Kinetic Analysis and Modeling of Firefly Luciferase as a Quantitative Reporter Gene in Live Mammalian Cells Jolene M. Ignowski, David V. Schaffer Department of Chemical Engineering and The Helen Wills Neuroscience Institute, MC 1462, University of California, Berkeley, Berkeley, California; 94720-1462; telephone: 510-643-5963; fax: 510-642-4778; e-mail: [email protected] Received 2 September 2003; accepted 6 January 2004 Published online 10 May 2004 in Wiley InterScience (www.interscience.wiley.com). DOI: 10.1002/bit.20059 Abstract: Firefly luciferase has proven to be a highly fluorescent protein has the advantages that its intrinsic fluo- sensitive and quantitative reporter gene for studying gene rescence is readily visualized, and that it is nonenzymatic delivery and regulation, and its recent use in live cells and and thus does not require a substrate; however, considerable organisms promises to further expand its utility. However, c the intracellular behavior and properties of the enzyme are concentrations of this fluor ( 1 AM) must be present inside not well characterized. Specifically, information on the the cell to detect a signal over the background noise (Cubitt intracellular kinetics and stability of luciferase activity is et al., 1995; Niswender et al., 1995). Furthermore, it is highly necessary for real-time luminescence counts from live cells stable intracellularly, with a half-life of over 24 hours. While to be quantitatively meaningful. Here, we report a dynamic this stability enhances its sensitivity by yielding higher con- analysis of luciferase activity in the context of living mammalian cells. We have determined the relative light centrations, is poses a significant disadvantage for dynamic units measured in living cells to be proportional to that found studies of short time scale gene expression events, and GFP in cell lysate. We have also calculated the Km of luciferase in variants with lower half-lives have a correspondingly lower living cells to be c 1mM, a value much higher than the sensitivity (Li et al., 1998). 10 AM found for pure enzyme in vitro. In addition, a 2-hour Firefly luciferase catalyzes the reaction of D-luciferin half-life of luciferase activity in live cells was measured in 2+ real time. Finally, we have modeled luciferase activity in live with O2 to produce light in the presence of Mg and ATP, cells for the purposes of understanding and translating the as shown below: luciferase signal into a more effective metric of gene 2þ expression and cell behavior. B 2004 Wiley Periodicals, Inc. Luciferase;Mg Luciferin þ O2 þ ATP ! Oxyluciferin Keywords: firefly; luciferase; reporter gene; enzyme; kinetic; model þ hv þ AMP þ PPi þ CO2 INTRODUCTION Luciferases have the advantage of a very low background noise, thus decreasing the number of molecules needed for a Reporter genes, genes that encode proteins whose presence detectable signal. This attribute is particularly useful in is readily detected and quantified, have significantly studies of promoters with low or transient activity. The advanced a number of efforts in biology and biotechnology, relatively short half-life reported for luciferase can also serve including studies of gene regulation, gene delivery, and sig- a practical purpose when the enzyme is utilized to study the nal transduction (Chalfie et al., 1994; Gould and Subramani, dynamics of gene expression (Thompson et al., 1991). 1988; Naylor, 1999). The reporter genes used initially, such Because of these advantageous properties, luciferases have as chloramphenicol acetyltransferase and h-galactosidase, been employed in a wide variety of studies including gene have gradually yielded to more sensitive, nonradioactive delivery (Taniyama et al., 2002), growth factor regulation of reporters based on fluorescence and luminescence. These gene expression (Harrison et al., 1999), and gene silencing include fluorescent proteins, such as the green fluorescent (Paddison et al., 2002). Real-time imaging of luciferase protein (GFP) from the jellyfish Aequorea victoria, and lu- expression in cell culture and in live rodents is also de- ciferases, including firefly luciferase (Fluc) from Photinus veloping into a standard technique for noninvasive local- pyralis (Tsien, 1998; Wilson and Hastings, 1998). Green ization and quantification of gene expression (Greer III and Szalay, 2002; Nunez et al., 1998; Ray et al., 2002; Rutter et al., 1995; White et al., 1995; Wu et al., 2001). Further- Correspondence to: D. Schaffer more, such real-time imaging may be well suited when the Contract grant sponsors: ONR Young Investigator Award; American Parkinson’s Disease Association Pilot Grant; University of California quantification of gene expression in single live cells may be Dissertation-Year Fellowship necessary (White et al., 1995). These include phenomena B 2004 Wiley Periodicals, Inc. where there is significant variability within a cell popula- 100 units/mL penicillin and 0.1 mg/mL streptomycin. Cells tion, such as for stochastic events where uniform conditions were counted using a hemacytometer. and stimuli can ultimately lead to highly divergent cell re- sponses and behavior, a hallmark of stem cells for example Viral Packaging and Cell Line Production (Gage, 2000). Although purified Fluc has been extensively studied since The retroviral vectors pCLPC Fluc and pCLPIT Fluc were the 1940s, relatively little is known about its activity in the packaged by transient transfection of the plasmid of interest context of a living cell. This information is important for into a 10 cm dish of 70% confluent 293T human embryonic understanding the quantitative relationship between gene kidney cells (ATCC) with two helper plasmids, CMV gag- expression, protein concentration, and light output, the pol and CMV VSVG, which encode the retroviral Gag-Pol signal that is experimentally measured. We have therefore proteins and vesicular stomatitis virus envelope glycopro- investigated the linearity, half-life, and enzyme kinetics of tein necessary for viral production. Cells were allowed to luciferase bioluminescence in live human embryonic kid- produce virus for 48 hours before harvesting. The viral- ney (HEK 293) cells. We have also created a model of the containing cell media was then centrifuged and filtered to luciferase-luciferin reaction in the context of living mam- clarify cell debris. The virus was then purified via malian cells based on our own experiments and values found ultracentrifugation, and resuspended in 100 AL of phos- in literature. This systematic investigation of the enzyme phate buffered saline. Purified virus was stored at À20jC. provides new and important information for the quantifica- The 293T CLPC Fluc and 293T CLPIT Fluc cell lines tion and interpretation of luciferase signals within live cells. were produced by infecting c 106 naı¨ve 293T cells with 1 AL purified retrovirus in the presence of 8 Ag/mL poly- brene. Stably infected cells were selected by culturing cells MATERIALS AND METHODS in the presence of 1 Ag/mL puromycin. Materials Luciferase Assays Iscove’s Modified Dulbecco Medium (IMDM), L-15 Luciferase assays were performed on cell lysate as follows. Medium, and penicillin-streptomycin were obtained from Media was aspirated from the cells, and the plate was rinsed Invitrogen (LaJolla/San Diego, CA). BioWhittaker pro- with phosphate-buffered saline (PBS). The cells were lysed duced the fetal bovine serum (FBS). D-luciferin, free-acid with 200 AL of a cell lysis buffer (25 mM Tris-phosphate, and potassium salt, were obtained from Regis Technologies pH 7.8, 2 mM dithiothreitol, 2 mM 1,2-diaminocyclohex- and Promega Corp. (Madison, WI), respectively with ane-N, N, N, -tetraacetic acid, 10% glycerol, and 1% Trition Quantilum luciferase also from Promega. All other reagents X-100), scraped from the plate, and placed in a 1.5 mL were acquired from Sigma-Aldrich Chemicals Co. (St. Eppendorf tube. The samples were then frozen at À 80jC. Louis, MO), unless otherwise noted. Prior to assay, samples were thawed and briefly centrifuged to remove cell debris. The luciferase assay buffer was prepared in semi-darkness (20 mM Tricine, 1.07 mM mag- Plasmid Construction nesium carbonate pentahydrate, 2.67 mM magnesium sul- The firefly luciferase gene (Fluc) gene was amplified from fate, 0.1 mM EDTA, 0.5 mM ATP sodium salt, 0.27 mM the plasmid MARSHA luc (a kind gift of F. Gage, the Salk Coenzyme A sodium salt, 33.3 mM dithiothreitol, and Institute for Biological Studies, La Jolla, CA) using the po- 0.47 mM D-luciferin potassium salt). The luminometer lymerase chain reaction (PCR). The primers used (5V-AGG- (Turner Designs TD 20/20) was blanked with 100 ALof GGCCGCCTCGGCCGTCGACGGTAT CGATAAG-3V the luciferase assay buffer in a 12 Â 75 mm polypropylene and 5V-GTGGCGGCCGCTCTAGAACTAGTG-3V) contain tube. The sensitivity was adjusted as necessary to ensure the restriction enzymes sites of Sfi I and Not I for ready in- light levels remained within the instrument’s detection lim- sertion into several vectors. The Fluc gene was then inserted its. To assay the samples, 10 AL of the cell lysate were into the MoMLV retroviral vector pCLPCX under the control added to 100 AL of the luciferase assay buffer, swirled of the human CMV IE (immediate early) promoter to create briefly, and placed in the luminometer. The signal was pCLPC Fluc. Fluc was also inserted into the MoMLV retro- integrated for 30 seconds with a 2 second delay and was viral vector pCLPIT under the control of the tetracycline-off reported in Relative Light Units (RLU). gene regulation system (Gossen and Bujard, 1992). DNA manipulation and purification was performed using standard Live Cell Assays molecular biology techniques (Ausubel et al., 1999). The 35-mm plates were typically seeded with 105 cells in 1 mL of IMDM or L-15 media 24 hours prior to the assay. Cell Culture Various amounts of a 1 mM D-luciferin stock in PBS or Human embryonic kidney 293T cells were maintained water were added to cells just prior to placing the plates in at 37jC and 5% CO2 in IMDM with 10% FBS and the luminometer.