Supporting Information

Wiener et al. 10.1073/pnas.1406444111 SI Materials and Methods (Tocris; 20 μM), PD173074 (Tocris; 10 μM), PD98059 (Sigma; Intestinal Crypt Cultures. The National Board for Animal Experi- 20 μM), U0126 (Tocris; 20 μM), picropodophyllotoxin (Tocris; ments at the Provincial State Office of Southern Finland approved 5 μM), NVP-AEW541 (Cayman Chemical; 10 μM), Z-VAD-FMK all mouse experiments. Intestinal crypts from Apcflox/flox; villin- (R&D Systems; 50 μM), and ABT-263 and ABT-737 (a kind gift CreERT and Apcflox/flox; Lgr5-EGFP-IRES-CreERT mice (1) were from Dr. Denis Kainov, Institute for Molecular Medicine Finland, isolated according to previously published methods (2, 3). The Helsinki, Finland). The percentage of dead organoids was counted – crypts were embedded in growth factor-reduced Matrigel (BD at 40 50 h after the start of the treatments. Because the long-term μ incubation with NVP-AEW541 and picropodophyllotoxin resulted in Biosciences; 50 L/well in 24-well plates) and cultured in DMEM/ β F12 medium (Gibco) containing N2 supplement, B27 supplement organoid death, they were removed together with TGF- . (Gibco), 1 μM N-acetyl cysteine (Sigma), 10 mM Hepes, gluta- Establishment and Analysis of Human Colorectal Organoid Cultures. mine, penicillin/streptomycin, 100 ng/mL noggin, 50 ng/mL EGF The Ethics Committee, Department of Surgery, Helsinki University (PeproTech), and 500 ng/mL mouse R-Spondin1 (R&D Systems). – Hospital approved all experiments involving patient samples and The crypts were subcultured into new Matrigel every 5 7d.To informed consent was obtained from the patients. Tissue biopsies β activate the endogenous -catenin/TCF pathway in the organoids, isolated from patients were processed according to the previously the cultures were treated with 300 nM 4-hydroxy-tamoxifen (4- min/+ published method (2). The isolated organoids were embedded into OH-Tam) for 48 h. Intestinal or colonic crypts from Apc , Matrigel and cultured in DMEM/F12 medium containing N2 sup- 1638N/+ 1638N/+ V12G Apc (ApcN) and Apc ; villin-KRas (ApcN-KRas) plement, B27 supplement, 1 μM N-acetyl cysteine, 10 mM Hepes, mice (4) were initially cultured without R-Spondin1. Under these glutamine, penicillin/streptomycin, gentamycin, fungizone, and conditions, only organoids with endogenously activated β-catenin/ metronidazole (Sigma). The late-stage CRC patient samples used TCF pathway survived beyond 5 d. in the BH3-mimetics studies were as follows:

Sample name Pt1 Pt2 Pt3 Pt4

Sample type Carcinoma Carcinoma Carcinoma Carcinoma Sex Male Female Male Male Age 79 59 78 85 Other diseases Hypertension, No Prostate carcinoma, Prostate hyperplasia diabetes mellitus type 2 diabetes mellitus type 2 Metastasis Lymph node, liver No Liver Liver

Detection of the Cre-Induced Recombination in the Apcflox Allele. To To characterize the human organoids, we analyzed some of the detect the recombination in the Apcflox allele, the following primers major other signaling pathways known to be often mutated in human were used in the PCR: GTTCTGTATCATGGAAAGATAGGT- CRC by sequencing the mutation hot spots in the PIK3CA, BRAF, GGTC (common primer), CACTCAAAACGCTTTTGAGGG- and KRAS genes (6, 7). Because loss of p53 did not affect TGF- TTGATTC (nonrecombined, 314 bp for the Apcflox allele and 226 bp β–induced apoptosis in the recently published mouse CKIα deletion for the WT allele), and GAGTACGGGGTCTCTGTCTCAGTG- model of CRC where CKIα functions as a tumor suppressor when AA (recombined allele, 250 bp). p53 is inactivated (8), we did not sequence tp53 in the human samples. Total RNA from crypt cultures was isolated with the NucleoSpin Lentivirus Production and Transduction of Organoids. Mouse shBim RNA II Kit (Macherey-Nagel) and 0.5–1 μg of RNA was re- − (TRCN0000009692 and TRCN0000009694) and scrambled control verse transcribed with M-MLV reverse transcriptase RNaseH (Scr) lentiviral vectors were produced from the TRC1 library (Finnzymes) in the presence of dNTP, oligo-dT primer, 5% (Sigma). Lentivirus-containing supernatant of 293FT cells was (vol/vol) trehalose, 1 M sorbitol, and 2 u/μL RiboLock RNase concentrated, and the organoid transduction was carried out inhibitor (Fermentas). The cDNA was then applied to PCR according to previously published methods with some modifica- using Phire polymerase (Finnzymes) to amplify fragments of the tions (5). Briefly, mouse organoids were trypsinized for 5 min to obtain human KRAS, BRAF, and PIK3CA cDNAs with the primers small cell clusters. Organoids were resuspended in transduction mix presented below: containing concentrated lentivirus, 10 μM Y-27632 dihydrochloride (Sigma) and polybrene (Sigma; 8 μg/mL) in a final volume of 250 μL, Gene/position Primers centrifuged at 250 × g for 45 min, and incubated for 6–12 h (5). Cells ′ ′ transduced with scrambled control or shBim lentivirus were se- hKRAS 5 -CACAACCGGTCCAGGTGCGGGAGAGAGGC-3 and ′ ′ lected with 10 μg/mL puromycin (Sigma) for 3 d. 5 -GGTAAAAGCTAACAGTCTGCATGGAGC-3 BRAF codons 462–470 5′-TCGTGGTGATGGAGGATCAACC-3′ and ′ ′ Treatment of Organoid Cultures. Two to 3 d after subculturing the 5 -GGATCCAGACAACTGTTCAAACTGATG-3 organoids, human Activin A, Activin B (Peprotech), or TGF-β1(R&D BRAF codons 595–602 5′-GTCAATCATCCACAGAGACCTCAAG-3′ and ′ ′ Systems) was added at the indicated concentrations and time periods. 5 -GCTACTCTCCTGAACTCTCTCACTCA-3 ′ ′ Where indicated, the various signal transduction inhibitors were PIK3CA exon 9 5 -GAGGAACACTGTCCATTGGCATG-3 and ′ ′ added 1 h before TGF-β1. The following inhibitors and compounds 5 -CTCCTGCTCAGTGATTTCAGAGAG-3 ′ ′ were used: SB431542 (Tocris; 10 μM), PHA665752 (Tocris; 10 μM), PIK3CA exon 20 5 -ATGCAGCCATTGACCTGTTTACAC-3 and 5′-GTGAGCTTTCATTTTCTCAGTTATC-3′ SB202190 monohydrochloride hydrate (Sigma; 20 μM), SB203580

Wiener et al. www.pnas.org/cgi/content/short/1406444111 1of10 The bands were separated in agarose gels and sequenced with Duo confocal microscope. The following primary antibodies were an ABI 3130xl Genetic Analyzer. The details of the patient used: rabbit anti–P-p42/p44 (Cell Signaling Technology) and samples used in our TGF-β sensitivity studies are as follows: rabbit anti-active caspase-3 (R&D Systems).

Sample name Pt5 Pt6 Pt7 Pt8

Sample type Adenoma (rectum) Adenoma (cecum) Adenoma (rectum) Carcinoma (cecum) Sex Female Male Female Male Age 71 61 45 67 Other diseases No Diabetes mellitus type 2, liver cirrhosis No No Medication before No No No No the operation KRas WT WT Q61K G12A BRaf WT WT WT WT (codons 462–470 and 595–601) PIK3CA WT WT WT WT (exons 9 and exon 20)

Gel Filtration Chromatography. Intestinal crypts from Apcflox/flox; The proportion of Lgr5-positive organoids was counted in an villin-CreERT mice were treated with 3 ng/mL TGF-β for 16 h and Axioplan microscope (Zeiss) at 10× magnification. All organoids lysed in buffer containing 2% (vol/vol) CHAPS, 300 mM NaCl, showing signal in the outer epithelial layer at this magnification and 0.2 mM Hepes (pH 7.5). Lysates were cleared by centrifu- were scored as positive. gation, and 200 μg of protein was loaded onto Superdex 75 10/ 300 GL column (GE Healthcare Life Sciences) in the Äkta Ex- RNA Analysis by Reverse Transcription–Quantitative PCR. Total RNA plorer FPLC Chromatography system. The column was equilibrated from organoid cultures was isolated with the NucleoSpin RNA II Kit with 2% CHAPS lysis buffer, and fractions of 1 mL were collected. (Macherey-Nagel), DNase treatment was performed on the column The proteins were precipitated by trichloroacetic acid and further during the purification, and 0.5–1 μg of RNA was reverse transcribed analyzed by Western blotting. with the DyNAmo cDNA Synthesis Kit using random hexamer primers (Finnzymes). Quantitative PCRs (qPCRs) using the SYBR Immunostaining and Tissue Processing. The mouse intestinal tube Green method were carried out with the DyNAmo HS SYBR Green was opened, washed extensively, and attached to a filter paper. qPCR Kit (Finnzymes) on an ABI 7500 Fast real-time PCR in- Both mouse and human tissue samples were fixed with 4% PFA strument according to the manufacturer’s instructions. Real-time overnight, embedded into paraffin and 4-μm sections were cut. PCR results were calculated according to the following protocol: −Δ For histological blocks of the organoids, the Matrigel was re- Relative expression level = 2 Ct, where ΔCt = Ct(gene of in- moved after centrifugation at 250 × g for 5 min and the organoids terest) – Ct(housekeeping gene). The primers are listed below: were washed once with PBS, fixed in 4% PFA for 30 min, and embedded into 3% low-melting point agarose (Finnzymes). The Primer Sequence agarose blocks containing the organoids were further fixed with 4% PFA for 4–5 h and then embedded into paraffin. mTnfrsf19_fw ATTCTCTTCCTACTCCACCTG After deparaffinization, the sections were treated with high mTnfrsf19_rev CATAGCCGAAGCCACATTC pH target retrieving solution (Dako) in a microwave oven at mBclx_fw GTTGGATGGCCACCTATCTG 700 W for 5 min and then at 400 W for 10 min. The sections mBclx_rev AAGAGTGAGCCCAGCAGAAC acaactttggcattgtggaa were blocked with TNB buffer, and the primary antibodies mGapdh_fw gatgcagggatgatgttctg were applied overnight. The sections were then washed with mGapdh_rev mAxin2-fw CTCCCCACCTTGAATGAAGA TNT buffer (2 M Tris, pH 7.4, 3 M sodium chloride, 0.05% mAxin2-rev ACTGGGTCGCTTCTCTTGAA Tween20), incubated with secondary antibodies for 2 h at room mMyc-fw TCCTGTACCTCGTCCGATTC temperature (RT), and mounted in Vectashield with DAPI (Vector mMyc-rev GGTTTGCCTCTTCTCCACAG Laboratories). mLgr5_fw CCTGTCCAGGCTTTCAGAAG The following antibodies were used: goat anti-human Prox1, mLgr5_rev CTGTGGAGTCCATCAAAGCA goat anti-EphB2, and rabbit anti-cleaved caspase-3 (R&D Sys- mOlfm4_fw GGACCTGCCAGTGTTCTGTT tems). For signal detection, Alexa Fluor 488- and 594-conjugated mOlfm4_rev GACCTCTACTCGGACCGTCA secondary antibodies (Molecular Probes) were used. The slides mBax_fw CCAAGAAGCTGAGCGAGTGT were imaged in a Zeiss Axioplan microscope. mBax_rev CACGTCAGCAATCATCCTCTG mBcl2_fw TGGCATCTTCTCCTTCCAGC Whole-Mount Staining. Organoids were cultured in four-well mBcl2_rev ACGTCCTGGCAGCCATGTC chamber slides (BD Biosciences), fixed in 4% PFA for 30 min, mBad_fw CCAAATGGGAACCCCAAAGC washed twice with PBS, and blocked and permeabilized in mBad_rev GGAACATACTCTGGGCTGCT blocking buffer [5% (vol/vol) nonimmune donkey serum, mBim_fw ATCTCAGTGCAATGGCTTCCA 0.2 g/100 mL BSA, 0.3% Triton X-100 in PBS] for 30 min. Primary mBim_rev GCTCCTGTGCAATCCGTATC antibodies were applied at 4 °C overnight in blocking buffer. mPuma_fw GCACTTAGAGTCGCCCGTG After extensive washing in PBS containing 0.3% Triton X-100 mPuma_rev CTTGTCTCCGCCGCTCGTA and overnight incubation with the conjugated secondary antibody mBid_fw GGACTCTGAGGTCAGCAACG (Alexa Fluor 594; Molecular Probes), the organoids were moun- mBid_rev CCTCCCAGTAAGCTTGCACA ted in medium containing DAPI and imaged with a Zeiss LSM 5

Wiener et al. www.pnas.org/cgi/content/short/1406444111 2of10 Cont. protein concentrations were determined using a Bio-Rad protein assay. Thirty to 40 μg of total protein/lane was loaded to SDS- Primer Sequence polyacrylamide gels (Bio-Rad Laboratories). Proteins were mMcl1_fw CTTGAACCTGTACTGCGGCG transferred to nitrocellulose membranes at 300 mA constant mMcl1_rev AGGTCGTCCTCTTCCTCCTC current at 4 °C for 1 h. Membranes were blocked in TBS, 0.1% mBcl2l2 (Bclw)_fw GGGACAAGTGCAGGATTGGA Tween 20 (TBS-T) containing 3 g/100 mL nonfat dry milk for mBcl2l2 (Bclw)_rev AGCACTGTCCTCACTGATGC 2 h, and then incubated for 1 h with primary antibodies followed hBCL2_fw GGATAACGGAGGCTGGGATGC by biotinylated anti-rabbit or anti-mouse immunoglobulins (Dako) hBCL2_rev AACAGCCTGCAGCTTTGTTTC and horseradish peroxidase-conjugated streptavidin (Dako) for hBCL2L2_fw GATGGTGGCCTACCTGGAGA 1 h. Proteins were visualized by the SuperSignal West Femto hBCL2L2_rev CTGTGAACTCCGCCCAGC Maximum Sensitivity Substrate (Thermo Scientific). The anti- hBCLX_fw GCCTAAGGCGGATTTGAATCTCT bodies used recognize P-Smad2 (Upstate), Smad2/3 (BD Trans- hBCLX_rev AAAGTCAACCACCAGCTCCC duction Laboratories), P-p38, p38, P-Erk1/2, Erk1/2, Bim, cleaved hMCL1_fw AAGAGGCTGGGATGGGTTTG caspase 3 (Asp-175), caspase-3 (Cell Signaling Technology), and hMCL1_rev GCTAGGTTGCTAGGGTGCAA HSC70 (Santa Cruz Biotechnology). For HSC70, the HRP- conjugated anti-rabbit antibody (Dako) was used as a secondary antibody.Separategelswererunatthesametimetodetect Microarray Experiments. The quality of RNA was determined in a Bioanalyzer (Agilent Technologies) and further analyzed phosphorylated and total protein levels in the same samples. on genome-wide Illumina Mouse WG-6 v2 Expression Bead- Production and Use of AAV9 Vector Encoding Active TGF-β1. To Chips (Illumina). Illumina’s GenomeStudio software was used produce the active mouse TGF-β1(TGFACT) (12), the C223S and for initial data analysis and quality control and the detailed data C225S mutations in the TGF-β1 cDNA were made by two-step analyses were performed with the Chipster software (chipster.csc.fi). ′ The data were normalized with quantile normalization. Statisti- PCR. The 5 fragment was amplified using primers CACACAG- cally significant differences in individual genes between the groups CTAGCTTAGGCCACCATGCCGCCCTCGGGGCT and GGA- – GTTTGTTATCTTTGCTGTCGCTAGAAGAGTGAGCGCTG- were tested using Empirical Bayes statistics and the Benjamini ′ Hochberg false-discovery rate (FDR). AATC. The 3 fragment was amplified using primers GATTCA- GCGCTCACTCTTCTAGCGACAGCAAAGATAACAAAC- Ingenuity Pathway Analysis and Gene Set Enrichment Analysis. Dif- TCC and CACAACGCGTTCAGCTGCACTTGCAGGAGCGCA. ferentially regulated genes (P < 0.01) were imported from Chipster The two fragments were then combined in a second PCR, cut with to Ingenuity Pathway Analysis (Ingenuity Systems), and gene NheI and MluI, and cloned into the pSubCAG-WPRE vector, networks with expression data were created to visualize the suitable for AAV production. The AAV9 viral vector was pro- interactions between the genes. The complete gene expression ducedwithathree-plasmidtransfection protocol (13), and the dataset was loaded to the Gene Set Enrichment Analysis soft- AAV9 particles were purified according to Zolotukhin et al. ware (www.broadinstitute.org/gsea) (9, 10), and analysis was (14). The AAV9-containing layer was used for determination carried out with default parameters except that the “exclude of the titer by qPCR using the primers TGAGTTTGGACAAA- smaller sets” was set to 30. We used a modified list of the c2.all. CCACAAC and TTGTTGTTAACTTGTTTATTGCAGC. v3.0.symbols gene set (www.broadinstitute.org/gsea/msigdb) with The Apc deletion in Apcflox/flox; Lgr5-EGFP-IRES-CreERT mice the addition of β-catenin/TCF (11) targets. FDR q value < 0.1 was (1) was induced by a single tamoxifen (Sigma) i.p. injection (2 mg regarded as significant. dissolved in 200 μL of sunflower oil) at the age of 8–9 wk. AAV9- TGFACT and control AAV9 encoding the HSA (AAV9-HSA) × Flow Cytometry. Organoids were centrifuged at 250 g for (13) were i.p. injected (2 × 1011 virus particles per mouse) on day 5 min, the Matrigel was removed, and they were disrupted 21 after tamoxifen treatment. with glass pipettes and trypsinized for 10 min. The cells were washed with 1 g/100 mL BSA and treated with benzonase Testing the Expression and Activity of Viral Vector-Encoded TGFACT. (Millipore; 120 U/mL) for 20 min. After fixation with 4% To test the functionality of the virus preparations, 4 × 106 293T PFA, cells were permeabilized with 1 g/100 mL BSA plus cells were plated in 6 mL of DMEM (DMEM supplemented with 0.1% Triton X-100 in PBS and stained for active caspase-3 2% FCS and penicillin/streptomycin) and transduced with 1 × 1011 (R&D Systems). Samples were measured with an Accuri C6 AAV9-TGFACT or AAV9-HSA virus particles on day 1. After instrument (BD). 48 h, the supernatant was collected, and 1.5 mL was used for immunoprecipitation of TGFACT with an anti–TGF-β1 antibody Protein Arrays. Organoids were centrifuged at 250 × g for 3 min, the (R&D Systems; MAB240). The signal was detected by a chicken Matrigel was removed, and the organoids were washed with PBS. anti–TGF-β antibody (R&D Systems; AF101NA). To determine Samples were then lysed in lysis buffer (R&D Systems), and the the bioactivity of the virus-encoded TGFACT, we used the PAI1 protein concentration was measured with the Pierce BCA Protein β– Assay Kit (Thermo Scientific). A total of 150 μg protein was loaded bioassay (15), using a TGF- responsive mink lung epithelial cell subclone (MLEC). This subclone had been stably transduced with onto apoptosis or phospho-kinase arrays, and further steps were β– carried out according to the manufacturer’sprotocol(R&D the TGF- responsive plasminogen activator inhibitor-1 (PAI-1) Systems). gene promoter fused to the firefly luciferase reporter. For the assay, 2 × 104 MLEC cells per well were plated in 96-well plates in Western Blotting. Organoid cultures in Matrigel were centri- DMEM. After 5 h, the medium was replaced by 100 μLofthe fuged and lysed in lysis buffer containing 20 mM Tris·HCl (pH supernatants derived from AAV-transduced 293T cells or by 7.4), 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 5 mM NaF, positive controls containing 0–3,000 pg/mL TGF-β1. The lucifer- 1 mM orthovanadate, 10% (vol/vol) glycerol, 1% Triton X-100, ase test was then carried out after 16 h (Promega). Whereas su- 0.5% Nonidet P-40, 1 mM phenylmethylsulfonyl fluoride, pernatants from AAV9-HSA-transduced 293T cells contained 2 μg/mL leupeptin, and 10 μg/mL aprotinin. The samples were <10 pg/mL active TGF-β, we detected >3,000 pg/mL active cleared with centrifugation at 13,500 × g at 4 °C for 10 min, and TGF-β in the AAV9-TGFACT-transduced samples.

Wiener et al. www.pnas.org/cgi/content/short/1406444111 3of10 1. Barker N, et al. (2007) Identification of stem cells in small intestine and colon by 9. Subramanian A, et al. (2005) Gene set enrichment analysis: A knowledge-based marker gene Lgr5. Nature 449(7165):1003–1007. approach for interpreting genome-wide expression profiles. Proc Natl Acad Sci USA 2. Sato T, et al. (2011) Long-term expansion of epithelial organoids from human colon, 102(43):15545–15550. adenoma, adenocarcinoma, and Barrett’s epithelium. Gastroenterology 141(5): 10. Mootha VK, et al. (2003) PGC-1alpha-responsive genes involved in oxidative 1762–1772. phosphorylation are coordinately downregulated in human diabetes. Nat Genet 3. Sato T, et al. (2009) Single Lgr5 stem cells build crypt-villus structures in vitro without 34(3):267–273. a mesenchymal niche. Nature 459(7244):262–265. 11. Van der Flier LG, et al. (2007) The intestinal Wnt/TCF signature. Gastroenterology 4. Janssen KP, et al. (2006) APC and oncogenic KRAS are synergistic in enhancing Wnt 132(2):628–632. signaling in intestinal tumor formation and progression. Gastroenterology 131(4): 12. Brunner AM, Marquardt H, Malacko AR, Lioubin MN, Purchio AF (1989) Site-directed 1096–1109. mutagenesis of cysteine residues in the pro region of the transforming growth factor 5. Koo BK, et al. (2012) Controlled gene expression in primary Lgr5 organoid cultures. beta 1 precursor. Expression and characterization of mutant proteins. J Biol Chem Nat Methods 9(1):81–83. 264(23):13660–13664. 6. Phillips B, Kalady M, Kim R (2010) BRAF testing in advanced colorectal cancer: Is it 13. Anisimov A, et al. (2009) Activated forms of VEGF-C and VEGF-D provide improved ready for prime time? Clin Adv Hematol Oncol 8(6):437–444. vascular function in skeletal muscle. Circ Res 104(11):1302–1312. 7. Baldus SE, et al. (2010) Prevalence and heterogeneity of KRAS, BRAF, and PIK3CA 14. Zolotukhin S, et al. (1999) Recombinant adeno-associated virus purification using mutations in primary colorectal adenocarcinomas and their corresponding metastases. Clin novel methods improves infectious titer and yield. Gene Ther 6(6):973–985. Cancer Res 16(3):790–799. 15. Abe M, et al. (1994) An assay for transforming growth factor-beta using cells 8. Elyada E, et al. (2011) CKIα ablation highlights a critical role for p53 in invasiveness transfected with a plasminogen activator inhibitor-1 promoter-luciferase construct. control. Nature 470(7334):409–413. Anal Biochem 216(2):276–284.

Fig. S1. Morphology of intestinal epithelial crypt/organoid cultures. (A) ApcV (WT) crypts. (B) ApcVΔ/Δ organoids 15 d after adding 4-OH-Tam ex vivo to delete the Apc gene in the intestinal epithelial cells. (C) Organoids from Apcmin/+ mice selected without R-Spondin1 for 15 d. (D) ApcV (WT) organoids cultured in the absence of R-Spondin1 for 5 d. Note that all of the organoids are disintegrated (arrowheads). (E) PCR analysis of ApcV organoids (15 d after a 48-h treatment with or without 4-OH-Tam). Note that the primers specific for the recombination in the Apcflox allele give signal only from the 4-OH-Tam-treated cultures. + Samples from Apcflox/ mice were used as a control. (F) RT-qPCR for selected Wnt-target genes from ApcV (WT) and ApcVΔ/Δ organoids (black and gray columns, respectively). (G and H) Immunostaining for the β-catenin/TCF (Wnt)-target EphB2 in sections from ApcV and ApcVΔ/Δ organoid cultures. Note that, in the ApcV sample, only the crypt regions are EphB2high (arrowheads). (Scale bar: 100 μm.)

Wiener et al. www.pnas.org/cgi/content/short/1406444111 4of10 Fig. S2. Analysis of the proapoptotic effects of activins and TGF-β.(A) The effect of activin A and activin B (48 h) on the death of ApcVΔ/Δ organoids. (B and C) Effect of TGF-β on the levels of pro/antiapoptotic gene expression in ApcVΔ/Δ organoids. (B) Apoptosis protein array (16 h) and (C) RT-qPCR (8 and 16 h).

Wiener et al. www.pnas.org/cgi/content/short/1406444111 5of10 Fig. S3. TGF-β down-regulation of the Wnt, but not Notch target genes in ApcVΔ/Δ organoids. (A) Gene Set Enrichment Analysis (GSEA) showing the negative enrichment (blue) of β-catenin/TCF (Wnt)-targets in the TGF-β–treated samples. The Wnt-regulated gene set is based on previous publications (SI Materials and Methods). (B) Ingenuity Pathway Analysis of differentially regulated genes highlights a gene network containing intestinal stem cell-specific genes (arrows; Tnfrsf19, Olfm4) that are down-regulated by TGF-β (green color).

Wiener et al. www.pnas.org/cgi/content/short/1406444111 6of10 + Fig. S4. TGF-β induces Bim expression in the Lgr5 adenoma stem cells in organoids. (A) Phase-contrast images of control and 4-OH-Tam–treated ApcL organoid + cultures 5 d after the removal of growth factors. Note the surviving organoids only in the 4-OH-Tam–treated sample (arrowheads). (B) The percentage of Lgr5 + ApcLΔ/Δ organoids 7 d after the addition of 4-OH-Tam. (C) Optical section from an ApcLΔ/Δ organoid (confocal microscopy). Note that most cells are EGFP .(D)The effect of TGF-β on the Bad, Bax, and Bim expression level in ApcLΔ/Δ organoids 7 d after the addition of 4-OH-Tam (RT-qPCR). [Scale bars: 100 μm(A), 50 μm(C).]

Wiener et al. www.pnas.org/cgi/content/short/1406444111 7of10 Fig. S5. Wild-type crypts are more resistant to TGF-β–induced death than Apc-mutant organoids. (A) Comparison of TGF-β–induced death in ApcV (WT) and ApcVΔ/Δ organoids cultured in complete medium. (B) Morphology of untreated and TGF-β–treated (3 h) ApcV organoids analyzed after 3 d (phase-contrast microscopy). (Scale bar: 100 μm.) (C) Bim protein levels in ApcV and ApcVΔ/Δ organoids at the indicated time points after the addition of TGF-β.(D and E)The + effect of BH3 mimetics (1 μM for 48 h) on the level of procaspase-3 and active caspase-3 (D, immunoblotting) and on the proportion of active–caspase-3 apoptotic cells (E, flow cytometry). (F and G) The effect of the IGF-I receptor inhibitor (F) NVP-AEW (10 μM) and (G) picropodophyllotoxin (5 μM) on the TGF- β–induced (40 min) death in ApcV (WT) and ApcVΔ/Δ organoids, analyzed at 48 h. The inhibitors were added 30 min before TGF-β and removed with TGF-β.

Wiener et al. www.pnas.org/cgi/content/short/1406444111 8of10 Fig. S6. The KRas oncogene protects against the TGF-β–induced cell death via P-Erk1/2–mediated Bim down-regulation. (A) The level of proapoptotic and antiapoptotic gene expression in ApcN and ApcN-KRas organoids in the absence or presence of TGF-β (3 ng/mL for 8 h, RT-qPCR). (B) Akt, P-Akt (T308), Smad2/3, P-Smad2, and Smad7 levels in ApcN and ApcN-KRas organoids at 16 h after the addition of TGF-β.(C) The effect of the PI3K-inhibitor LY294002 (10 μM) or wortmannin (5 μM) on the apoptosis in ApcN and ApcN-KRas organoids in the presence or absence of TGF-β. The inhibitors were added 1 h before the TGF-β, and the results were analyzed at 48 h. (D) The effect of the MEK1/2 inhibitor U0126 (20 μM) on the TGF-β–induced (1 h) apoptosis in the ApcN and ApcN-KRas organoid cultures, analyzed at 48 h.

Wiener et al. www.pnas.org/cgi/content/short/1406444111 9of10 Table S1. Differentially expressed genes between control and TGF-β–treated ApcVΔ/Δ organoids

Gene symbol Description Adjusted P value Fold change (log2)

Lama3 Laminin, α3 1.20E-05 3.7375 Tnfrsf11b Tumor necrosis factor receptor superfamily, member 11b (osteoprotegerin) 1.10E-05 2.9875 Rhob Ras homolog gene family, member B 4.00E-06 2.985 P2rx2 Purinergic receptor P2X, ligand-gated ion channel, 2 6.10E-05 2.925 Prkcdbp Protein kinase C, δ binding protein 6.00E-05 2.8275 Pyy Peptide YY 3.00E-06 2.7575 Stxbp1 Syntaxin binding protein 1 3.00E-06 2.74 Pdlim7 PDZ and LIM domain 7 1.20E-05 2.4675 Onecut2 One cut domain, family member 2 0.000255 2.3775 Ctse Cathepsin E 1.20E-05 2.375 Rab11fip5 RAB11 family interacting protein 5 (class I) 0.000161 2.3575 Sfn Stratifin 1.30E-05 2.325 Alox12 Arachidonate 12-lipoxygenase 0.000108 2.31 Pdlim4 PDZ and LIM domain 4 1.10E-05 2.3025 Blvrb Biliverdin reductase B [flavin reductase (NADPH)] 7.00E-06 2.28 Gch1 GTP cyclohydrolase 1 1.10E-05 2.26 Dok2 Docking protein 2 0.00015 2.2475 Itgb6 Integrin β6 4.50E-05 2.2375 Igfbp7 Insulin-like growth factor binding protein 7 7.20E-05 2.23 Pdgfb Platelet-derived growth factor, B polypeptide 7.00E-06 2.215 Rab11fip5 RAB11 family interacting protein 5 (class I) 0.000101 2.21 Cldn4 Claudin 4 2.50E-05 2.2 Onecut2 One cut domain, family member 2 4.90E-05 2.14 Igfbp5 Insulin-like growth factor binding protein 5 3.90E-05 2.1325 Lamb3 Laminin, β3 2.80E-05 2.035 Lamc2 Laminin, γ2 0.000187 2.02 Clca6 Chloride channel calcium activated 6 3.60E-05 2.0125 Anxa8 Annexin A8 0.00015 2 Sphk1 Sphingosine kinase 1 2.80E-05 1.9075 Tspo Translocator protein 1.80E-05 1.8775 Hopx HOP homeobox 0.000621 −1.1125 Ccnb1 Cyclin B1 0.000825 −1.115 Cdo1 Cysteine dioxygenase 1, cytosolic 0.000593 −1.1175 Ung Uracil DNA glycosylase 0.00011 −1.135 Lbr Lamin B receptor 0.000605 −1.1375 Gm2179 Predicted gene 2179 0.000901 −1.1375 Soat1 Sterol O-acyltransferase 1 0.000553 −1.1475 Soat1 Sterol O-acyltransferase 1 0.000393 −1.1625 Nusap1 Nucleolar and spindle associated protein 1 0.000356 −1.22 Hist1h2af Histone cluster 1, H2af 0.000827 −1.2275 Hist1h2an Histone cluster 1, H2an 0.000335 −1.2425 Lrig1 Leucine-rich repeats and Ig-like domains 1 0.000161 −1.2475 Uhrf1 Ubiquitin-like, containing PHD and RING finger domains, 1 0.000356 −1.2475 Hist2h2ab Histone cluster 2, H2ab 0.000914 −1.25 Hist1h2ah Histone cluster 1, H2ah 0.000526 −1.2625 Cdca3 Cell division cycle associated 3 0.000765 −1.2625 Gsta3 GST, α3 0.000294 −1.3125 Hist1h2ak Histone cluster 1, H2ak 0.000349 −1.3125 Cdt1 Chromatin licensing and DNA replication factor 1 0.000296 −1.33 Cdc20 Cell division cycle 20 homolog (Saccharomyces cerevisiae) 0.000454 −1.3325 Mcm5 Minichromosome maintenance deficient 5, cell division cycle 46 (S. cerevisiae) 0.000273 −1.385 Shmt1 Serine hydroxymethyltransferase 1 (soluble) 0.000194 −1.4 Nup210 Nucleoporin 210 0.000245 −1.4125 Hist1h2ah Histone cluster 1, H2ah 0.000273 −1.4325 Cldn15 Claudin 15 0.000121 −1.6625 Aqp1 Aquaporin 1 0.000223 −1.82 Cldn15 Claudin 15 1.90E-05 −1.915 Reg3b Regenerating islet-derived 3β 0.000187 −2.0475 Aqp1 Aquaporin 1 4.90E-05 −2.3425 1190002H23Rik RIKEN cDNA 1190002H23 gene 8.20E-05 −2.525

TGF-β (3 ng/mL) was added for 18 h. The 30 most up-regulated and 30 most down-regulated (P < 0.001) genes are listed.

Wiener et al. www.pnas.org/cgi/content/short/1406444111 10 of 10