DOCSLIB.ORG

(Symbiodinium) in Scleractinian Corals from Tropical Reefs in Southern Hainan

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
(Symbiodinium) in Scleractinian Corals from Tropical Reefs in Southern Hainan Journal of Systematics and Evolution 49 (6): 598–605 (2011) doi: 10.1111/j.1759-6831.2011.00161.x Research Article Low genetic diversity of symbiotic dinoflagellates (Symbiodinium) in scleractinian corals from tropical reefs in southern Hainan Island, China 1,2Guo-Wei ZHOU 1,2Hui HUANG∗ 1(Key Laboratory of Marine Bio-resources Sustainable Utilization, South China Sea Institute of Oceanology, Chinese Academy of Sciences, Guangzhou 510301, China) 2(Tropical Marine Biological Research Station in Hainan, Chinese Academy of Sciences, Sanya 572000, China) Abstract Endosymbiotic dinoflagellates in the genus Symbiodinium are among the most abundant and important group of photosynthetic protists found in coral reef ecosystems. In order to further characterize this diversity and compare with other regions of the Pacific, samples from 44 species of scleractinian corals representing 20 genera and 9 families, were collected from tropical reefs in southern Hainan Island, China. Denaturing gradient gel electrophoresis fingerprinting of the ribosomal internal transcribed spacer 2 identified 11 genetically distinct Symbiodinium types that have been reported previously. The majority of reef-building coral species (88.6%) harbored only one subcladal type of symbiont, dominated by host-generalist C1 and C3, and was influenced little by the host’s apparent mode of symbiont acquisition. Some species harbored more than one clade of Symbiodinium (clades C, D) concurrently. Although geographically isolated from the rest of the Pacific, the symbiont diversity in southern Hainan Island was relatively low and similar to both the Great Barrier Reef and Hawaii symbiont assemblages (dominated by clade C Symbiodinium). These results indicate that a specialist symbiont is not a prerequisite for existence in remote and isolated areas, but additional work in other geographic regions is necessary to test this idea. Key words coral, dinoflagellate, diversity, South China Sea, Symbiodinium. Dinoflagellates in the genus Symbiodinium (also An increasing number of studies have focussed on called zooxanthellae) are found in symbiosis with a di- the biogeographic distribution of Symbiodinium (e.g. verse range of marine invertebrate taxa and some pro- LaJeunesse, 2002; LaJeunesse et al., 2003, 2004a; Chen tists (reviewed in Baker, 2003; Finney et al., 2010). Al- et al., 2005; van Oppen et al., 2005). This understanding though originally thought to be a single dinoflagellate may provide insights into the future responses of reef species, Symbiodinium microadriaticum (Freudenthal, corals to environmental change (Buddemeier & Fautin, 1962), studies based on biochemical, morphological, 1993; Baker et al., 2004; LaJeunesse et al., 2010a). physiological, and molecular data have gradually es- As environmental factors may vary enormously from tablished that the genus Symbiodinium is a diverse as- spatial and temporal scales, regional differences in Sym- semblage (Rowan, 2004; LaJeunesse et al., 2010a). The biodinium diversity within a single host or among mul- genus Symbiodinium is now recognized to comprise nine tiple species are therefore important (LaJeunesse et al., divergent lineages (clades A–I) based on analyses of nu- 2010a). For example, Symbiodinium A and B are much clear ribosomal DNA (LaJeunesse, 2002; LaJeunesse more common in Caribbean scleractinians compared to et al., 2004a; Pochon & Gates, 2010) and chloroplast the Indo-Pacific, where clade C Symbiodinium prevail. 23S rDNA (Santos et al., 2002). Six of these clades (A– Moreover, the Symbiodinium in the same host species D, F, and G) are known to form associations with scler- are varied among different environments. For example, actinian corals, but predominantly with those of clades the Indo-Pacific coral Plesiastrea versipora (Lamarck, A–D (Baker, 2003). Each of these clades contains mul- 1816) hosts clade C at low latitudes and clade B at tiple subcladal lineages or types that show geographic the latitudinal margins of its distribution (Rodriguez- and host specificity using by more variable molecular Lanetty et al., 2001). It is believed that more research markers such as ITS rDNA (Sampayo et al., 2009). into regions of the Indo-Pacific will uncover more sym- biont diversity (Baker & Rowan, 1997; LaJeunesse et al., 2003). Received: 30 March 2011 Accepted: 5 July 2011 ∗ Author for correspondence. E-mail: [email protected]; Tel./Fax: 86- Considerable research on Symbiodinium diversity 20-84460294. and distribution has been carried out in the Caribbean C 2011 Institute of Botany, Chinese Academy of Sciences ZHOU & HUANG: Low genetic diversity of Symbiodinium in corals 599 and Central and Eastern Pacific (LaJeunesse, 2002; La- northern SCS. Luhuitou Bay (LHT), Ximao Island Jeunesse et al., 2003, 2004a, 2004b), but little has been (XD), Xipai Island (XP), and Xiaodonghai Bay (XDH) done in the South China Sea (SCS), Western Pacific, are part of Sanya National Coral Reefs Nature Reserve, one of the largest marginal seas. The SCS is rich in established in 1990. Small fragments (approximately coral cover and diversity and has recently been shown 5cm2) of reef corals were collected at a depth of 1– in decline (Huang, 2005). Several studies have reported 10 m with hammer and chisel using scuba diving at the Symbiodinium diversity in reef-building corals in four locations in Sanya in October 2008 (Fig. 1). All the SCS (Huang et al., 2006, 2011; Dong et al., 2009). specimens were preserved in 100% EtOH until further Dong et al. (2008) reported the diversity of Symbio- processing. dinium in Luhuitou Bay (Sanya, China) by polymerase chain reaction (PCR) restriction fragment length poly- morphism. Unfortunately, the method mainly used in 1.2 DNA extraction and ITS2-DGGE previous studies was only at the cladal level and could fingerprinting not provide more details about the ecological aspects Total DNA was extracted using the protocol de- (Sampayo et al., 2009). Additionally, it is not known scribed in Huang et al. (2006). The Symbiodinium ITS2 whether the Symbiodinium communities in this isolated region was analyzed using DGGE in combination with area are different from other regions of the Pacific. DNA sequencing of dominant bands. The ITS2 was am- In the present study, denaturing gradient gel elec- plified using the primers ITS2 clamp (5 -CGCCCGCCG trophoresis (DGGE) and sequencing of the internal tran- CGCCCCGCGCCCGTCCCGCCGCCCCCGCCCGG scribed spacer 2 (ITS2) region were used to determine GGATCCATATGCTTAAGTTCAGCGGGT-3 )and the diversity and community structure of Symbiodinium ITSintfor2 (5 -GAATTGCAGAACTCCGTG-3 ) with associated with reef-building corals from four reefs in a touch-down PCR protocol following LaJeunesse southern Hainan Island, SCS. We also compared our (2002). The PCR products were loaded on 8% findings to the data available for these coral species in polyacrylamide gels (acrylamide : N, N -methylenebis- other parts of the Pacific, including the Great Barrier acrylamide 37:1) with a denaturant gradient of 30%– Reef (GBR), Okinawa, and Hawaii (LaJeunesse et al., 60% (where 100% is defined as 7 mol/L urea and 40% 2003, 2004a, 2004b), to corroborate hypothesized bio- V/V formamide). Electrophoresis was carried out with geographic patterns in the distribution of Symbiodinium the DCode System (Bio-Rad, Hercules, CA, USA) ◦ diversity, and to determine whether or not an exception using 0.5 × Tris-Acetate-EDTA (TAE) buffer at 60 C occurred. for 14 h at 100 V. Gels were stained for 30 min in SYBR Green nucleic acid gel stain (Molecular Probes, 1 Material and methods Eugene, OR, USA) and photographed with ultraviolet transillumination. 1.1 Sample collection Distinct ITS2-DGGE profiles (fingerprints) were The sampling for this study was carried out at characterized by sequencing of the dominant bands. Sanya, on the southernmost coast of Hainan Island, The most prominent DGGE bands were excised from Fig. 1. Maps of coral reefs sampled in this study, downloaded from http://www.ngdc.noaa.gov/mgg/shorelines/gshhs.html and produced using Surfer 9. HI, Hainan Island; LHT, Luhuitou Bay; XD, Ximao Island; XDH, Xiaodonghai Bay; XP, Xipai Island. C 2011 Institute of Botany, Chinese Academy of Sciences 600 Journal of Systematics and Evolution Vol. 49 No. 6 2011 the gel, eluted in DNAase free water overnight, and other regions of the Pacific including the GBR, Ok- re-amplified with a reverse primer lacking the GC- inawa, and Hawaii (LaJeunesse et al., 2003, 2004a, clamp under the conditions described above. Sequenc- 2004b). Figure 2 shows the typical band profiles ob- ing was carried out using an ABI3730 DNA Sequencer tained, labelled with their ITS2 type (LaJeunesse, 2002; (Applied Biosystems, Carlsbad, CA, USA). The DGGE LaJeunesse et al., 2003). Heteroduplexes were usu- fingerprints and their corresponding sequences were ally produced from the DGGE analysis due to mis- compared against a reference database from diversity matching of variants during the PCR process (La- analyses carried out at other Indo-Pacific locations; Jeunesse et al., 2003). The ITS2 phylogeny inferred Symbiodinium ITS2 sequences were named as in pre- from MP is shown for Symbiodinium types in clade vious studies (LaJeunesse et al., 2003, 2004a, 2004b). C, as there was divergence among clade C symbionts The capital letter of these taxonomic designators refers (Fig. 3). Maximum parsimony, NJ, and Bayesian in- to the particular clade of Symbiodinium and the num- ference methods yielded very similar trees (data not bers and lowercase letters refer to bands diagnostic shown).
Load more

Recommended publications
  • Reproductive Strategies of the Coral Turbinaria Reniformis in The
    www.nature.com/scientificreports OPEN Reproductive strategies of the coral Turbinaria reniformis in the northern Gulf of Aqaba (Red Sea) Received: 10 October 2016 Hanna Rapuano1, Itzchak Brickner1, Tom Shlesinger1, Efrat Meroz-Fine2, Raz Tamir1,2 & Accepted: 13 January 2017 Yossi Loya1 Published: 14 February 2017 Here we describe for the first time the reproductive biology of the scleractinian coralTurbinaria reniformis studied during three years at the coral reefs of Eilat and Aqaba. We also investigated the possibility of sex change in individually tagged colonies followed over a period of 12 years. T. reniformis was found to be a stable gonochorist (no detected sex change) that reproduces by broadcast spawning 5–6 nights after the full moon of June and July. Spawning was highly synchronized between individuals in the field and in the lab. Reproduction ofT. reniformis is temporally isolated from the times at which most other corals reproduce in Eilat. Its relatively long reproductive cycle compared to other hermaphroditic corals may be due to the high reproductive effort associated with the production of eggs by gonochoristic females. Sex ratio in both the Aqaba and Eilat coral populations deviated significantly from a 1:1 ratio. The larger number of males than of females may provide a compensation for sperm limitation due to its dilution in the water column. We posit that such sex allocation would facilitate adaptation within gonochoristic species by increasing fertilization success in low density populations, constituting a phenomenon possibly regulated by chemical communication. Research on scleractinian coral reproduction is a prerequisite for the study of other life-history strategies, the ecol- ogy and persistence of populations and communities, and for the management and preservation of the reef1–3.
    [Show full text]
  • Genetic Variation in Heat Tolerance of the Coral Platygyra Daedalea Offers the Potential for 2 Adaptation to Ocean Warming
    bioRxiv preprint doi: https://doi.org/10.1101/2020.10.13.337089; this version posted October 17, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 Title: Genetic variation in heat tolerance of the coral Platygyra daedalea offers the potential for 2 adaptation to ocean warming. 3 4 Running head: Genetics of corals’ heat tolerance 5 6 Holland Elder1* 7 Virginia Weis1 8 Jose Montalvo-Proano2,3 9 Veronique J.L Mocellin2 10 Andrew H. Baird3 11 Eli Meyer1, 4 12 Line K. Bay2, 4 13 14 1. Oregon State University, Corvallis, OR, USA. 97331 15 2. Australian Institute of Marine Science, 1526 Cape Cleveland Road, Cape Cleveland 16 4810, Queensland, Australia 17 AIMS@JCU 18 3. ARC Centre of Excellence for Coral Reef Studies, James Cook University, 1 James Cook 19 Dr, Douglas QLD 4814, Australia 20 4. These authors contributed equally 21 22 *corresponding author 23 760-622-9116 24 [email protected] 25 26 Keywords: coral reefs; resilience, heritability, genomic markers, allele frequency change 27 28 Paper type: Primary research article. 29 Global Change Biology 30 bioRxiv preprint doi: https://doi.org/10.1101/2020.10.13.337089; this version posted October 17, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 31 Abstract 32 Reef-building corals are foundational species in coral reef ecosystems and are threatened 33 by many stressors including rising ocean temperatures.
    [Show full text]
  • Microsatellite Loci for Symbiodinium Goreaui and Other Clade C Symbiodinium
    Conservation Genet Resour DOI 10.1007/s12686-013-0023-5 MICROSATELLITE LETTERS Microsatellite loci for Symbiodinium goreaui and other Clade C Symbiodinium Drew C. Wham • Margaux Carmichael • Todd C. LaJeunesse Received: 27 June 2013 / Accepted: 12 August 2013 Ó Springer Science+Business Media Dordrecht 2013 Abstract The genus Symbiodinium comprises a diverse of ‘‘Clades’’, with the most ecologically dominant and group of dinoflagellates known for their obligate relation- diverse being Clade C (LaJeunesse et al. 2004). While the ship with reef–building corals. Members of the sub-genus group includes phylogenetic types that display narrow and ‘clade C’ are abundant, geographically wide-spread, as broad thermal tolerances, members of clade C are often the well as genetically and ecologically diverse. Coral colonies most severely impacted during bleaching events. For this harboring clade C are often the most exposed to physical reason, their symbiosis biology, dispersal capabilities and stressors. The genotypic diversity, dispersal and genetic genetic identities are of increasing importance to conser- connectivity exhibited by these Symbiodinium are the vation efforts as climates change globally, further affecting subjects of an increasing number of population genetic reef coral communities. studies utilizing microsatellites. Here we describe 18 new Coral endosymbionts are increasingly being studied with microsatellite loci and test their utility across four common multi-locus techniques because this approach offers genetic clade C types. We obtained multi-locus genotypes with resolution to the level of the individual. High-resolution individual level resolution in each of these types. Our markers, however, are not yet available for most Symbiodi- results indicate that multi-locus genotypes can be obtained nium spp.
    [Show full text]
  • Microbial Invasion of the Caribbean by an Indo-Pacific Coral Zooxanthella
    Microbial invasion of the Caribbean by an Indo-Pacific coral zooxanthella D. Tye Pettaya,b,1, Drew C. Whama, Robin T. Smithc,d, Roberto Iglesias-Prietoc, and Todd C. LaJeunessea,e,1 aDepartment of Biology, The Pennsylvania State University, University Park, PA 16802; bCollege of Earth, Ocean, and Environment, University of Delaware, Lewes, DE 19958; cUnidad Académica de Sistemas Arrecifales (Puerto Morelos), Instituto de Ciencias del Mar y Limnología, Universidad Nacional Autónoma de México, CP 77500 Cancún, Mexico; dScience Under Sail Institute for Exploration, Sarasota, FL 34230; and ePenn State Institutes of Energy and the Environment, University Park, PA 16802 Edited by Nancy A. Moran, University of Texas at Austin, Austin, TX, and approved April 28, 2015 (received for review February 11, 2015) Human-induced environmental changes have ushered in the rapid coral communities distributed across broad geographic areas decline of coral reef ecosystems, particularly by disrupting the over the decadal ecological timescales that are necessary to keep symbioses between reef-building corals and their photosymbionts. pace with the current rate of warming. However, escalating stressful conditions enable some symbionts Research on the diversity and ecology of coral symbionts to thrive as opportunists. We present evidence that a stress-tolerant suggests that episodes of stressful warming may facilitate the “zooxanthella” from the Indo-Pacific Ocean, Symbiodinium trenchii, spread of ecologically rare or opportunistic species (13). The has rapidly spread to coral communities across the Greater Carib- severe mass bleaching and mortality of eastern Caribbean corals bean. In marked contrast to populations from the Indo-Pacific, in 2005 corresponded with an increased prevalence and abun- Atlantic populations of S.
    [Show full text]
  • Checklist of Fish and Invertebrates Listed in the CITES Appendices
    JOINTS NATURE \=^ CONSERVATION COMMITTEE Checklist of fish and mvertebrates Usted in the CITES appendices JNCC REPORT (SSN0963-«OStl JOINT NATURE CONSERVATION COMMITTEE Report distribution Report Number: No. 238 Contract Number/JNCC project number: F7 1-12-332 Date received: 9 June 1995 Report tide: Checklist of fish and invertebrates listed in the CITES appendices Contract tide: Revised Checklists of CITES species database Contractor: World Conservation Monitoring Centre 219 Huntingdon Road, Cambridge, CB3 ODL Comments: A further fish and invertebrate edition in the Checklist series begun by NCC in 1979, revised and brought up to date with current CITES listings Restrictions: Distribution: JNCC report collection 2 copies Nature Conservancy Council for England, HQ, Library 1 copy Scottish Natural Heritage, HQ, Library 1 copy Countryside Council for Wales, HQ, Library 1 copy A T Smail, Copyright Libraries Agent, 100 Euston Road, London, NWl 2HQ 5 copies British Library, Legal Deposit Office, Boston Spa, Wetherby, West Yorkshire, LS23 7BQ 1 copy Chadwick-Healey Ltd, Cambridge Place, Cambridge, CB2 INR 1 copy BIOSIS UK, Garforth House, 54 Michlegate, York, YOl ILF 1 copy CITES Management and Scientific Authorities of EC Member States total 30 copies CITES Authorities, UK Dependencies total 13 copies CITES Secretariat 5 copies CITES Animals Committee chairman 1 copy European Commission DG Xl/D/2 1 copy World Conservation Monitoring Centre 20 copies TRAFFIC International 5 copies Animal Quarantine Station, Heathrow 1 copy Department of the Environment (GWD) 5 copies Foreign & Commonwealth Office (ESED) 1 copy HM Customs & Excise 3 copies M Bradley Taylor (ACPO) 1 copy ^\(\\ Joint Nature Conservation Committee Report No.
    [Show full text]
  • Taxonomic Checklist of CITES Listed Coral Species Part II
    CoP16 Doc. 43.1 (Rev. 1) Annex 5.2 (English only / Únicamente en inglés / Seulement en anglais) Taxonomic Checklist of CITES listed Coral Species Part II CORAL SPECIES AND SYNONYMS CURRENTLY RECOGNIZED IN THE UNEP‐WCMC DATABASE 1. Scleractinia families Family Name Accepted Name Species Author Nomenclature Reference Synonyms ACROPORIDAE Acropora abrolhosensis Veron, 1985 Veron (2000) Madrepora crassa Milne Edwards & Haime, 1860; ACROPORIDAE Acropora abrotanoides (Lamarck, 1816) Veron (2000) Madrepora abrotanoides Lamarck, 1816; Acropora mangarevensis Vaughan, 1906 ACROPORIDAE Acropora aculeus (Dana, 1846) Veron (2000) Madrepora aculeus Dana, 1846 Madrepora acuminata Verrill, 1864; Madrepora diffusa ACROPORIDAE Acropora acuminata (Verrill, 1864) Veron (2000) Verrill, 1864; Acropora diffusa (Verrill, 1864); Madrepora nigra Brook, 1892 ACROPORIDAE Acropora akajimensis Veron, 1990 Veron (2000) Madrepora coronata Brook, 1892; Madrepora ACROPORIDAE Acropora anthocercis (Brook, 1893) Veron (2000) anthocercis Brook, 1893 ACROPORIDAE Acropora arabensis Hodgson & Carpenter, 1995 Veron (2000) Madrepora aspera Dana, 1846; Acropora cribripora (Dana, 1846); Madrepora cribripora Dana, 1846; Acropora manni (Quelch, 1886); Madrepora manni ACROPORIDAE Acropora aspera (Dana, 1846) Veron (2000) Quelch, 1886; Acropora hebes (Dana, 1846); Madrepora hebes Dana, 1846; Acropora yaeyamaensis Eguchi & Shirai, 1977 ACROPORIDAE Acropora austera (Dana, 1846) Veron (2000) Madrepora austera Dana, 1846 ACROPORIDAE Acropora awi Wallace & Wolstenholme, 1998 Veron (2000) ACROPORIDAE Acropora azurea Veron & Wallace, 1984 Veron (2000) ACROPORIDAE Acropora batunai Wallace, 1997 Veron (2000) ACROPORIDAE Acropora bifurcata Nemenzo, 1971 Veron (2000) ACROPORIDAE Acropora branchi Riegl, 1995 Veron (2000) Madrepora brueggemanni Brook, 1891; Isopora ACROPORIDAE Acropora brueggemanni (Brook, 1891) Veron (2000) brueggemanni (Brook, 1891) ACROPORIDAE Acropora bushyensis Veron & Wallace, 1984 Veron (2000) Acropora fasciculare Latypov, 1992 ACROPORIDAE Acropora cardenae Wells, 1985 Veron (2000) CoP16 Doc.
    [Show full text]
  • Chromera Velia Is Endosymbiotic in Larvae of the Reef Corals Acropora
    Protist, Vol. 164, 237–244, March 2013 http://www.elsevier.de/protis Published online date 12 October 2012 ORIGINAL PAPER Chromera velia is Endosymbiotic in Larvae of the Reef Corals Acropora digitifera and A. tenuis a,b,1 b c,d e Vivian R. Cumbo , Andrew H. Baird , Robert B. Moore , Andrew P. Negri , c f e c Brett A. Neilan , Anya Salih , Madeleine J.H. van Oppen , Yan Wang , and c Christopher P. Marquis a School of Marine and Tropical Biology, James Cook University, Townsville, Queensland, 4811, Australia b ARC Centre of Excellence for Reef Studies, James Cook University, Townsville, Queensland, 4811, Australia c School of Biotechnology and Biomolecular Sciences, University of New South Wales, Sydney, NSW 2052, Australia d School of Biological Sciences, Flinders University, GPO Box 2100, Adelaide SA 5001, Australia e Australian Institute of Marine Science PMB 3, Townsville, Queensland, 4810, Australia f Confocal Bio-Imaging Facility, School of Science and Health, University of Western Sydney, NSW 2006, Australia Submitted May 8, 2012; Accepted August 30, 2012 Monitoring Editor: Bland J. Finlay Scleractinian corals occur in symbiosis with a range of organisms including the dinoflagellate alga, Symbiodinium, an association that is mutualistic. However, not all symbionts benefit the host. In par- ticular, many organisms within the microbial mucus layer that covers the coral epithelium can cause disease and death. Other organisms in symbiosis with corals include the recently described Chromera velia, a photosynthetic relative of the apicomplexan parasites that shares a common ancestor with Symbiodinium. To explore the nature of the association between C. velia and corals we first isolated C.
    [Show full text]
  • The Reproduction of the Red Sea Coral Stylophora Pistillata
    MARINE ECOLOGY PROGRESS SERIES Vol. 1, 133-144, 1979 - Published September 30 Mar. Ecol. Prog. Ser. The Reproduction of the Red Sea Coral Stylophora pistillata. I. Gonads and Planulae B. Rinkevich and Y.Loya Department of Zoology. The George S. Wise Center for Life Sciences, Tel Aviv University. Tel Aviv. Israel ABSTRACT: The reproduction of Stylophora pistillata, one of the most abundant coral species in the Gulf of Eilat, Red Sea, was studied over more than two years. Gonads were regularly examined using histological sections and the planula-larvae were collected in situ with plankton nets. S. pistillata is an hermaphroditic species. Ovaries and testes are situated in the same polyp, scattered between and beneath the septa and attached to them by stalks. Egg development starts in July preceding the spermaria, which start to develop only in October. A description is given on the male and female gonads, their structure and developmental processes. During oogenesis most of the oocytes are absorbed and usually only one oocyte remains in each gonad. S. pistillata broods its eggs to the planula stage. Planulae are shed after sunset and during the night. After spawning, the planula swims actively and changes its shape frequently. A mature planula larva of S. pistillata has 6 pairs of complete mesenteries (Halcampoides stage). However, a wide variability in developmental stages exists in newly shed planulae. The oral pole of the planula shows green fluorescence. Unique organs ('filaments' and 'nodules') are found on the surface of the planula;
    [Show full text]
  • Composition and Ecology of Deep-Water Coral Associations D
    HELGOLK---~DER MEERESUNTERSUCHUNGEN Helgoltinder Meeresunters. 36, 183-204 (1983) Composition and ecology of deep-water coral associations D. H. H. Kfihlmann Museum ffir Naturkunde, Humboldt-Universit~t Berlin; Invalidenstr. 43, DDR- 1040 Berlin, German Democratic Republic ABSTRACT: Between 1966 and 1978 SCUBA investigations were carried out in French Polynesia, the Red Sea, and the Caribbean, at depths down to 70 m. Although there are fewer coral species in the Caribbean, the abundance of Scleractinia in deep-water associations below 20 m almost equals that in the Indian and Pacific Oceans. The assemblages of corals living there are described and defined as deep-water coral associations. They are characterized by large, flattened growth forms. Only 6 to 7 % of the species occur exclusively below 20 m. More than 90 % of the corals recorded in deep waters also live in shallow regions. Depth-related illumination is not responsible for depth differentiations of coral associations, but very likely, a complex of mechanical factors, such as hydrodynamic conditions, substrate conditions, sedimentation etc. However, light intensity deter- mines the general distribution of hermatypic Scleractinia in their bathymetric range as well as the platelike shape of coral colonies characteristic for deep water associations. Depending on mechani- cal factors, Leptoseris, Montipora, Porites and Pachyseris dominate as characteristic genera in the Central Pacific Ocean, Podabacia, Leptoseris, Pachyseris and Coscinarea in the Red Sea, Agaricia and Leptoseris in the tropical western Atlantic Ocean. INTRODUCTION Considerable attention has been paid to shallow-water coral associations since the first half of this century (Duerden, 1902; Mayer, 1918; Umbgrove, 1939). Detailed investigations at depths down to 20 m became possible only through the use of autono- mous diving apparatus.
    [Show full text]
  • Pleistocene Reefs of the Egyptian Red Sea: Environmental Change and Community Persistence
    Pleistocene reefs of the Egyptian Red Sea: environmental change and community persistence Lorraine R. Casazza School of Science and Engineering, Al Akhawayn University, Ifrane, Morocco ABSTRACT The fossil record of Red Sea fringing reefs provides an opportunity to study the history of coral-reef survival and recovery in the context of extreme environmental change. The Middle Pleistocene, the Late Pleistocene, and modern reefs represent three periods of reef growth separated by glacial low stands during which conditions became difficult for symbiotic reef fauna. Coral diversity and paleoenvironments of eight Middle and Late Pleistocene fossil terraces are described and characterized here. Pleistocene reef zones closely resemble reef zones of the modern Red Sea. All but one species identified from Middle and Late Pleistocene outcrops are also found on modern Red Sea reefs despite the possible extinction of most coral over two-thirds of the Red Sea basin during glacial low stands. Refugia in the Gulf of Aqaba and southern Red Sea may have allowed for the persistence of coral communities across glaciation events. Stability of coral communities across these extreme climate events indicates that even small populations of survivors can repopulate large areas given appropriate water conditions and time. Subjects Biodiversity, Biogeography, Ecology, Marine Biology, Paleontology Keywords Coral reefs, Egypt, Climate change, Fossil reefs, Scleractinia, Cenozoic, Western Indian Ocean Submitted 23 September 2016 INTRODUCTION Accepted 2 June 2017 Coral reefs worldwide are threatened by habitat degradation due to coastal development, 28 June 2017 Published pollution run-off from land, destructive fishing practices, and rising ocean temperature Corresponding author and acidification resulting from anthropogenic climate change (Wilkinson, 2008; Lorraine R.
    [Show full text]
  • Sexual Reproduction of the Solitary Sunset Cup Coral Leptopsammia Pruvoti (Scleractinia: Dendrophylliidae) in the Mediterranean
    Marine Biology (2005) 147: 485–495 DOI 10.1007/s00227-005-1567-z RESEARCH ARTICLE S. Goffredo Æ J. Radetic´Æ V. Airi Æ F. Zaccanti Sexual reproduction of the solitary sunset cup coral Leptopsammia pruvoti (Scleractinia: Dendrophylliidae) in the Mediterranean. 1. Morphological aspects of gametogenesis and ontogenesis Received: 16 July 2004 / Accepted: 18 December 2004 / Published online: 3 March 2005 Ó Springer-Verlag 2005 Abstract Information on the reproduction in scleractin- came indented, assuming a sickle or dome shape. We can ian solitary corals and in those living in temperate zones hypothesize that the nucleus’ migration and change of is notably scant. Leptopsammia pruvoti is a solitary coral shape may have to do with facilitating fertilization and living in the Mediterranean Sea and along Atlantic determining the future embryonic axis. During oogene- coasts from Portugal to southern England. This coral sis, oocyte diameter increased from a minimum of 20 lm lives in shaded habitats, from the surface to 70 m in during the immature stage to a maximum of 680 lm depth, reaching population densities of >17,000 indi- when mature. Embryogenesis took place in the coelen- viduals mÀ2. In this paper, we discuss the morphological teron. We did not see any evidence that even hinted at aspects of sexual reproduction in this species. In a sep- the formation of a blastocoel; embryonic development arate paper, we report the quantitative data on the an- proceeded via stereoblastulae with superficial cleavage. nual reproductive cycle and make an interspecific Gastrulation took place by delamination. Early and late comparison of reproductive traits among Dend- embryos had diameters of 204–724 lm and 290–736 lm, rophylliidae aimed at defining different reproductive respectively.
    [Show full text]
  • 0Ca27eedadadd00c93df6016e4
    Long-Range Dispersal and High-Latitude Environments Influence the Population Structure of a “Stress-Tolerant” Dinoflagellate Endosymbiont D. Tye Pettay1,2*, Todd C. LaJeunesse1 1 Department of Biology, Pennsylvania State University, University Park, Pennsylvania, United States of America, 2 College of Earth, Ocean, and Environment, University of Delaware, Lewes, Delaware, United States of America Abstract The migration and dispersal of stress-tolerant symbiotic dinoflagellates (genus Symbiodinium) may influence the response of symbiotic reef-building corals to a warming climate. We analyzed the genetic structure of the stress- tolerant endosymbiont, Symbiodinium glynni nomen nudum (ITS2 - D1), obtained from Pocillopora colonies that dominate eastern Pacific coral communities. Eleven microsatellite loci identified genotypically diverse populations with minimal genetic subdivision throughout the Eastern Tropical Pacific, encompassing 1000’s of square kilometers from mainland Mexico to the Galapagos Islands. The lack of population differentiation over these distances corresponds with extensive regional host connectivity and indicates that Pocillopora larvae, which maternally inherit their symbionts, aid in the dispersal of this symbiont. In contrast to its host, however, subtropical populations of S. glynni in the Gulf of California (Sea of Cortez) were strongly differentiated from populations in tropical eastern Pacific. Selection pressures related to large seasonal fluctuations in temperature and irradiance likely explain this abrupt genetic
    [Show full text]