DOCSLIB.ORG

Downloaded From

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Downloaded From Antimicrobial Activity of PLUNC Protects against Pseudomonas aeruginosa Infection Lina Lukinskiene, Yang Liu, Susan D. Reynolds, Chad Steele, Barry R. Stripp, George D. Leikauf, Jay K. Kolls and This information is current as Y. Peter Di of October 2, 2021. J Immunol 2011; 187:382-390; Prepublished online 1 June 2011; doi: 10.4049/jimmunol.1001769 http://www.jimmunol.org/content/187/1/382 Downloaded from References This article cites 37 articles, 15 of which you can access for free at: http://www.jimmunol.org/content/187/1/382.full#ref-list-1 http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication by guest on October 2, 2021 *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2011 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology Antimicrobial Activity of PLUNC Protects against Pseudomonas aeruginosa Infection Lina Lukinskiene,* Yang Liu,* Susan D. Reynolds,† Chad Steele,‡ Barry R. Stripp,x George D. Leikauf,* Jay K. Kolls,{ and Y. Peter Di* Epithelial antimicrobial activity may protect the lung against inhaled pathogens. The bactericidal/permeability-increasing protein family has demonstrated antimicrobial activity in vitro. PLUNC (palate, lung, and nasal epithelium associated) is a 25-kDa secreted protein that shares homology with bactericidal/permeability-increasing proteins and is expressed in nasopharyngeal and respira- tory epithelium. The objective of this study was to determine whether PLUNC can limit Pseudomonas aeruginosa infection in mice. Transgenic mice (Scgb1a1-hPLUNC) were generated in which human PLUNC (hPLUNC) was directed to the airway epithelium with the Scgb1a1 promoter. The hPLUNC protein (hPLUNC) was detected in the epithelium throughout the trachea and bronchial airways and in bronchoalveolar lavage fluid. Bronchoalveolar lavage fluid from transgenic mice exhibited higher antibacterial Downloaded from activity than that from wild type littermates in vitro. After in vivo P. aeruginosa challenge, Scgb1a1-hPLUNC transgenic mice displayed enhanced bacterial clearance. This was accompanied by a decrease in neutrophil infiltration and cytokine levels. More importantly, the overexpressed hPLUNC in Scgb1a1-hPLUNC transgenic mouse airway significantly enhanced mouse survival against P. aeruginosa-induced respiratory infection. These data indicate that PLUNC is a novel antibacterial protein that likely plays a critical role in airway epithelium-mediated innate immune response. The Journal of Immunology, 2011, 187: 382–390. he ability of the host to avoid infection depends largely Based on predicted structural homology, palate, lung, and nasal http://www.jimmunol.org/ on mechanisms of innate immunity. This rapid-response epithelium associated (PLUNC) has been added to the BPI protein T system acts efficiently without prior exposure to a patho- family. PLUNC protein is expressed specifically in the nasopha- gen (1) and is initiated when bacterial products are detected. ryngeal and respiratory epithelium (6–8). The PLUNC genes are LPS, a cell-wall component of Gram-negative bacteria, is an ag- clustered on human chromosome 20 and encode eight different onist for innate immune response through activation of the TLR4 proteins that share some predicted structural similarity (9). signaling cascade. Exposure to LPS results in a production of PLUNC or short PLUNC protein 1 (SPLUNC1) is the first iden- proinflammatory and anti-inflammatory mediators by myeloid tified PLUNC protein that has multiple alternative names in- lineage and other cell types including epithelial cells. In humans, cluding secretory protein in upper respiratory tracts, lung-specific by guest on October 2, 2021 bactericidal/permeability-increasing protein (BPI) and LPS-binding protein X, and nasopharyngeal carcinoma-related protein. protein (LBP) can bind LPS and modulate the host response All BPI protein family members are defined by a similarly to Gram-negative bacterial infections. Although BPI and LBP predicted three-dimensional structure with a single predicted di- belong to the same protein family (i.e., BPI protein family), their sulphide bond and a conserved exon structure (7). However, the functions are antagonistic: LBP exhibits proinflammatory activity, amino acid homology among members of the BPI protein family whereas BPI displays anti-inflammatory activity and direct bac- is typically ∼15–30% (10). The biological function of PLUNC is tericidal action (2, 3). Two additional lipid transfer LPS-binding not known, but structural similarities to BPI family proteins sug- plasma proteins, cholesteryl ester transfer protein (CETP) and gest that PLUNC may be involved in defense responses in the phospholipid transfer protein (PLTP), are included in the BPI airways. Chu et al. (11) reported that human and mouse bronchial protein family based on predicted structural similarity (4, 5). epithelial cells expressed PLUNC (hSPLUNC1 and mSPlunc1), and that exogenously applied PLUNC decreased Mycoplasma pneumoniae levels and lessened IL-8 production in vitro. Con- *Department of Environmental and Occupational Health, University of Pittsburgh, † versely, PLUNC small interfering RNA enhanced M. pneumoniae Pittsburgh, PA 15260; Department of Pediatrics, National Jewish Health, Denver, CO 80206; ‡Division of Pulmonary Medicine, University of Alabama, Birmingham, growth and IL-8 production. IL-13 significantly decreased x AL 35201; Division of Pulmonary, Allergy and Critical Care, Duke University PLUNC and M. pneumoniae clearance in epithelial cell cultures, Medical Center, Durham, NC 27710; and {Department of Genetics, Louisiana State University Health Science Center, New Orleans, LA 70112 suggesting that decreased PLUNC expression during allergic responses may contribute to asthma pathobiology. Zhou et al. (12) Received for publication July 27, 2010. Accepted for publication April 22, 2011. found that PLUNC protein binds LPS and inhibits the growth of This work was supported by Public Health Service grants from the National Institutes of Health (ES011033 and HL091938 to Y.P.D.) and the American Heart Association- Pseudomonas aeruginosa in vitro. Garcia-Caballero et al. (13) Pennsylvania Delaware Affiliate (Grant 0365327U to Y.P.D.). reported that PLUNC may serve as an airway surface liquid vol- Address correspondence and reprint requests to Dr. Y. Peter Di, Department of ume sensor by regulating epithelial sodium ion-channel activity. Environmental and Occupational Health, University of Pittsburgh, 100 Technology Gakhar et al. (14) demonstrated that PLUNC has surfactant ac- Drive, Room 322, Pittsburgh, PA 15219. E-mail address: [email protected] tivity, and that this activity may account for the low surface ten- Abbreviations used in this article: BAL, bronchoalveolar lavage; BALF, bronchoal- veolar lavage fluid; BPI, bactericidal/permeability-increasing protein; GUS-B, b- sion of airway secretions. What was lacking in these studies is glucuronidase; hPLUNC, human PLUNC; LB, Luria-Bertani; LBP, LPS-binding pro- a demonstration that PLUNC has antimicrobial activity in vivo, tein; PLUNC, palate, lung, and nasal epithelium associated; qRT-PCR, quantitative and that additional PLUNC may be protective during infection. To RT-PCR; SPLUNC1, short PLUNC protein 1; TG, transgene; WT, wild type. determine whether PLUNC can limit P. aeruginosa infection in Copyright Ó 2011 by The American Association of Immunologists, Inc. 0022-1767/11/$16.00 the lung, transgenic mice (Scgb1a1-hPLUNC) were generated in www.jimmunol.org/cgi/doi/10.4049/jimmunol.1001769 The Journal of Immunology 383 which human PLUNC (hPLUNC) was directed to the airway aliquots at 280˚C in 20% glycerol/Luria-Bertani (LB) broth. For each epithelium with the Scgb1a1 promoter and these mice were experiment, an aliquot of bacteria was thawed, inoculated into 10 ml LB, challenged with P. aeruginosa. and incubated (6 h; 37˚C) with shaking. An aliquot was then diluted 1:100 into 100 ml LB broth and incubated (16 h; 37˚C). Bacteria were washed twice and resuspended in 10 ml PBS containing 10 mM magnesium Materials and Methods chloride. Generation of Scgb1a1-hPLUNC transgenic mice CFU assay Constitutive expression of hPLUNC protein in the mouse respiratory ep- ithelium was achieved through generation of mice harboring a transgene The number of CFU was determined by serial dilution and quantitative (TG) composed of the hPLUNC cDNA under the transcriptional control of culture on LB agar plates. P. aeruginosa was resuspended in PBS, and the ∼ ∼ 3 11 the mouse Scgb1a1 (also known as Clara cell secretory protein, or CCSP) OD (OD470) was adjusted to 0.74, 2 10 bacteria/ml. Five serial 10- promoter (Fig. 1A). Total human airway epithelial cell RNA was used as fold dilutions in PBS were prepared immediately before use. Duplicate a template for RT-PCR amplification of PLUNC cDNA (0.78 kb). The bacterial
Load more

Recommended publications
  • A Molecular and Genetic Analysis of Otosclerosis
    A molecular and genetic analysis of otosclerosis Joanna Lauren Ziff Submitted for the degree of PhD University College London January 2014 1 Declaration I, Joanna Ziff, confirm that the work presented in this thesis is my own. Where information has been derived from other sources, I confirm that this has been indicated in the thesis. Where work has been conducted by other members of our laboratory, this has been indicated by an appropriate reference. 2 Abstract Otosclerosis is a common form of conductive hearing loss. It is characterised by abnormal bone remodelling within the otic capsule, leading to formation of sclerotic lesions of the temporal bone. Encroachment of these lesions on to the footplate of the stapes in the middle ear leads to stapes fixation and subsequent conductive hearing loss. The hereditary nature of otosclerosis has long been recognised due to its recurrence within families, but its genetic aetiology is yet to be characterised. Although many familial linkage studies and candidate gene association studies to investigate the genetic nature of otosclerosis have been performed in recent years, progress in identifying disease causing genes has been slow. This is largely due to the highly heterogeneous nature of this condition. The research presented in this thesis examines the molecular and genetic basis of otosclerosis using two next generation sequencing technologies; RNA-sequencing and Whole Exome Sequencing. RNA–sequencing has provided human stapes transcriptomes for healthy and diseased stapes, and in combination with pathway analysis has helped identify genes and molecular processes dysregulated in otosclerotic tissue. Whole Exome Sequencing has been employed to investigate rare variants that segregate with otosclerosis in affected families, and has been followed by a variant filtering strategy, which has prioritised genes found to be dysregulated during RNA-sequencing.
    [Show full text]
  • Role of Amylase in Ovarian Cancer Mai Mohamed University of South Florida, [email protected]
    University of South Florida Scholar Commons Graduate Theses and Dissertations Graduate School July 2017 Role of Amylase in Ovarian Cancer Mai Mohamed University of South Florida, [email protected] Follow this and additional works at: http://scholarcommons.usf.edu/etd Part of the Pathology Commons Scholar Commons Citation Mohamed, Mai, "Role of Amylase in Ovarian Cancer" (2017). Graduate Theses and Dissertations. http://scholarcommons.usf.edu/etd/6907 This Dissertation is brought to you for free and open access by the Graduate School at Scholar Commons. It has been accepted for inclusion in Graduate Theses and Dissertations by an authorized administrator of Scholar Commons. For more information, please contact [email protected]. Role of Amylase in Ovarian Cancer by Mai Mohamed A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy Department of Pathology and Cell Biology Morsani College of Medicine University of South Florida Major Professor: Patricia Kruk, Ph.D. Paula C. Bickford, Ph.D. Meera Nanjundan, Ph.D. Marzenna Wiranowska, Ph.D. Lauri Wright, Ph.D. Date of Approval: June 29, 2017 Keywords: ovarian cancer, amylase, computational analyses, glycocalyx, cellular invasion Copyright © 2017, Mai Mohamed Dedication This dissertation is dedicated to my parents, Ahmed and Fatma, who have always stressed the importance of education, and, throughout my education, have been my strongest source of encouragement and support. They always believed in me and I am eternally grateful to them. I would also like to thank my brothers, Mohamed and Hussien, and my sister, Mariam. I would also like to thank my husband, Ahmed.
    [Show full text]
  • Investigating Single-Gene Disorders of Childhood Infectious Disease
    INVESTIGATING SINGLE-GENE DISORDERS OF CHILDHOOD INFECTIOUS DISEASE Bayarchimeg Mashbat A thesis submitted for the degree of Doctor of Philosophy Section of Paediatrics, Division of Infectious Diseases Department of Medicine, Imperial College London United Kingdom October 2017 Abstract A common feature of infectious diseases, including an infection with Neisseria meningitidis (Nm), is that only a small proportion of the individuals exposed to the same strain of the bacteria suffer from the clinical disease. Host genetics has long been considered to be an important determinant of both predisposition to and severity of outcome from invasive meningococcal disease (IMD). The human complement system is central to protection against IMD. It is well established that individuals with terminal or alternative complement deficiencies are predisposed to invasive, often recurrent meningococcal infections. However, the occurrence of these putative genetic deficiencies is rare, such that complement deficiencies account for less than 3 % of the disease cases. The current study sought to uncover novel genetic aetiologies of IMD, by employing WES and GWAS, in conjunction with molecular functional characterisation assays. Firstly, genetic analysis of six familial IMD exomes revealed a novel mutation in the SPLUNC1 gene. The encoding protein has been shown to play an important role in innate immune defence against a number of Gram-negative bacterial infections. The characterisation assays undertaken in this work suggest that the protein encoded by SPLUNC1 is also implicated with host innate immune defence against Nm infection, by providing protection against nasopharyngeal colonisation of a pathogenic Nm strain. The results further suggest that harbouring rare pathogenic mutations that impact the function of the encoding protein is associated with reduced host defence activities in the resulting protein, which in turn may possibly lead to increased susceptibility to IMD in the carriers.
    [Show full text]
  • Supplemental Table S1. Primers for Sybrgreen Quantitative RT-PCR Assays
    Supplemental Table S1. Primers for SYBRGreen quantitative RT-PCR assays. Gene Accession Primer Sequence Length Start Stop Tm GC% GAPDH NM_002046.3 GAPDH F TCCTGTTCGACAGTCAGCCGCA 22 39 60 60.43 59.09 GAPDH R GCGCCCAATACGACCAAATCCGT 23 150 128 60.12 56.52 Exon junction 131/132 (reverse primer) on template NM_002046.3 DNAH6 NM_001370.1 DNAH6 F GGGCCTGGTGCTGCTTTGATGA 22 4690 4711 59.66 59.09% DNAH6 R TAGAGAGCTTTGCCGCTTTGGCG 23 4797 4775 60.06 56.52% Exon junction 4790/4791 (reverse primer) on template NM_001370.1 DNAH7 NM_018897.2 DNAH7 F TGCTGCATGAGCGGGCGATTA 21 9973 9993 59.25 57.14% DNAH7 R AGGAAGCCATGTACAAAGGTTGGCA 25 10073 10049 58.85 48.00% Exon junction 9989/9990 (forward primer) on template NM_018897.2 DNAI1 NM_012144.2 DNAI1 F AACAGATGTGCCTGCAGCTGGG 22 673 694 59.67 59.09 DNAI1 R TCTCGATCCCGGACAGGGTTGT 22 822 801 59.07 59.09 Exon junction 814/815 (reverse primer) on template NM_012144.2 RPGRIP1L NM_015272.2 RPGRIP1L F TCCCAAGGTTTCACAAGAAGGCAGT 25 3118 3142 58.5 48.00% RPGRIP1L R TGCCAAGCTTTGTTCTGCAAGCTGA 25 3238 3214 60.06 48.00% Exon junction 3124/3125 (forward primer) on template NM_015272.2 Supplemental Table S2. Transcripts that differentiate IPF/UIP from controls at 5%FDR Fold- p-value Change Transcript Gene p-value p-value p-value (IPF/UIP (IPF/UIP Cluster ID RefSeq Symbol gene_assignment (Age) (Gender) (Smoking) vs. C) vs. C) NM_001178008 // CBS // cystathionine-beta- 8070632 NM_001178008 CBS synthase // 21q22.3 // 875 /// NM_0000 0.456642 0.314761 0.418564 4.83E-36 -2.23 NM_003013 // SFRP2 // secreted frizzled- 8103254 NM_003013
    [Show full text]
  • Identification of Genes Expressed by Human Airway Eosinophils After an in Vivo Allergen Challenge
    Identification of Genes Expressed by Human Airway Eosinophils after an In Vivo Allergen Challenge Stephane Esnault1*, Elizabeth A. Kelly1, Elizabeth A. Schwantes1, Lin Ying Liu1, Larissa P. DeLain1, Jami A. Hauer1, Yury A. Bochkov2, Loren C. Denlinger1, James S. Malter3, Sameer K. Mathur1, Nizar N. Jarjour1 1 Department of Medicine, Allergy, Pulmonary, and Critical Care Medicine Division, University of Wisconsin School of Medicine and Public Health, Madison, Wisconsin, United States of America, 2 Department of Pediatrics, University of Wisconsin School of Medicine and Public Health, Madison, Wisconsin, United States of America, 3 Department of Pathology, University of Texas Southwestern Medical Center, Dallas, Texas, United States of America Abstract Background: The mechanism for the contribution of eosinophils (EOS) to asthma pathophysiology is not fully understood. Genome-wide expression analysis of airway EOS by microarrays has been limited by the ability to generate high quality RNA from sufficient numbers of airway EOS. Objective: To identify, by genome-wide expression analyses, a compendium of expressed genes characteristic of airway EOS following an in vivo allergen challenge. Methods: Atopic, mild asthmatic subjects were recruited for these studies. Induced sputum was obtained before and 48h after a whole lung allergen challenge (WLAC). Individuals also received a segmental bronchoprovocation with allergen (SBP- Ag) 1 month before and after administering a single dose of mepolizumab (anti-IL-5 monoclonal antibody) to reduce airway EOS. Bronchoalveolar lavage (BAL) was performed before and 48 h after SBP-Ag. Gene expression of sputum and BAL cells was analyzed by microarrays. The results were validated by qPCR in BAL cells and purified BAL EOS.
    [Show full text]
  • The DNA Sequence and Comparative Analysis of Human Chromosome 20
    articles The DNA sequence and comparative analysis of human chromosome 20 P. Deloukas, L. H. Matthews, J. Ashurst, J. Burton, J. G. R. Gilbert, M. Jones, G. Stavrides, J. P. Almeida, A. K. Babbage, C. L. Bagguley, J. Bailey, K. F. Barlow, K. N. Bates, L. M. Beard, D. M. Beare, O. P. Beasley, C. P. Bird, S. E. Blakey, A. M. Bridgeman, A. J. Brown, D. Buck, W. Burrill, A. P. Butler, C. Carder, N. P. Carter, J. C. Chapman, M. Clamp, G. Clark, L. N. Clark, S. Y. Clark, C. M. Clee, S. Clegg, V. E. Cobley, R. E. Collier, R. Connor, N. R. Corby, A. Coulson, G. J. Coville, R. Deadman, P. Dhami, M. Dunn, A. G. Ellington, J. A. Frankland, A. Fraser, L. French, P. Garner, D. V. Grafham, C. Grif®ths, M. N. D. Grif®ths, R. Gwilliam, R. E. Hall, S. Hammond, J. L. Harley, P. D. Heath, S. Ho, J. L. Holden, P. J. Howden, E. Huckle, A. R. Hunt, S. E. Hunt, K. Jekosch, C. M. Johnson, D. Johnson, M. P. Kay, A. M. Kimberley, A. King, A. Knights, G. K. Laird, S. Lawlor, M. H. Lehvaslaiho, M. Leversha, C. Lloyd, D. M. Lloyd, J. D. Lovell, V. L. Marsh, S. L. Martin, L. J. McConnachie, K. McLay, A. A. McMurray, S. Milne, D. Mistry, M. J. F. Moore, J. C. Mullikin, T. Nickerson, K. Oliver, A. Parker, R. Patel, T. A. V. Pearce, A. I. Peck, B. J. C. T. Phillimore, S. R. Prathalingam, R. W. Plumb, H. Ramsay, C. M.
    [Show full text]
  • Regulated T Cell Pre-Mrna Splicing As Genetic Marker of T Cell Suppression
    Regulated T cell pre-mRNA splicing as genetic marker of T cell suppression by Boitumelo Mofolo Thesis presented for the degree of Master of Science (Bioinformatics) Institute of Infectious Disease and Molecular Medicine University of Cape Town (UCT) Supervisor: Assoc. Prof. Nicola Mulder August 2012 University of Cape Town The copyright of this thesis vests in the author. No quotation from it or information derived from it is to be published without full acknowledgementTown of the source. The thesis is to be used for private study or non- commercial research purposes only. Cape Published by the University ofof Cape Town (UCT) in terms of the non-exclusive license granted to UCT by the author. University Declaration I, Boitumelo Mofolo, declare that all the work in this thesis, excluding that has been cited and referenced, is my own. Signature Signature Removed Boitumelo Mofolo University of Cape Town Copyright©2012 University of Cape Town All rights reserved 1 ABSTRACT T CELL NORMAL T CELL SUPPRESSION p110 p110 MV p85 PI3K AKT p85 PI3K PHOSPHORYLATION NO PHOSHORYLATION HIV cytoplasm HCMV LCK-011 PRMT5-006 SHIP145 SIP110 RV LCK-010 VCL-204 ATM-016 PRMT5-018 ATM-002 CALD1-008 LCK-006 MXI1-001 VCL-202 NRP1-201 MXI1-007 CALD1-004 nucleus Background: Measles is a highly contagious disease that mainly affects children and according to the World Health Organisation (WHO), was responsible for over 164000 deaths in 2008, despite the availability of a safe and cost-effective vaccine [56]. The Measles virus (MV) inactivates T- cells, rendering them dysfunctional, and results in virally induced immunosuppression which shares certain features with thatUniversity induced by HIV.
    [Show full text]
  • Development and Application of Immunoassays For
    FUNCTIONAL CHARACTERIZATION OF SPURT USING TRANSGENIC MOUSE MODEL by Lina Lukinskiene BS, Vilnius University, 1995 MS, Vilnius University, 1997 Submitted to the Graduate Faculty of Department of Environmental and Occupational Health Graduate School of Public Health in partial fulfillment Of the requirements for the degree of Master of Science University of Pittsburgh 2005 UNIVERSITY OF PITTSBURGH Graduate School of Public Health This thesis was presented by Lina Lukinskiene It was defended on 06/10/2005 and approved by Thesis Advisor: Yuan Pu Di, PhD, Assistant Professor Department of Environmental & Occupational Health Graduate School of Public Health University of Pittsburgh Committee Member: Bruce Pitt, PhD, Professor Department of Environmental & Occupational Health Graduate School of Public Health University of Pittsburgh Committee Member: Chad Steele, PhD Assistant Professor Division of Pediatric Pulmonology, Laboratory of Lung Immunology and Host Defense School of Medicine University of Pittsburgh ii Yuan Pu Di, PhD FUNCTIONAL CHARACTERIZATION OF SPURT USING TRANSGENIC MOUSE MODEL Lina Lukinskiene, MS University of Pittsburgh, 2005 Abstract The respiratory tract is the target of multiple infectious agents. Because the lungs are continually exposed to infectious pathogens in inspired air, natural defense mechanisms have devolved to prevent infection. These defense mechanisms coordinate with each other to provide efficient protection against infection. As a result, pulmonary infections can be viewed not just as a consequence of exposure to a virulent pathogen but as a result of a breakdown of natural host defenses. SPLUNC1 or SPURT (secretory protein in upper respiratory tracts) is small, secreted protein that is expressed in epithelial areas of the nose, mouth, pharynx and lungs.
    [Show full text]
  • PLUNC Antibody - Middle Region Rabbit Polyclonal Antibody Catalog # AI12105
    10320 Camino Santa Fe, Suite G San Diego, CA 92121 Tel: 858.875.1900 Fax: 858.622.0609 PLUNC antibody - middle region Rabbit Polyclonal Antibody Catalog # AI12105 Specification PLUNC antibody - middle region - Product Information Application IHC, WB Primary Accession Q9NP55 Other Accession NM_016583, NP_057667 Reactivity Human, Mouse, Rat, Rabbit, Pig, Goat, Bovine, Guinea Pig, Dog Predicted Pig Host Rabbit Immunohistochemistry with Human Lung, Clonality Polyclonal respiratory epethelium tissue at an antibody Calculated MW 28kDa KDa concentration of 5.0μg/ml using anti-PLUNC antibody PLUNC antibody - middle region - Additional Information Gene ID 51297 Alias Symbol LUNX, NASG, SPLUNC1, SPURT, bA49G10.5, PLUNC, LPLUNC3 Other Names BPI fold-containing family A member 1, Lung-specific protein X, Nasopharyngeal carcinoma-related protein, Palate lung and WB Suggested Anti-PLUNC Antibody Titration: nasal epithelium clone protein, Secretory 0.2-1 μg/ml protein in upper respiratory tracts, Short Positive Control: Jurkat cell lysate PLUNC1, SPLUNC1, Tracheal epithelium-enriched protein, Von Ebner protein Hl, BPIFA1, LUNX, NASG, PLUNC, SPLUNC1, SPURT PLUNC antibody - middle region - References Format Liquid. Purified antibody supplied in 1x PBS Zhou,H.D.,(2006)Mol.Immunol.43(11),1864-18 buffer with 0.09% (w/v) sodium azide and 71ReconstitutionandStorage:Forshorttermuse,s 2% sucrose. toreat2-8Cupto1week.Forlongtermstorage,stor Reconstitution & Storage eat-20Cinsmallaliquotstopreventfreeze-thawcy Add 50 ul of distilled water. Final cles. anti-PLUNC antibody concentration is 1 mg/ml in PBS buffer with 2% sucrose. For longer periods of storage, store at 20°C. Avoid repeat freeze-thaw cycles. Page 1/3 10320 Camino Santa Fe, Suite G San Diego, CA 92121 Tel: 858.875.1900 Fax: 858.622.0609 Precautions PLUNC antibody - middle region is for research use only and not for use in diagnostic or therapeutic procedures.
    [Show full text]
  • Regulation of the Epithelial Sodium Channel (Enac) by the Short Palate, Lung, and Nasal Epithelial Clone (SPLUNC1) Brett Rollins
    Regulation of the Epithelial Sodium Channel (ENaC) by the Short Palate, Lung, and Nasal Epithelial Clone (SPLUNC1) Brett Rollins A thesis submitted to the faculty of the University of North Carolina at Chapel Hill in partial fulfillment of the requirements for the degree of Master of Science in the Department of Cell and Molecular Physiology Chapel Hill 2010 Approved by Dr. James Anderson Dr. P. Kay Lund Dr. Robert Tarran © 2010 Brett Matthew Rollins ALL RIGHTS RESERVED ii Abstract Brett Rollins: Regulation of the Epithelial Sodium Channel (ENaC) by the Short Palate, Lung, and Nasal Epithelial Clone (SPLUNC1) (Under the direction of Robert Tarran) The airways rely on mucociliary clearance (MCC) to remove inhaled particulates. Initiating events in chronic airway diseases, such as cystic fibrosis (CF), have been traced back to the failure of a critical MCC component, ion transport. Specifically, the epithelial sodium channel (ENaC) is known to be hyperabsorptive in CF airway epithelia and contributes to dehydrated airway surface liquid (ASL), collapsed cilia, and high percent solid mucus. Recently, proteolytic cleavage and activation of ENaC has been described and SPLUNC1 was identified as an endogenous inhibitor of ENaC activation. Here, we demonstrate SPLUNC1’s ability to reduce macroscopic current and specifically the number of channels of membrane-inserted ENaCs. This work also identifies the active site of SPLUNC1 and provides evidence for a functional SPLUNC1 mimetic peptide. Further, as nonfunctional CFTR influences abnormal bicarbonate secretion and thus CF ASL pH, we correlated the loss of SPLUNC1’s function in CF airways to this acidic environment. iii Table of Contents List of Abbreviations…………………………………………………………………….vii List of Figures……………………………………………………………………..……...ix List of Tables………………………………………………………………………….….xi Chapter I.
    [Show full text]
  • Development of Genomic Methods and Tools for an Equine Model
    DEVELOPMENT OF GENOMIC METHODS AND TOOLS FOR AN EQUINE MODEL A Dissertation Presented to the Faculty of the Graduate School of Cornell University In Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy in Animal Science by Mohammed Ali Obaid Al Abri August 2015 © 2015 Mohammed Ali Al Abri DEVELOPMENT OF GENOMIC METHODS AND TOOLS FOR AN EQUINE MODEL Mohammed Ali Al Abri, Ph.D. Cornell University 2015 The advent of genomic analysis has identified regions of functional significance in several mammalian species. However, for horses, relatively little such work was done compared to other farm animals. The current archive of genetic variations in the horse is mostly based on the Thoroughbred mare upon which the reference sequence (EquCab2.0) was generated. Thus, more investigation of the equine genomic architecture is critical to better understand the equine genome. Chapter 2 of this dissertation represents an analyses of next generation sequencing data of six horses from a diverse genetic background. I have utilized the most advanced techniques to identify, and annotate genetic variants including single nucleotide polymorphism, copy number variations and structural variations pertaining to these horse breeds. The analysis discovered thousands of novel SNPs and INDELs and hundreds of CNVs and SVs in each of the horses. These newly identified variants where formatted as online tracks and should provide a foundational database for future studies in horse genomics. Chapter three of the thesis discusses a genome wide association study aimed at the discovery of QTLs affecting body size variation in horses. I used the Illumina Equine SNP50 BeadChip to genotype 48 horses from diverse breeds and representing the extremes in body size in horses.
    [Show full text]
  • Collectins and Cationic Antimicrobial Peptides of the Respiratory Epithelia Branka Grubor Iowa State University
    Veterinary Pathology Publications and Papers Veterinary Pathology 9-2006 Collectins and cationic antimicrobial peptides of the respiratory epithelia Branka Grubor Iowa State University David K. Meyerholz Iowa State University Mark R. Ackermann Iowa State University, [email protected] Follow this and additional works at: http://lib.dr.iastate.edu/vpath_pubs Part of the Veterinary Pathology and Pathobiology Commons The ompc lete bibliographic information for this item can be found at http://lib.dr.iastate.edu/ vpath_pubs/32. For information on how to cite this item, please visit http://lib.dr.iastate.edu/ howtocite.html. This Article is brought to you for free and open access by the Veterinary Pathology at Iowa State University Digital Repository. It has been accepted for inclusion in Veterinary Pathology Publications and Papers by an authorized administrator of Iowa State University Digital Repository. For more information, please contact [email protected]. Collectins and cationic antimicrobial peptides of the respiratory epithelia Abstract The er spiratory epithelium is a primary site for the deposition of microorganisms that are acquired during inspiration. The innate immune system of the respiratory tract eliminates many of these potentially harmful agents preventing their colonization. Collectins and cationic antimicrobial peptides are antimicrobial components of the pulmonary innate immune system produced by respiratory epithelia, which have integral roles in host defense and inflammation in the lung. Synthesis and secretion of these molecules are regulated by the developmental stage, hormones, as well as many growth and immunoregulatory factors. The purpose of this review is to discuss antimicrobial innate immune elements within the respiratory tract of healthy and pneumonic lung with emphasis on hydrophilic surfactant proteins and β-defensins.
    [Show full text]