DOCSLIB.ORG

Dr Colin D Bingle Publication List April 2013

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Dr Colin D Bingle Publication List April 2013 Dr Colin D Bingle Publication list April 2013 H index ISI = 25, Google Scholar = 29 Denotes Principal (P) or joint (J) author REFEREED PAPERS. 50. (P) Musa M, Wilson K, Sun L, Mulay A, Bingle L, Marriott HM, LeClair EE, Bingle CD (2012) Differential localisation of BPIFA1 (SPLUNC1) and BPIFB1 (LPLUNC1) in the nasal and oral cavities of mice. Cell and Tissue Research Dec;350(3):455-64 49 (P) Bingle L, Wilson K, Musa M, Araujo B, Rassl D, Wallace WA, LeClair EE, Mauad T, Zhou Z, Mall MA, Bingle CD (2012) BPIFB1 (LPLUNC1) is upregulated in cystic fibrosis lung disease Histochemistry and Cell Biology 138:749–758 48 (J) Shin OS, Uddin T, Citorik R, Wang JP, Della Pelle P, Kradin RL, Bingle CD, Bingle L, Camilli A, Bhuiyan TR, Shirin T, Ryan ET, Calderwood SB, Finberg RW, Qadri FQ, LaRocque RC, Harris JB. (2011) LPLUNC1 Modulates Innate Immune Responses to Vibrio cholerae. Journal of Infectious Diseases 204(9):1349-5 47 (J) Wardle D, Burgon J, Sabroe I, Bingle CD, Whyte MKB, Renshaw SA (2011) A highly active di-peptide caspase inhibitor blocks constitutive neutrophil apoptosis, and reveals Mcl-1 as both an upstream regulator and a downstream target of neutrophil caspase activation. PLOSone 6(1) e15768 46 (J) da Silva AA, Bingle L, Speight PM, Bingle CD, Mauad T, da Silva LFF, Vargas PA. (2011) PLUNC protein expression in major salivary glands of HIV infected patients Oral Diseases 17, 258–264 45 (P) Chiang S-C, Veldhuizen EJA, Barnes FA, Craven CJ, Haagsman HP and Bingle CD. (2011) Identification and characterisation of theBPI/LBP/PLUNC–like gene repertoire in chickens reveals the absence of a LBP gene. Developmental and Comparative Immunology 35 (2011) 285–295 44 (J) Waby JS, Chirakkal H, Yu CW, Griffiths GJ, Benson RPS , Williams EA, Bingle CD, and Corfe BM. (2010) Sp1 acetylation results in loss of DNAbinding at promoters associated with cell cycle arrest and cell death in a colon cell line. Mol Cancer, 9:275 43 (P) Bingle CD, Wilson K, Lunn H, Barnes FA, High AS, Wallace WA, Rassl D, Campos MA, Ribeiro M, and Bingle L. (2010) LPLUNC1, a secreted product of goblet cells and minor glands of the upper aero-digestive tract, Histochemistry and Cell Biology 133 (5) 505-15. 42. (P) Bingle L, Barnes FA, Lunn H, Musa M, Webster S, Douglas CWI, Cross SS, High AS, and Bingle CD (2009) Characterisation and expression of SPLUNC2, the human orthologue of rodent Parotid Secretory Protein. Histochemistry and Cell Biology Sep;132(3):339-49 41. (J) Vargas PA, Speight PM, Bingle CD, Barrett AW, and Bingle L. (2008) Expression of PLUNC family members in benign and malignant salivary gland tumours. Oral Diseases Oct;14(7):613-9. C D Bingle April 2013 40. (J) Vaughan KR, Stokes L, Prince LR, Marriott, HM, Meis S, Kassack MU, Bingle CD, Sabroe I, Surprenant A, and Whyte MKB. (2007) Inhibition of NeutrophilApoptosis by ATP Is Mediated by the P2Y11 Receptor. J Immunol. 179(12):8544-53. 39. (P) Bingle L, Barnes FA, Cross SC, Rassl D, Wallace WA, Campos MA, and Bingle CD. (2007) Differential epithelial expression of the putative innate immune molecule, SPLUNC1 in Cystic Fibrosis. Respiratory Research. November 7; 8:79 38. (J) Wheeler TT, Hood KA, Maqbool N, McEwan JC, Bingle CD and Zhao S. (2007). Expansion of the Bactericidal/permeability increasing-like (BPI-like) protein locus in Cattle. BMC Genomics. March 15; 8:75. 37. (P) Bingle L, Cross SS, High AS, Wallace WA, Rassl D, Yuan G, Hellstrom I, Campos MA, and Bingle CD. WFDC2 (HE4): a potential role in the innate immunity of the oral cavity and respiratory tract and the development of adenocarcinomas of the lung. Respir Res. 2006 Apr 6;7:61. 36. (J) Chen H, Wilkins LM, Aziz N, Cannings C, Wyllie DH, Bingle CD, Rogus J, Beck JD, Offenbacher S, Cork MJ, Rafie-Kolpin M, Hsieh CM, Kornman KS, and Duff GW. (2006) Single nucleotide polymorphisms in the human interleukin-1B gene affect transcription according to haplotype context. Hum Mol Genet. 15:519-29 35. (J) Dempsey CE, Dive C, Fletcher DJ, Barnes FA, Lobo A, Bingle CD, Whyte MKB, and Renshaw SA (2005) Expression of pro-apoptotic Bfk isoforms reduces during 3 malignant transformation in the human gastrointestinal tract. FEBS Lett. 579:3646-50 34. (P) Bingle L, Cross SS, High AS, Wallace WA, Devine DA, Havard S, Campos MA, and Bingle CD. (2005) SPLUNC1 (PLUNC) is expressed in glandular tissues of the respiratory tract and in cancers with a glandular phenotype. J Path. 205: 491- 497. 33. (J) Marriott HM, Bingle CD, Read RC, Braley KE, Kroemer G, Hellewell PG, Craig RW, Whyte MKB and Dockrell DH. (2005). Dynamic changes in Mcl-1 expression regulate macrophage viability or commitment to apoptosis during bacterial clearance. J. Clin Invest. 115:359-68. 32. (J) Geetha C, Venkatesh SG, Bingle L, Bingle CD and Gorr SU. (2005) Design and validation of anti-inflammatory peptides from human Parotid Secretory Protein. J Dent Res. 84:149-53. 31. (P) LeClair EE, Nomellini V, Bahena M, Singleton V, Bingle L, Craven CJ and Bingle CD (2004) Cloning and expression of a mouse member of the PLUNC protein family exclusively expressed in tongue epithelium. Genomics. 83:658-66 30. (P) Bingle CD, LeClair EE, HavardS, Bingle L, Gillingham P, and Craven CJ (2004). Phylogenetic and evolutionary analysis of the PLUNC gene family. Protein Science 13:422-30 29. (J) Renshaw SA, Dempsey CE, Barnes FA, Bagstaff SM, Dower SK, Bingle CD, 2 C D Bingle April 2013 and Whyte MKB. (2004). Three novel Bid proteins generated by alternative splicing of the human Bid gene. J Biol Chem. 279:2846–2855. 28. (J) Renshaw SA, Parmar JS, Singleton V, Rowe SJ, Dockrell DH, Dower SK, Bingle CD, Chilvers ER and Whyte MKB (2003) Acceleration of human neutrophil apoptosis by tumour necrosis factor-related apoptosis-inducing ligand (TRAIL). J. Immunol. 70: 1027–1033. 27. (J) Vachon E, Bourbonnais Y, Bingle CD, Rowe SJ, Janelle MF, and Tremblay GM. (2002) Anti-inflammatory effect of pre-elafin in lipopolysaccharide-induced acute lung inflammation. Biol. Chem. 383:1249-1256. 26. (P) Bingle CD and Craven CJ. (2002) Plunc: A novel family of candidate host defence proteins expressed in the upper airways and nasopharynx. Human. Mol. Gen. 11;937-943. 25. (P) Bingle L, Singleton V and Bingle CD (2002). The putative ovarian tumour marker gene HE4 (WFDC2), is expressed in normal tissues and undergoes complex alternative splicing to yield multiple protein isoforms. Oncogene. 21, 2768-2773 24. (J) Usher LR, Lawson RA, Geary I, Taylor CJ, Bingle CD, Taylor GW and Whyte MKB. (2002). Induction of neutrophil apoptosis by the Pseudomonas aeruginosa exotoxin pyocyanin: a potential mechanism of persistent infection. J. Immunol. 168, 1861-1868. 23. (P) Bingle L, Tetley TD and Bingle CD. (2001) Cytokine mediated induction of the human elafin gene in pulmonary epithelial cells is regulated by NF-B. Am. J. Respir. Cell. Mol. Biol. 25,84-91. 22. (P) LeClair EE, Nguyen L, Bingle L, MacGowan, A, Singleton, V, Ward SJ and Bingle CD. (2001) Genomic organisation of the mouse plunc gene and expression in the developing airways and thymus. Biochem Biophys Res Commun. 284,792- 797. 21. (P) Bingle CD and Bingle L (2000) Characterisation of the human plunc gene, a gene product with an upper airways and nasopharyngeal restricted expression pattern. Biochem. Biophys. Acta 1493:363-367. 20. (J) Whyte MKB, Hubbard R, Meliconi R, Whidborne M, Eaton V, Bingle CD, Timms J, Duff GW, Facchini A, Pacilli A, Fabbri M, Hall I, Britton J, Johnston I and di Giovine F. (2000). Increased risk of fibrosing alveolitis associated with interleukin-1 receptor antagonist and tumor necrosis factor-a gene polymorphisms. Am. J. Resp. Crit. Care Med. 162:755-758. 19. (P) Bingle CD, Craig RW, Swales BM, Singleton V, Zhou P and Whyte MKB. (2000) Exon skipping in Mcl-1 results in a Bcl-2 homology domain 3 (BH3)-only gene product that promotes cell death. J. Biol. Chem. 275:22136-22146. 18. (J) Renshaw SA, Timmons SJ, Eaton V, Usher LR, Akil M, Bingle CD and Whyte MKB (2000) Inflammatory neutrophils retain susceptibility to apoptosis mediated via the Fas death receptor. J. Leukocyte. Biol. 67:662-668. 3 C D Bingle April 2013 17. (J) Melendez J, Maldonado V, Bingle CD, Selman M, and Pardo A. (2000) Cloning and expression of Guinea Pig Tissue Inhibitor of Metalloproteinases-2 (TIMP-2). Expression in normal and hyperoxic lung injury. Am. J Physiol. Respir. Cell. Mol. Physiol.).278:L737-L743. 16. (J) Baines DL, Folkesson HG, Norlin A, Bingle CD, Yuan HT and Olver RE (2000). The influence of mode of delivery, hormonal status and postnatal O2 environment on ENaC and ENaC expression in perinatal guinea pig lung. J. Physiol. 522:147-157. 15. (J) Downey JS, Bingle CD, Cottrell S, Ward N, Churchman D, Dobrota M and Powell CJ. (1998) The LEC Rat possesses reduced hepatic selenium, contributing to the severity of spontaneous hepatitis and sensitivity to carcinogenesis. Biochem. Biophys. Res. Commun. 244:463-467. 14. (P) Yuan HT, Gowan S, Kelly FJ and Bingle CD. (1997) Cloning of guinea pig surfactant protein-A defines a distinct cellular distribution pattern within the lung. Am. J. Physiol. Respir. Cell Mol. Physiol. 17:L900-L906. 13. (J) Yuan HT, Bingle CD and Kelly FJ. (1996) Differential patterns of antioxidant enzyme mRNA expression in guinea pig lung and liver during development. Biochem Biophys Acta. 1305:163-171. 12. (P) Bingle CD and Gowan S (1996). Molecular cloning of the forkhead transcription factor HNF-3 from a human pulmonary adenocarcinoma cell line.
Load more

Recommended publications
  • A Molecular and Genetic Analysis of Otosclerosis
    A molecular and genetic analysis of otosclerosis Joanna Lauren Ziff Submitted for the degree of PhD University College London January 2014 1 Declaration I, Joanna Ziff, confirm that the work presented in this thesis is my own. Where information has been derived from other sources, I confirm that this has been indicated in the thesis. Where work has been conducted by other members of our laboratory, this has been indicated by an appropriate reference. 2 Abstract Otosclerosis is a common form of conductive hearing loss. It is characterised by abnormal bone remodelling within the otic capsule, leading to formation of sclerotic lesions of the temporal bone. Encroachment of these lesions on to the footplate of the stapes in the middle ear leads to stapes fixation and subsequent conductive hearing loss. The hereditary nature of otosclerosis has long been recognised due to its recurrence within families, but its genetic aetiology is yet to be characterised. Although many familial linkage studies and candidate gene association studies to investigate the genetic nature of otosclerosis have been performed in recent years, progress in identifying disease causing genes has been slow. This is largely due to the highly heterogeneous nature of this condition. The research presented in this thesis examines the molecular and genetic basis of otosclerosis using two next generation sequencing technologies; RNA-sequencing and Whole Exome Sequencing. RNA–sequencing has provided human stapes transcriptomes for healthy and diseased stapes, and in combination with pathway analysis has helped identify genes and molecular processes dysregulated in otosclerotic tissue. Whole Exome Sequencing has been employed to investigate rare variants that segregate with otosclerosis in affected families, and has been followed by a variant filtering strategy, which has prioritised genes found to be dysregulated during RNA-sequencing.
    [Show full text]
  • Downloaded From
    Antimicrobial Activity of PLUNC Protects against Pseudomonas aeruginosa Infection Lina Lukinskiene, Yang Liu, Susan D. Reynolds, Chad Steele, Barry R. Stripp, George D. Leikauf, Jay K. Kolls and This information is current as Y. Peter Di of October 2, 2021. J Immunol 2011; 187:382-390; Prepublished online 1 June 2011; doi: 10.4049/jimmunol.1001769 http://www.jimmunol.org/content/187/1/382 Downloaded from References This article cites 37 articles, 15 of which you can access for free at: http://www.jimmunol.org/content/187/1/382.full#ref-list-1 http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication by guest on October 2, 2021 *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2011 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology Antimicrobial Activity of PLUNC Protects against Pseudomonas aeruginosa Infection Lina Lukinskiene,* Yang Liu,* Susan D. Reynolds,† Chad Steele,‡ Barry R. Stripp,x George D. Leikauf,* Jay K. Kolls,{ and Y.
    [Show full text]
  • Role of Amylase in Ovarian Cancer Mai Mohamed University of South Florida, [email protected]
    University of South Florida Scholar Commons Graduate Theses and Dissertations Graduate School July 2017 Role of Amylase in Ovarian Cancer Mai Mohamed University of South Florida, [email protected] Follow this and additional works at: http://scholarcommons.usf.edu/etd Part of the Pathology Commons Scholar Commons Citation Mohamed, Mai, "Role of Amylase in Ovarian Cancer" (2017). Graduate Theses and Dissertations. http://scholarcommons.usf.edu/etd/6907 This Dissertation is brought to you for free and open access by the Graduate School at Scholar Commons. It has been accepted for inclusion in Graduate Theses and Dissertations by an authorized administrator of Scholar Commons. For more information, please contact [email protected]. Role of Amylase in Ovarian Cancer by Mai Mohamed A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy Department of Pathology and Cell Biology Morsani College of Medicine University of South Florida Major Professor: Patricia Kruk, Ph.D. Paula C. Bickford, Ph.D. Meera Nanjundan, Ph.D. Marzenna Wiranowska, Ph.D. Lauri Wright, Ph.D. Date of Approval: June 29, 2017 Keywords: ovarian cancer, amylase, computational analyses, glycocalyx, cellular invasion Copyright © 2017, Mai Mohamed Dedication This dissertation is dedicated to my parents, Ahmed and Fatma, who have always stressed the importance of education, and, throughout my education, have been my strongest source of encouragement and support. They always believed in me and I am eternally grateful to them. I would also like to thank my brothers, Mohamed and Hussien, and my sister, Mariam. I would also like to thank my husband, Ahmed.
    [Show full text]
  • Investigating Single-Gene Disorders of Childhood Infectious Disease
    INVESTIGATING SINGLE-GENE DISORDERS OF CHILDHOOD INFECTIOUS DISEASE Bayarchimeg Mashbat A thesis submitted for the degree of Doctor of Philosophy Section of Paediatrics, Division of Infectious Diseases Department of Medicine, Imperial College London United Kingdom October 2017 Abstract A common feature of infectious diseases, including an infection with Neisseria meningitidis (Nm), is that only a small proportion of the individuals exposed to the same strain of the bacteria suffer from the clinical disease. Host genetics has long been considered to be an important determinant of both predisposition to and severity of outcome from invasive meningococcal disease (IMD). The human complement system is central to protection against IMD. It is well established that individuals with terminal or alternative complement deficiencies are predisposed to invasive, often recurrent meningococcal infections. However, the occurrence of these putative genetic deficiencies is rare, such that complement deficiencies account for less than 3 % of the disease cases. The current study sought to uncover novel genetic aetiologies of IMD, by employing WES and GWAS, in conjunction with molecular functional characterisation assays. Firstly, genetic analysis of six familial IMD exomes revealed a novel mutation in the SPLUNC1 gene. The encoding protein has been shown to play an important role in innate immune defence against a number of Gram-negative bacterial infections. The characterisation assays undertaken in this work suggest that the protein encoded by SPLUNC1 is also implicated with host innate immune defence against Nm infection, by providing protection against nasopharyngeal colonisation of a pathogenic Nm strain. The results further suggest that harbouring rare pathogenic mutations that impact the function of the encoding protein is associated with reduced host defence activities in the resulting protein, which in turn may possibly lead to increased susceptibility to IMD in the carriers.
    [Show full text]
  • Supplemental Table S1. Primers for Sybrgreen Quantitative RT-PCR Assays
    Supplemental Table S1. Primers for SYBRGreen quantitative RT-PCR assays. Gene Accession Primer Sequence Length Start Stop Tm GC% GAPDH NM_002046.3 GAPDH F TCCTGTTCGACAGTCAGCCGCA 22 39 60 60.43 59.09 GAPDH R GCGCCCAATACGACCAAATCCGT 23 150 128 60.12 56.52 Exon junction 131/132 (reverse primer) on template NM_002046.3 DNAH6 NM_001370.1 DNAH6 F GGGCCTGGTGCTGCTTTGATGA 22 4690 4711 59.66 59.09% DNAH6 R TAGAGAGCTTTGCCGCTTTGGCG 23 4797 4775 60.06 56.52% Exon junction 4790/4791 (reverse primer) on template NM_001370.1 DNAH7 NM_018897.2 DNAH7 F TGCTGCATGAGCGGGCGATTA 21 9973 9993 59.25 57.14% DNAH7 R AGGAAGCCATGTACAAAGGTTGGCA 25 10073 10049 58.85 48.00% Exon junction 9989/9990 (forward primer) on template NM_018897.2 DNAI1 NM_012144.2 DNAI1 F AACAGATGTGCCTGCAGCTGGG 22 673 694 59.67 59.09 DNAI1 R TCTCGATCCCGGACAGGGTTGT 22 822 801 59.07 59.09 Exon junction 814/815 (reverse primer) on template NM_012144.2 RPGRIP1L NM_015272.2 RPGRIP1L F TCCCAAGGTTTCACAAGAAGGCAGT 25 3118 3142 58.5 48.00% RPGRIP1L R TGCCAAGCTTTGTTCTGCAAGCTGA 25 3238 3214 60.06 48.00% Exon junction 3124/3125 (forward primer) on template NM_015272.2 Supplemental Table S2. Transcripts that differentiate IPF/UIP from controls at 5%FDR Fold- p-value Change Transcript Gene p-value p-value p-value (IPF/UIP (IPF/UIP Cluster ID RefSeq Symbol gene_assignment (Age) (Gender) (Smoking) vs. C) vs. C) NM_001178008 // CBS // cystathionine-beta- 8070632 NM_001178008 CBS synthase // 21q22.3 // 875 /// NM_0000 0.456642 0.314761 0.418564 4.83E-36 -2.23 NM_003013 // SFRP2 // secreted frizzled- 8103254 NM_003013
    [Show full text]
  • Identification of Genes Expressed by Human Airway Eosinophils After an in Vivo Allergen Challenge
    Identification of Genes Expressed by Human Airway Eosinophils after an In Vivo Allergen Challenge Stephane Esnault1*, Elizabeth A. Kelly1, Elizabeth A. Schwantes1, Lin Ying Liu1, Larissa P. DeLain1, Jami A. Hauer1, Yury A. Bochkov2, Loren C. Denlinger1, James S. Malter3, Sameer K. Mathur1, Nizar N. Jarjour1 1 Department of Medicine, Allergy, Pulmonary, and Critical Care Medicine Division, University of Wisconsin School of Medicine and Public Health, Madison, Wisconsin, United States of America, 2 Department of Pediatrics, University of Wisconsin School of Medicine and Public Health, Madison, Wisconsin, United States of America, 3 Department of Pathology, University of Texas Southwestern Medical Center, Dallas, Texas, United States of America Abstract Background: The mechanism for the contribution of eosinophils (EOS) to asthma pathophysiology is not fully understood. Genome-wide expression analysis of airway EOS by microarrays has been limited by the ability to generate high quality RNA from sufficient numbers of airway EOS. Objective: To identify, by genome-wide expression analyses, a compendium of expressed genes characteristic of airway EOS following an in vivo allergen challenge. Methods: Atopic, mild asthmatic subjects were recruited for these studies. Induced sputum was obtained before and 48h after a whole lung allergen challenge (WLAC). Individuals also received a segmental bronchoprovocation with allergen (SBP- Ag) 1 month before and after administering a single dose of mepolizumab (anti-IL-5 monoclonal antibody) to reduce airway EOS. Bronchoalveolar lavage (BAL) was performed before and 48 h after SBP-Ag. Gene expression of sputum and BAL cells was analyzed by microarrays. The results were validated by qPCR in BAL cells and purified BAL EOS.
    [Show full text]
  • The DNA Sequence and Comparative Analysis of Human Chromosome 20
    articles The DNA sequence and comparative analysis of human chromosome 20 P. Deloukas, L. H. Matthews, J. Ashurst, J. Burton, J. G. R. Gilbert, M. Jones, G. Stavrides, J. P. Almeida, A. K. Babbage, C. L. Bagguley, J. Bailey, K. F. Barlow, K. N. Bates, L. M. Beard, D. M. Beare, O. P. Beasley, C. P. Bird, S. E. Blakey, A. M. Bridgeman, A. J. Brown, D. Buck, W. Burrill, A. P. Butler, C. Carder, N. P. Carter, J. C. Chapman, M. Clamp, G. Clark, L. N. Clark, S. Y. Clark, C. M. Clee, S. Clegg, V. E. Cobley, R. E. Collier, R. Connor, N. R. Corby, A. Coulson, G. J. Coville, R. Deadman, P. Dhami, M. Dunn, A. G. Ellington, J. A. Frankland, A. Fraser, L. French, P. Garner, D. V. Grafham, C. Grif®ths, M. N. D. Grif®ths, R. Gwilliam, R. E. Hall, S. Hammond, J. L. Harley, P. D. Heath, S. Ho, J. L. Holden, P. J. Howden, E. Huckle, A. R. Hunt, S. E. Hunt, K. Jekosch, C. M. Johnson, D. Johnson, M. P. Kay, A. M. Kimberley, A. King, A. Knights, G. K. Laird, S. Lawlor, M. H. Lehvaslaiho, M. Leversha, C. Lloyd, D. M. Lloyd, J. D. Lovell, V. L. Marsh, S. L. Martin, L. J. McConnachie, K. McLay, A. A. McMurray, S. Milne, D. Mistry, M. J. F. Moore, J. C. Mullikin, T. Nickerson, K. Oliver, A. Parker, R. Patel, T. A. V. Pearce, A. I. Peck, B. J. C. T. Phillimore, S. R. Prathalingam, R. W. Plumb, H. Ramsay, C. M.
    [Show full text]
  • Regulated T Cell Pre-Mrna Splicing As Genetic Marker of T Cell Suppression
    Regulated T cell pre-mRNA splicing as genetic marker of T cell suppression by Boitumelo Mofolo Thesis presented for the degree of Master of Science (Bioinformatics) Institute of Infectious Disease and Molecular Medicine University of Cape Town (UCT) Supervisor: Assoc. Prof. Nicola Mulder August 2012 University of Cape Town The copyright of this thesis vests in the author. No quotation from it or information derived from it is to be published without full acknowledgementTown of the source. The thesis is to be used for private study or non- commercial research purposes only. Cape Published by the University ofof Cape Town (UCT) in terms of the non-exclusive license granted to UCT by the author. University Declaration I, Boitumelo Mofolo, declare that all the work in this thesis, excluding that has been cited and referenced, is my own. Signature Signature Removed Boitumelo Mofolo University of Cape Town Copyright©2012 University of Cape Town All rights reserved 1 ABSTRACT T CELL NORMAL T CELL SUPPRESSION p110 p110 MV p85 PI3K AKT p85 PI3K PHOSPHORYLATION NO PHOSHORYLATION HIV cytoplasm HCMV LCK-011 PRMT5-006 SHIP145 SIP110 RV LCK-010 VCL-204 ATM-016 PRMT5-018 ATM-002 CALD1-008 LCK-006 MXI1-001 VCL-202 NRP1-201 MXI1-007 CALD1-004 nucleus Background: Measles is a highly contagious disease that mainly affects children and according to the World Health Organisation (WHO), was responsible for over 164000 deaths in 2008, despite the availability of a safe and cost-effective vaccine [56]. The Measles virus (MV) inactivates T- cells, rendering them dysfunctional, and results in virally induced immunosuppression which shares certain features with thatUniversity induced by HIV.
    [Show full text]
  • Development and Application of Immunoassays For
    FUNCTIONAL CHARACTERIZATION OF SPURT USING TRANSGENIC MOUSE MODEL by Lina Lukinskiene BS, Vilnius University, 1995 MS, Vilnius University, 1997 Submitted to the Graduate Faculty of Department of Environmental and Occupational Health Graduate School of Public Health in partial fulfillment Of the requirements for the degree of Master of Science University of Pittsburgh 2005 UNIVERSITY OF PITTSBURGH Graduate School of Public Health This thesis was presented by Lina Lukinskiene It was defended on 06/10/2005 and approved by Thesis Advisor: Yuan Pu Di, PhD, Assistant Professor Department of Environmental & Occupational Health Graduate School of Public Health University of Pittsburgh Committee Member: Bruce Pitt, PhD, Professor Department of Environmental & Occupational Health Graduate School of Public Health University of Pittsburgh Committee Member: Chad Steele, PhD Assistant Professor Division of Pediatric Pulmonology, Laboratory of Lung Immunology and Host Defense School of Medicine University of Pittsburgh ii Yuan Pu Di, PhD FUNCTIONAL CHARACTERIZATION OF SPURT USING TRANSGENIC MOUSE MODEL Lina Lukinskiene, MS University of Pittsburgh, 2005 Abstract The respiratory tract is the target of multiple infectious agents. Because the lungs are continually exposed to infectious pathogens in inspired air, natural defense mechanisms have devolved to prevent infection. These defense mechanisms coordinate with each other to provide efficient protection against infection. As a result, pulmonary infections can be viewed not just as a consequence of exposure to a virulent pathogen but as a result of a breakdown of natural host defenses. SPLUNC1 or SPURT (secretory protein in upper respiratory tracts) is small, secreted protein that is expressed in epithelial areas of the nose, mouth, pharynx and lungs.
    [Show full text]
  • PLUNC Antibody - Middle Region Rabbit Polyclonal Antibody Catalog # AI12105
    10320 Camino Santa Fe, Suite G San Diego, CA 92121 Tel: 858.875.1900 Fax: 858.622.0609 PLUNC antibody - middle region Rabbit Polyclonal Antibody Catalog # AI12105 Specification PLUNC antibody - middle region - Product Information Application IHC, WB Primary Accession Q9NP55 Other Accession NM_016583, NP_057667 Reactivity Human, Mouse, Rat, Rabbit, Pig, Goat, Bovine, Guinea Pig, Dog Predicted Pig Host Rabbit Immunohistochemistry with Human Lung, Clonality Polyclonal respiratory epethelium tissue at an antibody Calculated MW 28kDa KDa concentration of 5.0μg/ml using anti-PLUNC antibody PLUNC antibody - middle region - Additional Information Gene ID 51297 Alias Symbol LUNX, NASG, SPLUNC1, SPURT, bA49G10.5, PLUNC, LPLUNC3 Other Names BPI fold-containing family A member 1, Lung-specific protein X, Nasopharyngeal carcinoma-related protein, Palate lung and WB Suggested Anti-PLUNC Antibody Titration: nasal epithelium clone protein, Secretory 0.2-1 μg/ml protein in upper respiratory tracts, Short Positive Control: Jurkat cell lysate PLUNC1, SPLUNC1, Tracheal epithelium-enriched protein, Von Ebner protein Hl, BPIFA1, LUNX, NASG, PLUNC, SPLUNC1, SPURT PLUNC antibody - middle region - References Format Liquid. Purified antibody supplied in 1x PBS Zhou,H.D.,(2006)Mol.Immunol.43(11),1864-18 buffer with 0.09% (w/v) sodium azide and 71ReconstitutionandStorage:Forshorttermuse,s 2% sucrose. toreat2-8Cupto1week.Forlongtermstorage,stor Reconstitution & Storage eat-20Cinsmallaliquotstopreventfreeze-thawcy Add 50 ul of distilled water. Final cles. anti-PLUNC antibody concentration is 1 mg/ml in PBS buffer with 2% sucrose. For longer periods of storage, store at 20°C. Avoid repeat freeze-thaw cycles. Page 1/3 10320 Camino Santa Fe, Suite G San Diego, CA 92121 Tel: 858.875.1900 Fax: 858.622.0609 Precautions PLUNC antibody - middle region is for research use only and not for use in diagnostic or therapeutic procedures.
    [Show full text]
  • Regulation of the Epithelial Sodium Channel (Enac) by the Short Palate, Lung, and Nasal Epithelial Clone (SPLUNC1) Brett Rollins
    Regulation of the Epithelial Sodium Channel (ENaC) by the Short Palate, Lung, and Nasal Epithelial Clone (SPLUNC1) Brett Rollins A thesis submitted to the faculty of the University of North Carolina at Chapel Hill in partial fulfillment of the requirements for the degree of Master of Science in the Department of Cell and Molecular Physiology Chapel Hill 2010 Approved by Dr. James Anderson Dr. P. Kay Lund Dr. Robert Tarran © 2010 Brett Matthew Rollins ALL RIGHTS RESERVED ii Abstract Brett Rollins: Regulation of the Epithelial Sodium Channel (ENaC) by the Short Palate, Lung, and Nasal Epithelial Clone (SPLUNC1) (Under the direction of Robert Tarran) The airways rely on mucociliary clearance (MCC) to remove inhaled particulates. Initiating events in chronic airway diseases, such as cystic fibrosis (CF), have been traced back to the failure of a critical MCC component, ion transport. Specifically, the epithelial sodium channel (ENaC) is known to be hyperabsorptive in CF airway epithelia and contributes to dehydrated airway surface liquid (ASL), collapsed cilia, and high percent solid mucus. Recently, proteolytic cleavage and activation of ENaC has been described and SPLUNC1 was identified as an endogenous inhibitor of ENaC activation. Here, we demonstrate SPLUNC1’s ability to reduce macroscopic current and specifically the number of channels of membrane-inserted ENaCs. This work also identifies the active site of SPLUNC1 and provides evidence for a functional SPLUNC1 mimetic peptide. Further, as nonfunctional CFTR influences abnormal bicarbonate secretion and thus CF ASL pH, we correlated the loss of SPLUNC1’s function in CF airways to this acidic environment. iii Table of Contents List of Abbreviations…………………………………………………………………….vii List of Figures……………………………………………………………………..……...ix List of Tables………………………………………………………………………….….xi Chapter I.
    [Show full text]
  • Development of Genomic Methods and Tools for an Equine Model
    DEVELOPMENT OF GENOMIC METHODS AND TOOLS FOR AN EQUINE MODEL A Dissertation Presented to the Faculty of the Graduate School of Cornell University In Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy in Animal Science by Mohammed Ali Obaid Al Abri August 2015 © 2015 Mohammed Ali Al Abri DEVELOPMENT OF GENOMIC METHODS AND TOOLS FOR AN EQUINE MODEL Mohammed Ali Al Abri, Ph.D. Cornell University 2015 The advent of genomic analysis has identified regions of functional significance in several mammalian species. However, for horses, relatively little such work was done compared to other farm animals. The current archive of genetic variations in the horse is mostly based on the Thoroughbred mare upon which the reference sequence (EquCab2.0) was generated. Thus, more investigation of the equine genomic architecture is critical to better understand the equine genome. Chapter 2 of this dissertation represents an analyses of next generation sequencing data of six horses from a diverse genetic background. I have utilized the most advanced techniques to identify, and annotate genetic variants including single nucleotide polymorphism, copy number variations and structural variations pertaining to these horse breeds. The analysis discovered thousands of novel SNPs and INDELs and hundreds of CNVs and SVs in each of the horses. These newly identified variants where formatted as online tracks and should provide a foundational database for future studies in horse genomics. Chapter three of the thesis discusses a genome wide association study aimed at the discovery of QTLs affecting body size variation in horses. I used the Illumina Equine SNP50 BeadChip to genotype 48 horses from diverse breeds and representing the extremes in body size in horses.
    [Show full text]