DOCSLIB.ORG

Genetic Association and Gene Expression Analysis of Inflammatory

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Genetic Association and Gene Expression Analysis of Inflammatory Genetic association and gene expression analysis of inflammatory genes in cystic fibrosis by Aabida Saferali A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY in THE FACULTY OF GRADUATE AND POSTDOCTORAL STUDIES (Experimental Medicine) THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver) September 2016 © Aabida Saferali, 2016 ABSTRACT Cystic fibrosis (CF) is characterized by a progressive decline in lung function due to airway obstruction, infection, and inflammation. CF patients are particularly susceptible to respiratory infection by a variety of pathogens, and the inflammatory response in CF is dysregulated and prolonged. This thesis identifies and characterizes BPI fold containing family A, member 1 (BPIFA1) and BPIFB1 as putative anti-inflammatory molecules in CF, and explores the CF inflammatory response to rhinovirus infection. BPIFA1 and BPIFB1 are proposed innate immune molecules expressed in the upper airways. We interrogated BPIFA1/BPIFB1 single-nucleotide polymorphisms in data from the North American genome-wide association study (GWAS) for lung disease severity in CF and discovered that the G allele of rs1078761 was associated with reduced lung function in CF patients. Microarray and qPCR gene expression analysis implicated rs1078761 G as being associated with reduced BPIFA1 and BPIFB1 gene expression, suggesting that decreased levels of these genes are detrimental in CF. Functional assays to characterize the role of BPIFA1 and BPIFB1 in CF indicated that these molecules do not have an anti-bacterial role against P. aeruginosa, but do have an immunomodulatory function in CF airway epithelial cells. To further investigate the mechanism of action of BPIFA1 and BPIFB1 during bacterial infection, gene expression was profiled using RNA-Seq in airway epithelial cells stimulated with P. aeruginosa and treated with recombinant BPIFA1 and BPIFB1. Viral infections are now recognized to play an important role in the short and long term health of CF patients. Rhinovirus is emerging as a lead viral pathogen although little is known about the inflammatory response triggered by rhinovirus in the CF lung. To investigate whether ii CF patients have a dysregulated response to rhinovirus infection, primary airway epithelial cells from CF and healthy control children were infected with rhinovirus and gene expression profiles were assessed by RNA-Seq. Although rhinovirus stimulation resulted significantly altered gene expression, the response to infection was not different in CF patients compared to healthy controls. However, CF cells had significantly higher rhinovirus levels than controls, indicating that CF patients may have a deficient antiviral response allowing for increased rhinovirus replication. iii PREFACE All work was conducted at the Centre for Heart Lung Innovation and the Child and Family Research Institute/BC Children’s Research Institute. Ethics approval was obtained for collection of saliva samples from CF patients and healthy controls from UBC Providence Health Care Research Institute Ethics Board (certificates H12-03293 and H15-02759). Healthy control samples were obtained through recruitment of volunteers by A. Saferali at the Centre for Heart Lung Innovation with informed written consent. CF patient samples were collected with informed written consent from the Pacific Lung Health Centre CF Clinic directed by Dr. B. Quon. A. Saferali was the lead investigator for all the work presented in this thesis. All aspects of study design, analysis, and execution were carried out by A. Saferali together with Drs. A.J. Sandford, and S.E. Turvey. Primary airway epithelial cells from CF patients described in Chapter 4 were obtained from Drs. A. Kicic and S. Stick in Perth Australia. RNA-Seq data shown in Chapter 4 were generated in the lab of Dr. R.E. Hancock. F. Shaheen helped with the immunohistochemistry shown in section 3.4.1. Dr. A. Tang performed the experiments described in section 3.4.5 and wrote the material and methods for that section. In addition, Dr. Tang contributed to 10% of the western blots shown in section 3.4.2. The study presented in Chapter 2 of this work was published in the American Journal of Respiratory Cell and Molecular Biology in November 2015. The data are reprinted with permission of the American Thoracic Society1. 1 Copyright © 2016 American Thoracic Society. The American Journal of Respiratory Cell and Molecular Biology is an official journal of the American Thoracic Society. iv Saferali, A., et al., Polymorphisms associated with expression of BPIFA1/BPIFB1 and lung disease severity in cystic fibrosis. Am J Respir Cell Mol Biol, 2015. 53(5): p. 607- 14. Certain aspects of Chapter 1 were included in a review to be published in Wiley eLS. Saferali, A., et al., (September 2016) Cystic Fibrosis: Modifier Genes. In: eLS. John Wiley & Sons, Ltd: Chichester. DOI: 10.1002/9780470015902.a0020233. v TABLE OF CONTENTS ABSTRACT ................................................................................................................................... ii PREFACE ..................................................................................................................................... iv TABLE OF CONTENTS ............................................................................................................ vi LIST OF TABLES ....................................................................................................................... ix LIST OF FIGURES ...................................................................................................................... x LIST OF ABBREVIATIONS .................................................................................................... xii ACKNOWLEDGEMENTS ...................................................................................................... xvi CHAPTER 1: A BACKGROUND ON CYSTIC FIBROSIS MODIFIER GENES AND HOST RESPONSE ....................................................................................................................... 1 1.1 Molecular basis of cystic fibrosis ..................................................................................................... 1 1.2 Genome-wide association studies in CF .......................................................................................... 4 1.2.1 Consortium approach to genome-wide association studies ......................................................... 5 1.2.2 Genome-wide studies of lung function in cystic fibrosis ............................................................ 6 1.2.3 Genetic association studies of other CF related phenotypes ..................................................... 11 1.2.3.1 Body mass index and nutritional status ............................................................................................. 11 1.2.3.2 CF-related diabetes ............................................................................................................................ 11 1.2.3.3 Meconium ileus ................................................................................................................................. 13 1.2.4 CF modifier genes, inflammation and immunity in CF ............................................................ 16 1.3 Infection in cystic fibrosis .............................................................................................................. 17 1.3.1 Bacterial infection ..................................................................................................................... 17 1.3.2 Viral infection in cystic fibrosis ................................................................................................ 18 1.3.3 Rhinovirus in CF ....................................................................................................................... 19 1.3.4 Fungal pathogens....................................................................................................................... 22 1.4 Inflammation in CF ........................................................................................................................ 23 1.4.1 Dysregulated immune response in CF ....................................................................................... 23 1.4.2 Abnormal airway surface liquid and mucociliary clearance ..................................................... 23 1.4.3 Secondary inflammatory defects in CF airways ........................................................................ 25 1.4.4 Anti-inflammatory therapies ..................................................................................................... 26 1.5 BPIFA1 and BPIFB1: Innate immune molecules in CF ............................................................. 27 1.5.1 The BPI fold containing family of proteins ............................................................................... 27 1.5.2 Antimicrobial properties of BPIFA1 ......................................................................................... 28 1.5.3 Immunomodulatory function of BPIFA1 .................................................................................. 30 1.5.4 BPIFA1 in ion transport and ASL regulation ............................................................................ 30 1.5.5 Function of BPIFB1 .................................................................................................................. 31 1.6 Summary of thesis objectives ........................................................................................................
Load more

Recommended publications
  • 2017.08.28 Anne Barry-Reidy Thesis Final.Pdf
    REGULATION OF BOVINE β-DEFENSIN EXPRESSION THIS THESIS IS SUBMITTED TO THE UNIVERSITY OF DUBLIN FOR THE DEGREE OF DOCTOR OF PHILOSOPHY 2017 ANNE BARRY-REIDY SCHOOL OF BIOCHEMISTRY & IMMUNOLOGY TRINITY COLLEGE DUBLIN SUPERVISORS: PROF. CLIONA O’FARRELLY & DR. KIERAN MEADE TABLE OF CONTENTS DECLARATION ................................................................................................................................. vii ACKNOWLEDGEMENTS ................................................................................................................... viii ABBREVIATIONS ................................................................................................................................ix LIST OF FIGURES............................................................................................................................. xiii LIST OF TABLES .............................................................................................................................. xvii ABSTRACT ........................................................................................................................................xix Chapter 1 Introduction ........................................................................................................ 1 1.1 Antimicrobial/Host-defence peptides ..................................................................... 1 1.2 Defensins................................................................................................................. 1 1.3 β-defensins .............................................................................................................
    [Show full text]
  • A Molecular and Genetic Analysis of Otosclerosis
    A molecular and genetic analysis of otosclerosis Joanna Lauren Ziff Submitted for the degree of PhD University College London January 2014 1 Declaration I, Joanna Ziff, confirm that the work presented in this thesis is my own. Where information has been derived from other sources, I confirm that this has been indicated in the thesis. Where work has been conducted by other members of our laboratory, this has been indicated by an appropriate reference. 2 Abstract Otosclerosis is a common form of conductive hearing loss. It is characterised by abnormal bone remodelling within the otic capsule, leading to formation of sclerotic lesions of the temporal bone. Encroachment of these lesions on to the footplate of the stapes in the middle ear leads to stapes fixation and subsequent conductive hearing loss. The hereditary nature of otosclerosis has long been recognised due to its recurrence within families, but its genetic aetiology is yet to be characterised. Although many familial linkage studies and candidate gene association studies to investigate the genetic nature of otosclerosis have been performed in recent years, progress in identifying disease causing genes has been slow. This is largely due to the highly heterogeneous nature of this condition. The research presented in this thesis examines the molecular and genetic basis of otosclerosis using two next generation sequencing technologies; RNA-sequencing and Whole Exome Sequencing. RNA–sequencing has provided human stapes transcriptomes for healthy and diseased stapes, and in combination with pathway analysis has helped identify genes and molecular processes dysregulated in otosclerotic tissue. Whole Exome Sequencing has been employed to investigate rare variants that segregate with otosclerosis in affected families, and has been followed by a variant filtering strategy, which has prioritised genes found to be dysregulated during RNA-sequencing.
    [Show full text]
  • Downloaded From
    Antimicrobial Activity of PLUNC Protects against Pseudomonas aeruginosa Infection Lina Lukinskiene, Yang Liu, Susan D. Reynolds, Chad Steele, Barry R. Stripp, George D. Leikauf, Jay K. Kolls and This information is current as Y. Peter Di of October 2, 2021. J Immunol 2011; 187:382-390; Prepublished online 1 June 2011; doi: 10.4049/jimmunol.1001769 http://www.jimmunol.org/content/187/1/382 Downloaded from References This article cites 37 articles, 15 of which you can access for free at: http://www.jimmunol.org/content/187/1/382.full#ref-list-1 http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication by guest on October 2, 2021 *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2011 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology Antimicrobial Activity of PLUNC Protects against Pseudomonas aeruginosa Infection Lina Lukinskiene,* Yang Liu,* Susan D. Reynolds,† Chad Steele,‡ Barry R. Stripp,x George D. Leikauf,* Jay K. Kolls,{ and Y.
    [Show full text]
  • Accompanies CD8 T Cell Effector Function Global DNA Methylation
    Global DNA Methylation Remodeling Accompanies CD8 T Cell Effector Function Christopher D. Scharer, Benjamin G. Barwick, Benjamin A. Youngblood, Rafi Ahmed and Jeremy M. Boss This information is current as of October 1, 2021. J Immunol 2013; 191:3419-3429; Prepublished online 16 August 2013; doi: 10.4049/jimmunol.1301395 http://www.jimmunol.org/content/191/6/3419 Downloaded from Supplementary http://www.jimmunol.org/content/suppl/2013/08/20/jimmunol.130139 Material 5.DC1 References This article cites 81 articles, 25 of which you can access for free at: http://www.jimmunol.org/content/191/6/3419.full#ref-list-1 http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists by guest on October 1, 2021 • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2013 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology Global DNA Methylation Remodeling Accompanies CD8 T Cell Effector Function Christopher D. Scharer,* Benjamin G. Barwick,* Benjamin A. Youngblood,*,† Rafi Ahmed,*,† and Jeremy M.
    [Show full text]
  • Association of Gene Ontology Categories with Decay Rate for Hepg2 Experiments These Tables Show Details for All Gene Ontology Categories
    Supplementary Table 1: Association of Gene Ontology Categories with Decay Rate for HepG2 Experiments These tables show details for all Gene Ontology categories. Inferences for manual classification scheme shown at the bottom. Those categories used in Figure 1A are highlighted in bold. Standard Deviations are shown in parentheses. P-values less than 1E-20 are indicated with a "0". Rate r (hour^-1) Half-life < 2hr. Decay % GO Number Category Name Probe Sets Group Non-Group Distribution p-value In-Group Non-Group Representation p-value GO:0006350 transcription 1523 0.221 (0.009) 0.127 (0.002) FASTER 0 13.1 (0.4) 4.5 (0.1) OVER 0 GO:0006351 transcription, DNA-dependent 1498 0.220 (0.009) 0.127 (0.002) FASTER 0 13.0 (0.4) 4.5 (0.1) OVER 0 GO:0006355 regulation of transcription, DNA-dependent 1163 0.230 (0.011) 0.128 (0.002) FASTER 5.00E-21 14.2 (0.5) 4.6 (0.1) OVER 0 GO:0006366 transcription from Pol II promoter 845 0.225 (0.012) 0.130 (0.002) FASTER 1.88E-14 13.0 (0.5) 4.8 (0.1) OVER 0 GO:0006139 nucleobase, nucleoside, nucleotide and nucleic acid metabolism3004 0.173 (0.006) 0.127 (0.002) FASTER 1.28E-12 8.4 (0.2) 4.5 (0.1) OVER 0 GO:0006357 regulation of transcription from Pol II promoter 487 0.231 (0.016) 0.132 (0.002) FASTER 6.05E-10 13.5 (0.6) 4.9 (0.1) OVER 0 GO:0008283 cell proliferation 625 0.189 (0.014) 0.132 (0.002) FASTER 1.95E-05 10.1 (0.6) 5.0 (0.1) OVER 1.50E-20 GO:0006513 monoubiquitination 36 0.305 (0.049) 0.134 (0.002) FASTER 2.69E-04 25.4 (4.4) 5.1 (0.1) OVER 2.04E-06 GO:0007050 cell cycle arrest 57 0.311 (0.054) 0.133 (0.002)
    [Show full text]
  • Role of Amylase in Ovarian Cancer Mai Mohamed University of South Florida, [email protected]
    University of South Florida Scholar Commons Graduate Theses and Dissertations Graduate School July 2017 Role of Amylase in Ovarian Cancer Mai Mohamed University of South Florida, [email protected] Follow this and additional works at: http://scholarcommons.usf.edu/etd Part of the Pathology Commons Scholar Commons Citation Mohamed, Mai, "Role of Amylase in Ovarian Cancer" (2017). Graduate Theses and Dissertations. http://scholarcommons.usf.edu/etd/6907 This Dissertation is brought to you for free and open access by the Graduate School at Scholar Commons. It has been accepted for inclusion in Graduate Theses and Dissertations by an authorized administrator of Scholar Commons. For more information, please contact [email protected]. Role of Amylase in Ovarian Cancer by Mai Mohamed A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy Department of Pathology and Cell Biology Morsani College of Medicine University of South Florida Major Professor: Patricia Kruk, Ph.D. Paula C. Bickford, Ph.D. Meera Nanjundan, Ph.D. Marzenna Wiranowska, Ph.D. Lauri Wright, Ph.D. Date of Approval: June 29, 2017 Keywords: ovarian cancer, amylase, computational analyses, glycocalyx, cellular invasion Copyright © 2017, Mai Mohamed Dedication This dissertation is dedicated to my parents, Ahmed and Fatma, who have always stressed the importance of education, and, throughout my education, have been my strongest source of encouragement and support. They always believed in me and I am eternally grateful to them. I would also like to thank my brothers, Mohamed and Hussien, and my sister, Mariam. I would also like to thank my husband, Ahmed.
    [Show full text]
  • Detecting Global in Uence of Transcription
    Detecting global inuence of transcription factor interactions on gene expression in lymphoblastoid cells using neural network models Neel Patel Case Western Reserve University William S. Bush ( [email protected] ) Case Western Reserve University Research Article Keywords: Transcription factors, Gene expression, Machine learning, Neural network, Chromatin-looping, Regulatory module, Multi-omics Posted Date: April 15th, 2021 DOI: https://doi.org/10.21203/rs.3.rs-406028/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Detecting global influence of transcription factor interactions on gene expression in lymphoblastoid cells using neural network models. Neel Patel1,2 and William S. Bush2* 1Department of Nutrition, Case Western Reserve University, Cleveland, OH, USA. 2Department of Population and Quantitative Health Sciences, Case Western Reserve University, Cleveland, OH, USA.*-corresponding author(email:[email protected]) Abstract Background Transcription factor(TF) interactions are known to regulate target gene(TG) expression in eukaryotes via TF regulatory modules(TRMs). Such interactions can be formed due to co- localizing TFs binding proximally to each other in the DNA sequence or over long distances between distally binding TFs via chromatin looping. While the former type of interaction has been characterized extensively, long distance TF interactions are still largely understudied. Furthermore, most prior approaches have focused on characterizing physical TF interactions without accounting for their effects on TG expression regulation. Understanding TRM based TG expression regulation could aid in understanding diseases caused by disruptions to these mechanisms. In this paper, we present a novel neural network based TRM detection approach that consists of using multi-omics TF based regulatory mechanism information to generate features for building non-linear multilayer perceptron TG expression prediction models in the GM12878 immortalized lymphoblastoid cells.
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • Investigating Single-Gene Disorders of Childhood Infectious Disease
    INVESTIGATING SINGLE-GENE DISORDERS OF CHILDHOOD INFECTIOUS DISEASE Bayarchimeg Mashbat A thesis submitted for the degree of Doctor of Philosophy Section of Paediatrics, Division of Infectious Diseases Department of Medicine, Imperial College London United Kingdom October 2017 Abstract A common feature of infectious diseases, including an infection with Neisseria meningitidis (Nm), is that only a small proportion of the individuals exposed to the same strain of the bacteria suffer from the clinical disease. Host genetics has long been considered to be an important determinant of both predisposition to and severity of outcome from invasive meningococcal disease (IMD). The human complement system is central to protection against IMD. It is well established that individuals with terminal or alternative complement deficiencies are predisposed to invasive, often recurrent meningococcal infections. However, the occurrence of these putative genetic deficiencies is rare, such that complement deficiencies account for less than 3 % of the disease cases. The current study sought to uncover novel genetic aetiologies of IMD, by employing WES and GWAS, in conjunction with molecular functional characterisation assays. Firstly, genetic analysis of six familial IMD exomes revealed a novel mutation in the SPLUNC1 gene. The encoding protein has been shown to play an important role in innate immune defence against a number of Gram-negative bacterial infections. The characterisation assays undertaken in this work suggest that the protein encoded by SPLUNC1 is also implicated with host innate immune defence against Nm infection, by providing protection against nasopharyngeal colonisation of a pathogenic Nm strain. The results further suggest that harbouring rare pathogenic mutations that impact the function of the encoding protein is associated with reduced host defence activities in the resulting protein, which in turn may possibly lead to increased susceptibility to IMD in the carriers.
    [Show full text]
  • Transcriptome Analysis of Complex I-Deficient Patients Reveals Distinct
    van der Lee et al. BMC Genomics (2015) 16:691 DOI 10.1186/s12864-015-1883-8 RESEARCH ARTICLE Open Access Transcriptome analysis of complex I-deficient patients reveals distinct expression programs for subunits and assembly factors of the oxidative phosphorylation system Robin van der Lee1†, Radek Szklarczyk1,2†, Jan Smeitink3,HubertJMSmeets4, Martijn A. Huynen1 and Rutger Vogel3* Abstract Background: Transcriptional control of mitochondrial metabolism is essential for cellular function. A better understanding of this process will aid the elucidation of mitochondrial disorders, in particular of the many genetically unsolved cases of oxidative phosphorylation (OXPHOS) deficiency. Yet, to date only few studies have investigated nuclear gene regulation in the context of OXPHOS deficiency. In this study we performed RNA sequencing of two control and two complex I-deficient patient cell lines cultured in the presence of compounds that perturb mitochondrial metabolism: chloramphenicol, AICAR, or resveratrol. We combined this with a comprehensive analysis of mitochondrial and nuclear gene expression patterns, co-expression calculations and transcription factor binding sites. Results: Our analyses show that subsets of mitochondrial OXPHOS genes respond opposingly to chloramphenicol and AICAR, whereas the response of nuclear OXPHOS genes is less consistent between cell lines and treatments. Across all samples nuclear OXPHOS genes have a significantly higher co-expression with each other than with other genes, including those encoding mitochondrial proteins. We found no evidence for complex-specific mRNA expression regulation: subunits of different OXPHOS complexes are similarly (co-)expressed and regulated by a common set of transcription factors. However, we did observe significant differences between the expression of nuclear genes for OXPHOS subunits versus assembly factors, suggesting divergent transcription programs.
    [Show full text]
  • Supporting Information
    Supporting Information Rangel et al. 10.1073/pnas.1613859113 SI Materials and Methods genes were identified, and the microarray data were used to Tumor Xenograft Studies. Female 6- to 7-wk-old Crl:NU(NCr)- determine the closest intrinsic subtype centroid for each sample, Foxn1nu mice were purchased from Charles River Laboratories. based on Spearman correlation using logged mean-centered Mammary fat pad injections into athymic nude mice were per- expression data. To estimate cellular proliferation, a “gene formed using 3 × 106 cells (HCC70, HCC1954, MDA-MB-468, and proliferation signature” (32) was used to generate a proliferation MDA-MB-231). The human cancer cells were resuspended in score for each sample. Briefly, using the logged expression data 100 μL of a 1:1 mix of PBS and matrigel (TREVIGEN). For for a subset of proliferation-related genes, singular value de- HCC1569 human breast cancer cells, we injected 4 × 106 cells in composition was used to produce a “proliferation metagene,” 100 μL of a 1:1 mix of PBS and matrigel. Injections were done which was then scaled to generate a score between 0 and 1, with into the fourth mammary gland. Tumors were measured using a a higher score denoting an increased level of proliferation rela- digital caliper, and the tumor volume was calculated using the tive to samples with lower scores. following formula: volume (mm3) = width × length/2. At the end of the experiment, tumor tissues were sectioned for fixation Human Data. Data from a combined cohort of 2,116 breast tumors (10% formalin or 4% paraformaldehyde) and RNA isolation.
    [Show full text]
  • Supplemental Table S1. Primers for Sybrgreen Quantitative RT-PCR Assays
    Supplemental Table S1. Primers for SYBRGreen quantitative RT-PCR assays. Gene Accession Primer Sequence Length Start Stop Tm GC% GAPDH NM_002046.3 GAPDH F TCCTGTTCGACAGTCAGCCGCA 22 39 60 60.43 59.09 GAPDH R GCGCCCAATACGACCAAATCCGT 23 150 128 60.12 56.52 Exon junction 131/132 (reverse primer) on template NM_002046.3 DNAH6 NM_001370.1 DNAH6 F GGGCCTGGTGCTGCTTTGATGA 22 4690 4711 59.66 59.09% DNAH6 R TAGAGAGCTTTGCCGCTTTGGCG 23 4797 4775 60.06 56.52% Exon junction 4790/4791 (reverse primer) on template NM_001370.1 DNAH7 NM_018897.2 DNAH7 F TGCTGCATGAGCGGGCGATTA 21 9973 9993 59.25 57.14% DNAH7 R AGGAAGCCATGTACAAAGGTTGGCA 25 10073 10049 58.85 48.00% Exon junction 9989/9990 (forward primer) on template NM_018897.2 DNAI1 NM_012144.2 DNAI1 F AACAGATGTGCCTGCAGCTGGG 22 673 694 59.67 59.09 DNAI1 R TCTCGATCCCGGACAGGGTTGT 22 822 801 59.07 59.09 Exon junction 814/815 (reverse primer) on template NM_012144.2 RPGRIP1L NM_015272.2 RPGRIP1L F TCCCAAGGTTTCACAAGAAGGCAGT 25 3118 3142 58.5 48.00% RPGRIP1L R TGCCAAGCTTTGTTCTGCAAGCTGA 25 3238 3214 60.06 48.00% Exon junction 3124/3125 (forward primer) on template NM_015272.2 Supplemental Table S2. Transcripts that differentiate IPF/UIP from controls at 5%FDR Fold- p-value Change Transcript Gene p-value p-value p-value (IPF/UIP (IPF/UIP Cluster ID RefSeq Symbol gene_assignment (Age) (Gender) (Smoking) vs. C) vs. C) NM_001178008 // CBS // cystathionine-beta- 8070632 NM_001178008 CBS synthase // 21q22.3 // 875 /// NM_0000 0.456642 0.314761 0.418564 4.83E-36 -2.23 NM_003013 // SFRP2 // secreted frizzled- 8103254 NM_003013
    [Show full text]