The Effects of Ketamine on Dopaminergic Function

THE EFFECTS OF KETAMINE ON DOPAMINERGIC FUNCTION

Michelle Kokkinou

Psychiatric Imaging Group London Institute of Medical Sciences (LMS), Medical Research Council (MRC) Faculty of Medicine, Imperial College London

Thesis submitted for the degree of Doctor of Philosophy

Declaration of originality

The experiments described and data analysis were part of my own work, unless otherwise stated. The work was conducted at the London Institute of Medical Sciences

(LMS) in collaboration with Imanova Ltd. Specialist pre-clinical imaging analysis was conducted in collaboration with Mattia Veronese (King’s College London). Specialist meta-analysis was conducted in collaboration with Abhishekh Ashok.

Peer-reviewed accepted paper

Michelle Kokkinou, Abhishekh H Ashok, Oliver D Howes. The effects of ketamine on dopaminergic function: meta-analysis and review of the implications for neuropsychiatric disorders. Molecular Psychiatry. Oct 3. doi: 10.1038/mp.2017.190.

Published conference abstracts arising from this thesis

Chapters 3&4: Howes OD., Kokkinou M. The Effects of Repeated NMDA Blockade with Ketamine on Dopamine and Glutamate Function. Biological Psychiatry. 72nd

Annual Scientific Convention and Meeting. https://doi.org/10.1016/j.biopsych.2017.02.091

Chapters 4&5: Kokkinou M, Irvine EE, Bonsall DR Ungless MA, Withers DJ, Howes

OD. Modulation of sub-chronic ketamine-induced locomotor sensitisation by midbrain dopamine neuron firing. European Neuropsychopharmacology (ENP)

Chapters 3 & 4 are in preparation for publication.

Presentation regarding the experiments in this thesis

British Association for Psychopharmacology Meeting July 2017. Midbrain dopamine neuron firing mediates the effects of ketamine treatment on locomotor activity: A

DREADD experiment

The copyright of this thesis rests with the author and is made available under a

Creative Commons Attribution Non-Commercial No Derivatives Licence. Researchers are free to copy, distribute or transmit the thesis on the condition that they attribute it, that they do not use it for commercial purposes and that they do not alter, transform or build upon it. For any reuse or redistribution, researchers must make clear to others the licence terms of this work.

One of the most remarkable experiences I have had throughout my PhD was to take part in a BBC Horizon programme along with my supervisor Professor Oliver Howes and discuss how an excess of the brain chemical dopamine can lead to paranoia and delusions. Therefore I would like to start with a photo I took on the day of the BBC2 film interview which was set in a Funfair.

Dedication

I would like to dedicate this thesis to my grandmother Maro.

Acknowledgments

Most of all I would like to thank my supervisor Professor Oliver Howes for his support, encouragement and expert advice throughout the PhD project. Oliver has given me the opportunity and resources to perform exciting experiments using state in the art technologies and has trained me to learn about the world of research. He has a great impact in my career development as a neuroscientist. I do not have the words to express how grateful I am to him.

For all their help, support and professional ideas about experiments I would like to thank my co-supervisors Dr Mark Ungless and Professor Dominic Withers. Many thanks also to Elaine Irvine for help and advice regarding the behavioural experiments presented and her time to train me to perform the experimental techniques, such as the stereotaxic surgeries. Importantly I would also like to thank many people who helped to make this research possible Dr David Bonsall, Dr Abhishekh Ashok, Justyna

Glegola, Maria Paiva Pessoa, Dr Paulius Viskaitis, Dr Kyoko Tossell and Ele Paul. I would also like to thank my academic mentors Professor Thomas Barnes and Dr Alex

Sardini who kept me on track with my assessments.

Many thanks to all my lovely colleagues in the Psychiatric Imaging group, Metabolic

Signalling group and Neurophysiology group at the London Institute of Medical

Sciences (LMS), Susan Watts and Deborah Oakley from the science communications team at the LMS, Central Biomedical Services Imperial College London, the PET modeller Mattia Veronese and all my collaborators at the Institute of Psychiatry King’s

College London, the biology and radiochemistry teams at Imanova Ltd. I would also like to thank Dr Paula Moran for her expert advice on the latent inhibition experiment.

I would also like to thank my family, especially Mum, Dad, Andrea, Michalis, Marisa,

Poly, Chloe, my grandparents, my godparents and my friends especially Antonia, Elli,

Maria, Irene, Georgia, Stephanos and Andrienne for supporting me throughout this journey.

The research was financially supported by Medical Research Council (UK) Grant (MC-

A656-5QD30) to Professor Howes.

Glossary of abbreviations

3Rs- Replacement, Reduction and Refinement

3-MT- 3-Methoxytyramine

6-OHDA- 6-hydroxydopamine

[(18)F]-DOPA- 3,4-dihydroxy-6-[(18)F]-fluoro-L-phenylalanine

[18]F-fluorodeoxyglucose (18F-FDG)

([11C] β-CFT)- [11C]2-β- carbomethocy3β-(4-fluorophenyl) tropane

[123I]-iodobenzamide

AADC- Aromatic L-amino acid decarboxylase

AC- adenylate cyclase

Ach- acetylcholine

AMPAR- α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptor

ANCOVA- Analysis of covariance

ANOVA- Analysis of variance

AAV- adeno-associated virus

BBB- Blood brain barrier

Carbon- C

Ca+2 - Calcium ion

CaMKII- calmodulin-dependent protein kinase II cAMP- cyclic adenosine monophosphate

CNO- Clozapine N-oxide

COMT-Catechol O-methyltransferase

CS- Conditioned stimulus

Ct region– cortex

Ct value- Cycle threshold

CT- computed tomography

DA – Dopamine

D1, D2, D3 – Dopamine receptor sub-type 1, 2, and 3 respectively

DAT - Dopamine transporter dB- Decibel df- degrees of freedom dlPFC – dorsolateral prefrontal cortex

DNA- Deoxyribonucleic acid dNTPs – deoxyribonucleotides

DOPA- L-3,4-dihydroxyphenylalanine

DOPAC- 3,4-Dihydroxyphenylacetic acid

DREADD – Designer Receptors Exclusively Activated by Designer Drugs

EDTA - ethylenediaminetetraacetic acid

FDA - Food and Drug administration

FOV- Field of view

GABA- γ-Aminobutyric acid

GIRK- G protein-coupled inwardly-rectifying potassium

Hipp- Hippocampus

HNK- Hydroxynorketamine

Hprt1- Hypoxanthine phosphoribosyltransferase 1

HVA-homovanillic acid hM3- human muscarinic acetylcholine receptor

IAW- Inveon Acquisition Workplace i.p- intraperitoneal i.v- intravenous

ITG – Inferior temporal gyrus

K+ - Potassium ion

Ket- Ketamine

Ki – Influx rate constant

mod Ki – Influx rate constant relative to the cerebellum corrected for kloss

std Ki – Influx rate constant relative to the cerebellum

kloss – rate constant for the loss of radioactive metabolites from the striatum

KS- Kolmogorov-Smirnov

LAT-1- Large-neutral Amino Acid Transporter 1

L-DOPA- L-3,4-dihydroxyphenylalanine

LSO- Lutetium Oxyorthosilicate

LI- Latent inhibition

µPET µ positron emission tomography

MAM- methylazoxymethanol acetate

MAO-B-monoamine oxidase B

Mg+2 - Magnesium ion

Min- minutes

MK-801- Dizocilpine mRNA- Messenger RNA

MRS - Magnetic Resonance Spectroscopy n- sample size

N- Nitrogen

Na+- Sodium ion n/a- not available

NAc – Nucleus accumbens

NaOH- Sodium hydroxide

NDS- Normal donkey serum

NMDA - N-methyl-D-aspartate

NMDAR - N-methyl-D-aspartate receptor

NPE- Non pre-exposed ns - not significant p- probability

Parvalbumin- PV

PBS- phosphate buffered saline

PCP - Phencyclidine

PE- Pre-exposed

PET - Positron Emission Tomography

PFA- paraformaldehyde

PFC- Prefrontal cortex

PMT- Photomultiplier tubes

PR- Progressive ratio

QPCR- quantitative polymerase chain reaction

RNA- ribonucleic acid

RT- reverse transcriptase

Sal- saline s.c- subcutaneous s.d.- standard deviation

SEM- standard error of the mean

SD- Sprague Dawley

SNc - Substantia nigra pars compacta

Str – striatum

SUV- standardized uptake value

TAC- Time activity curve

TAE- Tris acetate EDTA

TH- Tyrosine hydroxylase

Thal- Thalamus

TM3- transmembrane domains 3

US- Unconditioned stimulus

VHipp- ventral hippocampus

VSub- ventral subiculum

VS – ventral striatum

VTA - Ventral tegmental area

Zn+2- Zinc ion

Abstract

Schizophrenia is a chronic debilitating disorder which affects about 21 million people worldwide. One of the robust neurochemical abnormalities in schizophrenia is significantly elevated striatal dopamine synthesis capacity in patients compared to controls. Ketamine is a club drug of abuse and induces psychotomimetic effects at sub-anaesthetic doses in healthy human and exacerbates psychotic symptoms in patients with schizophrenia. Therefore it has been used to model neurochemical alterations seen in schizophrenia such as dopaminergic overactivity. However, the effect of sub-chronic ketamine on dopamine synthesis capacity in vivo is not known.

This thesis synthesizes the evidence of sub-chronic ketamine’s action on the dopaminergic function and behavioural measures previously associated with the dopaminergic system in the male mouse and it can be divided into four key findings.

Firstly, sub-chronic ketamine administration significantly increases presynaptic striatal dopamine synthesis capacity as measured by 3,4-dihydroxy-6-[(18)F]-fluoro-l- phenylalanine ([18F]-DOPA) positron emission tomography (PET) imaging and induces locomotor sensitization. Secondly, inhibiting midbrain dopamine neuron firing using

Designer Receptors Exclusively Activated by Designer Drugs (DREADDs) in vivo prevents the effects of sub-chronic ketamine administration on the presynaptic striatal dopaminergic function and locomotor sensitization. Thirdly, there are no alterations in latent inhibition in a conditioned fear paradigm and no alterations in incentive motivation following sub-chronic ketamine administration relative to control conditions.

Lastly, mice sub-chronically treated with ketamine or saline demonstrate cocaine- induced locomotor sensitization.

Collectively I show that sub-chronic ketamine results in the elevation in striatal dopamine synthesis capacity and locomotor sensitization and that these effects require midbrain dopamine neuron activation. I propose a model for the mechanism of action of ketamine on the dopaminergic function and discuss the implications for understanding schizophrenia, the potential antidepressant properties of ketamine and substance abuse.

List of contents

Declaration of originality ...... 2 Copyright Declaration ...... 3 Dedication ...... 5 Acknowledgments ...... 6 Glossary of abbreviations ...... 8 6-OHDA- 6-hydroxydopamine ...... 8 Abstract ...... 14 List of contents ...... 16 List of figures ...... 21 List of tables ...... 24 Chapter 1- Introduction ...... 26 1.1 The history of ketamine ...... 27 1.2 Pharmacology of ketamine ...... 28 1.3 Dopamine synthesis ...... 31 1.4 The dopaminergic system ...... 33 1.5 Measuring dopamine function ...... 34 1.6 Ketamine’s abuse potential, therapeutic benefits in depression and as a model for schizophrenia- The role of the dopamine ...... 35 1.6.1 Ketamine’s abuse potential ...... 35 1.6.2 Clinical PET imaging studies of the dopaminergic system in chronic ketamine users ...... 36 1.6.3 Major depressive disorder and dopamine ...... 37 1.6.4 Depression and glutamate ...... 38 1.6.5 Ketamine’s antidepressant effects ...... 38 1.6.6 Metabolite of ketamine – antidepressant effects ...... 39 1.6.7 Schizophrenia and dopamine ...... 41 1.6.8 The NMDA receptor hypofunction hypothesis of schizophrenia ...... 44 1.6.9 Ketamine – Potential as a model of the pathophysiology of schizophrenia ...... 46 1.7 Ketamine and dopamine ...... 47 1.7.1 Clinical Positron Emission Tomography (PET) studies of the effects of acute ketamine administration on dopamine release in healthy subjects ...... 47 1.7.2 Acute ketamine effects on dopaminergic function- Pre-clinical evidence ..... 50

1.7.3 Chronic ketamine’s effects on the dopaminergic function- Pre-clinical evidence ...... 52 1.7.4 Effects of ketamine on dopamine neuron firing ...... 53 1.7.5 Effects of anaesthetic doses of ketamine on the dopaminergic system in rodents ...... 53 1.7.6 Ketamine’s effects on the dopaminergic system in non-human primates- Pre-clinical imaging studies ...... 53 1.7.8 Theorized mechanism of action of ketamine in mediating the dopaminergic alteration ...... 58 1.9 Behavioural tests- Role of dopamine ...... 60 1.9.1 Locomotor sensitization ...... 60 1.9.2 Latent inhibition...... 62 1.9.3.1 Incentive motivation – The dopamine hypothesis ...... 68 1.10 Mind the ‘gap’ between ketamine and dopamine ...... 71 1.11 Aims of this thesis ...... 71 1.12 Hypotheses and outline of thesis ...... 72 Chapter 2- Materials and methods ...... 74 2.1 Introduction...... 75 2.2 Ethics/study approval ...... 75 2.3.1 Animals ...... 75 2.3.2 DAT-Cre transgenic mice ...... 76 2.3.3 Genomic DNA extraction from mouse tails...... 76 2.3.4 DAT-Cre genotyping strategy ...... 77 2.4 Drugs and route of administration ...... 78 2.5 Ketamine dosing regime ...... 78 2.6 Overall experimental design ...... 80 2.7.1 Behavioural tasks ...... 81 2.7.2 Open field test ...... 82 2.7.3 Progressive ratio (PR) operant behaviour task ...... 83 2.7.4 Latent inhibition of fear response ...... 84 2.8.1 Positron Emission Tomography (PET) imaging technology ...... 86 2.8.2 PET scanner ...... 88 2.8.3 Coincidence detection ...... 88 2.8.4 PET Image reconstruction ...... 89 2.8.5 PET Image analysis ...... 89 2.8.6 Indexing dopaminergic function with PET ...... 90 2.8.7 Indexing dopamine synthesis capacity with radiolabelled DOPA ...... 90

2.8.8 Graphical approach to rate of [(18)F]-DOPA uptake ...... 92 2.8.9 [(18)F]-DOPA kinetics ...... 92

2.8.10 Ki Patlak and extended (modified) Ki Patlak approaches ...... 93 2.9 Experimental pipeline for [(18)F]-DOPA mice ...... 96 2.9.1 Power calculations ...... 96 2.9.2 [18F]-DOPA ...... 97 2.9.3 Pre-PET Scan acquisition ...... 98 2.9.4 [18F]FDOPA injection ...... 99 2.9.5 PET Scan Acquisition ...... 99 2.9.6 Physiological measures during scanning ...... 100 2.9.7 Region of interest definition...... 100 2.9.8 PET image analysis ...... 100

mod 2.9.9 Ki calculation ...... 100 2.10.1 Designer receptors exclusively activated by designer drugs (DREADD) principles ...... 102 2.10.2 DREADD injection in midbrain dopaminergic neurons ...... 104 2.10.3 Virus preparation ...... 105 2.10.5 Post-operative care ...... 106 2.10.6 CNO dose and route of administration ...... 106 2.10.7 In vitro experiments ...... 107 2.11 Randomization and Blinding ...... 111 2.12 Statistical analysis ...... 111 Chapter 3- Effects of sub-chronic ketamine treatment on the presynaptic striatal dopaminergic function and locomotor activity...... 112 3.1 Abstract ...... 113 3.2 Introduction...... 114 3.3 Methods ...... 117 3.3.1 Animals ...... 117 3.3.2 Drugs ...... 117 3.3.3 Open field test ...... 117 3.3.4 PET imaging ...... 118 3.3.5 Power calculation ...... 118 3.3.6 Statistics ...... 119 3.4 Results ...... 120 3.4.1 Acute ketamine treatment induces locomotor hyperactivity ...... 120 3.4.2 Sub-chronic ketamine treatment induces locomotor hyperactivity ...... 121

3.4.3 Sub-chronic ketamine treatment induces locomotor sensitization ...... 123 3.4.4 Subject characteristics and scan parameters ...... 124 3.4.5 Presynaptic striatal dopaminergic function in the sub-chronic ketamine mouse model ...... 125 3.4.6 Subject characteristics and RNA samples quantity and purity ...... 129 3.4.7 Gene expression in the midbrain in sub-chronic ketamine treated mice versus saline-treated controls ...... 130 3.5 Discussion...... 131 3.5.1 Biologic significance of the striatal [18F]-DOPA uptake ...... 133 3.5.2 General methodological considerations ...... 133 3.5.3 Conclusion ...... 135 Chapter 4- Dopamine neuron firing is required for the sub-chronic ketamine’s effects on the presynaptic striatal dopamine synthesis capacity and locomotor sensitization...... 136 4.1 Abstract ...... 137 4.2 Introduction...... 138 4.3 Methods ...... 141 4.3.1 Animals ...... 141 4.3.2 Power calculation ...... 141 4.3.3 Statistics ...... 141 4.4 Results ...... 143 4.4.1 Validation of the midbrain hM4Di DREADDs ...... 143 4.4.2 Inhibiting midbrain dopamine neuron firing reduced ketamine-induced locomotor hyperactivity ...... 146 4.4.3 Inhibiting midbrain dopamine neuron firing prevented ketamine-induced locomotor sensitization ...... 150 4.4.4 Subject characteristics and scan parameters ...... 152 4.4.5 Sub-chronic ketamine’s effects on the pre-synaptic striatal dopaminergic function are reversed by inhibition of midbrain dopamine neuronal activation. .. 154 4.5 Discussion...... 157 4.5.1 General methodological considerations ...... 157 4.5.2 Interpretation of the findings ...... 158 4.5.3 Adding a piece to the puzzle of ketamine’s mechanism of action ...... 159 4.5.4 Conclusion ...... 160 Chapter 5- Investigating the effects of sub-chronic ketamine administration on cocaine- induced locomotor responses, latent inhibition and incentive motivation in the male mouse...... 161 5.1 Abstract ...... 162 5.2 Introduction...... 164

5.3 Methods ...... 168 5.3.1 Animals ...... 168 5.3.2 Power calculation ...... 168 5.3.3 Latent inhibition of fear response paradigm ...... 169 5.3.4 Progressive ratio test of breakpoint ...... 171 5.3.5 Cocaine administration ...... 172 5.3.6 Statistics ...... 173 5.4 Results ...... 174 5.4.1 No effect of sub-chronic ketamine treatment on latent inhibition of conditioned-fear response ...... 174 5.4.2 No effects of sub-chronic ketamine treatment on incentive motivation breakpoint...... 176 5.4.3 Effects of sub-chronic ketamine treatment on cocaine-induced locomotor activity ...... 178 5.4.4 Inhibiting midbrain dopamine neuron firing prior to ketamine administration did not prevent the effects of sub-chronic ketamine on cocaine-induced locomotor sensitization ...... 181 5.5 Discussion...... 184 5.5.1 Implications ...... 185 5.5.2 General methodological considerations ...... 186 5.5.3 Conclusion ...... 187 Chapter 6 - Discussion ...... 188 6.1 Introduction...... 189 6.1.1 Dopamine synthesis capacity following sub-chronic ketamine administration and its relationship to ketamine-induced locomotor sensitization- The role of midbrain dopamine neuron activation (Chapters 3&4) ...... 189 6.1.2 The effects of sub-chronic ketamine administration on behavioural phenotypes linked to the dopaminergic system. The role of midbrain dopamine neuron activation. (Chapter 5) ...... 190 6.2 General methodological considerations ...... 192 6.3 Towards deciphering the mechanism of ketamine’s action on the dopaminergic system ...... 196 6.5 Future research directions...... 203 6.6 Conclusion ...... 206 7. References ...... 207

List of figures

Figure 1.1: Ketamine’s chemical structure

Figure 1.2: NMDA Receptor schematic

Figure 1.3: Schematic of the dopamine synthesis pathway and the dopaminergic synapse

Figure 1.4: The location and projection targets of dopamine neurons in the adult rodent brain.

Figure 1.5: Meta-analyses of studies investigating the dopaminergic function in patients with schizophrenia compared to controls.

Figure 1.6: The figure depicts the interactions between glutamatergic and dopaminergic circuits.

Figure 1.7: Effects of acute ketamine administration on dopamine levels in the cortex in rodents

Figure 1.8: Effects of acute ketamine administration on dopamine levels in the striatum in rodents.

Figure 1.9: Effects of acute ketamine administration on dopamine levels in the nucleus accumbens in rodents

Figure 1.10: Proposed mechanism of ketamine’s action on the dopamine system.

Figure 2.1: A representative example of electrophoresis separation of the genotyping products.

Figure 2.2: Experimental pipeline

Figure 2.3: Schematic diagrams of the behavioural tasks used

Figure 2.4: PET basic physics schematic.

Figure 2.5 The two-tissue compartment model showing [18F]-DOPA kinetics.

Figure 2.6: [18F]-FDOPA compound structure

Figure 2.7: PET experimental pipeline

Figure 2.8: Schematic representation of the DREADDs coupled to different G protein cascades.

Figure 2.9: DREADD injection in the iDATCre mouse brain.

Figure 3.1: Locomotor activity following acute ketamine administration.

Figure 3.2: Locomotor activity following sub-chronic ketamine administration

Figure 3.3: Representative traces of locomotor activity in open field arenas generated by Ethovision software from mice treated with ketamine and saline on day 5.

Figure 3.4: Locomotor sensitization following sub-chronic ketamine administration.

Figure 3.5: Striatal presynaptic dopaminergic function in the sub-chronic ketamine model

Figure 3.6: mRNA levels of TH and DDC in striatum and midbrain of ketamine treated and saline treated mice.

Figure 4.1: hM4Di inhibitory DREADD expression in midbrain

Figure 4.2: Distance travelled in 5min bins as measured by the open field test in DAT

Cre mice.

Figure 4.3: Distance travelled in 5min bins as measured by the open field test in iDATCre mice.

Figure 4.4: Total distance travelled in the open field arenas 30min post ketamine or saline treatment on days 1 and 5.

Figure 4.5: Dopamine synthesis capacity as indexed by Kimod

Figure 4.6: The relationship between striatal dopamine synthesis capacity and locomotor activity in ketamine-treated mice.

Figure 4.7: No significant relationship between striatal dopamine synthesis capacity and locomotor activity in saline-treated mice.

Figure 5.1: Latent inhibition of conditioned fear response.

Figure 5.2: Progressive ratio task experimental pipeline.

Figure 5.3: (A) Experimental pipeline in wild type mice. (B) Experimental pipeline in iDATCre mice.

Figure 5.4: The effect of sub-chronic ketamine treatment on the % freezing response.

Figure 5.5: The effect of sub-chronic ketamine on the progressive ratio value.

Figure 5.6: Effects of sub-chronic ketamine treatment on cocaine-induced locomotor activity.

Figure 5.7: The effect of sub-chronic ketamine administration on cocaine-induced locomotor sensitization

Figure 6.1: Schematic summary of theorized circuit control of DA cell activity by direct and indirect glutamatergic projections at baseline and following ketamine administration.

List of tables

Table 1.1: Ketamine Ki values

Table 1.2: PET studies of D2/D3 receptor availability in healthy humans after ketamine infusion compared to control condition

Table 1.3: Acute and chronic microdialysis studies of dopamine levels in non-human primate studies

Table 1.4: PET studies of dopaminergic function in non-human primates after ketamine administration compared to control.

Table 1.5: Studies of ketamine-induced locomotor sensitization in rodents

Table 1.6: Acute and chronic studies of ketamine’s effects on latent inhibition

Table 1.7: Acute and chronic studies of ketamine’s effects on incentive motivation

Table 2.1: Characteristics of the µPET/CT scanner

Table 2.2: Stereotaxic coordinates used for the hM4Di injections.

Table 2.3: cDNA synthesis Mix

Table 2.4: List of real-time TaqMan probes

Table 3.1: Common effect size measures corresponding to statistical tests

Table 3.2: Summary of scan characteristics and scan parameters.

Table 3.3: Parameter estimates for the striatum in ketamine-treated and control mice.

Table 3.4: Sample characteristics

Table 4.1: Subject characteristics and scan parameters.

Table 4.2: [18F]-DOPA uptake in the four experimental groups.

18 mod Table 4.3: The relationship between [ F]-DOPA Ki and total distance travelled

Table 5.1: Subject weights for the latent inhibition experiment

Table 5.2: Subject weights for the progressive ratio task

Table 5.3: Subject characteristics for the cocaine challenge experiment

Chapter 1- Introduction

1.1 The history of ketamine

Ketamine (2-(2-chlorophenyl)-2-(methylamino)-cyclohexanone) is a cyclohexanone derivative (Domino, 2010), so named because it is a ketone with an amine (Figure

1.1). The history of ketamine dates back to the 1950s when researchers at the Parke-

Davis Labs performed investigations for prototype anaesthesic agents with analgesic properties (Please see informative reviews for a history of ketamine by (Domino, 2010,

Li and Vlisides, 2016). Phencyclidine (PCP) was synthesized (Maddox et al., 1965) and tested in animals (Domino and Luby, 2012) and humans (Johnstone et al., 1959,

Domino and Luby, 2012). Despite anaesthesia in humans PCP was also associated with delirium (Greifenstein et al., 1958, Domino and Luby, 2012). Ketamine was synthesized for the first time by the American Professor of Organic Chemistry Calvin

Lee Stevens at the Parke Davis Labs in 1962 with inception date of the first clinical study published by two Professors at the University of Michigan Corssen and Domino in 1966 (Corssen and Domino, 1966). The researchers reported safe, rapid and profound anaesthesia effects of ketamine with effective analgesia, minimal side effects and absence of delirium (Corssen et al., 1968). Ketamine received food and drug administration (FDA) approval for human use in 1970 (US Food and Drug administration., 1970)

(https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process

&ApplNo=016812), and it is listed as an essential medicine by the World Health

Organization since 1985. In fact ketamine is the most widely used anaesthetic in veterinary medicine (WHO, 2016). Ketamine has a shorter elimination half-life compared to PCP (ketamine’s half-life=186 min compared to PCP’s half-life 30 hours-

20days in human) (Clements and Nimmo, 1981, Braun, 1979, Uhl et al., 1986) thus decreasing the potential for lasting behavioural effects (Wieber et al., 1975). However

27 ketamine used as an analgesic in individuals with chronic pain is associated with urinary tract symptoms and liver toxicity (Katalinic et al., 2013).

O Cl

CH3

Figure 1.1: Ketamine’s chemical structure, adapted from (Li and Vlisides, 2016)

1.2 Pharmacology of ketamine

Ketamine is a non-competitive antagonist at the N-methyl-D-aspartate (NMDA) receptor (NMDAR) in the central nervous system (Irifune et al., 1992). The highest concentration of the NMDAR has been reported to be in the hippocampus (Monaghan and Cotman, 1986). When the NMDA receptor is at its resting state, the ligand and voltage gates are closed, the agonists and co-agonists sites are free and the membrane potential enables Mg+2 block (Figure 1.2). Upon binding of the glutamate and the co-agonist glycine, the ligand gate opens and the receptor is at an activated state. However the Mg+2 block prevents the flow of ions. Upon depolarization of the neuron, a process that occurs upon binding of glutamate to AMPA receptors, will then open the voltage channel via removal of the Mg+2 block (Dingledine et al., 1999). The receptor is then at the active state which permits the influx of Na+ and Ca+2 into the neuron and the efflux of K+ (Newport et al., 2015). Glutamatergic NMDA receptors

28 which constitute cation channels mediate signal transduction in synapses and are involved in learning and cognition. Specifically NMDA receptor antagonists have been shown to disrupt learning and memory in rodents (Caramanos and Shapiro, 1994) and recognition memory and attention in humans (Malhotra et al., 1996). Non-competitive antagonism refers to the ‘’simultaneous binding of agonist and antagonist to the receptor, with the antagonist binding preventing the effect of agonist with or without any effect on the binding of agonist’’ (Neubig et al., 2003). Specifically ketamine binds to the PCP-binding site of the excitatory ligand-gated ion channel and prevents the influx of Ca+2 ions upon binding of glutamate and glycine (Dingledine et al., 1999)

(Figure 1.2). Ketamine is a chiral compound. Chirality (derived from the Greek word hand -χειρ) is a geometrical property of molecules. Chiral molecules are non- superposable on their mirror images and are referred to as enantiomers. Chiral molecules encompass one asymmetric carbon atom, which is attached to four different groups. Ketamine has one chiral carbon atom (C2- the chiral centre at the second carbon of the cyclohexanone ring) thus exists in two optical enantiomers, namely R –

(-)-ketamine and S –(+)-ketamine which differ in their affinity and potency for receptors.

Specifically the S –(+)-ketamine enantiomer has higher affinity for the NMDA receptor compared to the R enantiomer in human brain (Vollenweider et al., 1997). Ketamine is used clinically and pre-clinically as a racemic mixture of equal quantities of the two enantiomers (Muller et al., 2016, Goldberg et al., 2011).

Of note ketamine blocks muscarinic acetylcholine receptors, has some affinity for sigma receptors and is a weak agonist at the mµ opioid receptors (Seeman et al.,

2005, Oye et al., 1992, Hirota et al., 2002) (Table 1.1). Evidence for the binding of ketamine to dopamine D2 receptors and the dopamine transporter (DAT) is controversial (Kapur and Seeman, 2002a, Can and Zanos, 2016). However, the affinity

29 of ketamine to NMDA receptors is over an order of magnitude higher than its affinity for muscarinic acetylcholine receptors, D2 receptor and DAT receptors and five times higher than its affinity for serotonin subtype 2 receptors (Table 1.1). Therefore the interpretation of ketamine’s effects in current thesis will be focused on its actions on the NMDA receptors.

Receptor type Ki Study

NMDA (striatum) 3100 nM (Seeman et al., 2005)

NMDA (cortex/hippocampus) 2270 nM (Grimwood et al., 1996)

NMDA (clone) * 3150 nM (Grimwood et al., 1996)

Serotonin (5-hydroxytryptamine) subtype 2 15 µM (Kapur and Seeman, 2002a)

High-affinity state D2 receptor (clone) 55 nM (Seeman et al., 2005)

Muscarinic Acetylcholine receptor M1 45µM (Hirota et al., 2002)

Muscarinic Acetylcholine receptor M2 294 µM (Hirota et al., 2002)

Muscarinic Acetylcholine receptor M3 246 µM (Hirota et al., 2002)

Mu Opioid receptors (S)- 11 µM (Oye et al., 1992)

(R)- 28 µM

σ receptors (S)- 131 µM (Oye et al., 1992)

(R)- 19 µM

*recombinant human NR1A/NR2A-1

Table 1.1: Ketamine Ki values (inhibitory constants-which reflect the affinity of ketamine for the receptor).

Figure 1.2: NMDA Receptor schematic. Concept of figure adapted from (Witt et al., 2004). The NMDA receptor is a heteromeric ion channel formed from a number of subunits namely NR1, NR2A-D, NR3A and NRB (Stone, 2011). Abbreviations Mg+2- Magnesium ions, Na+- Sodium ions, Ca+2- Calcium ions, Zn+2- Zinc ions, K+ - Potassium ions

1.3 Dopamine synthesis

Dopamine is a neurotransmitter, involved in a plethora of brain functions, including, for example, reward processing, learning, memory (Grace et al., 2007), fear, incentive motivation (Salamone and Correa, 2012, Wise, 2004) and locomotion (Albin et al.,

1989, Berridge, 2007, Pezze and Feldon, 2004). Dopamine synthesis involves the conversion of amino acid tyrosine to L-3,4-dihydroxyphenylalanine (L-DOPA) via tyrosine hydroxylase (rate limiting step) and subsequently the formation of dopamine via a decarboxylation step via DOPA decarboxylase enzyme (AADC). Dopamine is subsequently transported through the vesicular monoamine transporter (VMAT) proteins into the presynaptic vesicles and it is stored there ready for release into the synapse (Figure 1.3).

Figure 1.3: Schematic of dopamine synthesis pathway and dopaminergic synapse. D1 and D2 receptors are positively or negatively coupled to the adenylate cyclase (AC) via G proteins. Dopamine is subjected to metabolism via MAO-B and COMT enzymes, leading to the production of HVA, DOPAC and 3-MT metabolites. Dopamine in the synaptic cleft binds to D1/D2 receptors on the post-synaptic neuronal membrane or dopamine D2 autoreceptors or DAT on the pre-synaptic neuronal membrane. Binding to D2 autoreceptors leads to inhibition of the phosphorylation-dependent activation of TH (Blackstone, 2009). Abbreviations: DAT- dopamine transporter, AC- adenylate cyclase; G- G proteins, D1/D2= Dopamine receptors sub-type 1 and 2; cAMP- cyclic adenosine monophosphate; DOPA- L-3,4- dihydroxyphenylalanine; 3-MT- 3-Methoxytyramine; HVA-homovanillic acid; MAO-B- monoamine oxidase B; DOPAC- 3,4-Dihydroxyphenylacetic acid; COMT-Catechol O- methyltransferase; TH- tyrosine hydroxylase; AADC- Aromatic L-amino acid decarboxylase. Concept of figure adapted from (Blackstone, 2009)

1.4 The dopaminergic system

The midbrain dopamine neurons are classified traditionally into three cell groups namely the A8 (retrorubral field); A9 (substantia nigra) and A10 (ventral tegmental area) (Figure 1.4) (Nagai et al., 1983, Kosaka et al., 1987). The midbrain dopamine neurons project to areas such as the prefrontal cortex, the striatum, the nucleus accumbens and the amygdala. It is well established that there is a mediolateral topography within the dopaminergic system (Haber et al., 2000). Specifically dopamine neurons arising from the medial portion of the midbrain namely the ventral tegmental area (VTA) mesencephalic nucleus project to the nucleus accumbens/ventral striatum and cortex in what are known as the mesolimbic and the mesocortical dopaminergic pathways (Wise, 2004). These circuits have been primarily identified with motivational function. Additionally dopamine neurons arising from the substantia nigra pars compacta project to the striatum in what is known as the nigrostriatal pathway. The nigrostriatal system has been associated most strongly with the motor function (Wise, 2004). Although the three distinct dopaminergic pathways are valid since four decades ago until today, more recent evidence expanded our view of the dopaminergic system into an organized complex of diverse dopamine neuronal subtypes which express various co-transmitters and marker proteins (Bjorklund and

Dunnett, 2007). Dysfunction of the midbrain dopamine neurons has been implicated in various disorders including schizophrenia (Goldstein and Deutch, 1992, Winton-

Brown et al., 2014); Parkinson’s disease (DeLong, 1990) and drug addiction (Luscher and Ungless, 2006).

Figure 1.4: The location and projection targets of dopamine neurons in the adult rodent brain. Concept simplified from Figure 1 Bjorklund and Dunnett 2007 (Bjorklund and Dunnett, 2007). The subregions A8-Retrorubral areal, A9-Substantia nigra and A10- Ventral Tegmental Area represent the midbrain dopamine cell groups in accordance with Dahlstrom and Fuxe (Dahlstroem and Fuxe, 1964). Abbreviations: Ct-cortex; STR-striatum; NAc-Nucleus Accumbens.

1.5 Measuring dopamine function

Extracellular dopamine (DA) concentrations can be measured using microdialysis (Di

Chiara, 1990), voltammetry (Robinson et al., 2003) and brain imaging such as positron emission tomography (PET) (Volkow et al., 2003). Additionally DA neuron firing can be monitored via extracellular recordings (Schultz, 2002). Importantly the different methodologies capture distinct time frames of the DA function; voltammetry measures

– seconds, PET and microdialysis - minutes and electrophysiology recordings - milliseconds (Di Chiara, 2005). For detailed description of the PET imaging which will be the main focus of this thesis please refer to Chapter 2.

1.6 Ketamine’s abuse potential, therapeutic benefits in depression and as a model for schizophrenia- The role of the dopamine

In this section of the introduction I present the evidence for ketamine’s abuse potential, therapeutic benefits in depression and as a model for schizophrenia. In addition I summarize the evidence that these effects are mediated via the dopaminergic system.

1.6.1 Ketamine’s abuse potential

Ketamine is a ‘club drug’ of abuse, so named because the recreational use of the drug is predominantly prevalent at dance events (Ross et al., 2003). In fact ketamine induces self-administration in rats (De Luca and Badiani, 2011). Furthermore, a case study of intravenous ketamine administration resulted in emergent craving for the drug

(Gowda et al., 2016). Sub-anaesthetic doses of ketamine in humans induce ‘out of body’ experiences and hallucinations and induce a state of dissociation referred to as the K-hole (Stewart, 2001). Moreover ketamine users describe this experience as a spiritual exploration (Hansen et al., 1988, Krystal et al., 1994, Jansen and Theron,

2003). The annual prevalence of ketamine use in England and Wales in adults ranges from 0.4-0.6% and in young adults from 0.8-1.8% (UNODC). Additionally the number of people requesting treatment for ketamine abuse has increased (Crime, 2013). A systematic review of the literature reported that chronic frequent use of ketamine is associated with ulcerative cystitis and working memory impairment (Morgan and

Curran, 2012). Therefore ketamine’s abuse has displayed harms on the individual and the society (Morgan and Curran, 2012).

1.6.2 Clinical PET imaging studies of the dopaminergic system in chronic ketamine users

Importantly, ketamine’s abuse potential has been linked to the dopaminergic system.

Interestingly, altered prefrontal dopaminergic neurotransmission has been associated with chronic recreational ketamine use (Narendran et al., 2005). Specifically there was upregulation of the D1 receptor availability as measured by in-vivo positron emission tomography (PET) imaging in the prefrontal cortex of chronic recreational ketamine users compared to controls (Narendran et al., 2005). Narendran et al., 2005 did not report changes in regional cerebral blood flow and implicated the quantitative approach employed as a potential justification (Narendran et al., 2005). Of note studies in chronic ketamine users are confounded by polysubstance use in these subject cohorts (Curran and Monaghan, 2001, Curran and Morgan, 2000). Importantly there are no studies investigating dopamine synthesis, dopamine release or dopamine transporter availability in chronic ketamine users compared to control conditions.

Therefore investigations of the aforementioned dopaminergic effects in chronic ketamine users encompass necessary future research directions.

1.6.3 Major depressive disorder and dopamine

Major depressive disorder (MDD) is a debilitating disease which affects about 6% of the adult population worldwide each year (Bromet et al., 2011). MDD is characterised by at least one depressive episode lasting at least two weeks according to the

Diagnostic and Statistical Manual of Mental Disorders 5th edition (DSM-5) criteria.

Major depression is associated with blunted dopaminergic function (Kapur and Mann,

1992, Dunlop and Nemeroff, 2007).

Post mortem studies investigating the levels of tyrosine hydroxylase (TH) in patients with major depressive disorder compared to controls demonstrated inconsistent findings. Additionally no difference in TH is reported in the midbrain of patients with major depressive disorder as compared to control subjects (Howes et al., 2013). Whilst the majority of studies reported elevation of tyrosine hydroxylase (TH) in the locus coeruleus in patients with major depression compared to controls (Zhu et al., 1999,

Gos et al., 2008, Ordway et al., 1994), one study reported reductions (Biegon and

Fieldust, 1992), and one study no alterations in TH in patients compared to controls

(Baumann et al., 1999). Therefore these findings suggest that changes in TH in patients with major depressive disorder exist predominantly in norepinephrine instead of dopaminergic region.

Interestingly a PET study showed reduction in striatal dopamine synthesis capacity as measured by [18F]-fluorodopa uptake in patients with depression and psychomotor retardation as compared to anxious patients with depression and healthy controls

(Martinot et al., 2001). Whilst two earlier studies reported increase in striatal D2 binding in patients with depression (Shah et al., 1997, D'Haenen H and Bossuyt,

1994), two latter studies did not replicate this finding (Klimke et al., 1999, Parsey et

37 al., 2001). In addition there is evidence for reduction in striatal DAT binding in depression (Meyer et al., 2001).

1.6.4 Depression and glutamate

Furthermore there is evidence for the glutamatergic system dysfunction underlying the pathophysiology of depression. Proton magnetic resonance spectroscopy is a technology which enables the non-invasive quantification of regional brain metabolites including glutamate and γ-Aminobutyric acid (GABA). Metabolites are characterized through a unique set of chemical shifts (peak position along the x-axis). Sanacora and colleagues showed elevation in glutamate levels in the occipital cortex and reduction in GABA concentrations as measured by magnetic resonance spectroscopy (MRS) in patients with major depressive disorder (n=29) relative to healthy controls (n=28)

(Sanacora et al., 2004).

1.6.5 Ketamine’s antidepressant effects

Ketamine has been eulogized as the most important discovery in the treatment of depression in the last 50 years (Duman and Aghajanian, 2014). Remarkably a landmark study in 2000 reported rapid and robust reduction in depressive symptoms in seven patients with major depression following ketamine (0.5mg/kg) intravenous treatment as compared with saline treatment, within 72 hours (Berman et al., 2000).

The rapid and robust anti-depressant effect- as compared to 3-4 weeks therapeutic lag associated with current anti-depressant treatment effects (Rush et al., 2006), has spurred interest in the use of ketamine for the treatment of depression. Importantly studies showed that ketamine at sub-anaesthetic doses induced rapid and robust antidepressant effects in patients with treatment-resistant major depression (Zarate et al., 2006, Berman et al., 2000, Diazgranados et al., 2010, Lally et al., 2014).

Specifically, a systematic review encompassing a total of nine ketamine clinical trials concluded that ketamine, as compared to control conditions such as saline, was associated with significantly increased levels of response in alleviating acute symptoms of depression at 24 hours, 3 days and 7 days in patients with major depressive disorder (Caddy et al., 2015). Additionally in rodent models it has been shown that ketamine induced increase in glutamate levels, as indexed by reduction in the metabotropic glutamate receptor 5 (mGluR5) availability in both patients with major depressive disorder and healthy controls (Esterlis et al., 2017). Additionally sub- anaesthetic dose of acute ketamine (range of ketamine dose: 0.1-50mg/kg) is associated with a reduction in immobility in the forced swim test (FST) (Koike et al.,

2013, Ghasemi et al., 2010, Cruz et al., 2009) and tailed suspension test (TST) (Koike et al., 2011, Rosa et al., 2003); preclinical behavioural paradigms to assess the depressive-like behaviour in rodents (Browne and Lucki, 2013). Furthermore, ketamine administration restores the decrease in dopamine neuron population activity in a rat model of stress-induced depression (Belujon and Grace, 2014a). Additionally ketamine has been shown to restore synaptic plasticity in the ventral subiculum of the hippocampus (vSub)- Nucleus Accumbens (NAc) pathway (Belujon and Grace,

2014a). Importantly there is no study investigating the effects of ketamine enantiomers with each other or with the racemic mixture of ketamine on depression cohorts

(Andrade, 2017). Importantly to date no study has investigated the effects of ketamine infusion on the dopaminergic function using in vivo PET imaging in patients with major depression. This requires further investigation.

1.6.6 Metabolite of ketamine – antidepressant effects

Additionally it has recently been reported that a metabolite of ketamine namely (2R,

6R)-hydroxynorketamine (HNK) is associated with rapid anti-depressant effects of

39 ketamine in mice through the activation of AMPA α-amino-3-hydroxy-5-methyl-4- isoxazole propionic acid receptor) receptor signalling (Zanos et al., 2016). Whether these effects are independent of the NMDAR antagonism are still under scientific debate (Suzuki et al., 2017, Zanos et al., 2017). Paradoxically the S- enantiomer of ketamine, which produces (2S,6S)-HNK but not (2R,6R)-HNK has demonstrated clinical antidepressant effect, similar in potency to the racemic mixture of ketamine

(Collingridge et al., 2017, Singh et al., 2016). In contrast in pre-clinical studies the

(2R,6R)-HNK metabolite is more active than (2S,6S)-HNK (Zanos et al., 2016). In summary the doses at which the metabolites are studied and the inter-species differences warrant caution in extrapolating these findings in the human. Of note we should remember that α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) receptors appear to be lacking the GluR2 subunit on GABAergic interneurons in the hippocampus and amygdala as opposed to those receptors on pyramidal neurons

(Kew and Kemp, 2005, Dingledine et al., 1999). The lack of this subunit enables the receptors to be permeable to Ca+2. Thus generalizability of findings with regards to the brain regions and the neuronal subtype should be interpreted with caution.

1.6.7 Schizophrenia and dopamine

Schizophrenia is a chronic neuropsychiatric disorder with 0.87% lifetime prevalence

(Perala et al., 2007) and is one of the leading causes of health burden in the world

(Whiteford et al., 2013). The healthcare burden of schizophrenia is pronounced in both developed and developing countries (Howes and Murray, 2014). Schizophrenia is characterized by psychotic (positive) symptoms (such as hallucinations which are perceptions such as a voice or vision in the absence of a stimulus and delusions- fixed, implausible preoccupying beliefs, such as that an alien is chasing the patient), negative symptoms (such as apathy, reduced social interactions, amotivation) and relatively subtle cognitive impairment (such as deficits in working memory and attention) (Panel in Howes and Murray., 2014 (Howes and Murray, 2014). Diagnosis of schizophrenia relies on examination through a clinical interview based on diagnostic schedules such as the International Statistical Classification of Disease and Related

Health Problems (ICD-10) and the Diagnostic and Statistical Manual of Mental

Disorders (DSM-V) diagnostic criteria.

Our understanding of schizophrenia has evolved over the last three decades and one of the main reasons encompasses the advances in neuroimaging technology. The two most prevailing theories underlying the pathoetiology of schizophrenia revolve around dopamine (DA) and glutamate (Howes and Kapur, 2009, Howes et al., 2015).

Specifically two meta-analyses studies of clinical neuroimaging studies (number of studies (n)=15 (Howes et al., 2012), n= 11(Fusar-Poli and Meyer-Lindenberg, 2013) reported that the presynaptic striatal dopamine synthesis capacity as measured by

Positron Emission Tomography (PET) is elevated in patients with schizophrenia as compared to control subjects, with a large effect size (Cohen’s d= 0.79 (Howes et al.,

2012); Hedges’ g= 0.867 (Fusar-Poli and Meyer-Lindenberg, 2013) (Figure 1.5).

Figure 1.5: Meta-analyses of studies investigating the dopaminergic function in patients with schizophrenia compared to controls. Forest plot depicts a significant increase in the presynaptic dopaminergic function in patients with schizophrenia compared to controls with a large effects size (Summary effect size Cohen’s d= 0.79). Reproduced from Howes et al., 2012(Howes et al., 2012).

Additionally in vivo PET imaging with radiotracers which bind to the D2 dopamine receptors can give a measure of dopamine release, since dopamine competes with the radiotracer for binding with the receptors. Thus the lower radiotracer binding is indicative of DA release. Specifically a pharmacological challenge with amphetamine has shown that amphetamine-induced dopamine release is associated with a reduction in radiotracer binding (Egerton et al., 2010). Additionally studies reported reduction in D2 receptor radiotracer ([11C]raclopride or [123I]-iodobenzamide

[123I]IBZM) binding which corresponds to increased dopamine release in patients with schizophrenia relative to control subjects following amphetamine challenge (Laruelle

42 et al., 1999, Abi-Dargham et al., 2009, Pogarell et al., 2012). Moreover two meta- analyses of in vivo measurements of DAT density using PET and single-photon emission computer tomography (SPECT) imaging suggest no alterations of dopamine transporter density in patients with schizophrenia as compared with controls (Howes et al., 2012, Chen et al., 2013). This finding likely suggests that the dopaminergic abnormalities evident in schizophrenia are not secondary to the DAT receptor abnormalities (Howes et al., 2015). Studies of D1 receptors in schizophrenia have yielded inconsistent findings within chronically medicated patients (Hirvonen et al.,

2006, Kosaka et al., 2010) and antipsychotic naïve patient subgroups (Abi-Dargham et al., 2002, Okubo et al., 1997). This could be potentially attributed to the need for development of more specific radiotracers. For example the radiotracers used to measure D1 receptor availability also bind to the serotonergic receptor that has been involved in the aetiology of schizophrenia based on a meta-analysis of post-mortem findings (Selvaraj et al., 2014).

1.6.8 The NMDA receptor hypofunction hypothesis of schizophrenia

Whilst the dopaminergic dysregulation has been the main research focus, the dopamine hypothesis has been mostly linked to the positive symptoms of schizophrenia. The NMDA receptor hypofunction of schizophrenia is thought to better model the negative symptoms and cognitive impairment associated with schizophrenia (Krystal et al., 1994, Morgan and Curran, 2006, Stone et al., 2007).

Excitation-inhibition balance in a neural circuit refers to the homeostatic plasticity which is necessary to preserve neuronal activity within a safe range. The excitatory neurotransmission is primarily glutamatergic (Rothman et al., 2003). Moreover there are two classes of glutamate receptors namely ionotropic (NMDAR, kainate and AMPA receptors) and metabotropic receptors (Group I (mGluR1 and mGluR5), Group II

(mGluR2 and mGluR3) and Group III (mGluR4, mGluR6, mGluR7, mGluR8) (Kew and

Kemp, 2005). Whilst various receptors have been implicated, the prevailing hypothesis of altered excitatory/inhibitory balance in schizophrenia involved the ionotropic NMDA receptor (Stone et al., 2007). It is theorized that the NMDA receptor hypofunction on parvalbumin positive GABAergic interneurons is thought to disinhibit glutamatergic projections, ultimately increasing the dopaminergic neurotransmission to lead to psychosis (Figure 1.6).

Additionally studies reported a reduction in interneuron density and an increase in the

GABA-α receptor binding (viewed as a compensatory upregulation due to GABAergic interneuron loss) associated with schizophrenia (Benes et al., 1991, Benes et al.,

1996, Brickley and Mody, 2012). Additionally a SPECT study reported reduction in the

NMDAR binding in the hippocampus in patients with schizophrenia compared to controls (Pilowsky et al., 2006). Furthermore, a previous study showed that enhanced glutamate efferents from the ventral subiculum of the hippocampus to the nucleus

44 accumbens are thought to drive the elevation in dopamine neuron responsivity via increasing inhibition to the ventral pallidum, subsequently disinhibiting the VTA in the rodent (Lodge and Grace, 2006). Evidence in favour of the NMDAR hypofunction theory arises from clinical and pre-clinical studies of the effects of NMDAR antagonists on the brain structure and function. For example acute ketamine administration as compared with control conditions significantly increased glutamate levels in the cortex as measured by microdialysis in rodents (Lorrain et al., 2003, Moghaddam et al.,

1997b). Additionally rodents treated with NMDAR antagonists developed neurotoxic changes in cortical regions similar to those seen in patients with schizophrenia (Olney and Farber, 1995). The aforementioned evidence coupled with the fact that the antipsychotic drugs such as clozapine and olanzapine prevented these brain alterations further lent support for the NMDAR hypofunction hypothesis of schizophrenia (Olney and Farber, 1995).

Figure 1.6: The figure depicts the interactions between glutamatergic and dopaminergic circuits. Figure copied from (Howes et al., 2015).

1.6.9 Ketamine – Potential as a model of the pathophysiology of schizophrenia

Interestingly, the first study to assess the anti-depressant effects of ketamine (Berman et al., 2000) adopted the ketamine dose regime of a study which assessed the psychotomimetic effects (behaviours associated with the positive and negative symptoms of schizophrenia) of ketamine as a potential model of psychosis (Krystal et al., 1994, Sanacora, 2017). Thus, ketamine at doses used for treatment of major depressive disorder also elicits psychotomimetic effects (Krystal et al., 1994). In fact chronic ketamine use is associated with psychotic-like symptoms (Morgan et al., 2008,

Stone et al., 2014). Furthermore acute ketamine administration, at sub-anaesthetic doses induces psychotic-like symptoms and cognitive deficits in healthy human subjects (Krystal et al., 1994). Additionally ketamine exacerbated psychotic symptoms in patients with schizophrenia (Lahti et al., 2001). Moreover ketamine potentiated the amphetamine-induced dopamine release in healthy subjects (Kegeles et al., 2000c).

The amphetamine-induced dopamine release following ketamine was similar in magnitude to the amphetamine-induced dopamine release seen in patients with schizophrenia (Abi-Dargham et al., 1998, Breier et al., 1997, Laruelle et al., 1996).

Additionally 12 out of 17 patients with schizophrenia included in a research study reported exacerbation of their psychotic symptoms as measured by psychosis scores

20min post ketamine administration; an effect seen 20min following all three administrations of ketamine dispersed in 2 weeks (Lahti et al., 2001). Therefore ketamine activates psychosis in patients with schizophrenia.

1.7 Ketamine and dopamine

In this section I provide a summary of the effects of acute and chronic ketamine on the dopaminergic function in humans, non-human primates and rodents. Please refer to our systematic review of the literature for further details (Kokkinou, In press).

Additionally based on the results of our systematic review and meta-analyses studies

I propose a theoretical model of the mechanism of action of ketamine on the dopaminergic system.

1.7.1 Clinical Positron Emission Tomography (PET) studies of the effects of acute ketamine administration on dopamine release in healthy subjects

Acute administration of ketamine in healthy subjects resulted in elevations in the striatal dopamine release as indexed by reduction in the D2/D3 radiotracer binding potential compared to control conditions (Breier et al., 1998b, Smith et al., 1998b,

Vollenweider et al., 2000a). Specifically two studies used the racemic mixture of ketamine (Breier et al., 1998b, Smith et al., 1998c), while one study used the S- enantiomer of ketamine, which has higher affinity for the NMDAR as compared to the

R-enantiomer (Vollenweider et al., 2000b), thus providing evidence that NMDAR contributes to the induction of psychotic-like symptoms through the dopaminergic overactivity (Table 1.2). In agreement with the striatal findings, cortical dopamine release in the cingulate cortex was elevated in healthy controls following acute ketamine administration compared to the baseline and control conditions (Aalto et al.,

2005). Conversely three studies did not report changes in the striatal dopamine levels following acute ketamine infusion (Aalto et al., 2002, Kegeles et al., 2000a, Kegeles et al., 2002), yet one study reported elevation of amphetamine-induced dopamine release following ketamine (Kegeles et al., 2000b).

Study Ketami Ketamin Duration of Ligand Radiotracer Study design Region of Na [Plasma Result: change in ne e dose administratio administratio interest Mean D2/D3 receptor and n n ±SEM] availability after route of (ng/ml) ketamine infusion administ compared to control ration condition c Aalto et Racemi infusion= Infusion 15 [11C]raclop Infusion Control group: Baseline and Caudate, 8/8 293±29 ↔ al., c 0.80mg/k mins prior to ride repeat scan putamen, Str 2002(Aa gb scan till the Ketamine group : Baseline lto et al., end of scan and ketamine administration 2002) Aalto et Racemi Infusion Infusion 15 [11C]FLB Infusion Control group: Baseline and Ct regions, Thal 8/8 325.5±57.5 posterior cingulate ct al., c 325.5±57 mins prior to 457 repeat scan 2005(Aa .5 ng/ml scan- till the Ketamine group : Baseline ↔ (other regions) lto et al., end of scan and ketamine administration 2005) Breier et Racemi 0.12mg/k Bolus 50 mins [11C]raclop Bolus & Control group: Baseline and Str 6/9 N/A (11%) al., c g (bolus) after tracer ride Infusion saline 1998(Br and and 1 hour Ketamine group : Baseline eier et 0.65mg/k infusion and ketamine administration al., g 1998a) (infusion) /hour=0.8 8 Kegeles Racemi 0.12mg/k Bolus 50 mins [11C]raclop Bolus & Control group: Baseline and Str subregions 5/5 140±53 ↔ et al., c g bolus after start of ride infusion saline 2002(Ke and scan and Ketamine group : Baseline geles et 0.65mg/k 70mins and ketamine administration al., g/hour=0. infusion 2002) 88 Kegeles Racemi 0.2mg/kg Bolus 120 [123I]IBZ Bolus & Baseline scan and ketamine Str 8 191±38 ↔ et al., c bolus mins after M constant administration – within 2000(Ke and tracer and 4 infusion subject geles et 0.4mg/kg hours infusion /hr=1.00

al., 2000a)

Vernalek S- 0.097mg/ 35mins before [18F]- Bolus & Placebo/ Ketamine – within Caudate nucleus, 10 N/A en et al., ketami kg bolus start of scan fallypride constant subject putamen, Thal, (Caudate nucleus) 2012(Ve ne and infusion was infusion ITG, dlPFC rnaleken 0.25mg/ started. et al., ml infusion was 2013) infusion continued for ↔ (other region) 30mins

Smith et Racemi 0+1.5 Infusion over [11C]raclop Infusion Baseline scan and ketamine Str 7 N/A (14%) al., c mg/kg/ho 20mins ride administration – within 1998(Sm ur=0.50 subject ith et al., 1998a) Vollenw S- 0.21+0.8 Bolus over [11C]raclop bolus Placebo/ Ketamine – within Caudate nucleus, 8 N/A (14%) eider et ketami 4/hour=1. 5min ride subject putamen and VS al., ne 47 2000(Vo llenweid er et al., 2000b)

Table 1.2 – PET studies of D2/D3 receptor availability in healthy humans after ketamine infusion compared to control condition

Abbreviations: Ket-ketamine; i.v – intravenous; Ct-cortex; Thal-thalamus; ITG – inferior temporal gyrus; dlPFC – dorsolateral prefrontal cortex; VS – ventral striatum; n/a- not available; b average dose given in the study, c greater reduction in D2/D3 receptor binding potential after ketamine administration indicates greater dopamine release; significant increase, significant decrease, ↔ no significant change

N a the sample size represents the number of subjects per group

1.7.2 Acute ketamine effects on dopaminergic function- Pre-clinical evidence

Our meta-analysis findings highlight that acute ketamine administration (Range of ketamine dose = 18-100mg/kg) significantly increased dopamine levels in the cortex

(Figure 1.7), striatum (Figure 1.8) and nucleus accumbens (Figure 1.9) compared to control conditions in rodents. Interestingly elevations were more pronounced and were significant in in-vivo studies. In contrast dopamine levels were not significantly different following acute ketamine relative to control condition in ex-vivo studies (Figure 1.7).

Remarkably the effect size associated with the dopaminergic change in the cortex and nucleus accumbens following acute ketamine administration is numerically higher compared to the striatum. This is likely due to the higher doses of ketamine used in the studies in the cortex and nucleus accumbens (Range of ketamine doses in cortex=

18-100mg/kg; Range of ketamine doses in nucleus accumbens 10-100mg/kg), compared to the doses in striatum (Range of ketamine dose= 10-50mg/kg).

Alternatively it is possible that ketamine results in higher dopamine release in the cortex and nucleus accumbens compared to the striatum. Future studies are required to directly investigate dopamine release in those regions following the same dose of ketamine administration.

Furthermore acute ketamine administration did not alter dopamine levels as compared to control conditions in the other brain regions such as the hippocampus, brainstem and ventral pallidum (Irifune et al., 1997, Littlewood et al., 2006b, Irifune et al., 1991a)

Figure 1.7: Effects of acute ketamine administration on dopamine levels in the cortex in rodents. Figure copied from Kokkinou et al., In press (Kokkinou, In press)

Figure 1.8: Effects of acute ketamine administration on dopamine levels in the striatum in rodents. Figure copied from Kokkinou et al., In press (Kokkinou, In press)

Figure 1.9: Effects of acute ketamine administration on dopamine levels in the nucleus accumbens in rodents. Figure copied from Kokkinou et al., In press (Kokkinou, In press)

1.7.3 Chronic ketamine’s effects on the dopaminergic function- Pre-clinical evidence

Importantly not many studies investigated the effects of chronic sub-anaesthetic doses of ketamine on the dopaminergic systems to permit for a meta-analysis. Nonetheless evidence suggests that chronic administration of ketamine is associated with increases in dopamine levels relative to control conditions in the cortex in rodents

(Chatterjee et al., 2012a, Lindefors et al., 1997b, Tan et al., 2012). In the striatum the results are inconsistent with one study reporting increases in dopamine levels and two studies no effect. The null results in the latter studies could be attributed to the lower doses of ketamine used in one study (15mg/kg in liquid diet) (Micheletti et al., 1992) and the methodology used to assess dopamine levels in the other study (Tan et al.,

2012). Moreover as compared with control conditions, chronic administration of

52 ketamine did not result in changes in dopamine levels in the hippocampus, midbrain and cerebellum (Tan et al., 2012, Chatterjee et al., 2012c).

1.7.4 Effects of ketamine on dopamine neuron firing

A total of four studies have assessed ventral tegmental area (VTA) dopamine neuron firing following acute ketamine administration and showed increase in dopamine neuron population activity (French and Ceci, 1990, El Iskandrani et al., 2015c, Belujon and Grace, 2014b, Witkin et al., 2016). One study investigated the effects of chronic ketamine administration on dopamine neuron firing and reported no change (El

Iskandrani et al., 2015c).

1.7.5 Effects of anaesthetic doses of ketamine on the dopaminergic system in rodents

Interestingly all rodent studies investigating the effects of anaesthetic dose of ketamine

(>100mg/kg) reported consistently no change in dopaminergic measures compared to control conditions (Irifune et al., 1997, Irifune et al., 1991b, Ke et al., 2008, McCown et al., 1983).

1.7.6 Ketamine’s effects on the dopaminergic system in non-human primates-

Pre-clinical imaging studies

The majority of microdialysis studies investigated the effects of anaesthetic dose of ketamine on the dopaminergic systems (Table 1.3). Three out of four studies reported no change in dopamine levels in the cortex and striatum following acute ketamine administration (Yamamoto et al., 2013a, Onoe et al., 1994, Tsukada et al., 2000a).

Interestingly one study reported a small yet significant increase in dopamine levels

(30%) in the striatum (Adams et al., 2002).

In vivo PET imaging studies in non-human primates reported significant increases in striatal dopamine synthesis capacity using anaesthetic dose of ketamine (3 and

10mg/kg) (Tsukada et al., 2000a) (Table 1.4). Furthermore studies showed increase in dopamine release in the striatum as measured by reduction in D2/D3 receptor availability using both sub-anaesthetic (0.5mg/kg) (Hashimoto et al., 2016) and anaesthetic dose of ketamine (3 and 10mg/kg) (Tsukada et al., 2000a). Although studies of dopamine release and synthesis reported consistent findings, studies of dopamine transporter availability yielded mixed results. Whilst sub-anaesthetic dose of ketamine showed no changes in the dopamine transporter (DAT) availability

(Yamamoto et al., 2013b), studies that investigated anaesthetic dose of ketamine reported increases in the DAT availability (Tsukada et al., 2000a, Tsukada et al., 2001,

Harada et al., 2004b). Studies in non-human primates should be interpreted with caution due to the small sample size (Range of n used= 3-5 subjects).

Importantly no study investigated the effects of chronic ketamine administration on the dopaminergic measures in non-human primates.

ROI Study N a Dose and Duration When the outcome Study design/ Method DA release/levels route of of investigated Control administr treatment comparison ation of Outcome Result (% Diff) ketamine measure (mg/kg) Cortex Yamamoto 3 1.5 i.v Acute: 3 hours after start of Within subject/ Microdialysis, DA levels (% ↔ et al., 2013 Infusion infusion saline reverse-phase- baseline) over 3 HPLC-ECD hours Str Adams et 2 (8 5 i.m Acute, i.m 45 min after injection Within subject/ MRI-directed in vivo DA (% al., 2002 eve from baseline microdialysis, baseline) 30% over nts) HPLC-ECD baseline Onoe et al., 3 5 i.m Acute, i.m 2hr30mins after Within subject/ microdialysis and Dopamine ↔ 1994 injection from baseline HPLC release Tsukada et 4 3 and 10 Acute: 120mins after start of Within Microdialysis and Dopamine ↔ al., 2000 mg/kg/hr Infusion infusion subject/saline HPLC release infusion over 2 posterior hours tibia vein cannula

Table 1.3 – Copied from Kokkinou et al., In press (Kokkinou, In press). Acute and chronic microdialysis studies of dopamine levels in non- human primate studies.Abbreviations: Ct- cortex; Str- striatum; DA- dopamine; Ket- ketamine; HPLC-ECD-High-performance liquid chromatography electrochemical detection, i.m - intra muscular; i.v – intravenous; ↑ significant increase, ↓ significant decrease, ↔ no significant change N a the sample size represents the total number of animals used for the comparison in question Note that in non-human primate studies the dose of 3 mg/kg used is sufficient to cause anaesthesia. 1.5mg/kg is interpreted as sub-anaesthetic dose.

Dopami Study Keta Ketamin State Duratio When Ligand Radiot Study Analytical Region Na Outcome Change in dopamine ne mine e dose of n of the racer design/ method of measure measure after system and animal treatme outcome admini Control interes ketamine infusion studied route of nt investiga stratio group t compared to control administ ted n condition ration

Dopamin Tsukada Race 3 and 10 Anaest Infusion 30 mins L-[ β - i.v Within/ Graphical Str 4 Dopamine e et al., mic mg/kg/hr hetized througho prior to 11C]DO saline analysis ( L- synthesis synthesis 2000(Tsu , i.v ut scan scan PA [ β - rate kada et 11C]DOPA) al., 2000b) Dopamin Hashimo R and 0.5mg/kg Sub- Infusion After the [11C]ra i.v saline Reference Caudat 4 Δ D2/3 29% (S- e release to et al., S- anaesth 40 mins end of cloprid tissue model e/puta receptor Ketamine) 2017(Ha ketam etized infusion e men binding shimoto ine potential c ↔ No change (R et al., Ketamine) 2016)

Tsukada Race 3 and 10 Anaest Infusion 30 mins [11C]ra i.v Within/ Kinetic Str 4 Δ binding et al., mic mg/kg/hr hetized througho prior to cloprid saline analysis potential c 2000(Tsu , i.v ut scan scan e ([11C]raclopr kada et ide) al., 2000b)

Dopamin Tsukada Race 3 and 10 Anaest Infusion 30 mins [11C]β- i.v Within/ Kinetic Str 4 DAT e et al., mic mg/kg/hr hetized througho prior to CFT saline analysis binding transport 2000(Tsu , i.v ut scan scan ([11C]β- potential er kada et CFT) al., 2000b) Yamamo Race 0.5 & Sub- Infusion After the [11C]β- Bolus Within/ Reference Ct, Str, 5 DAT ↔ No change to et al., mic 1.5mg/kg anaesth 40 mins end of CFT i.v saline tissue model Midbra binding 2013(Ya etized infusion in, Thal potential mamoto

et al., 2013b) Harada et Race 3mg/kg/h Anaest Infusion 60 mins [11C]β- i.v Within/ Kinetic Str 3 DAT ([11C]β-CFT) al., mic r hetized througho before CFT & saline analysis binding 2004(Har ut scan tracers [11C]β- potential ↔ No change ada et al., CIT-FE ([11C]β-CIT-FE) 2004a) Tsukada Race 3 and 10 Anaest Infusion 60 mins [11C]β- i.v Within/ Kinetic Str 5 DAT (3mg/kg) et al., mic mg/kg/hr hetized througho before CFT & saline analysis binding 2001(Tsu , i.v ut scan tracers [11C]β- potential kada et CIT-FE al., 2001)

Table 1.4 – Copied from Kokkinou et al., In press (Kokkinou, In press). PET studies of dopaminergic function in non-human primates after ketamine administration compared to control. Abbreviations: Ct- cortex; Str- striatum; DA- dopamine; DAT- dopamine transporter; Thal – thalamus; i.m - intra muscular; i.v – intravenous; n/a-not available, N a the sample size represents the total number of animals used for the comparison in question; c greater reduction in D2/D3 receptor binding potential after ketamine administration indicates greater dopamine release;

↑ significant increase, ↓ significant decrease, ↔ no significant change

1.7.8 Theorized mechanism of action of ketamine in mediating the dopaminergic alteration

The association between synaptic excitation and inhibition is important for many brain functions (Isaacson and Scanziani, 2011). The theorized mechanism of action of ketamine is summarized in the following figure (Figure 1.10). NMDAR antagonists have been shown to reduce GABAergic neuron firing (Homayoun et al., 2005). These neurons are important for mediating excitatory-inhibitory balance. Upon ketamine binding there is reduction in firing of these GABAergic interneurons thus disinhibition of glutamatergic projections occurs and consequent increase in glutamate release

(Stone et al., 2012, Kim et al., 2011b, Abdallah et al., 2015, Esterlis et al., 2017).

Increase in glutamate results in the activation of midbrain dopamine neuron firing.

Specifically evidence shows that the ketamine-induced activation of midbrain dopamine neuron firing is glutamate-dependent, since the increase in dopamine neuron firing is prevented by the administration of an AMPA receptor antagonist namely 2,3-dihydroxy-6-nitro-7-sulfamoyl-benzo[f]quinoxaline-2,3-dione (NBQX) in the midbrain (El Iskandrani et al., 2015b). Increase in dopamine neuron firing subsequently leads to dopamine release in the projection targets such as the striatum

(Figure 1.10).

(A) Before ketamine

STR

SN VTA

(B) Following ketamine

STR

SN VTA

Figure 1.10: Proposed mechanism of ketamine’s action on the dopamine system. Adapted from Kokkinou et al., In press (Kokkinou, In press). Ketamine (green) blocks the NMDA receptors (purple) on GABAergic interneurons (blue), thus disinhibiting glutamate neurons (black) projecting to dopamine neurons in the midbrain, increasing glutamate release and subsequently increasing dopamine neuron firing (red) and thus increasing dopamine levels in projection targets such as the striatum and cortex.

1.9 Behavioural tests- Role of dopamine

The following section provides a summary of the effects of ketamine on the behavioural tests that have been linked to the dopaminergic system in rodents.

1.9.1 Locomotor sensitization

Locomotor sensitization presents a behavioural phenomenon whereby subsequent drug exposure leads to enhanced behavioural responses (Jentsch and Roth, 1999a,

Robinson and Berridge, 1993). Several classes of drugs of abuse induce locomotor sensitization in rodents (Scofield et al., 2016). This effect can be measured by quantifying the locomotor activity following repeated drug injections (Robinson and

Berridge, 1993). Importantly the expression of locomotor sensitization to stimulants such as cocaine, has been linked to alterations in the dopaminergic neurotransmission in the striatum and nucleus accumbens (Kalivas and Duffy, 1990). Specifically repeated cocaine administration as compared to single cocaine injection significantly elevated dopamine levels in the nucleus accumbens in rats (Kalivas and Duffy, 1990).

Table 1.5 provides the summary of the two studies investigating ketamine-induced locomotor sensitization in rodents. Specifically 10mg/kg but not 3mg/kg dose of ketamine induced locomotor sensitization from day 5 of treatment (Wiley et al., 2011).

Additionally an intermittent low dose of ketamine (5mg/kg in male rats and 2.5mg/kg in female rats, once weekly for 7 weeks) induced locomotor sensitization in rats

(Strong et al., 2017). Interestingly ketamine-induced locomotor sensitization was associated with significantly increased dendritic spine density in the nucleus accumbens (Strong et al., 2017). Importantly the effect of intermittent or repeated ketamine administration on the dopaminergic system in vivo in rodents has not been investigated and associations with locomotor sensitization to ketamine do not exist in the literature.

Study N a Sex Dose and Duration of When the Study design/ Locomotor sensitization route of treatment outcome Control administr investigated comparison ation of Outcome measure Result ketamine (mg/kg) Wiley et al., 24 F 3 and Once daily for Immediately for Between/Within Number of ↔ (3mg/kg) 2011(Wiley 10mg/kg, 5 days, 2 days 20min interactions; saline photocell beam (10mg/kg) et al., 2011) i.p drug free and group interruptions once daily for 5 days again Strong et al., 27(M) M, Escalating 4 ketamine Two weeks Between/ Number of beam 2017(Strong , 24 F doses of 0, injections with following last ket Compared to saline- breaks ↔ M, F (2.5mg/kg) et al., 2017) (F) 2.5 and 3-4 days apart injection and pre-treated group Both M&F (5mg/kg) 5mg/kg, i.p immediately for 3 hours

Table 1.5– Studies of ketamine-induced locomotor sensitization in rodents Abbreviations: Ket- ketamine; F- female; M-male; i.p - intra peritoneal; ↑ significant increase, ↓ significant decrease, ↔ no significant change N a the sample size represents the total number of animals used for the comparison in question

1.9.2 Latent inhibition

In this section the terminology used is explained in Box 1.

Box 1

Hedonia: ‘’The interoceptive sensation of pleasure’’ (Di Chiara and Bassareo, 2007)

Reward: ‘’The unconditioned motivational stimulus supplied with hedonic properties which

can serve as positive reinforcers‘’ (Di Chiara and Bassareo, 2007).

Reinforcement: ‘’A consequence that will increase future behaviour whenever that

behaviour is preceded by a specific stimulus.’’

Positive reinforcer: ‘’An event which will increase the chance of a behavioural response

on which it is contingent’’ (Everitt and Robbins., 2005).

Negative reinforcer: ‘’An event that when omitted will increase the chance of a

behavioural response on which it is contingent’’ (Everitt and Robbins., 2005).

Conditioning: The process by which a conditioned stimulus such as a tone/white noise

following a number of pairings with an unconditioned stimulus such as a footshock elicits

fear response in the absence of the unconditioned stimulus.

From an evolutionary perspective, the ability to ignore irrelevant stimuli in the environment is important so that attention can be directed on important stimuli for the survival of the species. Latent inhibition is the term used to describe the innate retardation in learning about a neutral cue (conditioned stimulus) which has been rendered familiar by being repeatedly presented without reinforcement (Lubow, 1973).

This phenomenon, which is generalised across the animal kingdom, is used to index the capacity of organisms to ignore irrelevant stimuli (Bonardi et al., 2016, Moser et al., 2000). Moreover it has been suggested that latent inhibition presents stimulus selectivity (Lubow and Gewirtz, 1995). In light of this view, latent inhibition is a way to

62 filter out non-consequential and thus irrelevant stimuli in the environment and focus on potentially relevant events (Lubow and Gewirtz, 1995).

Latent inhibition (LI) predominantly acquires a between-subjects design. LI usually encompasses three phases. In the first phase the experimental group (PE-Pre-

Exposure group) is presented with the to-be-conditioned stimulus, and the control group (NPE-Non Pre-Exposure group) is not presented with that stimulus.

Subsequently at the second phase of the experiment, both groups are presented with the stimulus followed by the presence of an important event either reinforcement or punishment. Consequently in the third phase, both groups are presented with the conditioned stimulus and the experimental group (PE) as compared to the control

(NPE) group exhibits delayed conditioning. This response is suggested to be reflective of the attention given to the stimulus (Kaye and Pearce, 1984), under the assumption that subjects need to attend to the stimulus in order to learn about the consequences of that stimulus. Thus the level of conditioning to a stimulus would be indicative of the level of attention the stimulus received (Kaye and Pearce, 1984, Tsakanikos, 2003).

Consequently, latent inhibition is believed to reflect the ability to ignore irrelevant stimuli (Swerdlow et al., 1996).

1.9.2.1 Latent inhibition- The role of dopamine

In this section I will provide the evidence which revolves around the role of dopamine in conditioning and latent inhibition. The role of dopamine in reward and reinforcing situations is well established. Specifically microdialysis studies in freely moving rats showed associations between dopamine increases and positively reinforced behaviours (Box 1) such as eating and drinking (Young, 1993, Joseph et al., 2003).

However the view that dopamine release in the NAc is associated with reward has been challenged since dopamine release has been associated with aversive stimuli

63 as well. Interestingly whilst the majority of studies report increases in dopamine neuron firing rates and extracellular dopamine in response to aversive stimuli such as mild footshock, tail pinch and social defeat (Horvitz et al., 1997, Horvitz, 2000, Joseph et al., 2003), other studies report no effect or even decrease in dopamine measures associated with aversive stimuli (Levita et al., 2002, Di Chiara et al., 1999). The NAc is subdivided into three sub-territories namely the shell, core and rostral pole (Zahm and Heimer, 1993). Thus one explanation for the discrepancy in aversive stimuli findings and also in reward could be attributed to the NAc location of the measurements as functional differences in NAc shell and core have been reported (Di

Chiara, 2002).

Furthermore increases in dopamine levels have been associated with conditioned stimulus-unconditioned stimulus (CS-US) pairings, and those increases were over and above dopamine increases reported during US presentation alone (Young, 1993,

Young et al., 1998, Young, 2004) and in the absence of motivation (Young et al.,

1998). Subsequent studies showed that dopamine increases were evident at the second and subsequent pairing presentations of the CS-US pairings, thus dopamine release provides information regarding the status of the stimulus (Young, 2004).

During the second but not the first pairing the CS stimulus (such as the tone) has motivational value.

Collectively the aforementioned data support the hypothesis that dopamine release in the NAc during conditioning is potentially associated with appetitive and aversive stimuli, and neutral stimuli predictive of either, as well as reward processing and motivation. The aforementioned results are also in support of the alternative hypothesis that dopamine release is representative of the importance (salience) of the stimulus to the animal. Importantly dopamine release in the NAc is indicative of the

64 salience aspect that is the common denominator of the stimuli. Therefore the role of the dopaminergic system in conditioning revolves around salience and in particular the regulation of salience via prior behavioural occurrence (Young et al., 2005). These phenomena are under the umbrella of the learned inattentions, the commonly used example being latent inhibition. In particular, converging evidence suggests an association between disruption of latent inhibition and the dopaminergic system.

Specifically studies reported disruption of latent inhibition following amphetamine administration (Solomon et al., 1981), thus supporting the role of dopamine in this attention outlook. Subsequent studies showed that the effects of amphetamine on latent inhibition were mediated within the mesolimbic dopaminergic circuit (Joseph et al., 2000).

1.9.2.2 Ketamine and latent inhibition- Preclinical evidence

To investigate the effects of ketamine on latent inhibition a PubMed search using the search terms ‘ketamine’ AND ’latent inhibition’ was conducted. A total of four studies were not considered relevant since one study was a review (Amann et al., 2010) and three studies did not investigate the effect of ketamine on latent inhibition (Zimmer and

Goshgarian, 2007, Gaisler-Salomon et al., 2009a, Romero-Alejo et al., 2016). Thus a total of seven studies which investigated the effect of ketamine on latent inhibition are included in table 1.6. The data are consistent with six out of seven studies reporting disruption of latent inhibition following ketamine administration (Range of ketamine dose= 10-100mg/kg) as compared to control conditions. In contrast one study reported potentiation of latent inhibition in the ketamine-treated group compared to the control conditions (Calzavara et al., 2009b). Interestingly sub-chronic ketamine treatment during the second postnatal week resulted in disruption of latent inhibition in

65 adulthood. Implications of LI deficits or potentiation could involve changes in attention

(Weiner and Feldon, 1997) or associative learning (Escobar et al., 2002).

Study N a Sex Dose and Duration of Outcome measure When the outcome Study CS-US pairing, protocol Latent inhibition route of treatment investigated design/ phases administr Control ation of comparis ketamine on Result (mg/kg) Aguado et al., 30 M 25mg/kg Acute & once Mean sucrose 40min post drug Saline Sucrose and LiCl ↓ (before PE) 1994(Aguado daily for 3 days consumption injection group injectiona, 3-stage ↔ (before each of et al., 1994) before testing protocol the 3 phases of LI) Gallo et al., 30 M&F 50mg/kg, Once daily for 3 Mean sodium Following each PE Naïve sodium saccharin and ↓ (following each 1998(Gallo et i.p days after each saccharin intake control LiCl injectiona, 2-stage PE) al., 1998) PE protocol

Becker et al., 58 M 30mg/kg, Chronic: Once Conditioned 4 weeks after last Saline Light and sound (CS) ↓ 2003(Becker i.p daily for 5 reactions drug injection group and footshock (US); 3- et al., 2003) consecutive days stage Razoux et al., 24 M 25mg/kg, Acute: 20min prior Percentage freezing On day 4 (2 days Saline Tone and mild eyelid ↓ 2007(Razoux i.p to PE after last drug group shock 3-stage (2 days et al., 2007) injection) of PE) Calzavara et 20 M 10mg/kg Acute: 15min prior Freezing response 15min post drug Saline Context and Foot shock ↑b al., to training administration group (CS), 2-stage 2009(Calzavar training started a et al., 2009a) Mickley et al., 8, N/A 100mg/k Acute: one hour Mean mouths and 48 hours post Saline Allicin (CS), LiCl, 3- ↓ 2014(Mickley 39c g (Dams prior to PE Licks (ingestive conditioning group staged et al., 2014) received orofacial motor i.p) reponses) Jeevakumar et 20 M 30mg/kg Chronic: PND 7, 9 % sucrose Tested as adults Saline Sucrose and LiCl ↓ al., and 11 preference group injectiona, 3-stage 2015(Jeevaku protocol mar et al., 2015)

Table 1.6: Acute and chronic studies of ketamine’s effects on latent inhibition amalaise-inducing agent LiCl induced state of illness- aversive stimulus, b contextual fear conditioning used: the reduction in freezing response compared to saline-treated group- please note that there are no non-pre-exposure control groups in this experiment), c N1= number of dams; N2= number of foetuses, d Dams were injected with allicin (garlic taste) on PE day, on conditioning day dams were injected with allicin and on testing day foetuses received oral infusion of Allicin and underwent behavioural testing. Abbreviations: M- Male, F-female, LiCl- lithium chloride, PE- pre-exposure to the to-be conditioned stimulus↔- no effect; ↓ disruption of latent inhibition; ↑potentiated latent inhibition, PND- postnatal day

1.9.3.1 Incentive motivation – The dopamine hypothesis

Studies showed that dopamine receptor antagonists were associated with reductions in animal’s instrumental response to rewarding (Box 1) effects of food (Wise et al.,

1978), water (Gerber et al., 1981) and drugs of abuse such as cocaine (De Wit and

Wise, 1977). These observations led to the reconceptualization of dopamine’s role in the brain from the predominant role in motor function to the role in motivation.

Specifically studies investigating the association between behaviour and impaired dopaminergic neurotransmission in rodents (Robbins and Everitt, 1996) and humans

(Knowlton et al., 1996) provided support for the motivational role of dopamine projections to the nucleus accumbens and frontal cortex. Furthermore studies of electrical self-stimulation in rodents implicated the mesolimbic dopamine system in motivational function (Wise, 2002).

‘’Incentive motivation refers to the priming or the drive-like effects of an encounter with an otherwise neutral stimulus which has acquired motivational importance through prior association with a reward’’ (Wise, 2004). Moreover the dopamine hypothesis of incentive-motivation posits that dopamine is essential in incentive motivation which precedes the earning of the reward in addition to the reinforcement which follows a reward (Wise, 2004). In contrast dopamine is considered to be relatively uninvolved in the hedonic reaction to reward. Interestingly the dopamine transporter (DAT) knockdown mice which display 70% increase in synaptic dopamine, or autoDrd2KO mice which showed increased dopamine synthesis, display increased motivation for food reward with intact orofacial liking reactions (Pecina et al., 2003, Bello et al., 2011).

Importantly a mouse model which overexpresses striatal dopamine receptors was associated with deficits in incentive motivation and no changes in hedonic reactions to reward (Simpson et al., 2011). Interestingly haloperidol which is a dopamine D2

68 receptor antagonist has been shown to enhance resistance to extinction thus yielding the assumption that intermittent application of neuroleptics blunt the reward value of food (Ettenberg and Camp, 1986). It is hypothesized that neuroleptic-induced D2 blockade is functionally equivalent to the omission of the reward (Wise, 2004).

1.9.3.2 Ketamine and incentive motivation- Preclinical studies

Furthermore a total of three studies investigated the effect of ketamine (Range of ketamine dose 10-100mg/kg) on incentive motivation in rodents. Results are inconsistent as can be seen in table 1.7. One of the two studies investigating chronic effects of high dose but not low dose of ketamine compared to control conditions reported deficits in incentive motivation for food reward (Wright et al., 2007). A potential explanation for no effect in Faetherstone et al., 2012 study could be attributed to the lower dose of ketamine used in that study. Interestingly the same study reported significantly reduced extinction during the second day suggesting deficits in behavioural flexibility (Featherstone et al., 2012). Acute ketamine administration is associated with decrease in incentive motivational value of reward-related cues

(Fitzpatrick and Morrow, 2017).

Study N a Se Dose and Duration of When the Study design/ Behavioural Reward Incentive motivation x route of treatment outcome Control test administra investigated comparison tion of Outcome Result ketamine measure (mg/kg) Featherstone 22 M 20mg/kg Chronic: once Not clear Control saline- Progressive 5% Number of ↔ et al., daily for 14 treated group ratio sucrose reinforcers earned 2012(Feathers days tone et al., 2012) Wright et al., 31, F 10 and Chronic: Once One day following Control (tap Progressive Food Response rate ↓ (100mg/kg) 2007(Wright et 38 a 100mg/kg; daily for 9 treatment water) group ratio reinforcers al., 2007) orogastric months ↔ (10mg/kg) gavage Wright et al., 15, F 10 and Chronic: Once 2 weeks Control (tap Progressive Food Response rate ↔ 2007(Wright et 16a 100mg/kg; daily for 9 withdrawalb water) group ratio reinforcers al., 2007) orogastric months gavage Fitzpatrick and 28 M 32mg/kg Acute a)30min and Control saline- Pavlovian Banana- Number of lever ↓ (30min and Morrow., b)one day after treated group conditioned flavoured press 1 day post 2017(Fitzpatric treatment approach food treatment) k and Morrow, pellets 2017)

Table 1.7: Acute and chronic studies of ketamine’s effects on incentive motivation a Depicts the total sample size of subjects treated with 100mg/kg ketamine or 10mg/kg ketamine and controls. b Subjects previously treated with 100mg/kg ketamine, received 10mg/kg ketamine and subjects previously treated with 10mg/kg ketamine received equivalent volume of tap water for one week and then the following week they all received water. This two-step withdrawal process was used to prevent withdrawal-induced seizures.

↔- no effect; ↓ in number of lever press and response rate is associated with deficits in incentive motivation

Summary

1.10 Mind the ‘gap’ between ketamine and dopamine

The aforementioned evidence supports that ketamine’s effects on the dopaminergic system are likely linked to its abuse potential, antidepressant effects and its likelihood as a model of the pathophysiology of schizophrenia. Importantly no studies investigated the effects of chronic ketamine administration on the dopaminergic function using translational in vivo imaging techniques.

1.11 Aims of this thesis

Therefore investigations of the effects of sub-chronic ketamine administration on the dopaminergic function using in vivo translational technique μPET are required. In this thesis I will present investigations of the dopamine synthesis capacity following sub- chronic ketamine administration in the male mouse. Additionally I will explore whether sub-chronic ketamine’s effects on the dopaminergic system are mediated via midbrain dopamine neuron activation. Interestingly I will investigate the sub-chronic ketamine’s effects on behavioural measures that have been linked to the dopaminergic system namely incentive motivation for sucrose reward, locomotor sensitization and latent inhibition of fear response.

1.12 Hypotheses and outline of thesis

The following hypotheses are associated with this thesis:

1) Sub-chronic ketamine administration compared to control conditions will induce

locomotor sensitization in the male mouse.

2) Sub-chronic ketamine administration as compared with control condition will be

associated with elevation in dopamine synthesis capacity.

3) If hypotheses 1&2 are correct: Midbrain dopamine neuron activation will be

required for the effects of sub-chronic ketamine administration on dopamine

synthesis capacity elevation and locomotor sensitization.

4) Sub-chronic ketamine administration as compared with control conditions will

be associated with alterations in locomotor sensitization to cocaine.

5) If hypothesis 4 is correct: Sub-chronic ketamine administration effects on

cocaine-induced locomotor sensitization would be dependent on midbrain

dopamine neuron activity.

6) Sub-chronic ketamine administration as compared to control condition will

disrupt latent inhibition in a conditioned fear paradigm.

7) Sub-chronic ketamine administration as compared to control condition will

induce reduction in incentive motivation.

To address the hypotheses I used in vivo µPET imaging technique to measure dopamine synthesis capacity. In addition I used a novel chemogenetics approach to specifically alter midbrain dopamine neuron firing to deconstruct the mechanism by which ketamine mediates its effects on the dopaminergic system and behaviours in the male mouse. The chemogenetics approach is explained in detail in the following chapter. In summary it is a novel technology which enables the manipulation of specific sub-populations of neurons in the mouse brain in vivo. It works in the following way:

72 a) injection of a viral construct carrying the sequence of a mutated G protein coupled receptor (GPCR) in the brain region of interest (in this case the midbrain), b) expression of the construct occurs via Cre recombination in the neurons which are only expressing Cre recombinase (in this thesis iDATCre mice were used, thus dopamine neurons expressed Cre recombinase), c) application of an otherwise pharmacologically inert ligand leads to the activation of the GPCR subsequently triggering the activation of a signalling pathway which leads to either activation or inhibition of neuron firing. Moreover I investigated the sub-chronic ketamine’s effects on behavioural tests that have been linked to the dopaminergic system, namely locomotor activity, latent inhibition of fear response and incentive motivation using the progressive ratio task for sucrose reward. Detailed descriptions of the methods are found in chapter 2 (Methods chapter) as well as in the methods sections in chapters

3-5 (Results chapters). Specifically hypotheses 1 and 2 will be addressed in chapter

3, hypothesis 3 in chapter 4, and hypotheses 4-7 in chapter 5. Lastly in Chapter 6 I will discuss the implications for understanding psychiatric disorders, and provide comparisons of the main experimental findings with stimulants and other NMDAR antagonists as well as highlight future research directions and ongoing experiments in this context.

Chapter 2- Materials and methods

2.1 Introduction

The study approval and subjects’ characteristics are described in this chapter.

Furthermore, the choice of the ketamine dosing regime and summary of the overall experimental approach are described. In addition the in vivo behavioural experiments are followed by a detailed explanation of the Positron Emission Tomography (PET) methodology. Moreover, a description of the methods used in the Designer Receptors

Exclusively Activated by Designer Drugs (DREADD) experiments and in vitro experiments is explained. This is followed by statistical analysis sections.

2.2 Ethics/study approval

All procedures for the preclinical studies contained in this thesis were approved by the

British Home Office Animal Scientific Procedures Act 1986 and Regulation 7 of the

Genetically Modified Organisms (Contained Use) Regulations 2000 under PPL

70/7438 entitled ‘Mechanisms of regulating energy homeostasis’ held by Professor

Dominic J. Withers. In addition the approval for the preclinical studies was set up for

Imanova imaging centre to administer radioligand in rodents for research purposes and the positron emission tomography (PET) scanning was carried under PPL

70/7332 renewed in 2016 to P4FE0C603 entitled ‘Preclinical imaging in biomedical research’ held by Mrs Sharon Ashworth. All procedures were performed in accordance with the ASPA 1986 and EU directive 2010/63/EU.

2.3.1 Animals

All experimental procedures were done in male mice 8-10 weeks of age. Mice were housed in individually ventilated cages, 2-5 mice per cage. Each cage had sawdust bedding, a tongue depressor, two paper tissues and at least one tunnel. Food and

75 water were available ad libitum unless otherwise noted and maintained under a constant 12-h light-dark cycle (light on 7:00 a.m.). The food was normal chow diet with

15.1% energy (MJ/kg) (RM3 SDS UK Ltd; http://www.sdsdiets.com/pdfs/RM3-E-

FG.pdf). Male C57BL/6 mice were obtained from Charles River Laboratories.

2.3.2 DAT-Cre transgenic mice

Furthermore for the DREADD experiments (see below) male iDAT Cre heterozygous mice on a C57BL/6 were used. The original DAT-Cre heterozygous mice were kindly gifted by Professor Francois Tronche (University of Pierre and Marie Curie, Paris) and mice were maintained on C57BL/6 genetic background. Mr Darran Hardy helped with the maintenance of the DAT-Cre colonies. Furthermore to test the successful insertion of Cre transgene into the genome of transgenic mice, and thus determine genotyping, the genomic DNA was extracted and subsequently Cre gene sequences were amplified using the polymerase chain reaction (PCR) technique and visualized by gel electrophoresis as illustrated in the following two subsections (2.3.3 and 2.3.4).

2.3.3 Genomic DNA extraction from mouse tails

DNA was isolated by an alkaline hydrolysis (NaOH) extraction procedure. Briefly 3-

4mm of mouse tail tips were placed in a 1.5ml Eppendorf tube, 300µL of 0.06M NaOH was added in each tube and then the samples were incubated for 10 min at 100°C in a heating block. Subsequently the samples were cooled down for 10min at room temperature and 50µL of 1M Tris pH 7.5-8 was then added in each tube to neutralise the solution. The samples were then vortexed and centrifuged for 30 seconds. 1 µl of the supernatant was used for the following genotyping step.

2.3.4 DAT-Cre genotyping strategy

The genotypes of iDAT Cre mice were confirmed routinely by standard PCR amplification-based genotyping. 1µl of genomic DNA was added to 0.25 µM forward and reverse primers (common primer CCAGCTCAACATGCTGCACA, mutant reverse primer GCCACACCAGACACAGAGAT) and 13 µl of PCR reagent mixture (Reddymix

PCR Master Mix, ThermoScientific, USA). The reactions were carried out in a 15 µl final volume in a thermocycler (C100, BioRad) under the following PCR machine settings 1. 95°C for 3 mins, 2. 95°C for 30sec, 3. 60°C for 30sec, 4. 72°C for 1min, 5.

Repeat 5 times, 6. 95 °C for 30 sec, 7. 58°C for 30sec, 8. 72°C for 1min, 9. Repeat 25 times, 72°C for 6 min, 11. 12°C for 3min. The PCR products, alongside the DNA ladder, were separated by gel electrophoresis on a 3% agarose gel prepared with Tris acetate EDTA (ethylenediaminetetraacetic acid) (TAE) buffer and stained with 0.02% ethidium bromide. The DNA positive band was subsequently imaged by illumination with ultraviolet light (Figure 2.1). Ms Maria Paiva Pessoa helped with the genotyping of the Dat Cre mice from January 2016 onwards.

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16

Figure 2.1: A representative example of electrophoresis separation of the genotyping products. 1, 2, 4,

5, 6, 8, 10, 12, 13, 14, and 15 indicate the presence of the Cre transgene in these mice.

2.4 Drugs and route of administration

Ketamine hydrochloride solid (Sigma Aldrich) was dissolved in 0.9% saline solution in

6mg/ml, injected at a volume of 5ml/kg of body weight, thus administered at a dose of

30mg/kg. Entacapone solid (40mg/kg) (Sigma Aldrich) was dissolved in 10% dimethyl sulfoxide (DMSO) and 0.9% saline. Benserazide hydrochloride solid (10mg/kg)

(Sigma Aldrich) was dissolved in de-ionised water. To prepare 25mg/ml Clozapine N-

Oxide (CNO) stock solution, 1g of CNO (Key Organics) was dissolved in 1ml of DMSO and 39ml of phosphate buffered saline (PBS’A’), at pH 7.2. CNO was further diluted in

PBS ‘A’ to 0.02mg/ml and injected in DAT Cre mice at a dose of 0.1mg/kg.

2.5 Ketamine dosing regime

Ketamine has demonstrated rapid anti-depressant effects, is a club drug of abuse and has been used as a pharmacological model of schizophrenia in humans, non-human primates and rodents. Evidence suggests ketamine’s effects may involve the dopaminergic system as discussed in Chapter 1. Clinical (Krystal et al., 1994, Rainey and Crowder, 1975, Allen and Young, 1978) and pre-clinical evidence suggests that the sub-chronic as compared to acute ketamine administration models structural and neurochemical changes similar to those observed in schizophrenia patients (Zhang et al., 2008). Please see review by (Jentsch and Roth, 1999a) for summary of acute vs sub-chronic treatment.

Following extensive PubMed and PsychInfo searches (Kokkinou, In press) using the search terms ‘’ketamine’’ and ‘’dopamine’’ five studies investigating the effects of chronic ketamine treatment on dopamine levels were identified (please see Chapter

1) (Chatterjee et al., 2012c, Tan et al., 2012, Micheletti et al., 1992, Li et al., 2015b,

Lindefors et al., 1997a). The median dose of ketamine used was 30mg/kg thus we

78 aimed to study the effects of ketamine on the pre-synaptic striatal dopaminergic function and behavioural outcome measures at this sub-anaesthetic dose. The shortest sub-chronic ketamine treatment duration to elicit behavioural and neurochemical alterations in the rodent at the median dose of 30mg/kg as compared with control conditions was 5 consecutive days (Becker et al., 2003, McNally et al.,

2013). Thus the treatment duration in my experiments was confined to five days. The rationale to use the shortest duration of ketamine treatment was to refine the experiments and thus reduce the number of injections in mice minimizing distress in accordance with the refinement principle of the 3Rs (replacement, reduction, refinement) (https://www.nc3rs.org.uk/the-3rs) in animal research. Moreover in doing so I increased the experimental time-efficiency and reduced costs associated with the experiments. Locomotor activity was assessed on days 1 and 5 of treatment to study behavioural sensitization. Furthermore the pre-synaptic striatal dopaminergic function as measured using in vivo using PET imaging (explained in detail below) and in vitro using biochemical techniques, was assessed two days following the last ketamine administration to investigate whether sub-chronic ketamine treatment elicits lasting alterations in the dopaminergic system.

2.6 Overall experimental design

To address the aforementioned hypotheses the following experimental approaches were designed:

(A) Ketamine experimental pipeline

Ket n= 8 WT n= 16 Sal n= 8

PET/CT scan

Day 1 Day 5 Day 7

(B) DREADD Experimental pipeline

CNO + Ket n= 12 n= 45 iDATCre Sal + Ket n= 13 Surgery hM4Di PET/CT scan expression CNO + Sal n= 9 Sal + Sal n= 11

Day 1 Day 5 Day 7

2 weeks

Figure 2.2: Experimental pipeline. (A) Ketamine experimental pipeline: Mice were treated with ketamine once daily for 5 consecutive days and the outcome measure was tested on day 7.

(B) DREADD experimental pipeline: Mice were treated with clozapine N-oxide (CNO) or saline

30 min prior to ketamine for 5 consecutive days and tested on day 7. Abbreviations: Ket- ketamine; Sal- saline; CNO-clozapine N-oxide; WT- wild type; DREADD- designer receptors exclusively activated by designer drugs; PET- positron emission tomography; CT- computed tomography; DAT-dopamine transporter

2.7.1 Behavioural tasks

Behavioural tasks which were previously associated with the dopaminergic system were studied in the sub-chronic ketamine model.

Syringe

A B

Pre-exposure Conditioning Testing Context B Context A Context B 24 h 24 h

Figure 2.3: Schematic diagrams of behavioural tasks used (Figures modified from Griebel and Holmes., 2013) A- Open field test; B- Progressive ratio task; C- Latent Inhibition task

2.7.2 Open field test

The open field test is one of the most widely used assays to record locomotor activity in the rodent. The open field test relies on the innate behaviour of rodents to explore novel environments. It has been previously used to assess a plethora of experimental manipulations, ranging from psychostimulants (O'Loinsigh et al., 2001), stress (Prut and Belzung, 2003), brain injury (Wali et al., 2014) or NMDA receptor antagonists

(Caixeta et al., 2013).

Dr Elaine Irvine, Ms Justyna Glegola and Dr Paulius Viskaitis helped with the open field experiments. Open field test was performed in a designated dimly lit room devoid of visual and noise disruptions. Mice were transferred to the designated room 10min before the start of the experiment to habituate to the environment (Figure 2.3 A).

Individual open-field arenas (45cm3) which had a base covered in sawdust were used.

Each mouse was placed gently in the centre of the arena for a 20min habituation period. Locomotor activity was recorded using a video tracking software system

Ethovision XT (Noldus Information Technologies, Leesburg, VA, USA). Mice then received an injection of ketamine or saline and were immediately placed back in the arenas. Locomotor activity was assessed for another 60min. To further examine whether ketamine’s effects require midbrain dopamine neuron firing specifically, the

DREADD methodology explained in section 2.10.1 was employed prior to ketamine administration and locomotor activity was measured. For the DREADD experiments, mice were placed in the arenas for a 20min habituation period. They then received an injection of CNO or saline and their activity was visually tracked for 30min. They then received an injection of ketamine or saline and their activity was visually tracked for

60min. Locomotor activity was assessed on days 1 and 5 of the experiments. The outcome measure for locomotor activity was the total distance travelled (cm).

2.7.3 Progressive ratio (PR) operant behaviour task

The progressive ratio (PR) operant behaviour task has been previously used to assess the motivation of rodents indexed as the amount of work they make to gain a reward

(in this case 10% sucrose) (de Jong et al., 2015).

The PR test was conducted in the operant conditioning mouse modular chambers

(20x21.5x13cm) with grid floors (Med Associates Inc) (Figure 2.3 B). Chambers were equipped with photobeam sensors (Med Associates Inc). Mice were on calorie restricted diet to reduce body weight 85% of their starting body weight. Food access was then modified to maintain body weights to the 85% of starting body weight level.

Mice were acclimatized to sucrose in drinking water overnight and normal drinking water was replaced the following morning.

To accustom the mice to the procedure prior to testing, (a) mice were habituated one day to the test chamber with sucrose in both receptacles placed manually, (b) mice underwent magazine training for three consecutive days and sucrose was supplied from a syringe pump into receptacles, (c) mice were then trained for nose poking to the left nose poke hole starting on a fixed-ratio (FR) 1 schedule of reinforcement, meaning that a single nose poke in left nose poke hole elicited the delivery of sucrose solution via a syringe pump into the receptacle. Nose poking on the inactive nose poke hole was without scheduled consequences. The training lasted for 30 minutes.

Following acquisition of the task under this schedule, the response requirement was increased to three and ultimately five nose pokes (for instance, an FR5 schedule of

83 reinforcement). The criterion for progression from one FR to another was the collection of more than 25 rewards on two consecutive days. Subsequently to learning the task motivation for sucrose reward was assessed under a progressive ratio (PR) schedule of reinforcement. The PR task lasted for 2 hours and the response requirement was progressively enhanced following each obtained reward (de Jong et al., 2015).

2.7.4 Latent inhibition of fear response

Latent inhibition (LI) refers to the innate retarded conditioning to neutral cue

(conditioned stimulus) that has been repeatedly presented without reinforcement

(Lubow, 1973). If animals are first pre-exposed (PE) to the conditioned stimulus, they show reduction in the conditioned response following pairing of the neutral stimulus to an unconditioned stimulus (US) compared to animals that are not pre-exposed (NPE) to the conditioned stimulus.

LI was tested in a Med Associates mouse test chamber (24x29x22cm) (Figure 2.3C).

Mice were randomised to four experimental treatment groups. The LI procedure was conducted on days 6-8 and consisted of the following stages according to Barad et al.,

2004 (Barad et al., 2004).

Pre-exposure: A chamber with transparent front and back walls and white floor sprayed with lemon (Context B) was used for the pre-exposure. Mice which belonged to the pre-exposed group were placed in the box and the pre-exposure phase encompassed a 2min habituation followed by 602min, 80dB white noise presentations

(CS), each separated by a 5sec stimulus-free period. The non-pre-exposed group was tested with an equivalent period of time (2h, 7mins) without white noise presentations.

Conditioning: The environment of the chamber was modified such that the white floor was substituted with a metal grid floor and 10% ethanol spray in place of lemon spray was used prior to the conditioning phase (Context A). Mice were placed in the box and conditioning encompassed two pairings of 2min, 80dB white noise presentations (CS) coterminating with 2sec, 0.7mA footshock (US). In addition CS-US pairings were preceded, separated and followed by a 2min stimulus-free period.

Testing: Mice were placed in context B. Testing consisted of 2min habituation period and three 2min 80dB white noise presentations separated by 5sec stimulus- free periods.

The freezing behaviour was continuously videotaped. The outcome measure was the

% freezing response during the testing day and was calculated by the following equation according to Gaisler-Salomon et al., 2009 (Gaisler-Salomon et al., 2009b):

% 푓푟푒푒푧푖푛푔 = 퐵 ÷ (퐵 + 퐴) 퐸푞푢푎푡푖표푛 3 where A represents the percent freezing during the habituation period immediately preceding white noise presentation onset and B represents the average percent freezing during the three white noise presentations (Gaisler-Salomon et al., 2009b).

2.8.1 Positron Emission Tomography (PET) imaging technology

Mouse/human

511keV

Annihilation site 511keV

Detector

Figure 2.4: PET basic physics schematic. PET measures the fate of biological molecules labelled with positron emitters via quantification of the antiparallel emitted annihilation 511keV

γ-photons with a ring of detectors (Figure adapted from (Mandelkern and Raines, 2002).

Positron Emission Tomography (PET) is a molecular imaging technique which measures the concentration of radiolabelled tracers over time to construct three dimensional quantitative images of the rates of physiological processes in vivo.

Clinically and pre-clinically PET has been used in cancer biology to identify and evaluate tumours, as well as in the diagnosis of cardiovascular and autoimmune disease (Gambhir, 2002). Importantly PET constitutes a leading translational tool for brain research to study the different aspects of brain function such as metabolic activity, blood flow and neurochemistry in animal models of neurological disorders

86 such as Parkinson’s disease and Alzheimer’s disease. More recently the development of improved tracers has enabled the study of the more complex pathophysiology of animal models of neuropsychiatric disorders (Virdee et al., 2012). Specifically PET is powerful tool to index aspects of the dopaminergic function in vivo, as opposed to postmortem studies which are confounded by the effects of antipsychotic treatment. In addition PET provides a less invasive alternative to microdialysis procedures in mice and has therefore translational potential to study dopamine function in human.

Furthermore it enables researchers to plan experiments with a longitudinal study design.

In addition the fundamental concept which advanced the development of PET relies on the serendipitous chemical property of certain radionuclides to decay by emitting positrons. The common radionuclides used in PET imaging experiments include carbon (11C), oxygen (15O), nitrogen (13N) and fluorine (18F) and are produced inside a subatomic particle accelerator, the cyclotron, located on site. Accelerated protons are consequently bombarded onto a target, which has atoms of the biochemical compound, producing unstable radioactive isotopes by a nuclear reaction.

Radiolabelled compounds, also known as radiotracers, are injected intravenously in animals and humans. When the radioisotope on the radiotracer decays, the emitted positron travels a short distance (less than 3mm), in so doing it loses energy and subsequently undergoes a process known as annihilation with a nearby electron. The summed mass of the positron and electron is converted into energy in the form of two

511keV γ-photons at 180° to each other (Cherry, 2001). The γ-radiation is detected by the scintillation detectors located around in the ring of the tomograph (Figure 2.4), subsequently determining the distribution of annihilation sites in tissue by a process known as coincidence detection discussed in section 2.8.3.

2.8.2 PET scanner Lutetium Oxyorthosilicate (LSO) crystals <1.5nsec Absolute sensitivity >10% Field of view (FOV) 12.7cm Individual detector elements Over 25000 Spatial resolution <1.4mm

Table 2.1: Characteristics of µPET/CT scanner

The Siemens Inveon µPET/CT system is used for all scanning experiments in this thesis. The characteristics of this system are summarized in table 2.1. Every morning prior to the CT/PET acquisitions I performed the calibrations of the µPET/CT system and the X-ray source conditioning. Inveon Acquisition Workplace (IAW) pre-clinical imaging platform enables the planning, CT/PET acquisitions and reconstructions efficiently from one console (https://www.healthcare.siemens.co.uk/molecular- imaging/preclinical-imaging/inveon-workplace/inveon-acquisition-workplace). The mouse is positioned on the bed of the scanner with the target organ (the brain) in the field of view.

2.8.3 Coincidence detection

Coincidence detection is the method of detecting two anti-parallel γ-photons using scintillator detectors via inorganic scintillator crystals (Scintillation is the process of re- emitting absorbed energy in the form of light). Scintillator crystals emit photons in the visual spectrum upon absorption of a γ-photon. In turn the crystals are connected to photomultiplier tubes (PMT) which amplify the light signal to enable reliable detection.

When photons reach either side of the PET camera over a short time interval the pair of anti-parallel photons are assumed to have arisen from the same annihilation event at a point along a straight line between the two detectors, referred to as a coincidence line. If the time-frame threshold is trespassed photons are not regarded for detection.

The µPET camera comprises over 25000 detector elements (Table 2.1) that form a ring around the mouse.

Furthermore, the PET camera performance is directly linked to the physical and scintillation properties of the crystals (Melcher, 2000). Lutetium Oxyorthosilicate (LSO) crystals comprise a combination of properties which deem them most suitable for PET compared to other scintillators (Melcher, 1992). Notably such properties include ‘high density and high atomic number for good γ-photon detection efficiency’ as well as

‘short decay constant for good coincidence timing’ (Melcher, 2000).

2.8.4 PET Image reconstruction

During the PET scan acquisition millions of coincidence events, constituting the raw data, are recorded creating a large number of coincidence lines. These lines are subsequently saved as a two-dimensional matrix namely the sinogram file. The sinogram data undergo corrections namely a) a normalisation for detector efficiencies such as random and scatter coincidences and b) for unequal emission of photons by tissue, even in small animals (Chow et al., 2005), resulting in attenuation (attenuation- correction). Data are reconstructed into three-dimensional (3D) images using a filtered back projection algorithm. Following reconstruction data are given as series of 3D images acquired during adjacent time intervals of increasing duration known as frames. Successive frames increase in duration as frequency of events recorded decreases over time due to the decay of radiotracer.

2.8.5 PET Image analysis Data from the region of interest (ROI), in this case the brain, sampled over the range of time frames and normalised for injected dose and weight of the human/mouse produce time-activity curves (TACs) from which kinetic variables are calculated. PET

89 image analysis is complicated and its quality is largely dependent on the tracer kinetics in tissue compartment in vivo in the species examined. A description of the kinetic analysis of the tracer used in the PET experiments in this thesis is given in the following sections.

2.8.6 Indexing dopaminergic function with PET

PET tracers exist to image different aspects of the dopamine pathway. For instance dopamine synthesis using L-[β-11C]- dihydroxyphenyl-L-alanine ([(11)C]-DOPA) or 3,4- dihydroxy-6-[(18)F]-fluoro-L-phenylalanine ([(18)F]-DOPA tracers, D2/D3 receptor binding and dopamine release using [11C] Raclopride tracer and dopamine recycling by dopamine transporter (DAT) using [11C]2-β- carbomethocy3β-(4-fluorophenyl) tropane ([11C] β-CFT) tracer.

2.8.7 Indexing dopamine synthesis capacity with radiolabelled DOPA

The focus of this thesis is the presynaptic dopaminergic function and the radiolabelled

DOPA tracer is used to index dopamine synthesis capacity. PET with [(18)F]-DOPA is a well-recognised and validated approach to assess nigrostriatal function (Garnett et al., 1983, Vingerhoets, 1994). This tracer has been widely used to investigate dopamine synthesis capacity in a number of neurological and neuropsychiatric disorders. Specifically increased striatal dopamine synthesis capacity is evident in people with schizophrenia and predates conversion to psychosis (Kim et al., 2013,

Egerton et al., 2013, Howes et al., 2009, Howes et al., 2011). Decrease in dopamine synthesis capacity is seen in people with attention deficit hyperactivity disorder

(ADHD) (Ludolph et al., 2008) and Parkinson’s disease (Dhawan et al., 2002). While pre-clinically the radiolabelled DOPA methodology has been applied to non-human primates (Tsukada et al., 2000a) limited studies exist in rats and mice (Cumming et

90 al., 1987, Cumming et al., 1995). Walker et al., 2013 successfully developed [(18)F]-

DOPA imaging methodology in the rodent (Walker et al., 2013b).

Endogenous DOPA is synthesized in the brain by tyrosine hydroxylase (TH) enzyme and this hydroxylation is the rate-limiting step in the pathway of the dopamine synthesis. Radiolabelled FDOPA circumvents this rate limiting step. Following intravenous injection [18]F-DOPA is transported across the blood brain barrier (BBB) in the brain by the Large-neutral Amino Acid Transporter 1, LAT-1 (Alexander et al.,

1994). Initially [18]F-DOPA distribution is spatially homogeneous, yet over time, radioactivity concentration accumulates within the healthy striatum (Kumakura and

Cumming, 2009). This is due to the presence of aromatic L-amino acid decarboxylase

(AADC) enzyme in the dopamine neurons. AADC converts [18]F-DOPA to [18F]- fluorodopamine retained in the synaptic vesicles in striatal dopamine nerve terminals ready for release (Deep et al., 1997, Cumming and Gjedde, 1998, DeJesus et al.,

2000, Cumming et al., 2001, Howes et al., 2012). AADC enzymatic activity is a regulated step in the synthesis of dopamine (Cumming et al., 1995), thus AADC activity as measured by [18F]-DOPA is representative of the dopamine synthesis capacity. AADC is also present in non-dopaminergic neurons in the brain (Mura et al.,

1995). Despite that, striatal [18F]-DOPA uptake significantly correlated with the dopaminergic cell densities in the substantia nigra and striatal dopamine levels in post mortem brains with large correlation coefficients of 0.94 and 0.97 respectively (Snow et al., 1993). In addition acute antipsychotic treatment, which provided an experimental manipulation of the dopaminergic system, was shown to potentiate striatal [18F]-DOPA utilization in the brain in vivo (Danielsen et al., 2001, Vernaleken et al., 2006).

2.8.8 Graphical approach to rate of [(18)F]-DOPA uptake

The key to data quality is the accurate modelling of the [18F]-DOPA kinetics in vivo using graphical methods. Graphical methods are data-driven methods. Firstly [18F]-

DOPA kinetics in tissue compartments are explained followed by a modified approach to account for the faster metabolism in the mouse within the experimental time window used.

2.8.9 [(18)F]-DOPA kinetics

Figure 2.5 The two-tissue compartment model showing [18F]-DOPA kinetics. [18F]-DOPA over time accumulates in the striatum which is rich in AADC, in contrast to the cerebellum and flurodopamine, along with metabolites DOPAC, 3-MT and HVA diffuse out of the striatum.

Abbreviations: FDA-fluorodopamine; HVA- homovanillic acid; 3MT- 3-Methoxytyramine;

DOPAC- 3,4-Dihydroxyphenylacetic acid

Figure 2.5 shows simplified model of [(18)F]-DOPA tracer kinetics. The quantified rate of [(18)F]-DOPA uptake is a measure of the activity of the enzyme it binds to, in this

92 case the AADC. [18F]-DOPA is taken up into the nigrostriatal nerve terminals and undergoes decarboxylation by AADC into 6-fluorodopamine which is unable to cross

18 BBB hence it gets trapped. Ki would be defined as the steady state rate of [ F]-DOPA influx from plasma through the BBB at constant concentration divided by the plasma concentration. Patlak et al., (1983) developed a method for quantification of the Ki via multiple time uptake data when [18F]-DOPA concentration is not constant as would be the case of a bolus intravenous administration of [18F]-DOPA used in this thesis vs for instance a constant infusion (Patlak et al., 1983).

Quantitative PET studies often require that input function, which describes the concentration of non-metabolised compound in arterial plasma as a function of time, be measured from blood sampling at time intervals during the scan duration.

Additionally a non-invasive alternative that circumvents arterial cannulation, blood sampling, analysis and additional radiation exposure to the researcher, includes the image-derived input function from an area lacking target receptors referred to as the reference region in the field of view. Furthermore arterial sampling is challenging in mice because of limited circulating blood volume of 1.5-2.5ml

(https://www.nc3rs.org.uk/mouse-blood-vessel-cannulation-surgical; http://web.jhu.edu/animalcare/procedures/mouse.html). Thus according to the aforementioned reasons, for all PET studies described in this thesis the image-derived reference tissue input function using the cerebellum as the reference region has been used.

2.8.10 Ki Patlak and extended (modified) Ki Patlak approaches

The basic principle underlying the Patlak graphical approach is that [18F]-DOPA incorporation into the irreversible compartment (striatum) can be identified in the data

93 even if all reversible intermediate components are not particularly well-represented by the model based on various assumptions (Patlak et al., 1983) as outlined below.

Assumptions (Adapted from (Patlak et al., 1983); (Holden et al., 1997), (Bloomfield,

2016)) include:

1) [18F]-DOPA should not alter the system.

2) Single input function, specifically single source (plasma) of [18F]-DOPA in the

system.

3) Plasma concentration of [18F]-DOPA can vary with time.

4) There should exist a rapid exchange of [18F]-DOPA between plasma and tissue

containing a number of compartments, such that tracer flows from plasma to

any tissue compartment in a reversible fashion.

5) [18F]-DOPA kinetics in a given compartment should encompass mechanistic

processes which result in irreversible uptake of tracer in that field. This

compartment is modelled mathematically as a single compartment.

6) Metabolism of [18F]-DOPA occurs only in the irreversible compartment resulting

in the production of 6-fluorodopamine which a) can be measurable and b) is

exclusively trapped in that compartment.

7) [18F]-DOPA transfer should follow first-order kinetics meaning the rate at which

a given metabolite appears in plasma is the difference between rate of

generation and rate of elimination. At a time defined as t* all reversible

exchanges should be in equilibrium with plasma, ie: for t>t* and Ki rate constant

represents trapping of tracer in tissues.

8) [18F]-DOPA should exit the reversible compartment either through entering

plasma or the irreversible tissue compartment.

9) All other kinetic processes should be reversible.

10) [18F]-DOPA is not originally found in irreversible or reversible tissue

compartments.

Patlak et al., 1983 showed that when assumptions are met the time course of the tracer in the tissue can be delineated into two kinetic compartments (Figure 2.5). In this thesis and in accordance with previous studies (Holden et al., 1997, Kyono et al.,

2011, Walker et al., 2013b) we replaced blood activity with activity of the reference

TAC devoid of AADC summarized by the equation:

푡 퐶 (푡)푑푡 퐶푇푖푠푠푢푒(푡) ∫0 푅푒푓푒푟푒푛푐푒 = 퐾푖 + 푉 = 퐾푖휃(푡) + 푉 퐸푞푢푎푡푖표푛 1 퐶푅푒푓푒푟푒푛푐푒 (푡) 퐶푅푒푓푒푟푒푛푐푒(푡)

Where CTissue (t) represents tissue radioactivity at time t; CReference (t) represents reference tissue radioactivity at time t as measured by the PET image analysis. Ki represents rate of tracer uptake from the reference region into irreversibly accumulating component as measured from regression gradient (Kyono et al., 2011).

V is the constant and represents initial distribution volume in tissue of interest at time

0. θ(t) referred to as the stretch time, is the time integral of reference region input function to time t divided by value of input function at that time. The curve produced by plotting the ratio of tissue concentration to the reference region concentration of trapped tracer (in y-axis) against the stretch time (in x-axis) starting at origin, would have a straight line behaviour with gradient equal to Ki by t=t*.

This model presents a good fit in measuring the dopamine synthesis capacity with

[18F]-DOPA since it allows for a single bolus administration of radiotracer and yields an estimation of AADC enzymatic activity and thus index of dopamine synthesis capacity. Nonetheless [18F]-DOPA metabolism is faster in the mouse. Thus one

95 limitation of the model is that [18F]-DOPA starts to behave in a reversible manner after a certain time point from the tracer injection. Thus irreversibility assumption of Patlak graphical analysis is breached, and this is represented by a decrease in slope as time passes. This is due to the metabolism of 6-fluorodopamine by catechol-O-methyl transferase (COMT) and monoamine oxidase (MAO) enzymes into metabolites that diffuse out of the striatal compartment. Thus for the purposes of this thesis, a modified

Patlak method was used to evaluate kloss. Subsequently definition of θ(t) in Equation 1 is modified according to the following equation:

푡 ′ ′ ∫ 퐶푟푒푓푒푟푒푛푐푒(푡 ) exp(−푘푙표푠푠(푡 − 푡 ))푑푡′ 휃(t) = 0 퐸푞푢푎푡푖표푛 2 퐶푟푒푓푒푟푒푛푐푒(푡)

This alternative estimate of θ(t) does not change ordinate values of data points (y- coordinates ie: ratio of tissue time-course and reference tissue time-course stay the same). Instead this estimate is used to change abscissa values (x-coordinates ie: stretch time) and it is then applied to [18F]-DOPA data to give optimal straight line behaviour over the entire period. This extended formulation models more robustly the kinetic behaviour of [18F]-DOPA in mice.

2.9 Experimental pipeline for [(18)F]-DOPA mice 2.9.1 Power calculations

A large effect size of d=1.25 is associated with the [18]F-DOPA PET work in humans

18 ref mod (Howes et al., 2009). In a recent [ ]F-DOPA PET study in rats, striatal Ki ,or Ki as referred to in the current thesis, had an inter-class correlation coefficient of 0.93. In addition following 6-hydroxydopamine (6-OHDA) lesioning as a model of Parkinson’s

ref disease, Ki was reduced, the difference between the lesioned (0.023±0.004) and the control (0.037±0.005) groups represented a large effect size d=3.09 (Walker et al.,

2013b). It is therefore logical to expect a large effect size in our [18]F-DOPA PET work in the mouse. Therefore, to achieve a power of 0.8 to detect a large effect size of 0.8, p<0.05, using independent t-tests, a total of 16 mice will be needed. Furthermore, to achieve a power of 0.8 to detect a large effect size, p<0.05, using repeated-measures two-way ANOVA with four experimental groups, a total of 45 mice will be required.

Power calculations are performed using G power 3.1 software.

2.9.2 [18F]-DOPA

18 2.9.2.1 Production of [ F]F2

[18F]fluorine produced using a Siemens RDS-111 Eclipse cyclotron equipped with a fluorine target loaded with [18O]oxygen gas, was obtained by means of the 18O(p,n)18F reaction at Imanova (London, UK). Following this irradiation, [18O]oxygen gas was recovered and the target was loaded with F2/Argon mix gas. A second irradiation provided [18F]fluorine gas, which was transferred with a sweep of argon gas from the cyclotron target to the minicell containing the automated module used to manufacture

[18F]FDOPA.

2.9.2.2 [18F]FDOPA synthesis

An electrophilic fluorination method was then used to synthesize [18F]FDOPA.

Figure 2.6: [18F]FDOPA compound structure

18 Specifically [ F]F2 was delivered to a reaction vessel loaded with 6-trimethylstannyl

L-Dopa precursor (60 mg) dissolved in silver stabilised deuterated chloroform (5 mL)

97 standing at 5°C. When the radioactivity level in the reaction vessel reached its peak, the reaction mixture was stirred at 5°C for 10 minutes. 4M HCl (1 mL) was added and the vessel was heated to 65°C to evaporate the deuterated chloroform. After 10 min the temperature was reduced to enable addition of the remaining 4M HCl (3 mL). The mixture was heated to 100°C for 15 min to deprotect the product before raising the pH with 2M NaOH and loading onto the HPLC injection loop for purification. The fraction corresponding to [18F]FDOPA (Figure 2.6) was collected in a vial containing L-Ascorbic

Acid (10 mg) (to prevent oxidation of [18F]FDOPA) and 0.1 M Di-Sodium Hydrogen

Phosphate (0.5 mL). The resulting formulated solution of [18F]FDOPA was delivered into its final sterile container and analysed by reverse phase high-pressure liquid chromatography to confirm identity and purity. To be further transferred to the in vivo

PET scanning suite suitable for PET injection, [18F]FDOPA had to be ≥ 95% pure.

Additionally not all tracer molecules contain the radioactive isotope and specific activity is the ratio between ‘hot’ (radioactive tracer molecules) and ‘cold’ (non-radioactive tracer molecules). The specific activity of the [18F]FDOPA was recorded and comparisons were made between the two experimental treatment groups during data analysis. Anna Pacelli produced the [18F]FDOPA for my pre-clinical experiments.

2.9.3 Pre-PET Scan acquisition

Induction of isoflurane anaesthesia and external jugular vein cannulation

0 mins 15 mins 45 mins 165 mins

Benserazide Entacapone [18F] FDOPA i.v Hydrochloride End scan injection and start and CT scan PET scan acquisition

Figure 2.7: PET experimental pipeline

The mice were transferred to Imanova in vivo scanning suite 2-5 hours before anaesthesia induction, always in pairs in the transport boxes enriched with tissue from the original cage to make the transfer more familiar to them and minimise stress. Mice were anaesthetized with 5% isoflurane, underwent external jugular vein cannulation and were maintained under terminal 1.5-2.5% isoflurane anaesthesia. Dr David

Bonsall and Mrs Sac Tang cannulated the mice. Mice received entacapone and benserazide hydrochloride, inhibitors of COMT and AADC enzymes respectively, to reduce the [18F]FDOPA metabolism in the periphery and thus enable the tracer to enter the brain (Cumming et al., 1993, Walker et al., 2013b, Bonsall et al., 2017).

Entacapone (40mg/kg) was injected 45 minutes prior to [18F]FDOPA scanning and benserazide hydrochloride (10mg/kg) was administered 30 mins prior to [18F]FDOPA scanning via i.p route of administration.

2.9.4 [18F]FDOPA injection

A bolus of [18F]FDOPA was injected via the external jugular vein cannula followed by

0.9% saline washout.

2.9.5 PET Scan Acquisition

The Siemens Inveon Micro CT/PET was used for all the scans. A 15 minute CT scan was performed before the radiotracer injection for attenuation correction. A dynamic

PET scan was performed directly following the intravenous administration of ca. 1-

10MBq of [18F] FDOPA in the external jugular vein. Emission data were acquired in list mode for 2 hours and split into 43 frames with increasing time duration (ten 3- second frames, six 5-second frames, eight 30-second frames, five 60-second frames, six 300-second frames, eight 600-second frames, a total of 7200 seconds).

2.9.6 Physiological measures during scanning

During the PET scanning body temperature was monitored and maintained at 37 °C throughout the study and additional heating provided by a heating lamp if deemed necessary. In addition the respiration rate was carefully monitored using the BioVet physiological monitoring software system (BioVet software; m2m Imaging Corp,

Cleveland, OH, USA) along with observation of breaths per ten seconds.

2.9.7 Region of interest definition

PET images were analysed using the Inveon Research Workplace software. For each scan, three regions of interest (ROIs) were drawn manually on summation radioactivity images at the level of the striatum (right and left) and cerebellum to extract time activity curves (TACs). Each ROI had ellipsoid shape (Walker et al., 2013b, Bonsall et al.,

2017).

2.9.8 PET image analysis

Uptake of (18)F-DOPA was calculated by Patlak plots yet activity of the cerebellum

TAC replaced the blood activity. The radioactivity profile from 20 to 90min after tracer administration was used (Walker et al., 2013b).

mod 2.9.9 Ki calculation

Striatal dopamine synthesis capacity indexed by the rate of [18F]FDOPA uptake was

mod -1 mod -1 calculated relative to the cerebellum [Ki (min )]. To derive Ki (min ) extended

Patlak graphical analysis was used. Dr Mattia Veronese adapted the Patlak method for reference tissue input function and accounting for loss of radiolabelled metabolites

-1 from trapped compartment by evaluating kloss (min ) according to Walker et al., 2013

100

(Walker et al., 2013b). The rate constant was used to determine the optimal straight line behaviour by providing optimal least-squares fit in linear regression applied to

mod derive the Ki (Holden et al., 1997, Patlak and Blasberg, 1985, Walker et al., 2013b).

101

2.10.1 Designer receptors exclusively activated by designer drugs (DREADD) principles

ACh ACh CNO

hM3Dq hM4Di

Gq/11 Gi/o

Excitation Silencing

Figure 2.8: Schematic representation of DREADDs coupled to different G protein cascades.

Human muscarinic acetylcholine receptors mutated in transmembrane domains 3 (TM3) and

5 (TM5) (grey stars) can no longer bind cognate ligand acetylcholine (Ach), but can be activated by otherwise pharmacologically inert ligand clozapine N-oxide (CNO). Upon CNO binding hM3Dq-DREADD (purple) and hM4Di-DREADD (blue) expressing neurons are activated or inhibited respectively (Concept of figure adapted from (Wess et al., 2013)).

A novel chemogenetic technique which allows researchers to control in vivo the activity of specific sub-populations of neurons has rapidly proliferated in use in neuroscience.

This approach is referred to as designer receptors exclusively activated by designer drugs (DREADD). Specifically PubMed search using the search term ‘’DREADD’’ retrieved 178 studies published between October 2008 and April 2017. The crux of

102

DREADD is exclusive specificity of receptor with ligand (Krook-Magnuson and Soltesz,

2015). Repeated cycles of random mutagenesis and selection of human muscarinic acetylcholine receptor (hM3) mutants in yeast led to the identification of a double mutant Y3.33C/A5.46G (Y113C/A203G) which has lost its ability to bind cognate ligand acetylcholine (Armbruster et al., 2007, Conklin et al., 2008, Han et al., 2005, Lu and Hulme, 1999, Allman et al., 2000). Incorporation of the two aforementioned mutations into all other mAChR led to the manufacture of engineered receptors (hM1-

5D). Please see review by Pei et al., 2008 (Pei et al., 2008). The mutants can be activated by an otherwise pharmacologically inert ligand with high potency and efficacy namely clozapine N-oxide (CNO). CNO has been demonstrated to be metabolically stable in C57BL/6 mouse (Armbruster et al., 2007). Specifically experiments in mice and rats in contrast to human and guinea-pig, retro-conversion of CNO to its metabolites does not occur (Guettier et al., 2009, Jann et al., 1994, Wess et al., 2013).

Engineered receptors are G-protein coupled receptors and according to G protein they bind to, they activate or inhibit activity of specific subpopulations of neurons (Figure

2.8). The M4-muscarinic DREADD (hMDi) is selective for Gi-mediated signalling pathway. Upon binding of CNO to hMDi receptor, G protein-coupled inwardly-rectifying potassium (GIRK) channels are activated via Gβγ protein activation. This leads to neuronal hyperpolarization and silencing (Atasoy et al., 2012).

103

2.10.2 DREADD injection in midbrain dopaminergic neurons

For the purposes of this thesis, to understand how dopaminergic neuronal signalling processes regulate ketamine’s mechanism of action DREADD technology which allows for precise spatiotemporal control of dopaminergic neuronal signalling was used.

Figure 2.9: DREADD injection in DAT Cre mouse brain. To insert engineered Gi-coupled receptors into dopaminergic neurons specifically we used the Cre-Lox system. DAT Cre mice

104 express Cre recombinase in DAT neurons. (A) Adeno-associated virus (AAV) virus vector carrying hM4Di DREADD along with mCherry fluorescent protein flanked by loxP sites is injected in two midbrain regions of interest namely ventral tegmental area (VTA) and substantia nigra pars compacta (SNc) bilaterally (total of four injections depicted by 4 light- blue lines). (B) Expression of hM4Di DREADD in DAT neurons occurs via Cre recombination.

2.10.3 Virus preparation

To construct DREADD hM4Di-mCherry, hM4Di was fused to mCherry according to

Nawaratne et al 2008 (Nawaratne et al., 2008). DREADD construct was then cloned into pAAV-EF1A-DIO-WPRE-pA vectors. This was kindly done by Dr Munim

Choudhury. The resulting Cre-inducible recombinant AAV vectors carrying chemogenetic pAAV-EF1A-DIO-hM4Di-mCherry-WPRE-pA transgene (gift from

Deisseroth Lab, Stanford: http://web.stanford.edu/group/dlab/optogenetics/sequence_info.html) were packaged with AAV1 serotype capsid gene AAV2 ITR genomes (Vector Biolab, Philadelphia).

The final concentration of the chemogenetic transgene was 2.8x1012 genome copies

(GC) ml-1. Aliquots of virus were stored at -80 °C before stereotaxic injection.

2.10.4 Surgery- Stereotaxic injection to VTA and SNc

Target AP coordinate ML coordinate DV coordinate

(posterior to (lateral to the (deep from

bregma) midline) dura)

VTA -3.15 +/-0.40 4.30

SNc -3.15 +/-1.50 4.30

Table 2.2: Stereotaxic coordinates used for hM4Di injections. Abbreviations: AP-

Anteroposterior; ML-mediolateral; DV-dorsoventral

105

At the start of surgical procedures, DAT Cre mice, 6-8 weeks of age, were anaesthetized with isoflurane and placed on a stereotaxic frame. Mice were treated with carprofen (2.5mg/kg) i.p and buprivacaine (2.5mg/ml) s.c at the incision side and were maintained at 1.5-2% isoflurane during surgery. To selectively express the viral constructs in dopaminergic neurons of VTA and SNc, recombinant AAV (0.5ul per injection) at a flow rate of 0.15ul/min was infused bilaterally over 3 min using a

Hamilton microinjection syringe in DAT Cre mice at pre-specified coordinates (Table

2.2). Injection sites were analysed by dye injections in brain sections by Dr Kyoko

Tossell and myself, based on previously published data and modifications using

Paxinos and Franklin’s mouse brain atlas (data not shown) (Paxinos G., 2013, Vardy et al., 2015). Needle was left in place for 3 min post injection. Following injections the wound was sutured (Mersilk, 3-1 Ethicon).

2.10.5 Post-operative care

Carprofen at a dose of 0.0272mg/ml from 50mg/ml stock was added in drinking water for 2-4 days following surgery to act as analgesic. Mice were closely monitored daily for 2-4 days after surgery.

2.10.6 CNO dose and route of administration

For DREADD experiment, CNO was injected in DAT Cre mice at a dose of 0.1mg/kg.

Dose corresponded to lowest effective dose previously reported (Mahler et al., 2014).

106

2.10.7 In vitro experiments

2.10.7.1 Histology

Following completion of experiments, mice were culled by cervical dislocation and brains were rapidly removed. Brains were postfixed in 4% paraformaldehyde (PFA) overnight and then cryo-protected in 30% sucrose solution. Following sinking in sucrose, brains were rapidly frozen in isopentane (2-methylbutane) and stored in -80

°C. Coronal sections of 70µm were taken on a cryostat (Leica Biosystems). For RNA experiments, VTA and striatum regions of interest were isolated from fresh tissue

(following sinking in sucrose) and rapidly frozen in isopentane.

2.10.7.2 Immunohistochemistry

Standard immunohistochemistry was used to label dopamine neurons and reporter expression was confirmed using confocal microscopy. Tyrosine hydroxylase (TH) is a marker of dopamine neurons and ultimately co-expression with mCherry fluorescence protein was of interest to confirm specificity of virus expression in the DREADD experiment. TH staining was accomplished following a two-day protocol.

Day 1: Briefly coronal sections were washed four times (5min) in phosphate-buffered saline (PBS) on shaker plate. Sections were subsequently blocked by incubating in

PBS containing 0.2% Triton X-100 (0.2% PBS-TX) and 6% normal donkey serum

(NDS) for 45min at room temperature on a shaker plate. Sections were then incubated with primary antibody solution (2% NDS in 0.2% PBS-Triton X) for Tyrosine

Hydroxylase, namely chicken anti-tyrosine hydroxylase antibody (1:1000, ABCAM ab76442, Cambridge, UK) overnight at 4°C on shaker plate.

107

Day 2: Following four (5min) washes in 0.2% PBS-Triton X, sections were incubated with secondary antibody solution (2% NDS in 0.2% PBS-Triton X) containing Alexa

Fluor 488-conjugated goat anti-chicken secondary antibody (1:1000, Life technologies) for 2 hours in the dark at room temperature on shaker plate.

Subsequently sections were washed three times (5min) in 0.2% PBS-Triton X and twice (5min) in PBS. Sections were mounted in Vectorshield Mounting Medium (Vector

Laboratories).

Results were analysed by direct observation under Leica SP confocal microscope

(Leica Microsystems, UK). Images were taken at a resolution of 1024x1024 and were processed consistently using the same number of z stacks in ImageJ.

2.10.7.3 Ribonucleic acid (RNA) extraction

TRIzol reagent (500µL) (Invitrogen) was used to lyse biological samples of VTA and striatum. Subsequently the homogenate was supplemented with chloroform (100µL) to precipitate DNA, proteins and polysaccharides. Following shaking for 15sec, the tube containing the sample was placed on benchtop for 3mins to acquire room temperature and was then centrifuged for 15mins at 4°C. The supernatant (containing the RNA) was transferred to a new tube and 70% ethanol (1 volume ≈ 300µL) added and mixture was vortexed. Total RNA was isolated using the fast commercial QIAGEN

RNeasy mini kit. The sample (≈ 700µL) was transferred to an RNeasy Mini spin column placed in a 2ml collection tube and underwent series of centrifugations with buffers

(RW1 (700 µL), twice in RPE (500 µL)). Subsequently RNeasy Mini spin column was placed in a new 2ml collection tube and following centrifuging for 1min, the column was transferred to a new 1.5ml collection tube. Following the addition of 30 µL of

RNease-free water, the sample was left for 1min at room temperature and centrifuged.

108

The RNA quality and quantity were determined using the NanoDropTM 1000 spectrophotometer (Thermoscientific) and samples with absorbance ratio at 260nm and 280nm < than 2 were not considered for gene expression analysis.

2.10.7.4 Quantitative real time PCR analysis

Ms Maria Paiva Pessoa helped with qPCR analysis. First strand complementary deoxyribonucleic acid (cDNA) synthesis was performed using the Superscript III First

Strand Synthesis Kit (Life Technologies). cDNA synthesis Mix was prepared as follows:

Reagent Per sample (µL) Buffer 10x 3

25mM MgCl2 6.6 10mM dNTPs 6

Random Hexomers 1.5 RNase Inhibitor 0.6

RT Enzyme 0.75

Table 2.3: cDNA synthesis Mix

Abbreviations: MgCl2 -magnesium chloride; dNTPs – deoxyribonucleotides; RT- reverse transcriptase

1µg of RNA was diluted in 12 µL of DNAse-treated and then 18µL of cDNA synthesis mix was added. Negative controls contained the sample only without reverse transcriptase enzyme. Samples were incubated at room temperature for 5 mins and reactions were carried out in a thermocycler (C100, BioRad) under the following PCR machine settings: 48°C for 30min, 94°C for 5min and 18°C for 5min.

109

2.10.7.5 Taqman real-time PCR

Subsequently quantitative real-time PCR was performed using Applied Biosystems kit and TaqMan gene expression assays. Briefly diluted cDNA (4.5 µL) from each sample was added to TaqMan universal PCR Master mix (5 µL) (ABI # 4364340) and Taqman primers (0.5 µL) for a total of 10 µL per sample reaction using a 384 well plate. The following TaqMan assays were used to quantify the gene expression of housekeeping

Hprt1, tyrosine hydroxylase mRNA and DOPA decarboxylase mRNA:

Gene TaqMan catalog

name/symbol number

Hprt1 Mm00446968_m1

Th Mm00447557_m1 DDC Mm00516688_m1

Table 2.4: List of real-time TaqMan probes

Abbreviations: Hprt1- Hypoxanthine phosphoribosyltransferase 1; Th- tyrosine hydroxylase; Ddc- dopa decarboxylase

All Taqman probes contained a non-fluorescent quencher at 3’ end and a fluorophore

(FAM) at the 5’ end of the oligonucleotide. All reactions were done in duplicates and were performed using a Taqman real time PCR machine (Applied Biosystems 7900HT

Fast). The following real-time PCR program was employed: 50°C for 2min; 95°C for

10min; 95°C for 15sec; 60°C for 1 min; 95°C (40x repeat). Absolute Quantitation using standard curve method (SDS 2.3 software) was used for data analysis. The software retrieved experimental Ct (threshold cycle) values per sample. Subsequently duplicate means of Ct values for sample gene expression were normalized to means of housekeeping gene generating delta delta ct values per sample. Between-group

110 comparisons of fold differences in gene expression levels between ketamine treated and saline treated mice were determined by dividing delta delta Ct values from individual samples with average delta delta ct of control group (Livak and Schmittgen,

2001).

2.11 Randomization and Blinding

Mice were randomized in experimental treatment groups using random number generator. Ketamine effects on psychotomimetic symptoms were obvious within minute of administration, thus although initially trialled, it was not possible to conduct injections blind to group status. However, analysis was conducted blind to group status.

2.12 Statistical analysis

We assessed normality of distributions using the one-sample Kolmogorov-Smirnov test. For the PET scanning experiment between-group comparisons were made with two-tailed independent samples t-tests for normally distributed data and Levene’s test for equality of variance guided the choice of t-statistic. Cohen’s d effect size is calculated using the online calculator (http://www.uccs.edu/~lbecker/). In addition two- way ANOVA was used to test the difference in Ki mod value between the four groups of Dat Cre mice. Statistical significance was defined as p<0.05 (two-tailed). Two–way repeated-measures ANOVA was used to investigate locomotion data. Outliers in the data were identified using the Grubbs test and data are presented with and without the outliers (Grubbs, 1950). Post hoc comparisons were Bonferroni corrected.

111

Chapter 3- Effects of sub-chronic ketamine treatment on the presynaptic striatal dopaminergic function and locomotor activity.

112

3.1 Abstract

Ketamine, a non-competitive N-methyl-D-aspartate (NMDA) receptor antagonist, induces psychotomimetic symptoms and has also been shown to have rapid antidepressant effects. Importantly the effects of sub-chronic ketamine administration on the translational imaging measures of the dopaminergic function are not known.

Here I aimed to test whether sub-chronic ketamine treatment is associated with the induction of locomotor hyperactivity and the elevation of pre-synaptic striatal dopaminergic function in the male mouse. Specifically I measured the locomotor activity of mice using the open field test. Additionally I measured the striatal presynaptic dopaminergic function using 3,4-dihydroxy-6-[(18)F]-fluoro-l- phenylalanine ([18F]-DOPA) positron emission tomography (PET) imaging. The main outcome measure was the distance travelled in the open field arena for the open field

mod test and the influx rate constant Ki for PET imaging. Sub-chronic ketamine treatment significantly increased locomotor activity (effect size > 4, F (1, 26) =104.0, p<0.001) and induced locomotor sensitization (effect size > 0.9, t (26) =6.109, p<0.01).

Moreover sub-chronic ketamine administration significantly increased the striatal presynaptic dopaminergic function (effect size > 1.2, t (14) = 2.42, p=0.03) relative to controls. In summary, I demonstrate that presynaptic striatal dopaminergic function, as measured by [18F]-DOPA PET in vivo, is elevated in the sub-chronic ketamine mouse model relative to controls. Remarkably this novel finding reinforces the utility of the sub-chronic ketamine model for the preclinical investigations of dopaminergic overactivity.

113

3.2 Introduction

Ketamine is an NMDA receptor (NMDAR) antagonist reported to have rapid and sustained anti-depressants effects, but the potential for clinical use is limited due to its psychotomimetic properties and abuse potential (Berman et al., 2000, Krystal et al.,

1994, Morgan and Curran, 2012). As explained in chapter 1 the evidence suggests that the abuse potential and the psychotomimetic properties of ketamine might involve its actions on the dopaminergic system (Robinson and Berridge, 1993, Morgan and

Curran, 2012). Additionally, ketamine’s antidepressant effects might also involve the dopaminergic system (Belujon and Grace, 2014a, Li et al., 2015a).

Additionally the sub-chronic exposure to a drug precipitates progressively increased behavioural responses at subsequent exposures, a phenomenon referred to as behavioural sensitization (Jentsch and Roth, 1999b). Importantly alterations in the dopamine transmission in the axon terminal fields, such as the striatum and nucleus accumbens (NAc), of midbrain dopamine neurons following repeated exposures to stimulants have been linked to the expression of locomotor sensitization (Kalivas and

Duffy, 1990). In particular locomotor sensitization is suppressed by the infusion of dopamine antagonists directly in the NAc (Johnson et al., 1996). Moreover chronic

NMDA receptor antagonism by phencycline (PCP)- a more potent than ketamine

NMDAR antagonist- induces locomotor sensitization (Xu and Domino, 1994, Johnson et al., 1998) and this has been linked to the dopaminergic system (Phillips et al., 2001).

Acute or sub-chronic administration of sub-anaesthetic dose of ketamine typically increases locomotor activity in mice (Chatterjee et al., 2011, Hou et al., 2013).

Therefore, in this chapter I sought to investigate whether sub-chronic ketamine treatment induces locomotor sensitization.

114

Furthermore, the presynaptic striatal dopaminergic function can be measured in vivo in humans, non-human primates and rodents using [18F]-DOPA positron emission tomography (PET) imaging as explained in Chapters 1 and 2 (Tsukada et al., 2000a,

Walker et al., 2013a, Kumakura et al., 2007). Our meta-analysis of pre-clinical studies reported increases in dopamine levels in cortical and sub-cortical regions following acute ketamine administration in rodents (Kokkinou, In press, Verma and

Moghaddam, 1996b, Lindefors et al., 1997a, Moghaddam et al., 1997b, Lorrain et al.,

2003, Vaisanen et al., 2004, Sorce et al., 2010, Kamiyama et al., 2011, Masuzawa et al., 2003a, Littlewood et al., 2006a, Witkin et al., 2016, Usun et al., 2013b). Whilst few studies investigated the effects of chronic ketamine on the dopaminergic function, they showed consistent elevations in dopamine levels in the cortex and striatum (Chatterjee et al., 2012a, Tan et al., 2012, Lindefors et al., 1997a). It is remarkable that there exists no published imaging study investigating measures of the presynaptic dopaminergic function in vivo following sub-chronic ketamine treatment.

Thus in this chapter I aimed to:

A. Investigate whether sub-chronic ketamine administration leads to locomotor

sensitization.

B. Investigate presynaptic striatal dopaminergic function using in vivo [18F]-

DOPA µ positron emission tomography (µPET) imaging in the sub-chronic

ketamine model.

C. Investigate messenger RNA (mRNA) expression of dopamine synthesis

genes, namely tyrosine hydroxylase (TH) and DOPA decarboxylase (DDC),

ex vivo in the midbrain using quantitative real time polymerase chain

reaction (PCR).

115

My a priori hypotheses were that sub-chronic ketamine treatment would induce locomotor sensitization, would be associated with elevation in pre-synaptic striatal dopaminergic function, and with elevation in TH and DDC ex vivo levels in the midbrain compared to saline-treated controls.

116

3.3 Methods

For the experimental pipeline along with a detailed description of the methods please see Chapter 2.

3.3.1 Animals

Eight to ten week old male C57BL/6 mice (Charles River, UK) were used in all experiments. Twenty-eight mice were used to assess locomotor activity following drug treatment. Sixteen mice were prepared for the [18F]-DOPA positron emission tomography (PET) scanning. Twelve mice were used to measure TH and DDC mRNA levels in the midbrain following sub-chronic ketamine treatment.

3.3.2 Drugs

Mice received ketamine hydrochloride (30mg/kg, i.p) or an equivalent volume of 0.9% saline once daily for five consecutive days at a volume of 5ml/kg body weight. All i.p injections were performed at the same time of the day. Entacapone (40mg/kg) and benserazide hydrochloride (10mg/kg) were administered 45min and 30min prior to the

[18F]-DOPA injection respectively to block the peripheral metabolism of the radiotracer and thus enable its entry into the brain.

3.3.3 Open field test

Locomotor activity was assessed on days 1 and 5 of treatment using the open field test as described in Chapter 2. The main outcome measure was the total distance travelled (cm) in 5min bins for 30min post drug treatment in accordance with previous studies in mice (Chatterjee et al., 2011).

117

3.3.4 PET imaging

A detailed description of the PET methodology employed is provided in chapter 2.

Following a two-day washout from the last drug administration, mice underwent a

15min CT scan for attenuation and scatter correction. Mice then received a bolus injection of [18F]-DOPA (mean injected dose ± SEM (MBq) 3.49± 0.72 ketamine group and 4.45 ± 1.05 saline group) and emission data were acquired for 120min. Data underwent normalisation and attenuation corrections, and were then reconstructed into 3D images using a filtered back projection algorithm. 3D regions of interest (ROIs) were drawn manually on summation radioactivity images at the level of the striatum

(right and left) (0.07cm3) and the cerebellum (0.1cm3) to extract time activity curves

(TACs). Presynaptic striatal dopamine synthesis capacity indexed by the rate of [18F]-

mod -1 DOPA uptake was calculated relative to the cerebellum [Ki (min )] using a modified

Patlak plot. The slope of the time activity curves decreases ≈ 20min and graph plateaus ≈ 70min from the beginning of the scan acquisition. Therefore my choice of the modified Patlak graphical analysis approach, which accounts for the loss of radioactive metabolites from the striatal compartment throughout the scan duration more robustly models [18F]-DOPA kinetics in the mouse (Holden et al., 1997, Walker et al., 2013b).

3.3.5 Power calculation

Detailed power calculations for the PET imaging experiment are provided in chapter

2. In addition a large effect size of d>3.0 is associated with the number of crossings in the open field test following sub-chronic ketamine administration in the mouse (Monte et al., 2013). It is therefore logical to expect a large effect size in the open field test experiment. Therefore, to achieve a power of 0.8 to detect a large effect size of f=0.4

118

(effect size f for ANOVAs), p<0.05, using a two-way ANOVA with repeated measures, a total of 28 mice are required. A large effect size of Cohen’s d> 6 is associated with

TH mRNA expression in the cortex following chronic ketamine administration in the mouse (Chatterjee et al., 2012a). It is therefore logical to expect a large effect size in the gene expression study. Therefore, to achieve a power of 0.8 to detect a large effect size of f=3 (effect size f for ANOVAs) (Cohen’s d>6 equivalent effect size f for

ANOVAs), p<0.05, using two-way ANOVA with repeated measures, at least 4 mice are required.

Statistical test Effect size Small Medium Large t-test Cohen’s d 0.20 0.50 0.80

ANOVA Cohen’s f 0.10 0.25 0.40

Table 3.1: Common effect size measures corresponding to statistical tests (Cohen, 1988, Ellis, 2010).

3.3.6 Statistics

Subject characteristics, tracer activity data and RNA samples characteristics were analysed by independent-samples t-tests. Two-way analysis of variance (ANOVAs) with repeated measures were conducted to compare the main effects of drug treatment and time and the interaction effect between these factors on locomotor activity and gene expression analysis followed by post-hoc Bonferroni t-tests.

Independent-samples t-tests were used to determine whether there were group differences in the [18F]-DOPA influx rate constant. Outliers in the data were identified using the Grubbs’ test (Grubbs, 1950). All results are expressed as the mean ± SEM

(standard error of the mean). Statistical significance was defined as p<0.05 (two- tailed). Cohen’s d effect size was calculated using the online effect size calculator

(http://www.uccs.edu/~lbecker/).

119

3.4 Results

3.4.1 Acute ketamine treatment induces locomotor hyperactivity

Ketamine-treated mice displayed significantly higher levels of locomotor activity compared to saline-treated controls on day 1 (Figure 3.1). A two-way ANOVA analysis demonstrated significant main effects of treatment [F(1, 26)=8.387, p<0.01], time

[F(15, 390)=43.33, p <0.001] and a treatment X time interaction [F(15, 390)=7.511, p

<0.001].

Hab Testing 4 0 0 0

) S a lin e

c (

K e ta m in e

d 3 0 0 0 e

l ***

e v

a 2 0 0 0 **

e c

n 1 0 0 0

i D 0 5 1 0 1 5 2 0 2 5 3 0 3 5 4 0 4 5 5 0 5 5 6 0 6 5 7 0 7 5 8 0 T im e in 5 m in b in s (m in s )

Figure 3.1: Locomotor activity following acute ketamine administration. On day 1 of drug administration, following habituation (hab) for 20min in the open field arenas, mice received ketamine or saline (dashed line) injections and locomotor activity was recorded for 1 h. Ketamine injected mice (red) (n=13) moved significantly more compared to saline-treated controls (black) (n=15) p<0.05 on day 1. Bonferroni’s post-hoc analyses indicated that locomotor activity in ketamine-treated mice was significantly higher as compared to saline- treated mice from 5min to 30min following drug administration with small to moderate effect size (Median Cohen’s d Effect size d=0.4). Data represent mean ± SEM. ** p <0.01, *** p <0.001

120

3.4.2 Sub-chronic ketamine treatment induces locomotor hyperactivity

In addition ketamine-treated mice displayed significantly higher levels of locomotor activity compared to saline-treated controls on day 5 (Figure 3.2). Figure 3.3B shows that the representative track plot tracing is denser for a mouse treated with ketamine

(red) as compared with the track plot tracing for a mouse treated with saline (black). A two-way ANOVA analysis demonstrated significant main effects of treatment [F(1,

26)=104.0, p <0.001], time [F(15, 390)=23.17, p <0.001] and a treatment X time interaction [F(15, 390)=21.74, p <0.001].

Hab Testing

4 0 0 0

) *** S a lin e

c (

K e ta m in e

d 3 0 0 0

e v

a 2 0 0 0

e c

n 1 0 0 0

i D 0 5 1 0 1 5 2 0 2 5 3 0 3 5 4 0 4 5 5 0 5 5 6 0 6 5 7 0 7 5 8 0 T im e in 5 m in b in s (m in s )

Figure 3.2: Locomotor activity following sub-chronic ketamine administration. On day 5 of the experiment, following habituation (hab) for 20min in the open field arenas, C57BL/6 mice received ketamine or saline (dashed line) injections and locomotor activity was recorded for 1 h. (A) Ketamine injected mice (red) (n=13) moved significantly more compared to saline- treated controls (black) (n=15) p<0.05 on day 5. Bonferroni’s post-hoc analyses indicated that the locomotor activity was significantly higher in ketamine-treated mice as compared to saline- treated mice from the start of the drug injection to 50min following the drug administration with a large effect size (Median Cohen’s d Effect size d= 0.9) Data represent mean ± SEM. *** p <0.001.

121

(A) Habituation

(B) Testing

Figure 3.3: Representative traces of the locomotor activity in the open field arenas as generated by the Ethovision software from mice treated with ketamine (red) or saline (black) on day 5. (A) During 20min habituation (top) there was no observable difference in the track plot tracings of the two mice (One mouse was placed per box). (B) Representative track plot tracings for 1 hour following ketamine or saline injection (bottom). The track plot tracing of ketamine-treated mouse (red) was denser compared to the track plot tracing of the saline- treated mouse (black).

122

3.4.3 Sub-chronic ketamine treatment induces locomotor sensitization

Moreover, sub-chronic ketamine treatment induced locomotor sensitization (p<0.01).

Ketamine-treated mice displayed significantly higher levels of locomotor activity on day 5 as compared to day 1 (Figure 3.4). A two-way ANOVA analysis of locomotor activity 30min following drug treatment on day 5, demonstrated significant main effects of treatment [F(1,26)=135.6, p <0.001], time [F(1,26)=7.677, p <0.05] and a treatment

X time interaction [F(1,26)=38.1, p <0.001]. )

m 2 5 0 0 0 *** c

( S a lin e

e 2 0 0 0 0 K e ta m in e l

l *

a i

r 1 5 0 0 0

c 1 0 0 0 0

t s

i 5 0 0 0

a t

o 0 T D a y 1 D a y 5

Figure 3.4: Locomotor sensitization following sub-chronic ketamine administration. Repeated ketamine administration induced locomotor sensitization as the ketamine treated mice moved significantly more on day 5 compared to day 1 (p<0.001) (red). Saline-treated mice moved significantly less on day 5 compared to day 1 since the open field arenas appear more familiar (black). Bonferroni’s post-hoc analyses yielded a significant increase in locomotor activity on day 5 as compared to the locomotor activity on day 1 in ketamine-treated mice with a large effect size, [Cohen’s d=4.99, t(26)=6.109, p <0.001***]. This difference is indicative of locomotor sensitization to ketamine. In addition Bonferroni’s post-hoc analyses yielded a significant decrease in locomotor activity on day 5 as compared to locomotor activity on day 1 in saline-treated mice with large effect size [t(26)=2.496, p <0.05*]. This difference is representative of increase in familiarity for the environment of open field arenas. Data represent mean ± SEM. * p <0.05, *** p <0.001

123

3.4.4 Subject characteristics and scan parameters

There was no significant group difference in the weight of mice (t14=.68, p=0.51) or in

18 the amount of injected dose of [ F]-DOPA (t14=.76, p=0.46). There was no significant group difference in the specific activity (t10=-0.06, p=0.95) (Table 3.2).

Sample characteristic Ketamine Controls Group comparisons

a and scan parameters treated [mean(SEM)] tdf p

[mean(SEM)]

Weight (g) 24.2 ± 0.93 24.8 ± 0.37 t14=.68, p=0.51, ns

Injected dose (MBq) 3.49 ± 0.72 4.45 ± 1.05 t14=.76, p=0.46, ns

Specific activity 0.06 ± 0.02 0.06 ± 0.01 t10=-0.06, p=0.95, ns

(MBq/µmol)

Table 3.2: Summary of scan characteristics and scan parameters. Abbreviations: SEM- standard error of mean, a Independent-samples t-tests, ns - non significant

124

3.4.5 Presynaptic striatal dopaminergic function in the sub-chronic ketamine mouse model

To determine whether ketamine altered the presynaptic striatal dopaminergic function in vivo I used µPET imaging. Representative images of [18F]-DOPA uptake are illustrated in Figure 3.5D. Consistent with the known distribution of [18F]-DOPA in the brain, the [18F]-DOPA uptake was highest in the striatum (Figure 3.5 A) for example as compared to the reference region the cerebellum (Figure 3.5B).

mod Dopamine synthesis capacity, as indexed by the Ki was significantly increased in the striatum of ketamine-treated mice compared to control mice (effect size >1.2; t14 =

2.42, p=0.03) (Figure 3.5E). Visual inspection of the data followed by Grubbs’ test, identified one outlier in the control group and so it was excluded from the analysis.

mod Ki was significantly increased in the striatum of ketamine-treated mice compared to control mice [effect size >2; t (13) = 4.74, p <0.001]. There was no significant group

std difference in the striatal Ki , the measure which omits the correction for the loss of radioactive metabolites from the striatal compartment (Table 3.3).

125

A) Striatal region of interest

B) Cerebellum region of interest

126

1.8

1.6

1.4

1.2

1 ketamine_str

0.8 control_str ketamine_cer 0.6 control_cer SUV SUV (kBq/cm3/MBq/kg) 0.4

0.2

0 0 20 40 60 80 100 120 Time (min)

C) Time activity curves

1.6 Control Ketamine

SUV

1.0

D) Examples of control and ketamine treated mouse PET images.

127

0 .0 8 *

) 0 .0 6

(

0 .0 4

m i

K 0 .0 2

0 .0 0 C o n tr o l K e ta m in e

mod E) Dopamine synthesis capacity as indexed by Ki

Figure 3.5: Striatal presynaptic dopaminergic function in the sub-chronic ketamine model. A+B) Representative images showing the delineation of the striatal and cerebellar regions of interest. The image depicts higher striatal [18F]-DOPA uptake. C) Time activity curves (TACs) show mean striatal (solid line) and cerebellar (dashed line) [18F]-DOPA signal from control (black) and ketamine treated mice (red). The radioactivity (y-axis) corresponds to the standardized uptake values (SUV), corrected for mouse body weight and the time of [18F]-DOPA injection. D) Representative [18F]-DOPA PET images (2 hour summation) co-registered with CT showing higher 18F]-DOPA uptake in the ketamine treated mouse (right) compared to control mouse (left). Both images are shown in the unit of standardized uptake value (SUV). E) Striatal dopamine synthesis capacity in ketamine-treated mice (n=8) and mod controls (n=8). Ki was significantly increased in the striatum of ketamine treated compared to control mice t14 = 2.42, p=0.03 (Data with the outlier in saline group included). Data represent the mean± error bars indicate SEM. * p <0.05 Abbreviations: SUV- standardized uptake value

Parameter Ketamine treated Controls Group comparisons

a [mean(SEM)] [mean(SEM)] tdf p

mod -1 Ki (min ) 0.044 ± 0.005 0.022 ± 0.007 t14 = 2.42, p<0.05*

std -1 Ki (min ) 0.011 ± 0.001 0.010 ± 0.001 t14 = 0.66, p>0.05

-1 kloss (min ) 0.043 ± 0.009 0.020 ± 0.007 t14 =2.04, p>0.05

Table 3.3: Parameter estimates for the striatal [18F]-DOPA uptake measures in ketamine-treated and control mice. Abbreviations: SEM- standard error of mean, a Independent-samples t-tests. *p<0.05 compared to control

128

3.4.6 Subject characteristics and RNA samples quantity and purity

There was no significant group difference in the weight of the mice (t6 = 1.34, p=0.23).

The acceptable absorbance ratio criterion at A260/A280 > than 2 was met in all midbrain samples, therefore they were all included in the mRNA expression analysis (Table

3.4).

Sample characteristic and Ketamine Controls Group

RNA samples quantity and treated [mean(SEM)] comparisons

a purity [mean(SEM)] tdf p

Weight (g) 24.2 ± 0.81 23.5 ± 0.72 t6 = 1.34, p=0.23

Midbrain A260/A280 Ratio 2.11 ± 0.008 2.10 ± 0.012 t10 = 0.23, p=0.82

Midbrain Concentration (μg/μL) 0.37 ± 0.07 0.48 ± 0.09 t10 =0.92, p= 0.38

Table 3.4: Sample characteristics. a Independent samples t-tests.

129

3.4.7 Gene expression in the midbrain in sub-chronic ketamine treated mice versus saline-treated controls

There were no significant group differences in TH and DDC mRNA levels in the midbrain (t10= 0.66, p>0.05; t10= 0.57, p>0.05 for TH and DDC mRNA levels respectively) (Figure 3.6).

0 .6 S a lin e

K e ta m in e

T C

0 .4

a t

l 0 .2

e d

0 .0 D D C T H

Figure 3.6: mRNA levels of TH and DDC in the midbrain of ketamine treated (red) (n=6) and saline treated mice (black) (midbrain n=6). Data represent mean± SEM.

130

3.5 Discussion

This is the first study to examine the effects of sub-chronic ketamine administration on the presynaptic striatal dopaminergic function using in vivo µPET in the mouse. My novel finding is that the striatal dopamine synthesis capacity, as indexed by [18F]-

mod DOPA uptake rate constant Ki , is significantly increased in mice sub-chronically treated with ketamine (Cohen’s d>1.2). This finding is similar in magnitude with the pre-synaptic striatal dopamine synthesis capacity elevations seen in patients with schizophrenia (Cohen’s d>1.2) (Meyer-Lindenberg et al., 2002, Howes et al., 2009,

Howes et al., 2012). Moreover, one [18F]-DOPA PET imaging study investigated dopamine synthesis capacity in the non-human primates following ketamine infusion and reported increase in the rate of dopamine synthesis with a large effect size

(Cohen’s d= 1.18 for 3mg/kg/hr dose of ketamine and Cohen’s d= 1.73 for 10mg/kg/hr dose of ketamine) (Tsukada et al., 2000a). My finding extends the non-human primate findings to indicate that sub-chronic ketamine treatment is associated with the elevation of the pre-synaptic striatal dopaminergic function in the rodent. Two rodent studies used [18F]-DOPA to study the acute effects of ketamine on the [18F]-DOPA uptake using PET imaging and autoradiography (Fang et al., 2013, Yeh et al., 2014b).

Contrary to my finding they reported decreases in the [18F]-DOPA accumulation as indexed by the specific binding ratios at 2 hours following the tracer administration.

Whilst this index gives the total accumulation of the tracer in the brain at one time- point ex vivo, it is not equivalent to the uptake rate constant measured in vivo in the human imaging studies.

Additionally, and in agreement with previous studies, my experiments demonstrate that locomotor activity was significantly higher following acute and sub-chronic

131 ketamine treatment as compared to saline treatment (Monte et al., 2013, Chatterjee et al., 2011). Moreover, I showed that mice sub-chronically treated with ketamine developed locomotor sensitization. My result is in line with the intermittent administration of sub-anaesthetic doses of ketamine leading to locomotor sensitization in rodents (Trujillo et al., 2008). Furthermore, previous studies showed that dopamine release in axonal terminal fields may underlie the mechanism of behavioural sensitization to stimulants (Laruelle, 2000, Robinson et al., 1988). The reinforcing properties of recreational drugs have been linked to the dopaminergic system

(Robinson and Berridge, 1993). My data show that dopamine synthesis capacity in the striatum is associated with the sub-chronic ketamine-induced locomotor hyperactivity.

Thus my finding has implications for understanding ketamine’s abuse potential.

Furthermore, contrary to my hypothesis TH and DDC mRNA levels were not significantly different between saline- and ketamine-treated mice. It is noteworthy that a previous study using a three-month chronic ketamine regimen showed a significant increase in TH mRNA expression in the midbrain of ketamine-treated mice (Tan et al., 2012). However, the statistical comparisons used in the aforementioned study were likely inappropriate. Specifically, student’s t-tests were used instead of a two-way ANOVA statistical test which would be more appropriate for the analysis of mRNA levels when a total of five different genes are assessed in two brain regions in the same animals. Moreover the possibility of a type II error, which is the possibility of a false negative finding, in my mRNA expression experiment must be considered. Nevertheless, my study has over 80% power to detect an effect size similar to that reported following chronic ketamine administration in cortical regions (Chatterjee et al., 2012b). Additionally future

132 studies could investigate the effect of the sub-chronic ketamine administration on the protein levels of AADC and TH using mass spectrometry.

3.5.1 Biologic significance of the striatal [18F]-DOPA uptake

My data confirm that [18F]-DOPA PET imaging in mice can provide a quantitative measure of fluorodopamine trapping in the striatum. Importantly the quantitative method used yielded estimates of striatal Kimod and kloss in the mouse. Additionally a

mod previous study in rats showed that the striatal Ki values responded to 6- hydroxydopamine lesioning, a process which presents another experimental manipulation of the brain dopaminergic system (Walker et al., 2013a). From the current data one can infer that Kimod outcome measure is more sensitive than Kistd in detecting the magnitude of the dopaminergic changes in response to sub-chronic ketamine-induced pharmacological manipulations. Furthermore, by correcting for the reversibility of the radiotracer in the striatum throughout the duration of the PET scan, the extended modified Patlak analysis approach we used might be representative of a more biologically meaningful and accurate outcome measure of the presynaptic dopamine synthesis capacity in the mouse (Holden et al., 1997, Walker et al., 2013b).

3.5.2 General methodological considerations

One methodological consideration is the use of male animals only. Gonadal hormones influence the dopaminergic function in rodents and non-human primates (Becker,

1999, Czoty et al., 2009, Leranth et al., 2000). Whilst there are higher numbers of dopaminergic cells in female compared to male rats, no sex difference in ketamine brain levels has been reported in rodents (Zanos et al., 2016). Specifically all 32 rodent and non-human primate studies included in our pre-clinical review (Kokkinou, In press)

133 of the ketamine’s effects on the dopaminergic system used male animals only. The rationale of using male animals in my experiments was twofold, a) to coincide with the previous [18F]-DOPA imaging studies in rodents (Walker et al., 2013b, Walker et al.,

2013a, Fang et al., 2013, Yeh et al., 2014a) and b) to keep experimental designs simple, since characterization of oestrous cycle phases in females was not required.

However, extrapolations of the dopaminergic function elicited by sub-chronic ketamine in females should be treated with care and studies in females are required.

Another consideration is the use of isoflurane anaesthesia throughout the PET scan.

This was compulsory due to the nature of the experiments that is mice had undergone external jugular vein cannulations for the injection of the radiotracer. A previous rodent study demonstrated significantly less 11C raclopride uptake (D2 radiotracer) in the striatum and cerebellum in the awake as compared to the anaesthetized states

(ketamine/xylazine anaesthesia) (Patel et al., 2008). Moreover isoflurane anaesthesia has been shown to reduce the uptake of [18]F-fluorodeoxyglucose (18F-FDG) compared with awake states in mice (Toyama et al., 2004), rats (Matsumura et al.,

2003) and non-human primates (Noda et al., 2003). There exists no investigation of the effects of isoflurane anaesthesia on the FDOPA uptake compared to the awake states. However, isoflurane anaesthesia is unlikely to impact the significance of my findings for two reasons 1) I used the necessary saline-control group and 2) the method of quantification of dopamine synthesis capacity used involves the calculation of striatal [18F]-DOPA uptake relative to the cerebellum, thus under the assumption that the effect of isoflurane anaesthesia on [18F]-DOPA uptake is the same in both regions in both groups, one can infer that any differences between the experimental groups in striatal [18F]-DOPA uptake would be due to the experimental manipulation

(ie: saline vs ketamine).

134

3.5.3 Conclusion

Sub-chronic ketamine treatment leads to increased striatal dopamine synthesis capacity and locomotor sensitization in mice. My data suggest for the first time that sub-chronic ketamine’s effects in vivo in the rodent could be used to model striatal dopaminergic overactivity.

135

Chapter 4- Dopamine neuron firing is required for the sub-chronic ketamine’s effects on the presynaptic striatal dopamine synthesis capacity and locomotor sensitization.

136

4.1 Abstract

In the previous chapter I showed for the first time that sub-chronic ketamine administration is associated with elevations in the presynaptic striatal dopamine synthesis capacity as measured by [18F]-DOPA PET imaging in the male mouse.

Additionally, I showed that sub-chronic ketamine treatment induced locomotor sensitization. In this chapter to investigate whether ketamine’s effects on the striatal dopamine synthesis capacity and locomotor sensitization require midbrain dopamine neuron activation I used a chemogenetic approach to selectively inhibit midbrain dopamine neuron activity prior to ketamine administration. To do so Gi human M4 muscarinic DREADDs (hM4Di) were expressed in the midbrain dopamine neurons of iDATCre mice. Mice then received repeated ketamine or saline administration preceded by CNO or vehicle. Locomotor activity as indexed by the distance travelled and presynaptic striatal dopaminergic function as indexed by the influx rate constant

18 mod of [ F]-DOPA uptake, namely Ki , were the main outcome measures. Chemogenetic inhibition of dopamine neuron firing prevented the ketamine-induced locomotor sensitization (p<0.01). Furthermore, chemogenetic inhibition also prevented the

mod ketamine-induced elevation in the presynaptic striatal Ki (p<0.05). My findings indicate that in the male mouse sub-chronic ketamine administration mediates its effects on locomotor sensitization and increase in striatal pre-synaptic dopamine synthesis capacity via the activation of midbrain dopamine neurons.

137

4.2 Introduction

In the previous chapter I showed that sub-chronic ketamine administration leads to locomotor sensitization. Importantly my [18F]-DOPA PET work in the previous chapter has demonstrated that sub-chronic ketamine administration is associated with a significant elevation in the pre-synaptic striatal dopamine synthesis capacity in the male mouse as compared to control conditions. These exciting findings triggered an interesting and in fact logical question: What is the mechanism by which sub-chronic ketamine administration leads to locomotor sensitization and the elevation in striatal dopamine synthesis capacity?

It is theorized that ketamine’s effects on the dopaminergic system are mediated by increased glutamate release via the inhibition of GABAergic interneurons (Homayoun and Moghaddam, 2007). There is extensive evidence that local glutamate afferents modulate dopamine release in the striatal terminals (Desce et al., 1992, Leviel et al.,

1990). Moreover, enhanced glutamate function in the hippocampus has been shown to correlate with increased fluorodopa ([18F]-DOPA) uptake in the striatal dopamine terminals of patients with schizophrenia (Stone et al., 2010). Furthermore, four in vivo electrophysiology studies in chloral hydrate anaesthetized rats suggest that acute ketamine (range of ketamine dose: 3-17mg/kg) increases dopamine neuron population activity (Belujon and Grace, 2014a, Witkin et al., 2016, El Iskandrani et al.,

2015b, French and Ceci, 1990). Conversely only one study investigated the effect of sub-chronic (3 day) administration of ketamine (dose 10mg/kg) and reported no changes in population activity and the firing rate of dopamine neurons (El Iskandrani et al., 2015a).

138

Importantly the mechanism of sub-chronic ketamine’s action on the dopamine neuron firing at the systems level is not clear. Specifically direct evidence in real time linking the effect of sub-chronic ketamine on dopamine neuron firing in mediating ketamine- induced locomotor sensitization and the pre-synaptic striatal dopaminergic function is lacking. Given this context it was logical to infer that ketamine’s mode of action in inducing locomotor sensitization and elevation in striatal dopamine synthesis capacity involves the activation of midbrain dopamine neurons. In virtue of the pre-clinical literature and the exciting findings from Chapter 3 I aimed to unravel the role of midbrain dopamine neuron firing in mediating ketamine’s effects on locomotor sensitization and the presynaptic striatal dopaminergic function. To do this I have used inhibitory hM4Di DREADD receptor technology (explained in methods chapter 2), which is the most commonly used inhibitory DREADD (Urban and Roth, 2015) in a dopamine specific manner. The goal was to investigate whether midbrain dopamine neuron activation is necessary for the effects of sub-chronic ketamine on locomotor sensitization and elevation of dopamine synthesis capacity. Therefore in the current chapter I aimed to

A. investigate whether sub-chronic ketamine-induced locomotor sensitization

requires midbrain dopamine neuron activation.

B. investigate the role of midbrain dopamine neuron firing in mediating the effects

of sub-chronic ketamine treatment on the elevation in presynaptic striatal

dopaminergic function as measured using in vivo [18F]-DOPA µ positron

emission tomography (µPET) imaging.

139

My a priori hypotheses were that midbrain dopamine neuron activation would be required for the effects of the sub-chronic ketamine administration on the induction of locomotor sensitization and the elevation of dopamine synthesis capacity.

140

4.3 Methods

4.3.1 Animals

Male iDAT Cre heterozygous mice on a C57BL/6 background (8-10 week old at the start of testing) were used in all experiments. For the DREADD experiments mice expressing Gi-coupled human M4 muscarinic DREADD (hM4Di) in midbrain dopamine neurons were used. Mice underwent stereotaxic injection of hM4Di DREADD in VTA and SNc and locomotor activity was assessed using the open field test.

4.3.2 Power calculation

Detailed power calculation for the PET imaging experiment is provided in chapter 2.

Specifically to achieve a power of 0.8 to detect a large effect size, p<0.05, using repeated-measures two-way ANOVA with four experimental groups, a total of 45 mice will be required. Previous unpublished data in our experimental settings showed significantly reduced locomotor activity in hM4Di stereotactically-injected iDAT Cre mice treated with CNO compared to mice treated with saline with a large effect size of

Cohen’s d=1.8. Therefore to achieve a power of 0.8 to detect a large effect size of f=0.9 (effect size f for ANOVAs equivalent to Cohen’s d=1.8), p<0.05, using a two-way

ANOVA with four experimental groups, a minimum of 20 mice are required.

4.3.3 Statistics

Normality of distributions was tested using the one-sample Kolmogorov-Smirnov test.

Subject characteristics and tracer activity data were analysed using one-way ANOVA for normally distributed data and Kruskal-Wallis test for data that was not normally distributed. The frequency of TH/mCherry co-expression was analysed by independent samples t-tests. Two-way analysis of variance (ANOVAs) with repeated

141 measures were conducted to compare main effects of time and group and the interaction effect between these factors on locomotor activity followed by post-hoc

Bonferroni t-tests. Two-way analysis of variance (ANOVA) was conducted to compare main effects of CNO or saline pre-treatment and saline or ketamine treatment and the interaction effect between these factors on [18F]-DOPA influx rate constant followed by post-hoc Bonferroni t tests. In addition analysis of covariance (ANCOVA) with group

mod as fixed factor and Ki as the dependent variable was used to determine the potential confounding effects of specific activity on [18F]-DOPA influx rate constant. Outliers in the data were identified using the Grubb’s test (Grubbs 1950). Pearson’s correlations were used to explore the relationship between [18F]-DOPA influx rate constant and locomotor activity. All results are expressed as the mean ± SEM (standard error of the mean). Statistical significance was defined as p<0.05, two-tailed. Effect sizes were calculated as Cohen’s d, partial η2 and correlation coefficient r where appropriate.

142

4.4 Results

4.4.1 Validation of the midbrain hM4Di DREADDs

I used a DREADD-driven method to remotely control midbrain dopamine neuron activation in vivo. I injected a Cre-dependent adeno-associated (AAV) virus vector in order to drive the expression of Gi-coupled DREADD hM4Di into VTA and SNc dopamine neurons of iDAT Cre mice (Figure 4.1A). Two to three weeks post–surgery mice were culled and brains were checked for virus expression. In the VTA a total of

65 TH+ neurons were counted, 47 of which were determined to also express mCherry, whilst 18 did not, thus resulting in about 71.7% colocalization (Figure 4.1C).

Furthermore, from a total of 48 mCherry positive neurons, only 1 which did not stain for TH was determined, thus about 1.5% of mCherry+ neurons were not TH+. In the

SNc a total of 52 TH+ neurons were counted, 47 of which were determined to also express mCherry, whilst 5 did not, thus resulting in about 89.6% colocalization.

Furthermore, from a total of 48 mCherry positive neurons, only 1 which did not stain for TH was determined, thus about 1.5% of mCherry+ neurons were not TH+ (Figure

4.1D). Therefore, the virus produced robust hM4Di expression within the midbrain

(Figure 4.1) and the transduction efficiency is in line with previous studies DAT Cre mice (Domingos et al., 2011). In addition previous data from our group confirmed via ex vivo recordings of midbrain dopamine neuron firing that CNO application to coronal midbrain slices resulted in hyperpolarization of the dopamine neurons in iDAT Cre mice previously injected with hM4Di DREADDs (Sandhu EC., In review). Therefore, these data support the validation of the hM4Di DREADD expression in the midbrain of iDAT Cre mice and the inhibition of neuronal firing following CNO application in our experimental settings.

143

A AAV- hM4Di-mCherry

VTA SNc

B TH mCherry Merge

SNc

VTA

15 µm

144

C D

A 1 0 0

1 0 0

s s

n 8 0 n

o 8 0

e e

n 6 0

e l

4 0 l l

e 4 0

2 0 L

2 0

% % 0 0 TH + - TH + - mCherry + + mCherry , + +

Figure 4.1: hM4Di inhibitory DREADD expression in the midbrain: (A+B) Representative example of co-expression (white) of mCherry (magenta) and TH (green) confirmed expression of the hM4Di DREADD in the midbrain dopamine neurons. Scale bars=15m. (C) Frequency of TH+ neurons co-expressing mCherry (47 out of total 65 TH+ neurons; 71.7 ± 11 %) and frequency of mCherry+ which do not express TH (1 out of total 48 mCherry + neurons, 1.5 ± 1.5%) in the ventral tegmental area. (D) Frequency of TH+ neurons co-expressing mCherry (47 out of total 52 TH+ neurons; 89.6 ± 5.4) and frequency of mCherry+ which do not express TH (1 out of total 48 mCherry+ neurons, 1.5 ± 1.5 %) in the SNc.

145

4.4.2 Inhibiting midbrain dopamine neuron firing reduced ketamine-induced locomotor hyperactivity

To test whether inhibiting midbrain dopamine neuron firing would prevent the effects of the acute ketamine administration on locomotor hyperactivity I injected iDAT Cre mice with CNO or vehicle (saline) prior to the administration of ketamine or vehicle

(saline). CNO administration prevented the effects of ketamine on locomotor hyperactivity in the male mouse. A two-way repeated measure ANOVA of the data from the acute ketamine experiment revealed a significant time (F11, 550= 42.79, p<0.001), group (F3, 50= 23.68, p<0.001) and time x group interaction effects (F33, 550=

5.381, p<0.001). Ketamine alone (Saline/ketamine group) significantly increased locomotor activity compared to control conditions, an effect that lasted for 30min following drug administration (p<0.05). Interestingly there was no significant difference between CNO/Ketamine and saline/saline groups (p>0.05). Moreover there was a significant difference in locomotor activity between CNO/Saline and CNO/Ketamine groups (p<0.001) and between saline/ketamine and CNO/Ketamine groups (p<0.01).

Thus, CNO pre-treatment reduced ketamine-induced locomotor hyperactivity by

~42%.

146

Hab CNO or Sal Sal or Ket

4 0 0 0

) S a l_ S a l

c (

C N O _ S a l

d 3 0 0 0

e l

l S a l_ K e t e

v C N O _ K e t

a 2 0 0 0

e c

n 1 0 0 0

i D 0 2 5 5 0 7 5 1 0 0 T im e in 5 m in b in s (m in s )

Figure 4.2: Distance travelled in 5min bins as measured by the open field test in DAT Cre mice. On day 1 of the experiment, mice were habituated in open field arenas for 20min. Mice then received pre-treatment with CNO or saline (dashed line) at time point=20min, followed by treatment with ketamine or saline at time point 50min. Values represent mean ± SEM.

147

To test whether inhibiting midbrain dopamine neuron firing would prevent the effects of sub-chronic ketamine administration on locomotor hyperactivity I injected iDAT Cre mice with CNO or vehicle (saline) prior to the administration of ketamine or vehicle

(saline), daily for five consecutive days and locomotor activity was assessed on day 5

(Please see Figure 2.2 in Chapter 2 for a schematic of the experimental pipeline). CNO administration prevented the effects of sub-chronic ketamine administration on locomotor hyperactivity in the male mouse. A two-way ANOVA of the locomotor data from the sub-chronic ketamine experiment revealed a significant effect of time (F11, 638

= 50.61, p<0.001), group (F3, 58= 37.33, p<0.001) and time x group interaction effects

(F33, 638 = 15.38, p<0.001). Bonferroni post hoc analyses revealed that ketamine alone

(Saline/Ketamine group) significantly increased locomotor activity for 40min after administration compared to control conditions (Figure 4.3). In addition CNO alone did not significantly reduce locomotor activity (p>0.05). Interestingly there was no significant difference between CNO/Ketamine and saline/saline groups (p>0.05).

Moreover there was a significant difference in locomotor activity between CNO/Saline and CNO/Ketamine groups (p<0.001), an effect that lasted for 20min after administration and between saline/ketamine and CNO/Ketamine groups, an effect that lasted for 40min after administration (p<0.001). Therefore, CNO pre-treatment attenuated ketamine-induced locomotor hyperactivity by ~80% (Figure 4.3).

148

Hab CNO or Sal Sal or Ket

4 0 0 0

) S a l_ S a l

c (

C N O _ S a l

d 3 0 0 0

e l

l S a l_ K e t e

v C N O _ K e t

a 2 0 0 0

e c

n 1 0 0 0

i D 0 2 5 5 0 7 5 1 0 0

T im e in 5 m in b in s (m in s )

Figure 4.3: Distance travelled in 5min bins as measured by the open field test in DAT Cre mice. All mice received once daily injections of CNO or Saline pre-treatment and 30min later received ketamine or saline treatment on days 2, 3 and 4 of the experiment. On day 5 of the experiment, mice were habituated in open field arenas for 20min. Mice then received pre- treatment with CNO or saline (dashed line) at time point=20min, followed by treatment with ketamine or saline at time point 50min. Values represent mean ± SEM.

149

4.4.3 Inhibiting midbrain dopamine neuron firing prevented ketamine-induced locomotor sensitization

Additionally I performed a secondary analysis of the data of locomotor activity on days

1 and 5 following ketamine or saline administration (for 30min) to test the hypothesis that inhibiting midbrain dopamine neuron firing via CNO would prevent ketamine- induced locomotor sensitization. CNO prevented the effects of sub-chronic ketamine on locomotor sensitization. A two-way ANOVA analysis of locomotor activity, demonstrated significant main effects of treatment (F3, 52= 63.1, p<0.001), no significant effect of day (F1, 52=1.847, p>0.05) and a significant group X day interaction

(F3, 52=10.89, p<0.001) (Figure 4.4). Importantly Bonferroni’s post-hoc analyses yielded a significant increase in locomotor activity on day 5 as compared to day 1 in the sal/ket group (Cohen’s d=1.4, t52 = 5.93,p<0.001) with a large effect size (d= 1.9).

There was no difference in locomotor activity on day 5 as compared to day 1 in

CNO/Ket group (t52= 1.08, p>0.05). Therefore inhibiting dopamine neuron firing by

CNO administration prevented ketamine-induced locomotor sensitization.

150

) * * *

m 2 5 0 0 0 n s c

( S a l/S a l

e 2 0 0 0 0 C N O /S a l

l e

v S a l/K e t

a i

r 1 5 0 0 0

m T

C N O /K e t

c 1 0 0 0 0

t s

i 5 0 0 0

a t

o 0 T D a y 1 D a y 5

Figure 4.4: Total distance travelled in the open field arenas 30min post ketamine or saline treatment on days 1 and 5. Repeated CNO administration prior to ketamine treatment (CNO/Ket group depicted in purple) prevented the ketamine-induced locomotor sensitization evident in saline/ketamine group of mice (depicted in red). Data represent mean ± SEM. *** p <0.001

151

4.4.4 Subject characteristics and scan parameters

Subject characteristics and scan parameters are summarized in Table 4.1. There was no significant group difference in the weight of the mice (F3, 44=1.13, p=0.35) and the amount of injected dose (F3, 44 =1.39, p=0.26). There was a significant group difference in specific activity (F3, 41 =4.28 p<0.05). Specifically post-hoc Bonferroni comparisons identified that the specific activity differed between CNO/Saline and Sal/Ketamine

(p=0.048) and between CNO/Saline and CNO/Ketamine groups (p=0.014). Therefore specific activity was factored in as a covariate of separate analysis.

152

Subject Saline/Saline CNO/Saline Saline/Ketamine CNO/Ketamine Group comparisons

a characteristic [mean(SEM)] [mean(SEM)] [mean(SEM)] [mean(SEM)] Fdf p and scan parameters

Weight (g) 27.55 ± 0.65 26.52 ± 0.44 26.83 ± 0.54 26.23 ± 0.42 F3, 44=1.13, p=0.35

Injected dose 4.08 ± 0.56 3.38 ± 0.57 5.4 ± 0.96 5.23 ± 0.82 F3, 44=1.39, p=0.26

(MBq)

Specific activity 0.03 ± 0.002 0.02 ± 0.003 0.03 ± 0.002 0.04 ± 0.004 F3, 41=4.28, p=0.01*

(MBq/µmol)

Table 4.1: Subject characteristics and scan parameters. Abbreviations: CNO- clozapine N-Oxide; SEM- standard error of mean, a One-way ANOVA,* p<0.05

153

4.4.5 Sub-chronic ketamine’s effects on the pre-synaptic striatal dopaminergic function are reversed by inhibition of midbrain dopamine neuronal activation.

My pilot data showed that activation of midbrain dopamine neuronal firing using activatory hM3Dq DREADDs resulted in locomotor hyperactivity following CNO administration as compared to control condition (data not shown). These data in addition to the finding in current chapter that activation of midbrain dopamine neuron is required for the effects of ketamine on locomotor hyperactivity our hypothesis was that dopamine neuronal activity in the midbrain contributes to the ketamine-induced elevation of the pre-synaptic striatal dopaminergic function. Therefore, I used chemogenetics to investigate whether inhibiting midbrain dopamine neuron firing via

CNO would prevent the effects of sub-chronic ketamine on the dopamine synthesis

mod capacity as indexed by Ki . In line with my hypothesis chemogenetic inhibition of midbrain dopamine neuron firing via CNO prevented the ketamine-induced increase

mod in Ki (Figure 4.5). Therefore midbrain dopamine neuron firing is necessary for the effects of ketamine on the pre-synaptic striatal dopaminergic function. In agreement to my previous findings summarised in chapter 3 ketamine as compared to saline

mod treatment significantly increased Ki irrespective of CNO or saline pre-treatment. In addition, visual inspection of the data followed by Grubb’s test, identified two outliers, one in the CNO/Ket and one in Sal/Ket group. Results remained significant after exclusion of the outliers.

mod std Moreover, specific activity was not significantly related to Ki , Ki nor kloss (p>0.05).

mod The finding of reduced Ki following inhibition of dopamine neuron firing with CNO remained significant even after covarying for the specific activity, with the amount of specific activity included as a covariate in the ANCOVA (F4, 41= 3.58, p=0.015).

154

* * 0 .1 0

0 .0 8

)

- n

i 0 .0 6

(

o 0 .0 4

i K 0 .0 2

0 .0 0 S a l/S a l C N O /S a l S a l/K e t C N O /K e t

Figure 4.5: Dopamine synthesis capacity as indexed by Kimod. *Significance p<0.05 compared to all other groups. A two-way ANOVA demonstrated significant main effect of CNO/Saline pre-treatment (F1, 41=5.89, p=0.02), ketamine/saline treatment (F1, 41=4.78, p=0.03) and an interaction (F1, 41=4.146, p=0.048) between these two factors. Bonferroni’s post-hoc analyses

mod indicated that CNO as compared to saline pre-treatment significantly reduced Ki in ketamine-treated mice (t41=3.35, p<0.05). Bonferroni post-hoc between Sal/Sal and Sal/Ket groups t41=3.10, p<0.05 and Bonferroni post-hoc between CNO/Sal and Sal/Ket groups t41=3.20, p<0.05. Data shown with inclusion of the outliers.

155

Parameter Sal/Sal CNO/Sal Sal/Ket CNO/Ket Dopamine neuron firing Ketamine vs Saline Interaction between

mean mean mean mean manipulation treatment dopamine neuron firing

(SEM) (SEM) (SEM) (SEM) CNO vs Saline manipulation and ketamine

n=11 n=9 n=13 n=12 vs saline treatment

F p η2 F p η2 F p η2

mod -1 Ki (min ) 0.017 0.015 0.034 0.016 F1,41=5.88 0.02* 0.125 F1,41=4.78 0.03* 0.104 F1,41=4.15 0.048* 0.092

(0.002) (0.002) (0.006) (0.003)

std -1 Ki (min ) 0.009 0.010 0.011 0.009 F1,41=0.25 0.62 0.006 F1,41=3.00 0.09 0.068 F1,41=9.58 0.004* 0.189

(0.0003) (0.001) (0.001) (0.0005)

-1 kloss (min ) 0.016 0.013 0.027 0.015 F1,41=6.10 0.02* 0.130 F1,41=4.44 0.04* 0.098 F1,41=1.90 0.178 0.044

(0.002) (0.001) (0.003) (0.004)

Table 4.2 A: [18F]-DOPA uptake in four experimental groups. Dopamine synthesis capacity, as measured by [18F]-DOPA uptake, is significantly reduced following inhibition of dopamine neuron firing prior to

mod std ketamine treatment. The mean outcome measure namely Ki , Ki and kloss are shown for main experimental group (CNO/Ket) along with those of the control groups (Sal/Ket, CNO/Sal and Sal/Sal). * Significance <0.05. Data with inclusion of the outliers.

156

4.5 Discussion

My main finding is that midbrain dopamine neuron activation is required for the effects of the sub-chronic ketamine administration (A) on locomotor sensitization and (B) elevation of the presynaptic striatal dopaminergic function. CNO treatment prior to ketamine administration in iDatCre mice expressing hM4Di DREADDs prevented the effects of ketamine on locomotor activity (p<0.01) and striatal dopamine synthesis capacity (p<0.05). Furthermore striatal dopamine synthesis capacity, as indexed by

mod Ki , was significantly correlated with the ketamine-induced locomotor hyperactivity linking elevated dopamine synthesis capacity to the expression of locomotor hyperactivity induced by ketamine, rather than locomotor activity in general. This finding is of particular interest in relation to the mechanism of action of ketamine, further lending support to the hypothesis that ketamine alters the midbrain dopamine neuron firing to drive the striatal dopaminergic alterations. Moreover I validated the use of Gi-coupled DREADDs to specifically inhibit the dopamine neuron pathway through modulation of DREADD-expressing dopamine neuron cell bodies and to functionally disconnect midbrain-striatal circuit in vivo in the male iDATCre mouse.

4.5.1 General methodological considerations

One limitation of the DREADD technology is the potential for ectopic expression of the hM4Di DREADD in non-dopamine neurons and thus inhibition of non-dopamine neuron activity. Thus Cre expression in unintentionally targeted neurons would confound the interpretation of my findings supposed to be driven via targeted specific neuronal populations. Specifically it has been shown that in TH-Cre transgenic mouse lines in contrast to the iDAT-Cre transgenic mouse lines there was significant ectopic

Cre expression in the VTA (Lammel et al., 2015). Here I used the iDAT-Cre transgenic

157 mouse line, with the Cre recombinase expression under the DAT promoter, with ~1.5% ectopic expression in midbrain. Thus it is unlikely that my findings are due to inhibition of non-dopamine midbrain neurons. Moreover, it has been recently reported that clozapine as opposed to CNO has greater affinity for the DREADD receptors (Gomez and Bonaventura, 2017). Yet, in C57BL/6 mice the retroconversion of CNO to clozapine has not been documented. The aforementioned DREADD technology limitation is discussed in chapter 6 in more detail. Additionally, the inclusion of an empty vector control group such as a viral construct expressing mCherry without the

DREADD receptor would be required to rule out the possibility of off-target effects of

CNO.

4.5.2 Interpretation of the findings

I showed that the repeated ketamine-induced locomotor sensitization requires midbrain dopamine neuronal activation using the DREADD technology to specifically deconstruct this behavioural phenomenon. My results are in line with previous data that linked the chronic NMDAR antagonist-induced locomotor sensitization to the dopaminergic system (Phillips et al., 2001). Specifically the locomotor stimulatory effects of the more potent than ketamine NMDAR antagonists namely phencyclidine

(PCP) and dizocilpine (MK-801) were reduced with the administration of dopamine receptor antagonists (Sturgeon et al., 1981, Lapin and Rogawski, 1995). Additionally it has been reported that 6-hydroxydopamine (6-OHDA) lesions in the VTA and the nucleus accumbens prevented the NMDAR antagonist –induced hyperactivity (French et al., 1985, French and Vantini, 1984). However conflicting data also exist. In particular a dissociation between the effects of dopamine and acute PCP and MK-801- induced locomotor hyperactivity has been reported using a dopamine deficient genetic

158 mouse model in which tyrosine hydroxylase is selectively inactivated in dopaminergic neurons (Chartoff et al., 2005). Our results are in line with sensitization of midbrain dopamine neuron reactivity and stimulant-induced locomotor sensitization (Didone et al., 2016, Vezina, 2004).

Importantly based on my findings one can infer that activation of midbrain dopamine neuron firing induced by sub-chronic ketamine administration is reflected via increased striatal uptake of the radiotracer fluorodopa ([18F]-DOPA), measured by positron- emission tomography. It would be interesting to directly test whether activating midbrain dopamine neuron firing using hM3Dq DREADD would lead to increase in striatal dopamine synthesis capacity and dopamine release in the striatum.

Additionally sub-chronic ketamine induced locomotor hyperactivity positive correlates with striatal dopamine synthesis capacity. This suggests that midbrain dopamine neuron firing rate may be one of the mechanisms underlying ketamine-induced locomotor hyperactivity.

4.5.3 Adding a piece to the puzzle of ketamine’s mechanism of action

The mechanism of action of ketamine on the dopaminergic system has not yet been completely established. It is theorized that this involves NMDAR hypofunction on

GABAergic interneurons, which in turn disinhibit glutamatergic projections to the midbrain. This consequently leads to an increase in dopamine neuron firing and elevation of dopamine levels in the projection targets. In particular there is evidence to suggest that ketamine induces glutamate release (Rowland et al., 2005, Stone et al., 2012, Kim et al., 2011a). My data confirm that specifically dopamine neuronal activation is required for ketamine’s mechanism of action on striatal dopamine synthesis capacity. Further studies are required to investigate whether ketamine’s

159 effects on the dopaminergic system require inhibition of the GABAergic interneurons by directly activating this neuronal subpopulation prior to ketamine administration.

4.5.4 Conclusion

Here I describe a midbrain-striatal pathway activated by and necessary for ketamine- induced locomotor sensitization. These data provide a novel circuit-level framework to understand the contribution of the dopaminergic mechanisms in driving ketamine- induced locomotor sensitization. Additionally my findings have implications in understanding the effects of the dopaminergic system in ketamine-induced psychotomimetic and antidepressant effects in addition to ketamine’s abuse potential.

In summary I have described a new pathway, the projection from the midbrain to striatum that is necessary for locomotor sensitization and the elevation in presynaptic striatal dopaminergic function in the sub-chronic ketamine mouse model.

160

Chapter 5- Investigating the effects of sub-chronic ketamine administration on cocaine-induced locomotor responses, latent inhibition and incentive motivation in the male mouse.

161

5.1 Abstract

In previous chapters I have shown that sub-chronic ketamine administration is associated with the elevation of pre-synaptic striatal dopamine synthesis capacity and that this requires midbrain dopamine neuronal activation. Thus sub-chronic ketamine administration is associated with dopaminergic overactivity in the male mouse brain.

Additionally dopamine has been implicated in reward processing and learning.

Moreover previous studies have shown enhanced effects of psychostimulants on the dopamine release following acute ketamine injections in rodents (Uchihashi et al.,

1992) and humans (Kegeles et al., 2000b). The sub-chronic effects of ketamine on cross-sensitization to psychostimulants are understudied. Therefore in this chapter I sought to investigate the effects of sub-chronic ketamine administration on latent inhibition, incentive motivation and cocaine-induced locomotor activity in the male mouse and investigate whether these effects are dependent on midbrain dopamine neuronal activation. Mice received repeated ketamine or saline administration. Then latent inhibition of conditioned fear response was assessed and the main outcome measure was the percentage freezing response. Incentive motivation was assessed using the operant progressive ratio task for sucrose reward. The main outcome measure was the progressive ratio breakpoint. Locomotor sensitization to cocaine was measured using the open field test and the main outcome measure was the total distance travelled in 15min post cocaine administration. The hM4Di DREADD approach was then used to selectively inhibit midbrain dopamine neuron firing via the application of CNO as described in chapter 4 to investigate whether midbrain dopamine neuron activation is required for the sub-chronic ketamine’s effects on cocaine cross-sensitization. Mice sensitized to ketamine did not show deficits in latent inhibition of fear response (F1, 32=0.52, p>0.05) nor incentive motivation (t37=0.07,

162 p>0.05) to sucrose reward when tested drug free. Mice sub-chronically treated with ketamine as compared to saline did not demonstrate changes in cocaine-induced locomotor sensitization. Finally the effects of sub-chronic ketamine on cross- sensitization to cocaine were independent of midbrain dopamine neuron activation at the time of ketamine administration (Moderate effect size Cohen’s d=0.69, t66=4.46, p<0.01).

163

5.2 Introduction

In previous chapters I showed for the first time that sub-chronic ketamine administration as compared to saline condition is associated with elevation in striatal dopamine synthesis capacity. Thus, in this chapter I examined the effects of sub- chronic ketamine administration on mouse behavioural measures that have been previously linked to the dopaminergic system, namely latent inhibition, incentive motivation and enhanced locomotor response to cocaine (Powell and Miyakawa,

2006).

Alterations in dopaminergic neurotransmission have been implicated with disruption in latent inhibition (LI). Specifically LI has been abolished with the administration of amphetamine; a stimulant which increases extracellular dopamine (Calipari and

Ferris, 2013), in humans (Kumari et al., 1999) and rats (Solomon et al., 1981).

Furthermore, alterations in glutamatergic neurotransmission such as in a genetic mouse model with deficient glutamatergic neurotransmission have been associated with potentiated LI (Gaisler-Salomon et al., 2009c). Additionally acute administration of ketamine and other non-competitive NMDA receptor antagonists, namely phencyclidine (PCP) and dizocipline (MK-801), impaired the performance of cognitive tasks in rats (Verma and Moghaddam, 1996a, Kesner and Dakis, 1993). Precisely acute ketamine (dose= 25mg/kg) administration abolished LI in a conditioned fear paradigm in the rat (Razoux et al., 2007). Few studies investigated the effects of sub- chronic ketamine administration in LI paradigms and results are inconsistent with studies showing impairment or no change in LI (Weiner and Arad, 2009, Jeevakumar et al., 2015, Becker et al., 2003).

Furthermore there is a dissociation between the neurochemical mechanisms underlying hedonia (liking) and anticipatory motivation (wanting), with the latter being

164 associated with the dopaminergic system (Pecina et al., 2003, Simpson et al., 2012).

Additionally dopamine is implicated in reinforcement learning and willingness to provide effort to acquire a reward (Smith et al., 2011). Please see the review by

Simpson et al. for more details (Simpson et al., 2012). Interestingly the dopamine transporter (DAT) knockdown mice, which are genetic mouse models with 70% increase in synaptic dopamine, displayed increased motivation for sweet reward, without changes in orofacial liking reactions (Pecina et al., 2003). Importantly mice, referred to as autoDrd2KO mice, which are deficient in D2 autoreceptors on the dopaminergic neurons, showed increased dopamine synthesis and release and displayed increased motivation for food reward (Bello et al., 2011). Additionally a mouse model overexpressing striatal D2 receptors (D2R-OE) displayed intact hedonic reactions to reward and deficits in incentive motivation (Simpson et al., 2011).

Additionally sub-anaesthetic dose of ketamine has been associated with reduction in the incentive-motivational value of reward-related cues (Fitzpatrick and Morrow,

2017). The effects of sub-chronic administration of ketamine on incentive motivation are inconsistent with the majority of studies reporting no effect (Amann et al., 2009,

Featherstone et al., 2012) or deficits in incentive motivation as compared to control conditions (Wright et al., 2007).

Additionally previous studies showed enhanced effects of psychostimulants on dopamine release following acute ketamine injections in rodents (Uchihashi et al.,

1992) and humans (Kegeles et al., 2000b). It is logical to suspect that the dopaminergic overactivity seen following sub-chronic ketamine administration as reported in Chapter 3 may be linked to the enhanced responses to psychostimulants.

Stimulants, for instance cocaine and amphetamine, elevate extracellular dopamine via blockade of the dopamine transporter (DAT) or stimulation of dopamine release

165 respectively (Kahlig and Galli, 2003). Drug abuse is closely linked to the striatal dopamine release (Everitt and Robbins, 2005), a critical association that has been recognized for many years (Koob, 1992). Preclinical studies suggest that acute administration of psychostimulants increases dopamine levels in the striatum and accumbens as measured by in vivo microdialysis (Willuhn et al., 2010). Conversely there is evidence of reduction in phasic dopamine signalling in the striatum following excessive cocaine use in the rat (Willuhn et al., 2014). Additionally evidence for chronic cocaine administration is inconsistent with studies reporting reduction in extracellular dopamine in the caudate and accumbens (Segal and Kuczenski, 1992,

Hooks et al., 1994, Kalivas and Duffy, 1993) or increase in dopamine output following withdrawal (Heidbreder et al., 1996, Imperato et al., 1992, Weiss et al., 1992).

Interestingly there has been a dissociation between phasic and tonic dopamine with the latter being uninvolved in the chronic effects of cocaine on dopamine signalling in the striatum in both rodents (Ahmed et al., 2003) and non-human primates (Bradberry,

2000).

Interestingly NMDAR antagonism via MK-801 (a more potent NMDAR blocker compared to ketamine) induced potentiation of stimulant-induced dopamine release in the rat striatum (Miller and Abercrombie, 1996). Additionally acute co-administration of cocaine with ketamine has been shown to potentiate the ambulatory activity in mice

(Uchihashi et al., 1992). These data suggest that the dopamine and glutamate systems are directly linked. Specifically we have shown that ketamine-induced locomotor sensitization required midbrain dopamine neuron activation (Chapter 4).

Additionally hyperlocomotion in rodents induced by acute NMDAR antagonism, via the administration of PCP, MK-801 and ketamine, was blocked by dopamine receptor antagonists (Corbett, 1989, Irifune et al., 1995). These data suggest that the activation

166 of the dopaminergic system induced by NMDAR antagonism may be necessary in driving the enhanced behavioural effects to psychostimulants. However, the effect of sub-chronic ketamine administration on cocaine-induced locomotor behaviour has not been previously investigated. Cross-sensitization is a phenomenon whereby sub- chronic administration of one drug, such as ketamine, leads to an increased sensitivity to the effect of another drug. In this chapter I sought to

(A) investigate the effects of sub-chronic ketamine regime following a two-day

washout on latent inhibition using a conditioned fear paradigm

(B) investigate the effects of sub-chronic ketamine regime following a two-day

washout on incentive motivation for sucrose reward

on cocaine-induced locomotor responses in the male mouse

(D) investigate whether inhibiting midbrain dopamine neuron firing prior to

ketamine administration, which prevents ketamine-induced locomotor

sensitization, would suppress cocaine-induced locomotor behaviours

Furthermore, my a priori hypotheses were that sub-chronic ketamine administration

(A) would block latent inhibition, (B) would reduce incentive motivation to sucrose reward, (C) would induce enhanced response to repeated cocaine administration, and

(D) that these effects would require the activation of midbrain dopamine neurons at the time of ketamine administration.

167

5.3 Methods

5.3.1 Animals

A total of thirty-six male C57BL/6 mice (age 8-10 weeks) were used for the latent inhibition experiment. A total of thirty-nine male C57BL/6 mice (age 8-10 weeks) were used to test incentive motivation using the operant progressive ratio task for sucrose reward. A total of thirty C57BL/6 wild type mice and twenty six iDAT Cre mice (Age =

8-10 weeks old at the start of behavioural testing) were used to assess the effects of sub-chronic ketamine administration on locomotor activity following repeated cocaine injections.

5.3.2 Power calculation

A large effect size of d>2.0 is associated with the acute ketamine-induced disruption of latent inhibition in rodents (Razoux et al., 2007). It is therefore logical to expect a large effect size in my latent inhibition experiment in the mouse. Therefore, to achieve a power of 0.8 to detect a large effect size of f=0.4 (effect size f for ANOVAs), p<0.05, using two-way ANOVA with repeated measures, at least 28 mice are required in total.

Additionally data were not available to measure the effect size associated with the sub-chronic ketamine-induced reduction in progressive ratio task in the rodent study

Wright et al., 2007 (Wright et al., 2007). A large effect size of Cohen’s d=1.18 is associated with acute sub-anaesthetic ketamine-induced reduction in incentive motivational value of reward-related cues (Fitzpatrick and Morrow, 2017). Additionally unpublished data using the same progressive ratio approach in our experimental settings, showed changes in progressive ratio task performance with modification of dopaminergic system with a large effect size d=1.06. Thus to achieve a power of 0.8 to detect a large effect size d=1 using independent samples t-test, p<0.05, two-tailed at least thirty mice are required in total.

168

Previous study in 3-4 week old C57BL/6 mice demonstrated significant increase in locomotor activity in cocaine-treated mice compared to saline-treated controls, this difference was associated with a large effect size (Cohen’s d = 1.79) (Wanat and

Bonci, 2008). Therefore to achieve power 0.8 to detect a large effect size of f=0.40, p<0.05, using a two-way repeated measures ANOVA, a minimum of thirty mice are required.

5.3.3 Latent inhibition of fear response paradigm

Detailed methodology is provided in the methods chapter 2 and the experimental pipeline demonstrated in Figure 5.1. Barad et al., 2004 validated the experimental protocol and showed that mice that are not pre-exposed to the white noise presentations (NPE group) associate the white noise to the footshock and exhibit significantly higher freezing response as compared to mice pre-exposed to the white noise presentations (PE group). Therefore mice which belong to the PE group exhibit latent inhibition, ie: reduced association between the white noise presentation and the footshock. Using Barad et al., 2004 conditioned freezing paradigm, I investigated whether sub-chronic ketamine administration would affect latent inhibition (Barad et al., 2004). In my experiment mice were randomly allocated into four experimental groups according to the pre-exposure to the conditional stimulus (white noise) and treatment (ketamine or saline) (Figure 5.1).

169

Figure 5.1: Latent inhibition of conditioned fear response. Latent inhibition experimental pipeline: a total of 36 mice were randomly allocated into two treatment groups. Mice were injected with either 30mg/kg ketamine or an equivalent volume of 0.9% saline (i.p) once daily for 5 consecutive days. On day 6 of the experiment mice were randomly allocated into pre- exposure (PE) or non-pre-exposure (NPE) groups and underwent training in context B. Mice which belonged to the PE group experienced white noise presentations (denoted by speaker in the diagram above) and mice which belonged to the NPE group did not experience white noise presentations. On day 7 of the experiment mice were placed in context A and experienced two white noise presentations co-terminating with a footshock (yellow thunder). On day 8 mice were placed in context B and average freezing response during three white noise presentations was recorded.

170

5.3.4 Progressive ratio test of breakpoint

A detailed methodology is provided in the methods chapter and the experimental pipeline demonstrated in figure 5.2. The number of nose pokes needed to earn the next sucrose reward was increased after each subsequent sucrose reward based on an exponential progressive ratio schedule (1, 2, 4, 6, 12, 15, 20, 25, 32, 40, 50, 62,

77, 95.. etc) using the following equation:

푃푅 = [5푒(푟푒푤푎푟푑 푛푢푚푏푒푟 푥 0.2)] − 5 Equation 5.1

where PR is progressive ratio schedule rounded up to the closest integer (Richardson and Roberts, 1996, Warlow et al., 2017). Thus the main outcome measure was the progressive ratio schedule (breakpoint) reached within the 2 hours of the test day of the experiment. The higher the PR value the higher the effort the mice were willing to exert to obtain sucrose reward.

Figure 5.2: Progressive ratio task experimental pipeline. C57BL/6 mice were maintained at 85% body weight and underwent habituation and training up to fixed ratio 5 (FR5). Once they reached criteria, they underwent injections of either 30mg/kg ketamine or saline for 5 consecutive days. On day 7 they underwent testing in the progressive ratio schedule.

171

5.3.5 Cocaine administration

Mice were injected with 30mg/kg ketamine or an equivalent volume of saline once

daily for five consecutive days. Following a two-day washout period, mice were then

injected with 4mg/kg cocaine once daily for four consecutive days (Figure 5.3).

Locomotor activity was recorded on days 1, 5, 7, 8, 9 and 10 of the experiment as

explained in chapter 2. The main outcome measure was the total distance travelled

30min and 15min post ketamine and cocaine administration respectively (Wanat and

Bonci, 2008).

A 30mg/kg ketamine or saline 4mg/kg cocaine

Day1 Day5 Day 7 Day 8 Day 9 Day 10

OF test OF test OF test OF test OF test OF test

B CNO or saline & 30min later

iDATCre mice 30mg/kg ketamine 4mg/kg cocaine Stereotaxic surgery

Day1 Day5 Day 7 Day 8 Day 9 Day 10

OF test OF test OF test OF test OF test OF test

2 weeks

Figure 5.3: (A) Experimental pipeline in wild type mice. (B) Experimental pipeline in iDATCre mice.

172

5.3.6 Statistics

Data were analysed using SPSS statistical software and graphs were produced in

Graph Pad Prism. Normality of distributions was assessed using the Kolmogorov-

Smirnov (KS) test. Progressive ratio data were analyzed using independent-samples t-test for normally distributed data. Latent inhibition data were analyzed using a two- way ANOVA with mouse treatment group and pre-exposure group as the fixed factors and % freezing as the dependent factor. Two-way analysis of variance (ANOVAs) with repeated measures were conducted to compare main effects of day and group and the interaction effect between these factors on locomotor activity followed by post-hoc

Bonferroni t-tests. Statistical significance was set at p<0.05 (two-tailed). Outliers in data were identified using the Grubbs’ test (Grubbs, 1950).

173

5.4 Results

5.4.1 No effect of sub-chronic ketamine treatment on latent inhibition of conditioned-fear response

There was no significant group difference in weight of mice (t34 = 1.28, p>0.05) (Table

5.1). The percentage freezing response is indicative of the degree of association of the white noise presentation with the footshock. Contrary to my hypothesis sub-chronic ketamine administration compared to saline condition was not associated with significantly increased percentage freezing in the PE group. As seen in figure 5.4 the percentage freezing response is significantly higher in the NPE groups as compared to the PE groups irrespective of treatment. Therefore in this experimental paradigm, sub-chronic ketamine administration did not disrupt latent inhibition.

Subject characteristics Saline-treated Ketamine-treated

Mean ± SEM Mean ± SEM

Weight (g) 27.6 ± 0.56 25.7 ± 1.34

Table 5.1: Subject weights for latent inhibition experiment

174

* 1 5 0 S a lin e

K e ta m in e g

n 1 0 0

r F

5 0 %

0 N P E P E

Figure 5.4: The effect of sub-chronic ketamine treatment on the % freezing response. When tested one day following fear conditioning (acquisition), both saline and ketamine pre- exposure groups showed significant latent inhibition compared to non-pre-exposure groups

(p<0.05). A two-way ANOVA analysis revealed a significant effect of pre-exposure (F1, 32=6.29, p=0.02), no significant effect of treatment (F1, 32=0.52, p>0.05) and no interaction (F1, 32=0.15, p>0.05) between pre-exposure and treatment. Thus sub-chronic ketamine treatment did not disrupt latent inhibition. Values represent mean ± SEM. * p <0.05

175

5.4.2 No effects of sub-chronic ketamine treatment on incentive motivation breakpoint.

There was no significant difference in weight of mice (t37=0.43, p>0.05) (Table 5.2).

Contrary to my hypothesis mice sensitized to ketamine as compared with saline condition did not display reduction in incentive motivation to sucrose reward as measured by the amount of effort they put into obtaining a sucrose reward. The progressive ratio data were normally distributed (KS Test p>0.05). Contrary to my hypothesis there was no significant difference in the progressive ratio schedule between the two treatment groups (t37=0.07, p>0.05) (Figure 5.5). Additionally there were no differences between the two treatment groups neither in the number of rewards received (t37=0.071, p>0.05) nor in the number of correct responses (t37=0.07, p>0.05).

176

Subject characteristics Saline-treated Ketamine-treated

Mean ± SEM Mean ± SEM

Weight (g) 17.60 ± 0.48 17.86 ± 0.45

Table 5.2: Subject weights for the progressive ratio task

2 0 0

a v

1 5 0

e 1 0 0

s e

r 5 0

r P 0 S a lin e K e ta m in e

Figure 5.5: The effect of sub-chronic ketamine on the progressive ratio value. The progressive ratio value corresponds to the final progressive ratio reached within 2 hours of testing. Independent samples t-test reveals no significant effect of sub-chronic ketamine administration (p>0.05). Bar graphs represent mean and error bars SEM.

177

5.4.3 Effects of sub-chronic ketamine treatment on cocaine-induced locomotor activity

There was no significant group difference in the weight of mice (t28=0.20, p>0.05)

(Table 5.3). As seen in Figure 5.6A sub-chronic ketamine administration induced locomotor sensitization. Importantly this repeat study replicated my finding from chapter 3 (Section 3.4.3). Repeated 4mg/kg cocaine injections induced locomotor sensitization, irrespective of sub-chronic ketamine or saline pre-treatment. Specifically to investigate the effect of ketamine or saline administration on locomotor activity (for

15min) following repeated injections of low dose 4mg/kg cocaine in four consecutive days, a repeated measures two-way ANOVA with treatment (saline or ketamine) and day (day 7, 8, 9 10) as fixed factors was performed. Importantly Grubb’s test identified two significant outliers, one per treatment (saline or ketamine) group. However, the results were the same with the inclusion (Figure 5.6B) or exclusion of the outliers

(Figure 5.6C).

178

) ***

m 4 0 0 0 0 c

( S a lin e

e K e ta m in e l

l 3 0 0 0 0

0 2 0 0 0 0

a t

s 1 0 0 0 0

a t

o 0 T D a y 1 D a y 5

(A)

)

(

i 2 5 0 0 0 m

S a lin e

5 1

2 0 0 0 0 K e ta m in e

d e

l 1 5 0 0 0

v a

r 1 0 0 0 0

c 5 0 0 0

t s

i 0

l D a y 7 D a y 8 D a y 9 D a y 1 0

o T

(B)

179

)

(

i 1 5 0 0 0 m

S a lin e

5 1

K e ta m in e

d 1 0 0 0 0

r T

5 0 0 0

t s

i 0

l D a y 7 D a y 8 D a y 9 D a y 1 0

o T (C)

Figure 5.6: Effects of sub-chronic ketamine treatment on cocaine-induced locomotor activity. (A) Sub- chronic ketamine administration induced locomotor sensitization (p<0.001). A repeated measures two- way ANOVA, with treatment (saline or ketamine) and day (day 1 or day 5) was performed. There was a significant effect of treatment (F1, 28= 61.46, p<0.001), a significant effect of day (F1, 28= 10.54, p<0.01) and a significant interaction (F1, 28= 25.87, p<0.0001). Bonferroni post-hoc comparisons showed that sub-chronic ketamine administration induced locomotor sensitization (Cohen’s d= 2.75, t28=5.89, p<0.001), an effect absent in saline-treated group (t28=1.30, p>0.05). (B) Locomotor activity (with inclusion of outliers) in thirty mice following 4mg/kg cocaine administration. Mice treated sub-chronically with ketamine (red, n=15) and saline (black, n=15) showed significant locomotor sensitization to cocaine. Repeated measures two-way ANOVA revealed significant effect of day (F3, 84=8.74, p<0.001), no significant effect of group (F1, 28= 0.22, p>0.05) and no significant group X day interaction (F3, 84=1.19, p>0.05). (C) Locomotor activity (with exclusion of two outliers) following 4mg/kg cocaine administration.

A repeated measures two-way ANOVA revealed significant effect of day (F3, 78=6.63, p<0.001), no significant effect of group (F1, 26=2.21, p>0.05) and no significant group X day interaction (F3, 78=1.71, p>0.05). Values represent mean ± SEM. ** p <0.01, *** p<0.001

180

5.4.4 Inhibiting midbrain dopamine neuron firing prior to ketamine administration did not prevent the effects of sub-chronic ketamine on cocaine- induced locomotor sensitization

There was no significant group difference in the weight of mice (t24=1.59, p>0.05)

(Table 5.3). The day 1 and day 5 data presented here are a subset from the experiment presented in chapter 4 (section 4.4.3). In other words the mice used to investigate the effects of the midbrain dopamine neuron firing in driving ketamine-induced locomotor sensitization, underwent the cocaine experiment two days post last day of treatment as explained in the experimental timeline in the methods section above (Figure 5.3B).

As discussed in chapter 4 inhibiting midbrain dopamine neuron firing prevented sub- chronic ketamine-induced locomotor sensitization (Figure 4.4 and Figure 5.7A). Mice were sensitized to repeated cocaine administration in the iDATCre mouse an effect that did not require the activation of midbrain dopamine neuron firing at the time of ketamine administration (Figures 5.7B&C).

) **

m c

( S a l/K e t

2 0 0 0 0 d

e C N O /K e t

l l

e 1 5 0 0 0

0 e

3 1 0 0 0 0

t s

i 5 0 0 0

a t

o 0 T D a y 1 D a y 5

(A)

181

*** )

m **

(

i 2 5 0 0 0 ** m

S a l/K e t

5 1

2 0 0 0 0 C N O /K e t

d e

l 1 5 0 0 0

v a

r 1 0 0 0 0

c 5 0 0 0

t s

i 0

l D a y 7 D a y 8 D a y 9 D a y 1 0

o T

(B)

)

(

i 2 0 0 0 0 * m

*** S a l/K e t

5 ** 1 ** C N O /K e t

n 1 5 0 0 0

l l

e 1 0 0 0 0

e 5 0 0 0

t s

i 0

l D a y 7 D a y 8 D a y 9 D a y 1 0

o T

(C)

182

Figure 5.7: Sub-chronic ketamine administration induces locomotor cross-sensitization to cocaine, an effect that does not require the activation of midbrain dopamine neurons at the time of ketamine administration. (A) CNO application (purple) prior to ketamine administration prevented the ketamine- induced locomotor sensitization seen in the saline/ketamine group (red). A repeated measures two-way ANOVA, with treatment (saline or ketamine) and day (day 1 or day 5) as fixed factors was performed.

There was significant effect of treatment (F1, 24= 19.44, p<0.001), significant effect of day (F1, 24= 7.467, p<0.05) and a significant interaction (F1, 24= 5.415, p<0.05). Bonferroni post-hoc comparisons showed that sub-chronic ketamine administration induced locomotor sensitization (Cohen’s d=3.74, t24=3.45, p<0.01), an effect prevented by inhibiting midbrain dopamine neuron firing with CNO prior to ketamine administration (t24=0.30, p>0.05). (B+C) Mice in both CNO (purple, n=14) and saline (red, n=12) pre- treated groups showed significant locomotor sensitization to cocaine. A repeated measures two-way ANOVA was used with group (CNO/Ket or Sal/Ket) and day (Day 7, 8, 9, 10) as fixed factors. Importantly Grubb’s test identified two significant outliers, one per treatment group. However, the results were significant with the inclusion or exclusion of the outliers and were the following: (B) (With inclusion of outliers) There was a significant effect of day (F3, 72=10.23, p<0.001), no significant effect of group (F1,

24= 0.31, p>0.05) and no significant group X day interaction (F3, 72= 1.30, p>0.05). Bonferroni post-hoc comparisons revealed cocaine-induced locomotor sensitization in both CNO/Ket (Day 7 vs Day 8,

Moderate effect size Cohen’s d = 0.52, t72=3.60, p<0.01; Day 7 vs Day 9, Moderate effect size Cohen’s d=0.50, t72=3.88, p<0.01; Day 7 vs Day 10 Moderate effect size Cohen’s d=0.54, t72=3.58, p<0.01) and

Sal/Ket groups (Day 7 vs Day 10 Large effect size Cohen’s d=0.74, t72=3.80, p<0.01). (C) (With exclusion of outliers) There was a significant effect of day (F3, 66=9.48, p<0.001), no significant effect of group (F1, 22= 0.44, p>0.05) and no significant group X day interaction (F3, 66= 1.59, p>0.05). Bonferroni post-hoc comparisons revealed cocaine-induced locomotor sensitization in both CNO/Ket (purple) (Day

7 vs Day 8, Moderate effect size Cohen’s d = 0.68, t66=3.82, p<0.01; Day 7 vs Day 9, Moderate effect size Cohen’s d=0.60, t66=3.98, p<0.01; Day 7 vs Day 10 Moderate effect size Cohen’s d=0.69, t66=4.46, p<0.01) and Sal/Ket groups (red) (Day 7 vs Day 10 Moderate to Large effect size Cohen’s d=0.75, t66=2.96, p<0.05). Values represent mean ± SEM. ** p <0.01, *** p<0.001

Subject weights Group, Mean ± SEM, n Group, Mean ± SEM, n

Wild type mice Saline, 25.88 ± 0.82, 26.13 ± 0.89,

n=15 n=15

iDATCre mice Saline/Ketamine, 29.06 ± 0.44, CNO/Ketamine, 28.14 ± 0.38,

n=12 n=14

Table 5.3: Subject characteristics for the cocaine challenge experiment

183

5.5 Discussion

In this investigation, I have shown that sub-chronic ketamine administration is not associated with changes in LI in a conditioned-fear paradigm when mice receive the last ketamine injection two days prior to the pairing of the conditioned stimulus (white- noise) with the unconditioned stimulus (footshock). Previous study in the rat stated that under conditions disrupting LI in controls, ketamine treatment at low sub- anaesthetic doses (range=2-20mg/kg) induced persistent LI (Weiner and Arad, 2009).

Therefore further studies are required to investigate sub-chronic ketamine‘s effects on

LI persistence in a protocol where latent inhibition is disrupted in control conditions.

Additionally my results are in line with a previous study which reported impaired contextual fear conditioning in 4 weeks but not in 2 weeks following sub-chronic administration of ketamine (dose = 5mg/kg) (Amann et al., 2009). Moreover a previous study showed that sub-chronic administration of ketamine (30mg/kg) in mice during the second postnatal week induced deficits in latent inhibition in adulthood

(Jeevakumar et al., 2015). Furthermore my data show that sub-chronic ketamine administration compared to control condition does not associate with deficits in incentive motivation for sucrose reward using the progressive ratio task. My findings extend previous evidence which showed no effect of sub-chronic (14-day) ketamine

(dose = 20mg/kg) administration following a 6-month washout on a progressive ratio task in mice (Featherstone et al., 2012).

Additionally I replicated my findings from chapter 4 in that sub-chronic ketamine administration induced locomotor sensitization and that inhibition of midbrain dopamine neuron firing prior to ketamine administration prevented the ketamine- induced locomotor sensitization. Contrary to my primary hypothesis I did not show that sub-chronic ketamine administration potentiated cocaine-induced locomotor

184 sensitization. Contrary to my hypothesis mice in both CNO/ketamine and saline/ketamine groups developed cocaine-induced locomotor sensitization.

Therefore my data suggest that sensitization to repeat cocaine administration following sub-chronic ketamine administration does not require the activation of midbrain dopamine neurons at the time of ketamine administration. This suggests that ketamine-induced locomotor sensitization and cocaine-induced locomotor sensitization may be driven by distinct neuroadaptation mechanisms. We believe that longitudinal investigations of in vivo dopamine release and dopamine neuron population activity measurements (using agonist ligand [11C] PHNO and in vivo electrophysiology recordings respectively) on days 5, 7 and 10 in line with our experimental pipeline are needed to acquire a more comprehensive view of the neural systems underlying the effects of sub-chronic ketamine on cocaine-induced locomotor sensitization.

5.5.1 Implications

Several lines of evidence implicate augmented dopamine neurotransmission in stimulant-induced behavioural sensitization (Sorg et al., 1997). Despite consistency between rodent and human studies in elevation of extracellular dopamine release following short-term administration of stimulants, there exists inter-species discrepancy in dopaminergic findings with chronic stimulant use (Volkow et al., 2006).

Specifically a recent meta-analysis study of the neuroimaging studies showed reduction in dopamine release in chronic stimulant users compared to healthy controls

(Ashok et al., 2017). This finding is in contrast with the pre-clinical studies reporting no change or increase in dopamine output following withdrawal from cocaine (Kalivas and

Duffy, 1993, Meil et al., 1995, Hooks et al., 1994, Bradberry, 2007).

185

5.5.2 General methodological considerations

Despite the extensive use of the progressive ratio breakpoint in research, there are concerns since the value is derived from single point in time throughout the experiment with ignorance in data from the rest of the session (Arnold and Roberts, 1997). To demonstrate the performance throughout the 2 hours progressive ratio session, I analyzed the data for the number of correct responses, the number of rewards gained and the number of nose pokes. Importantly there were no differences between the two treatment groups in these performance measures. Future studies are needed to employ a quantitative model of the performance on the progressive ratio schedule to derive parameters which better classify and measure the effects of ketamine on performance (Olarte-Sanchez et al., 2015). Additionally a previous study in rats showed that performance on the progressive ratio varies significantly as a function of body weight (Ferguson and Paule, 1997). Mice were maintained on 85% of free- feeding body weight restriction for the progressive ratio experiment and were not singly housed. There was no significant difference in body weight before testing between the saline and ketamine-treated groups (p>0.05). Additionally body weight did not correlate with the progressive ratio performance in saline (r=-0.065, p>0.05) and ketamine groups (r=0.08, p>0.05). Thus it is unlikely that the body weight confounded the progressive ratio findings.

It should be noted that the lack of CNO/saline and saline/saline treatment groups in the cocaine sensitization experiment deems the interpretation of findings inconclusive.

Specifically these control groups are required to investigate the locomotor response following cocaine administration in the iDATCre mice. Importantly there was no significant difference in the locomotor activity following ketamine administration in the iDATCre mice as compared to wild-type mice on days 1 or 5 of ketamine treatment

186

(F1, 25 = 2.90, p>0.05) (Appendix). Therefore it seems unlikely that the observed cocaine-induced effects are confounded by genotype. Additionally it would be useful to perform sub-analyses of ketamine-treated mice which exhibit or not sensitized locomotor response to sub-chronic ketamine administration (day 1 vs day 5 of treatment). Specifically ~20% (six out of twenty-seven) of ketamine-treated mice did not move significantly more on day 5 as compared to day 1 of treatment.

5.5.3 Conclusion

These findings indicate that in the male mouse sub-chronic ketamine administration as compared to saline control condition had no effect on latent inhibition in a conditioned-fear paradigm. Further to this there was no significant difference in incentive motivation for sucrose reward following sub-chronic ketamine administration as compared to control conditions. Finally repeated cocaine administration induced locomotor sensitization irrespective of saline or ketamine pre-treatment, an effect that did not require the activation of midbrain dopamine neurons at the time of ketamine administration. These data suggest that sub-chronic ketamine-induced locomotor sensitization and cocaine sensitization may be driven by distinct neuroadaptation mechanisms.

187

Chapter 6 - Discussion

188

6.1 Introduction

In my thesis seven main hypotheses were investigated and addressed in three experimental results chapters. Furthermore the findings of the µPET and behavioural studies in the sub-chronic ketamine-treated mouse are summarized in this chapter.

Finally, general methodological considerations, general conclusions and future research directions are discussed.

6.1.1 Dopamine synthesis capacity following sub-chronic ketamine administration and its relationship to ketamine-induced locomotor sensitization- The role of midbrain dopamine neuron activation (Chapters 3&4)

The main finding from this study is that mice sub-chronically treated with ketamine as compared to controls developed locomotor sensitization (effect size: Cohen’s d=4.99).

Additionally striatal presynaptic dopamine synthesis capacity as indexed by [18F]-

mod DOPA uptake rate constant Ki is significantly elevated in mice sub-chronically treated with ketamine as compared to control conditions (effect size: Cohen’s d >1.2).

In mice sub-chronically treated with ketamine, higher dopamine synthesis capacity was associated with increased ketamine-induced locomotor hyperactivity (r=0.59, p<0.05). Importantly DREADD-mediated inhibition of midbrain dopamine neuron firing prevented the effects of sub-chronic ketamine administration on locomotor sensitization and striatal presynaptic dopamine synthesis capacity.

Hypotheses 1&2: Sub-chronic ketamine administration compared to control conditions will (1) induce locomotor sensitization and (2) will be associated with elevation in striatal dopamine synthesis capacity in the male mouse.

189

My findings are in line with hypotheses 1 and 2. My data show that sub-chronic ketamine treatment as compared to saline treatment significantly increased locomotor activity and induced locomotor sensitization. Additionally I report that in comparison to saline controls, sub-chronic ketamine administration significantly increased striatal pre-synaptic dopamine synthesis capacity as indexed by the influx rate constant Ki mod.

Hypothesis 3: If hypotheses 1&2 are correct: Midbrain dopamine neuron activation will be required for the effects of sub-chronic ketamine administration on the dopamine synthesis capacity elevation and locomotor sensitization.

In line with this hypothesis I showed that the DREADD-mediated inhibition of midbrain dopamine neuron firing inhibited the effects of sub-chronic ketamine administration on the presynaptic striatal dopamine synthesis capacity and locomotor sensitization.

Interestingly I report that sub-chronic ketamine was associated with a significant positive correlation between striatal dopamine synthesis capacity and locomotor activity, a correlation that was absent in controls.

6.1.2 The effects of sub-chronic ketamine administration on behavioural phenotypes linked to the dopaminergic system. The role of midbrain dopamine neuron activation. (Chapter 5)

In these studies I showed that mice sub-chronically treated with ketamine as compared to saline demonstrated cocaine-induced locomotor sensitization to repeated cocaine administration (Effect size: Cohen’s d= 1.1). Interestingly the sub-chronic ketamine’s effects on cross-sensitization to cocaine were independent of the midbrain dopamine neuron activation at the time of ketamine administration. Moreover I showed that sub- chronic ketamine administration is not associated with changes in latent inhibition (LI)

190 in a conditioned-fear paradigm when mice receive the last ketamine injection two days prior to pairing of conditioned stimulus (white-noise) with the unconditioned stimulus

(footshock). Additionally I showed that sub-chronic ketamine administration as compared to control condition does not associate with deficits in incentive motivation for sucrose reward using the progressive ratio task.

Hypotheses 4 & 5: (4) Sub-chronic ketamine administration as compared with control conditions will be associated with alterations in locomotor sensitization to cocaine. (5)

Sub-chronic ketamine administration effects on cocaine-induced locomotor sensitization would be dependent on midbrain dopamine neuron activity (Chapter 5).

In contrast to hypothesis 4 I demonstrate that cocaine administration induced locomotor sensitization to cocaine irrespective of sub-chronic ketamine or saline treatment. Contrary to my hypothesis 5 the effect of sub-chronic ketamine administration on cocaine-induced locomotor sensitization was not mediated via activation of midbrain dopamine neurons.

Hypothesis 6 & 7: Sub-chronic ketamine administration as compared to control condition (6) will disrupt latent inhibition in a conditioned fear paradigm and (7) will induce reduction in incentive motivation. (Chapter 5)

In contrast to my hypotheses 6&7, mice sensitized to ketamine as compared to saline controls did not show deficits in latent inhibition of fear response nor incentive motivation for a sucrose reward.

191

6.2 General methodological considerations

Despite the wide use of DREADDs to deconstruct behaviour there are various considerations associated with this methodology. Firstly studies have shown that CNO undergoes retro-conversion to clozapine in the rat (MacLaren et al., 2016), guinea-pig

(Jann et al., 1994), non-human primate (Raper et al., 2017) and human (Jann et al.,

1994). Additionally it has been recently reported that CNO as compared to clozapine demonstrates low affinity for DREADDs in vitro and that intravenous (i.v) administration of [11C]clozapine instead of [11C]CNO results in brain uptake as visualized by PET during 45-60min from i.v injection of the radiotracers in the rat

(Gomez and Bonaventura, 2017). Importantly because of the observation of CNO retro-conversion to clozapine in other species it would be necessary to test the potential of other DREADD agonists such as Compound 21 (Chen et al., 2015) in non- human primates. However there are interspecies differences in the endogenous production of ascorbate which inhibits cytochrome P450 enzymes necessary for the retro-reduction of CNO to clozapine (Pirmohamed et al., 1995). Thus retro-reduction of CNO to clozapine is thought to be held back in the C57Bl/6 mouse and this has been linked to the high levels of ascorbate in the mouse (Chatterjee et al., 1975,

Guettier et al., 2009). Thus the retro-conversion of CNO to clozapine is unlikely to explain my findings.

Another consideration of the DREADD technology encompasses the potential for ectopic expression of the DREADD in non-dopamine neurons. This observation was specific to the TH-Cre rather than the iDAT-Cre transgenic mouse lines (Lammel et al., 2015). Thus in my experiments the use of the iDAT-Cre transgenic mouse line in addition to the observation of ~1.5% ectopic DREADD expression (Chapter 4) in the

192 midbrain of the iDAT-Cre mice suggests that ectopic expression of DREADD is unlikely to affect interpretation of findings.

Additionally general methodological consideration in all studies in this thesis encompasses the use of male animals. Furthermore the use of male animals only to investigate the effects of ketamine on the dopaminergic system represents inherent limitation for all studies included in our meta-analysis (Kokkinou, In press). Whilst sex differences in brain ketamine levels have not been previously reported (Zanos et al.,

2016), there are fewer numbers of dopamine neurons in male than female rats (Beyer et al., 1991). Thus studies are needed in females to investigate the effects of sub- chronic ketamine administration on the dopaminergic function as well as the behavioural measures previously linked to the dopaminergic system. This is an important consideration for the translation of findings. Another general methodological consideration in this thesis is the use of one specific strain of mice. Importantly the strain-specific effect of acute and repeated ketamine administration on the dopaminergic function has not been directly tested.

One potential confounder of the µPET imaging result in chapter 4 is significant difference in the specific activity of the FDOPA radiotracer (p<0.05) between the four experimental groups, with higher specific activity in the CNO/ketamine-treated group.

mod However the group difference in the striatal Ki remained significant when co-varying for the specific activity (F4, 41= 3.58, p=0.015). Additionally there was no association between specific activity and dopamine synthesis capacity across all mice. Therefore these observations suggest that specific activity is unlikely to have an effect on the main result.

193

Another potential confounder of the µPET imaging is the use of isoflurane anaesthesia which was compulsory due to the nature of the experiments since mice had undergone external jugular vein cannulations for the injection of the radiotracer. Moreover isoflurane at anaesthetic concentrations increases the extracellular concentration of dopamine in the striatum in rats (Opacka-Juffry et al., 1991). A previous study showed that cocaine-induced increase in dopamine levels as measured by in vivo microdialysis is significantly higher in isoflurane-anaesthetized non-human primates compared to the awake state (Tsukada et al., 1999). Additionally there exists no investigation of the effects of isoflurane anaesthesia on FDOPA uptake compared to the awake states.

Importantly as mentioned in chapter 3 our method of quantification involves calculation of the striatal [18F]-DOPA uptake relative to the cerebellum, thus under the assumption that the effect of isoflurane anaesthesia on [18F]-DOPA uptake is the same in both regions in both groups, one can infer that any differences between experimental groups in striatal [18F]-DOPA uptake would be due to the experimental manipulation

(ie: saline vs ketamine). Furthermore, there was no significant difference in the age of the mice which is a variable that might putatively change the dopaminergic system.

Moreover another methodological consideration includes the possible effects of ketamine on blood flow in the cerebellum which was used as the reference region in the graphical analysis approach in my [18F]-DOPA studies. A previous study showed increases in the blood flow in the cerebellum in rodents following an anaesthetic dose of ketamine (Cavazzuti et al., 1987). However, there was no significant difference in the [18F]-DOPA activity in the cerebellum between the saline and ketamine-treated groups in my [18F]-DOPA experiment (p>0.05), therefore this would suggest that ketamine at the dose studied is not having an effect on the blood flow in the mouse.

194

Furthermore it is worth considering the potential confounding effects of the AADC and

COMT inhibitors namely benserazide hydrochloride (10mg/kg) and entacapone

(40mg/kg) in the interpretation of the findings. The inhibitors were used in my [18F]-

DOPA experiments to prevent the peripheral metabolism of the radiotracer and enable its entry into the brain. Additionally these inhibitors were used in previous rodent and human [18F]-DOPA studies (Walker et al., 2013b, Bloomfield et al., 2014). The doses of the inhibitors used and the time of administration of the inhibitors relative to the

FDOPA injection were chosen based on a previous study in order to ensure that the peripheral metabolism of the radiotracer is inhibited almost completely throughout the time period of the PET scan (Walker et al., 2013b). Of note the use of inhibitors could provide bias to the findings that is dependent upon the efficacy of the inhibitors in each mouse. Specifically a previous study showed no central effects of the AADC inhibitor benserazide hydrochloride at the dose used in my experiments, yet central effects of

AADC inhibitor were seen in higher doses (Jonkers et al., 2001). Whilst this inhibitor did not alter the extracellular dopamine levels nor the striatal formation of dopamine, the AADC activity was significantly reduced (Jonkers et al., 2001). Nonetheless, the

mod partial inhibition of central AADC is unlikely to affect my data, since the striatal Ki is likely limited by the sequestration of fluorodopamine into the presynaptic vesicles rather than the AADC activity (Reith et al., 1990).

195

6.3 Towards deciphering the mechanism of ketamine’s action on the dopaminergic system

My main finding is that sub-chronic ketamine administration increases dopamine synthesis capacity as measured in vivo via µPET and that this requires the activation of midbrain dopamine neurons. The sub-chronic effects of ketamine on striatal dopaminergic function I report are believed to be the result of a cascade of events which could involve the direct and indirect circuits.

Glutamatergic projections are important in regulating the activity of mesostriatal dopamine neurons and are thought to encompass a direct/activatory and an indirect/inhibitory pathway (Lisman et al., 2008, Carlsson et al., 1999). The direct pathway from the prefrontal cortex and midbrain to the striatum has an activatory effect and increases dopamine release (Kegeles et al., 2000a). Conversely the indirect pathways to the striatum via the midbrain which involve GABAergic interneurons have the opposite effect. If the inhibitory pathway dominates, a decrease in glutamatergic signalling or NMDA receptor hypofunction will disinhibit mesostriatal dopamine neurons consequently increasing striatal dopamine synthesis and release. In accordance with this model my finding of increased striatal dopamine synthesis could be mediated via failure to activate the indirect pathway, this leads to disinhibition of midbrain dopamine neuron firing (Figure 6.1). Therefore it could be inferred that sub- chronic ketamine administration increases population activity of midbrain dopamine neurons. In fact it has been shown that ketamine administration restored the reduced midbrain dopamine neuron population activity in stress-induced depression (Belujon and Grace, 2014b). Moreover NMDA receptor antagonism leads to the elevation of glutamate release in the midbrain and this in turn activates AMPA/kainate receptors on dopamine neurons stimulating increase in dopamine synthesis and release in

196 projection targets such as the striatum. It is thus possible that ketamine via NMDA receptor blockade and increase in AMPA/kainate receptor activity leads to increase in dopamine synthesis capacity and release. My data are consistent with the theorized mechanism of action of ketamine in mediating the increase in dopaminergic function in the striatum via activation of midbrain dopamine neuron firing. It would be interesting to directly investigate the sub-chronic ketamine’s effects on DA neuron firing and how that relates to dopamine synthesis capacity and dopamine release as measured in vivo via µPET.

Figure 6.1: Schematic summary of theorized circuit control of DA cell activity by direct (grey arrows) and indirect (black arrows) glutamatergic projections at baseline and following ketamine administration. The activating pathway encompasses direct glutamatergic projection to the midbrain and the striatum from the PFC. The inhibitory pathway is mediated via glutamatergic projections to the midbrain GABAergic interneurons (blue). It is theorized that ketamine via blockade of NMDA receptors leads to inhibition of the indirect pathway thus disinhibiting dopamine neurons (more dopamine neurons are spontaneously active- depicted in red) from GABAergic interneuron inhibition consequently enhancing dopamine synthesis and release in the striatum. Moreover, NMDAR blockade via ketamine leads to increase in glutamate release in the midbrain leading to activation of AMPA-kainate receptors on dopaminergic neurons, increasing DA synthesis and release in projection targets such as the striatum. Concept of figure adapted from Kegeles et al., 2000.

197

6.4 Implications Importantly my data support the use of in vivo µPET with high scanner resolution to be able to measure the dopaminergic function in the striatum as a less invasive alternative technique when compared to the in vivo microdialysis. The in vivo microdialysis technique involves the surgical implantation of a probe into discrete brain regions. In a longitudinal study design the implantation of cannulae and cement cap could lead to the reduction of animal welfare and increase in the probability of an infection. Therefore my µPET studies provide a non-invasive alternative technique with superior sensitivity to the dopaminergic outcome measures when compared to the in vivo microdialysis technique which measures the total interstitial dopaminergic levels encompassing the synaptic ‘spill over’. Moreover the longitudinal measurement

mod of dopamine synthesis capacity as indexed by the Ki might be useful in deciphering the mechanisms underlying disease as well as compensatory effects at the molecular level.

My data show that sub-chronic ketamine administration is associated with elevation in striatal dopamine synthesis capacity, an effect that requires activation of midbrain dopamine neurons. Thus in accordance with the rodent literature, acute and sub- chronic ketamine administration is associated with dopaminergic overactivity.

Therefore ketamine’s effects on the dopaminergic system are similar in direction to the dopaminergic alterations induced by stimulants such as amphetamine and cocaine

(Robinson and Berridge, 1993, Riccardi et al., 2006, Bloomfield et al., 2016, Ashok et al., 2017). The role of the dopaminergic system in drug reinforcement has long been accepted from pre-clinical studies (Koob, 1992). Stimulants are more potent as compared with ketamine in terms of dopamine release. Specifically whilst 1mg/kg amphetamine administration induces 1000% increase in dopamine levels in the

198 nucleus accumbens and 520% increase in dopamine levels in the caudate (Carboni et al., 1989), the median percentage increase in dopamine levels elicited by ketamine is 55% as reported in a total of three studies at range of ketamine dose 10-100mg/kg in the nucleus accumbens (Masuzawa et al., 2003b, Littlewood et al., 2006b, Witkin et al., 2016) and 41.4% in a total of three studies at range of dose 10-30mg/kg in the striatum (Usun et al., 2013a, Moghaddam et al., 1997a, Verma and Moghaddam,

1996b). Thus whilst ketamine is less potent as compared to stimulants in increasing dopamine levels, ketamine’s action involves the dopaminergic system. It is therefore logical to infer that ketamine’s effects on the dopaminergic system are potentially underlying its abuse potential.

In addition the possibility that blockade of dopamine reuptake may contribute to the effects of sub-chronic ketamine on the presynaptic striatal dopaminergic function should be considered given the role of ketamine as a dopamine transporter (DAT) blocker (Kapur and Seeman, 2002b). However, there is evidence to show that the density of the DAT in the prefrontal cortex (PFC) is lower compared to the striatum

(Sesack et al., 1998). In line with this observation cocaine which is a dopamine transporter (DAT) blocker is not particularly effective in increasing dopamine levels in the PFC (Moghaddam and Bunney, 1989). Our meta-analysis study showed that the increase in dopamine levels in the PFC is numerically higher compared to the striatum in the rodents treated acutely with ketamine compared to controls (Kokkinou, In press).

The opposite findings would be expected if the effects of acute ketamine administration on the dopaminergic system were attributable to the DAT blockade.

Therefore it is unlikely that the sub-chronic ketamine-induced increase in striatal dopamine synthesis capacity reported in my experiments is attributable to the dopamine uptake blockade. Nevertheless, since an in vitro study suggested that

199 ketamine has affinity for the DAT (Kapur and Seeman, 2002b), additional experimental control groups are required to investigate the effects of sub-chronic ketamine administration following saturation of DAT prior to ketamine administration.

Alternatively future studies are required to address the effects of sub-chronic ketamine administration on the dopaminergic function in the DAT knock-out rodents.

My findings also have implications for understanding ketamine’s potential to inform understanding of schizophrenia. As explained in the introduction of this thesis (Chapter

1) meta-analyses studies showed that striatal dopamine synthesis capacity is significantly elevated in patients with schizophrenia as compared to healthy controls

(Howes et al., 2012, Fusar-Poli and Meyer-Lindenberg, 2013). Additionally sub- anaesthetic dose of ketamine induces psychotic-like symptoms (Krystal et al., 1994) in healthy human subjects and exacerbates psychotic symptoms in patients with schizophrenia (Lahti et al., 1995). My finding of elevated striatal dopamine synthesis capacity following sub-chronic ketamine administration in the male mouse is consistent with the well-replicated evidence of increased dopamine synthesis and release seen in patients with schizophrenia. Likewise chronic ketamine administration has been associated with neurochemical alterations seen in patients with schizophrenia (Chesters et al., 2017).

My findings could also have implications for understanding the mechanism underlying ketamine’s antidepressant actions. As discussed in Chapter 1 of this thesis, depression is associated with blunted dopaminergic function (Kapur and Mann, 1992,

Dunlop and Nemeroff, 2007). Moreover patients with depression have reduced striatal dopamine synthesis capacity compared to controls (Martinot et al., 2001). Studies of transporter (DAT) availability in patients with depression yielded mixed results suggesting either reduction (Meyer et al., 2001) or increase in DAT availability in

200 depression (Brunswick et al., 2003). Furthermore patients with major depressive disorder (MDD) have 34% greater monoamine oxidase availability as compared with healthy controls (Meyer et al., 2006). The finding of higher levels of MAO density in patients with major depressive disorder suggests that this enzyme is a primary monoamine-lowering process. Additionally midbrain dopamine neuron firing has been associated with regulation of depression-related behaviours in mice (Chaudhury et al.,

2013). Moreover it has been shown that dopamine neuron population activity is reduced in an animal model of depression (Belujon and Grace, 2014a). Collectively these data suggest that depression is associated with reduction in dopaminergic function. My data that sub-chronic ketamine administration is associated with increased presynaptic striatal dopaminergic function mediated via activation of midbrain dopamine neurons support a mechanism by which ketamine could act on the dopamine system to illicit anti-depressant responses. Importantly my data are consistent with previous study reporting that ketamine (5mg/kg) administration restored the reduction in dopamine neuron population activity evident in an animal model of depression (Belujon and Grace, 2014a). Importantly Belujon and Grace 2014 reported that whilst 20min following ketamine administration there was an increase in dopamine neuron population activity in the central tracks of the VTA, 2 hours following ketamine administration there was an increase in dopamine neuron population activity in the central and medial VTA tracks in both the rat model of depression and control rats (Belujon and Grace, 2014a).

Furthermore my data have implications in understanding the longer term consequences of the use of repeated ketamine administration on attention and motivation. My negative findings, that sub-chronic ketamine administration does not impair latent inhibition of fear response and does not alter incentive motivation to

201 sucrose reward two days following the last drug administration could suggest that repeated ketamine application for the treatment of depression may not impair the aforementioned cognitive functions at the time frame studied. Additionally investigating the relationship between ketamine’s effects on dopamine synthesis capacity and its antidepressant and addictive effects would be important towards the understanding of the contribution of the dopaminergic mechanisms to these effects

(Kokkinou, In press). Specifically future studies are required to investigate the longer- term effects of sub-chronic ketamine administration on the dopaminergic system and behavioural measures. This would be important to aid towards the understanding of the concerns which revolve around the longer-term efficacy and safety of ketamine as an antidepressant (Sanacora et al., 2017).

202

6.5 Future research directions

The substantial ongoing question is whether the dopaminergic dysregulation seen in patients with schizophrenia and in pre-clinical models following ketamine administration are driven by an upstream NMDAR hypofunction on GABAergic interneurons (Homayoun et al., 2005). It is thought that NMDAR hypofunction weakens the excitation of GABAergic interneurons which synchronize cortical networks and disinhibition of pyramidal neurons. Evidence suggests derangements of GABA- mediated systems in schizophrenia patients (Benes et al., 1991, Benes et al., 1996,

Brickley and Mody, 2012). Reduction in the GABA-synthesizing enzyme GAD67 was reported in the prefrontal cortex of patients with schizophrenia compared to controls

(Akbarian et al., 1995, Volk et al., 2000). Specifically studies reported reductions in the expression of the calcium binding protein parvalbumin (PV) in the prefrontal cortex of patients with schizophrenia compared to controls (Reynolds et al., 2001, Hashimoto et al., 2003). Furthermore changes in the somatostatin (SST) expressing GABAergic interneurons in the PFC have also been associated with schizophrenia (Morris et al.,

2008). Moreover there is evidence to suggest reductions in interneurons expressing parvalbumin (PV) and those that express the neuromodulator somatostatin (SST) in the hippocampus of patients with schizophrenia compared to controls (Zhang and

Reynolds, 2002, Konradi et al., 2011). It is thus logical to hypothesize that dysfunction of various subtypes of GABAergic interneurons are involved in schizophrenia pathophysiology.

Ketamine which is an NMDAR antagonist induces loss of GABAergic interneuron function in the rodent brain. Most studies investigated the effects of ketamine on the parvalbumin-positive GABAergic interneuron function. Specifically it has been shown that sub-chronic ketamine administration (dose of ketamine= 30mg/kg for 5

203 consecutive days) is associated with significant reduction in parvalbumin-positive

GABAergic interneurons (Cohen’s d effect size = 0.89) in the hippocampus (Keilhoff et al., 2004). Furthermore sub-chronic ketamine administration (30mg/kg for 5 consecutive days) as compared to control conditions resulted in a significant reduction in parvalbumin-containing GABAergic interneurons in the prefrontal cortex (Zhou et al., 2015). Interestingly sub-chronic as compared to acute ketamine administration was associated with more pronounced reductions in PV interneurons (Zhou et al.,

2015). A key future question is thus to establish if GABAergic interneuron reductions mediate the effects on the dopamine system that I see. It is logical to investigate the relationship between parvalbumin positive and somatostatin positive GABAergic interneurons and the dopaminergic dysregulation following repeated ketamine administration.

Additionally Inscopix fibre optometry technique could be used to visualize the activity of GABAergic interneuron sub-populations following ketamine administration during behavioural tests that have been linked to the dopaminergic system (Resendez et al.,

2016). Additionally it would be useful to visualize the activity of GABAergic interneurons following ketamine administration during the attentional set-shifting task.

The attentional set-shifting task is used to measure cognitive flexibility in mice and data suggest that sub-chronic ketamine administration leads to impairments in this task (Jeevakumar et al., 2015, Szlachta et al., 2017). Specifically deficits in this task involve deficits in GABAergic interneurons in the prefrontal cortex and the ventral hippocampus which further implicate the dopaminergic system (Donegan et al., 2017).

A recent issue is whether there is retro-conversion of CNO to clozapine which might mediate some of the effects we see (Gomez and Bonaventura, 2017). Thus to add certainty to the interpretation of our DREADD findings, it would be necessary to

204 measure plasma and brain levels of CNO and clozapine at various timepoints within the range from 5min to 2hours following i.p injection of CNO at the dose studied. If retro-conversion of CNO to clozapine exists in C57BL/6 mouse, and clozapine enters the mouse brain, the next step would be to investigate whether clozapine (0.1mg/kg) could reverse the ketamine-induced locomotor sensitization in the mouse. If clozapine at that dose does not reverse the ketamine’s effects on locomotor sensitization, then the non-DREADD specific effects of clozapine are at least excluded. However my pilot

‘’failed experiments’’ (data not shown) where the virus did not express in the midbrain dopamine neurons because of blockade of needles during the day of stereotaxic surgeries, did not result in the reversal of the ketamine’s effects on locomotor hyperactivity. Therefore it is unlikely that the effects seen on dopaminergic overactivity and sensitization are in any way mediated via the off-target clozapine or CNO effects.

Importantly these failed experiments encompass a plausible justification to avoid performing the experiment to delineate the effects of clozapine on ketamine-induced behaviours and dopaminergic effects. This will be in agreement with the 3Rs mentioned in chapter 2, for reducing the number of animals in research.

Additionally it is necessary to recognize the gaps regarding longer-term efficacy of ketamine with regards to its therapeutic potential as an antidepressant (Sanacora et al., 2017). Therefore it would be useful to use a wider ketamine dose range and longer- term dosing schedules in future pre-clinical experiments in order to test the impact of these factors on the dopaminergic function and depressive-like behavioural measures.

Specifically it would be interesting to investigate the dopaminergic function before and after long-term repeated ketamine administration in an animal model of depression and perform correlations with the behavioural tests that assess the antidepressant effects of ketamine. Furthermore a second means of adding to the knowledge base is

205 for future studies to investigate the dopaminergic function specifically dopamine synthesis capacity before and after ketamine administration in patients with major depressive disorder and how that correlates with the efficacy of the treatment.

Importantly my data are focussed on the striatum, therefore future pre-clinical and clinical studies are required to investigate the effects of ketamine administration on the extra-striatal dopamine system in vivo using other agonist ligands such as [11C]

PHNO.

6.6 Conclusion

My data demonstrate that sub-chronic ketamine administration leads to an elevation in striatal dopamine synthesis capacity in vivo and induces locomotor sensitization.

My data identify a mechanism by which sub-chronic ketamine administration leads to the striatal dopaminergic alterations and locomotor sensitization through the activation of midbrain dopamine neurons. Sub-chronic ketamine administration leads to locomotor sensitization to cocaine, independently of midbrain dopamine neuronal activation. Sub-chronic ketamine administration does not result in changes in incentive motivation and latent inhibition. My findings have implications in understanding neuropsychiatric disorders, in particular schizophrenia, substance abuse and potential anti-depressant properties of ketamine by suggesting these could be mediated by dopaminergic changes. Further studies are required to examine the role of PV- containing GABAergic interneurons in mediating the dopaminergic changes seen following the sub-chronic ketamine administration.

206

7. References

AALTO, S., HIRVONEN, J., KAJANDER, J., SCHEININ, H., NAGREN, K., VILKMAN, H., GUSTAFSSON, L., SYVALAHTI, E. & HIETALA, J. 2002. Ketamine does not decrease striatal dopamine D2 receptor binding in man. Psychopharmacology (Berl), 164, 401-6. AALTO, S., IHALAINEN, J., HIRVONEN, J., KAJANDER, J., SCHEININ, H., TANILA, H., NAGREN, K., VILKMAN, H., GUSTAFSSON, L. L., SYVALAHTI, E. & HIETALA, J. 2005. Cortical glutamate- dopamine interaction and ketamine-induced psychotic symptoms in man. Psychopharmacology (Berl), 182, 375-83. ABDALLAH, C. G., SANACORA, G., DUMAN, R. S. & KRYSTAL, J. H. 2015. Ketamine and rapid-acting antidepressants: a window into a new neurobiology for mood disorder therapeutics. Annu Rev Med, 66, 509-23. ABI-DARGHAM, A., GIL, R., KRYSTAL, J., BALDWIN, R. M., SEIBYL, J. P., BOWERS, M., VAN DYCK, C. H., CHARNEY, D. S., INNIS, R. B. & LARUELLE, M. 1998. Increased striatal dopamine transmission in schizophrenia: confirmation in a second cohort. Am J Psychiatry, 155, 761-7. ABI-DARGHAM, A., MAWLAWI, O., LOMBARDO, I., GIL, R., MARTINEZ, D., HUANG, Y., HWANG, D. R., KEILP, J., KOCHAN, L., VAN HEERTUM, R., GORMAN, J. M. & LARUELLE, M. 2002. Prefrontal dopamine D1 receptors and working memory in schizophrenia. J Neurosci, 22, 3708-19. ABI-DARGHAM, A., VAN DE GIESSEN, E., SLIFSTEIN, M., KEGELES, L. S. & LARUELLE, M. 2009. Baseline and amphetamine-stimulated dopamine activity are related in drug-naive schizophrenic subjects. Biol Psychiatry, 65, 1091-3. ADAMS, B. W., BRADBERRY, C. W. & MOGHADDAM, B. 2002. NMDA antagonist effects on striatal dopamine release: microdialysis studies in awake monkeys. Synapse, 43, 12-8. AGUADO, L., SAN ANTONIO, A., PEREZ, L., DEL VALLE, R. & GOMEZ, J. 1994. Effects of the NMDA receptor antagonist ketamine on flavor memory: conditioned aversion, latent inhibition, and habituation of neophobia. Behav Neural Biol, 61, 271-81. AHMED, S. H., LIN, D., KOOB, G. F. & PARSONS, L. H. 2003. Escalation of cocaine self-administration does not depend on altered cocaine-induced nucleus accumbens dopamine levels. J Neurochem, 86, 102-13. AKBARIAN, S., KIM, J. J., POTKIN, S. G., HAGMAN, J. O., TAFAZZOLI, A., BUNNEY, W. E., JR. & JONES, E. G. 1995. Gene expression for glutamic acid decarboxylase is reduced without loss of neurons in prefrontal cortex of schizophrenics. Arch Gen Psychiatry, 52, 258-66. ALBIN, R. L., YOUNG, A. B. & PENNEY, J. B. 1989. The functional anatomy of basal ganglia disorders. Trends Neurosci, 12, 366-75. ALEXANDER, G. M., SCHWARTZMAN, R. J., GROTHUSEN, J. R. & GORDON, S. W. 1994. Effect of plasma levels of large neutral amino acids and degree of parkinsonism on the blood-to-brain transport of levodopa in naive and MPTP parkinsonian monkeys. Neurology, 44, 1491-9. ALLEN, R. M. & YOUNG, S. J. 1978. Phencyclidine-induced psychosis. Am J Psychiatry, 135, 1081-4. ALLMAN, K., PAGE, K. M., CURTIS, C. A. & HULME, E. C. 2000. Scanning mutagenesis identifies amino acid side chains in transmembrane domain 5 of the M(1) muscarinic receptor that participate in binding the acetyl methyl group of acetylcholine. Mol Pharmacol, 58, 175-84. AMANN, L. C., GANDAL, M. J., HALENE, T. B., EHRLICHMAN, R. S., WHITE, S. L., MCCARREN, H. S. & SIEGEL, S. J. 2010. Mouse behavioral endophenotypes for schizophrenia. Brain Res Bull, 83, 147-61. AMANN, L. C., HALENE, T. B., EHRLICHMAN, R. S., LUMINAIS, S. N., MA, N., ABEL, T. & SIEGEL, S. J. 2009. Chronic ketamine impairs fear conditioning and produces long-lasting reductions in auditory evoked potentials. Neurobiol Dis, 35, 311-7. ANDRADE, C. 2017. Ketamine for Depression, 3: Does Chirality Matter? J Clin Psychiatry, 78, e674- e677.

207

ARMBRUSTER, B. N., LI, X., PAUSCH, M. H., HERLITZE, S. & ROTH, B. L. 2007. Evolving the lock to fit the key to create a family of G protein-coupled receptors potently activated by an inert ligand. Proc Natl Acad Sci U S A, 104, 5163-8. ARNOLD, J. M. & ROBERTS, D. C. 1997. A critique of fixed and progressive ratio schedules used to examine the neural substrates of drug reinforcement. Pharmacol Biochem Behav, 57, 441-7. ASHOK, A. H., MIZUNO, Y., VOLKOW, N. D. & HOWES, O. D. 2017. Association of Stimulant Use With Dopaminergic Alterations in Users of Cocaine, Amphetamine, or Methamphetamine: A Systematic Review and Meta-analysis. JAMA Psychiatry, 74, 511-519. ATASOY, D., BETLEY, J. N., SU, H. H. & STERNSON, S. M. 2012. Deconstruction of a neural circuit for hunger. Nature, 488, 172-7. BARAD, M., BLOUIN, A. M. & CAIN, C. K. 2004. Like extinction, latent inhibition of conditioned fear in mice is blocked by systemic inhibition of L-type voltage-gated calcium channels. Learn Mem, 11, 536-9. BAUMANN, B., DANOS, P., DIEKMANN, S., KRELL, D., BIELAU, H., GERETSEGGER, C., WURTHMANN, C., BERNSTEIN, H. G. & BOGERTS, B. 1999. Tyrosine hydroxylase immunoreactivity in the locus coeruleus is reduced in depressed non-suicidal patients but normal in depressed suicide patients. Eur Arch Psychiatry Clin Neurosci, 249, 212-9. BECKER, A., PETERS, B., SCHROEDER, H., MANN, T., HUETHER, G. & GRECKSCH, G. 2003. Ketamine- induced changes in rat behaviour: A possible animal model of schizophrenia. Progress in Neuro-Psychopharmacology & Biological Psychiatry, 27, 687-700. BECKER, J. B. 1999. Gender differences in dopaminergic function in striatum and nucleus accumbens. Pharmacol Biochem Behav, 64, 803-12. BELLO, E. P., MATEO, Y., GELMAN, D. M., NOAIN, D., SHIN, J. H., LOW, M. J., ALVAREZ, V. A., LOVINGER, D. M. & RUBINSTEIN, M. 2011. Cocaine supersensitivity and enhanced motivation for reward in mice lacking dopamine D2 autoreceptors. Nat Neurosci, 14, 1033-8. BELUJON, P. & GRACE, A. A. 2014a. Restoring Mood Balance in Depression: Ketamine Reverses Deficit in Dopamine-Dependent Synaptic Plasticity. Biological Psychiatry, 76, 927-936. BELUJON, P. & GRACE, A. A. 2014b. Restoring mood balance in depression: ketamine reverses deficit in dopamine-dependent synaptic plasticity. Biol Psychiatry, 76, 927-36. BENES, F. M., MCSPARREN, J., BIRD, E. D., SANGIOVANNI, J. P. & VINCENT, S. L. 1991. Deficits in small interneurons in prefrontal and cingulate cortices of schizophrenic and schizoaffective patients. Arch Gen Psychiatry, 48, 996-1001. BENES, F. M., VINCENT, S. L., MARIE, A. & KHAN, Y. 1996. Up-regulation of GABAA receptor binding on neurons of the prefrontal cortex in schizophrenic subjects. Neuroscience, 75, 1021-31. BERMAN, R. M., CAPPIELLO, A., ANAND, A., OREN, D. A., HENINGER, G. R., CHARNEY, D. S. & KRYSTAL, J. H. 2000. Antidepressant effects of ketamine in depressed patients. Biol Psychiatry, 47, 351-4. BERRIDGE, K. C. 2007. The debate over dopamine's role in reward: the case for incentive salience. Psychopharmacology (Berl), 191, 391-431. BEYER, C., PILGRIM, C. & REISERT, I. 1991. Dopamine content and metabolism in mesencephalic and diencephalic cell cultures: sex differences and effects of sex steroids. J Neurosci, 11, 1325-33. BIEGON, A. & FIELDUST, S. 1992. Reduced tyrosine hydroxylase immunoreactivity in locus coeruleus of suicide victims. Synapse, 10, 79-82. BJORKLUND, A. & DUNNETT, S. B. 2007. Dopamine neuron systems in the brain: an update. Trends Neurosci, 30, 194-202. BLACKSTONE, C. 2009. Infantile parkinsonism-dystonia: a dopamine "transportopathy". J Clin Invest, 119, 1455-8. BLOOMFIELD, M. A. 2016. Dopaminergic Mechanisms Underlying Psychosis. PhD thesis Imperial College London. BLOOMFIELD, M. A., ASHOK, A. H., VOLKOW, N. D. & HOWES, O. D. 2016. The effects of Delta9- tetrahydrocannabinol on the dopamine system. Nature, 539, 369-377.

208

BLOOMFIELD, M. A., PEPPER, F., EGERTON, A., DEMJAHA, A., TOMASI, G., MOUCHLIANITIS, E., MAXIMEN, L., VERONESE, M., TURKHEIMER, F., SELVARAJ, S. & HOWES, O. D. 2014. Dopamine function in cigarette smokers: an [(1)(8)F]-DOPA PET study. Neuropsychopharmacology, 39, 2397-404. BONARDI, C., BRILOT, B. & JENNINGS, D. J. 2016. Learning about the CS during latent inhibition: Preexposure enhances temporal control. J Exp Psychol Anim Learn Cogn, 42, 187-99. BONSALL, D. R., KOKKINOU, M., VERONESE, M., COELLO, C., WELLS, L. A. & HOWES, O. D. 2017. Single cocaine exposure does not alter striatal presynaptic dopamine function in mice: an [18 F]-FDOPA PET study. J Neurochem. BRADBERRY, C. W. 2000. Acute and chronic dopamine dynamics in a nonhuman primate model of recreational cocaine use. J Neurosci, 20, 7109-15. BRADBERRY, C. W. 2007. Cocaine sensitization and dopamine mediation of cue effects in rodents, monkeys, and humans: areas of agreement, disagreement, and implications for addiction. Psychopharmacology (Berl), 191, 705-17. BRAUN, W. B., GE. CHENOWETH, MB 1979. The metabolism/ pharmacokinetics of pentachlorophenol in man, and a comparison with the rat and monkey. . Dev Toxicol Environ Sci, 289-296. BREIER, A., ADLER, C. M., WEISENFELD, N., SU, T. P., ELMAN, I., PICKEN, L., MALHOTRA, A. K. & PICKAR, D. 1998a. Effects of NMDA antagonism on striatal dopamine release in healthy subjects: application of a novel PET approach. Synapse, 29, 142-7. BREIER, A., ADLER, C. M., WEISENFELD, N., SU, T. P., ELMAN, I., PICKEN, L., MALHOTRA, A. K. & PICKAR, D. 1998b. Effects of NMDA antagonism on striatal dopamine release in healthy subjects: Application of a novel PET approach. Synapse, 29, 142-147. BREIER, A., SU, T. P., SAUNDERS, R., CARSON, R. E., KOLACHANA, B. S., DE BARTOLOMEIS, A., WEINBERGER, D. R., WEISENFELD, N., MALHOTRA, A. K., ECKELMAN, W. C. & PICKAR, D. 1997. Schizophrenia is associated with elevated amphetamine-induced synaptic dopamine concentrations: evidence from a novel positron emission tomography method. Proc Natl Acad Sci U S A, 94, 2569-74. BRICKLEY, S. G. & MODY, I. 2012. Extrasynaptic GABA(A) receptors: their function in the CNS and implications for disease. Neuron, 73, 23-34. BROMET, E., ANDRADE, L. H., HWANG, I., SAMPSON, N. A., ALONSO, J., DE GIROLAMO, G., DE GRAAF, R., DEMYTTENAERE, K., HU, C., IWATA, N., KARAM, A. N., KAUR, J., KOSTYUCHENKO, S., LEPINE, J. P., LEVINSON, D., MATSCHINGER, H., MORA, M. E., BROWNE, M. O., POSADA- VILLA, J., VIANA, M. C., WILLIAMS, D. R. & KESSLER, R. C. 2011. Cross-national epidemiology of DSM-IV major depressive episode. BMC Med, 9, 90. BROWNE, C. A. & LUCKI, I. 2013. Antidepressant effects of ketamine: mechanisms underlying fast- acting novel antidepressants. Front Pharmacol, 4, 161. BRUNSWICK, D. J., AMSTERDAM, J. D., MOZLEY, P. D. & NEWBERG, A. 2003. Greater availability of brain dopamine transporters in major depression shown by [99m Tc]TRODAT-1 SPECT imaging. Am J Psychiatry, 160, 1836-41. CADDY, C., AMIT, B. H., MCCLOUD, T. L., RENDELL, J. M., FURUKAWA, T. A., MCSHANE, R., HAWTON, K. & CIPRIANI, A. 2015. Ketamine and other glutamate receptor modulators for depression in adults. Cochrane Database Syst Rev, Cd011612. CAIXETA, F. V., CORNELIO, A. M., SCHEFFER-TEIXEIRA, R., RIBEIRO, S. & TORT, A. B. 2013. Ketamine alters oscillatory coupling in the hippocampus. Sci Rep, 3, 2348. CALIPARI, E. S. & FERRIS, M. J. 2013. Amphetamine mechanisms and actions at the dopamine terminal revisited. J Neurosci, 33, 8923-5. CALZAVARA, M. B., MEDRANO, W. A., LEVIN, R., KAMEDA, S. R., ANDERSEN, M. L., TUFIK, S., SILVA, R. H., FRUSSA-FILHO, R. & ABILIO, V. C. 2009a. Neuroleptic drugs revert the contextual fear conditioning deficit presented by spontaneously hypertensive rats: a potential animal model of emotional context processing in schizophrenia? Schizophr Bull, 35, 748-59.

209

CALZAVARA, M. B., MEDRANO, W. A., LEVIN, R., KAMEDA, S. R., ANDERSEN, M. L., TUFIK, S., SILVA, R. H., FRUSSA, R. & ABILIO, V. C. 2009b. Neuroleptic Drugs Revert the Contextual Fear Conditioning Deficit Presented by Spontaneously Hypertensive Rats: A Potential Animal Model of Emotional Context Processing in Schizophrenia? Schizophrenia Bulletin, 35, 748- 759. CAN, A. & ZANOS, P. 2016. Effects of Ketamine and Ketamine Metabolites on Evoked Striatal Dopamine Release, Dopamine Receptors, and Monoamine Transporters. 359, 159-70. CARAMANOS, Z. & SHAPIRO, M. L. 1994. Spatial memory and N-methyl-D-aspartate receptor antagonists APV and MK-801: memory impairments depend on familiarity with the environment, drug dose, and training duration. Behav Neurosci, 108, 30-43. CARBONI, E., IMPERATO, A., PEREZZANI, L. & DI CHIARA, G. 1989. Amphetamine, cocaine, phencyclidine and nomifensine increase extracellular dopamine concentrations preferentially in the nucleus accumbens of freely moving rats. Neuroscience, 28, 653-61. CARLSSON, A., HANSSON, L. O., WATERS, N. & CARLSSON, M. L. 1999. A glutamatergic deficiency model of schizophrenia. Br J Psychiatry Suppl, 2-6. CAVAZZUTI, M., PORRO, C. A., BIRAL, G. P., BENASSI, C. & BARBIERI, G. C. 1987. Ketamine effects on local cerebral blood flow and metabolism in the rat. J Cereb Blood Flow Metab, 7, 806-11. CHARTOFF, E. H., HEUSNER, C. L. & PALMITER, R. D. 2005. Dopamine is not required for the hyperlocomotor response to NMDA receptor antagonists. Neuropsychopharmacology, 30, 1324-33. CHATTERJEE, I. B., MAJUMDER, A. K., NANDI, B. K. & SUBRAMANIAN, N. 1975. Synthesis and some major functions of vitamin C in animals. Ann N Y Acad Sci, 258, 24-47. CHATTERJEE, M., GANGULY, S., SRIVASTAVA, M. & PALIT, G. 2011. Effect of 'chronic' versus 'acute' ketamine administration and its 'withdrawal' effect on behavioural alterations in mice: implications for experimental psychosis. Behav Brain Res, 216, 247-54. CHATTERJEE, M., VERMA, R., GANGULY, S. & PALIT, G. 2012a. Neurochemical and molecular characterization of ketamine-induced experimental psychosis model in mice. Neuropharmacology, .63, pp. CHATTERJEE, M., VERMA, R., GANGULY, S. & PALIT, G. 2012b. Neurochemical and molecular characterization of ketamine-induced experimental psychosis model in mice. Neuropharmacology, 63, 1161-71. CHATTERJEE, M., VERMA, R., GANGULY, S. & PALIT, G. 2012c. Neurochemical and molecular characterization of ketamine-induced experimental psychosis model in mice. Neuropharmacology, 63, 1161-1171. CHAUDHURY, D., WALSH, J. J., FRIEDMAN, A. K., JUAREZ, B., KU, S. M., KOO, J. W., FERGUSON, D., TSAI, H. C., POMERANZ, L., CHRISTOFFEL, D. J., NECTOW, A. R., EKSTRAND, M., DOMINGOS, A., MAZEI-ROBISON, M. S., MOUZON, E., LOBO, M. K., NEVE, R. L., FRIEDMAN, J. M., RUSSO, S. J., DEISSEROTH, K., NESTLER, E. J. & HAN, M. H. 2013. Rapid regulation of depression- related behaviours by control of midbrain dopamine neurons. Nature, 493, 532-6. CHEN, K. C., YANG, Y. K., HOWES, O., LEE, I. H., LANDAU, S., YEH, T. L., CHIU, N. T., CHEN, P. S., LU, R. B., DAVID, A. S. & BRAMON, E. 2013. Striatal dopamine transporter availability in drug-naive patients with schizophrenia: a case-control SPECT study with [(99m)Tc]-TRODAT-1 and a meta-analysis. Schizophr Bull, 39, 378-86. CHEN, X., CHOO, H., HUANG, X. P., YANG, X., STONE, O., ROTH, B. L. & JIN, J. 2015. The first structure-activity relationship studies for designer receptors exclusively activated by designer drugs. ACS Chem Neurosci, 6, 476-84. CHERRY, S. R. 2001. Fundamentals of positron emission tomography and applications in preclinical drug development. J Clin Pharmacol, 41, 482-91. CHESTERS, R. C., WOOD, T. C. & A.C., V. 2017. Repeat ketamine exposure induces microstructural changes in mouse brain tissue. Conference Abstract. The British Association for Psychopharmacology Summer Meeting

210

CHOW, P. L., RANNOU, F. R. & CHATZIIOANNOU, A. F. 2005. Attenuation correction for small animal PET tomographs. Phys Med Biol, 50, 1837-50. CLEMENTS, J. A. & NIMMO, W. S. 1981. Pharmacokinetics and analgesic effect of ketamine in man. Br J Anaesth, 53, 27-30. COHEN, J. 1988. Statistical power analysis for the behavioral sciences COLLINGRIDGE, G. L., LEE, Y., BORTOLOTTO, Z. A., KANG, H. & LODGE, D. 2017. Antidepressant Actions of Ketamine Versus Hydroxynorketamine. Biol Psychiatry, 81, e65-e67. CONKLIN, B. R., HSIAO, E. C., CLAEYSEN, S., DUMUIS, A., SRINIVASAN, S., FORSAYETH, J. R., GUETTIER, J. M., CHANG, W. C., PEI, Y., MCCARTHY, K. D., NISSENSON, R. A., WESS, J., BOCKAERT, J. & ROTH, B. L. 2008. Engineering GPCR signaling pathways with RASSLs. Nat Methods, 5, 673-8. CORBETT, D. 1989. Possible abuse potential of the NMDA antagonist MK-801. Behav Brain Res, 34, 239-46. CORSSEN, G. & DOMINO, E. F. 1966. Dissociative anesthesia: further pharmacologic studies and first clinical experience with the phencyclidine derivative CI-581. Anesth Analg, 45, 29-40. CORSSEN, G., MIYASAKA, M. & DOMINO, E. F. 1968. Changing concepts in pain control during surgery: dissociative anesthesia with CI-581. A progress report. Anesth Analg, 47, 746-59. CRIME, U. N. O. D. A. 2013. World Drug Report. CRUZ, S. L., SOBERANES-CHAVEZ, P., PAEZ-MARTINEZ, N. & LOPEZ-RUBALCAVA, C. 2009. Toluene has antidepressant-like actions in two animal models used for the screening of antidepressant drugs. Psychopharmacology (Berl), 204, 279-86. CUMMING, P., BOYES, B. E., MARTIN, W. R., ADAM, M., GRIERSON, J., RUTH, T. & MCGEER, E. G. 1987. The metabolism of [18F]6-fluoro-L-3,4-dihydroxyphenylalanine in the hooded rat. J Neurochem, 48, 601-8. CUMMING, P. & GJEDDE, A. 1998. Compartmental analysis of dopa decarboxylation in living brain from dynamic positron emission tomograms. Synapse, 29, 37-61. CUMMING, P., KUWABARA, H., ASE, A. & GJEDDE, A. 1995. Regulation of DOPA decarboxylase activity in brain of living rat. J Neurochem, 65, 1381-90. CUMMING, P., LEGER, G. C., KUWABARA, H. & GJEDDE, A. 1993. Pharmacokinetics of plasma 6- [18F]fluoro-L-3,4-dihydroxyphenylalanine ([18F]Fdopa) in humans. J Cereb Blood Flow Metab, 13, 668-75. CUMMING, P., MUNK, O. L. & DOUDET, D. 2001. Loss of metabolites from monkey striatum during PET with FDOPA. Synapse, 41, 212-8. CURRAN, H. V. & MONAGHAN, L. 2001. In and out of the K-hole: a comparison of the acute and residual effects of ketamine in frequent and infrequent ketamine users. Addiction, 96, 749- 60. CURRAN, H. V. & MORGAN, C. 2000. Cognitive, dissociative and psychotogenic effects of ketamine in recreational users on the night of drug use and 3 days later. Addiction, 95, 575-90. CZOTY, P. W., RIDDICK, N. V., GAGE, H. D., SANDRIDGE, M., NADER, S. H., GARG, S., BOUNDS, M., GARG, P. K. & NADER, M. A. 2009. Effect of menstrual cycle phase on dopamine D2 receptor availability in female cynomolgus monkeys. Neuropsychopharmacology, 34, 548-54. D'HAENEN H, A. & BOSSUYT, A. 1994. Dopamine D2 receptors in depression measured with single photon emission computed tomography. Biol Psychiatry, 35, 128-32. DAHLSTROEM, A. & FUXE, K. 1964. EVIDENCE FOR THE EXISTENCE OF MONOAMINE-CONTAINING NEURONS IN THE CENTRAL NERVOUS SYSTEM. I. DEMONSTRATION OF MONOAMINES IN THE CELL BODIES OF BRAIN STEM NEURONS. Acta Physiol Scand Suppl, Suppl 232:1-55. DANIELSEN, E. H., SMITH, D., HERMANSEN, F., GJEDDE, A. & CUMMING, P. 2001. Acute neuroleptic stimulates DOPA decarboxylase in porcine brain in vivo. Synapse, 41, 172-5. DE JONG, J. W., ROELOFS, T. J., MOL, F. M., HILLEN, A. E., MEIJBOOM, K. E., LUIJENDIJK, M. C., VAN DER EERDEN, H. A., GARNER, K. M., VANDERSCHUREN, L. J. & ADAN, R. A. 2015. Reducing Ventral Tegmental Dopamine D2 Receptor Expression Selectively Boosts Incentive Motivation. Neuropsychopharmacology, 40, 2085-95.

211

DE LUCA, M. T. & BADIANI, A. 2011. Ketamine self-administration in the rat: evidence for a critical role of setting. Psychopharmacology (Berl), 214, 549-56. DE WIT, H. & WISE, R. A. 1977. Blockade of cocaine reinforcement in rats with the dopamine receptor blocker pimozide, but not with the noradrenergic blockers phentolamine or phenoxybenzamine. Can J Psychol, 31, 195-203. DEEP, P., GJEDDE, A. & CUMMING, P. 1997. On the accuracy of an [18F]FDOPA compartmental model: evidence for vesicular storage of [18F]fluorodopamine in vivo. J Neurosci Methods, 76, 157-65. DEJESUS, O. T., HAAPARANTA, M., SOLIN, O. & NICKLES, R. J. 2000. 6-fluoroDOPA metabolism in rat striatum: time course of extracellular metabolites. Brain Res, 877, 31-6. DELONG, M. R. 1990. Primate models of movement disorders of basal ganglia origin. Trends Neurosci, 13, 281-5. DESCE, J. M., GODEHEU, G., GALLI, T., ARTAUD, F., CHERAMY, A. & GLOWINSKI, J. 1992. L-glutamate- evoked release of dopamine from synaptosomes of the rat striatum: involvement of AMPA and N-methyl-D-aspartate receptors. Neuroscience, 47, 333-9. DHAWAN, V., MA, Y., PILLAI, V., SPETSIERIS, P., CHALY, T., BELAKHLEF, A., MARGOULEFF, C. & EIDELBERG, D. 2002. Comparative analysis of striatal FDOPA uptake in Parkinson's disease: ratio method versus graphical approach. J Nucl Med, 43, 1324-30. DI CHIARA, G. 1990. In-vivo brain dialysis of neurotransmitters. Trends Pharmacol Sci, 11, 116-21. DI CHIARA, G. 2002. Nucleus accumbens shell and core dopamine: differential role in behavior and addiction. Behav Brain Res, 137, 75-114. DI CHIARA, G. 2005. Dopamine, motivation and reward. Handbook of Chemical Neuroanatomy, 21, 303-394. DI CHIARA, G. & BASSAREO, V. 2007. Reward system and addiction: what dopamine does and doesn't do. Curr Opin Pharmacol, 7, 69-76. DI CHIARA, G., LODDO, P. & TANDA, G. 1999. Reciprocal changes in prefrontal and limbic dopamine responsiveness to aversive and rewarding stimuli after chronic mild stress: implications for the psychobiology of depression. Biol Psychiatry, 46, 1624-33. DIAZGRANADOS, N., IBRAHIM, L., BRUTSCHE, N. E., NEWBERG, A., KRONSTEIN, P., KHALIFE, S., KAMMERER, W. A., QUEZADO, Z., LUCKENBAUGH, D. A., SALVADORE, G., MACHADO-VIEIRA, R., MANJI, H. K. & ZARATE, C. A., JR. 2010. A randomized add-on trial of an N-methyl-D- aspartate antagonist in treatment-resistant bipolar depression. Arch Gen Psychiatry, 67, 793- 802. DIDONE, V., MASSON, S., QUOILIN, C., SEUTIN, V. & QUERTEMONT, E. 2016. Correlation between ethanol behavioral sensitization and midbrain dopamine neuron reactivity to ethanol. Addict Biol, 21, 387-96. DINGLEDINE, R., BORGES, K., BOWIE, D. & TRAYNELIS, S. F. 1999. The glutamate receptor ion channels. Pharmacol Rev, 51, 7-61. DOMINGOS, A. I., VAYNSHTEYN, J., VOSS, H. U., REN, X., GRADINARU, V., ZANG, F., DEISSEROTH, K., DE ARAUJO, I. E. & FRIEDMAN, J. 2011. Leptin regulates the reward value of nutrient. Nat Neurosci, 14, 1562-8. DOMINO, E. F. 2010. Taming the ketamine tiger. 1965. Anesthesiology, 113, 678-84. DOMINO, E. F. & LUBY, E. D. 2012. Phencyclidine/Schizophrenia: One View Toward the Past, The Other to the Future. Schizophrenia Bulletin, 38, 914-919. DONEGAN, J. J., TYSON, J. A., BRANCH, S. Y., BECKSTEAD, M. J., ANDERSON, S. A. & LODGE, D. J. 2017. Stem cell-derived interneuron transplants as a treatment for schizophrenia: preclinical validation in a rodent model. Mol Psychiatry, 22, 1492-1501. DUMAN, R. S. & AGHAJANIAN, G. K. 2014. Neurobiology of rapid acting antidepressants: role of BDNF and GSK-3beta. Neuropsychopharmacology, 39, 233. DUNLOP, B. W. & NEMEROFF, C. B. 2007. The role of dopamine in the pathophysiology of depression. Arch Gen Psychiatry, 64, 327-37.

212

EGERTON, A., CHADDOCK, C. A., WINTON-BROWN, T. T., BLOOMFIELD, M. A., BHATTACHARYYA, S., ALLEN, P., MCGUIRE, P. K. & HOWES, O. D. 2013. Presynaptic striatal dopamine dysfunction in people at ultra-high risk for psychosis: findings in a second cohort. Biol Psychiatry, 74, 106- 12. EGERTON, A., HIRANI, E., AHMAD, R., TURTON, D. R., BRICKUTE, D., ROSSO, L., HOWES, O. D., LUTHRA, S. K. & GRASBY, P. M. 2010. Further evaluation of the carbon11-labeled D(2/3) agonist PET radiotracer PHNO: reproducibility in tracer characteristics and characterization of extrastriatal binding. Synapse, 64, 301-12. EL ISKANDRANI, K. S., OOSTERHOF, C. A., EL MANSARI, M. & BLIER, P. 2015a. Impact of subanesthetic doses of ketamine on AMPA-mediated responses in rats: An in vivo electrophysiological study on monoaminergic and glutamatergic neurons. Journal of Psychopharmacology, 29, 792-801. EL ISKANDRANI, K. S., OOSTERHOF, C. A., EL MANSARI, M. & BLIER, P. 2015b. Impact of subanesthetic doses of ketamine on AMPA-mediated responses in rats: An in vivo electrophysiological study on monoaminergic and glutamatergic neurons. Journal of Psychopharmacology, .29, pp. EL ISKANDRANI, K. S., OOSTERHOF, C. A., EL MANSARI, M. & BLIER, P. 2015c. Impact of subanesthetic doses of ketamine on AMPA-mediated responses in rats: An in vivo electrophysiological study on monoaminergic and glutamatergic neurons. J Psychopharmacol, 29, 792-801. ELLIS, P. 2010. The Essential Guide to Effect Sizes: Statistical Power, Meta-Analysis, and the Interpretation of Research Results Cambridge University Press. ESCOBAR, M., OBERLING, P. & MILLER, R. R. 2002. Associative deficit accounts of disrupted latent inhibition and blocking in schizophrenia. Neurosci Biobehav Rev, 26, 203-16. ESTERLIS, I., DELLAGIOIA, N., PIETRZAK, R. H., MATUSKEY, D., NABULSI, N., ABDALLAH, C. G., YANG, J. & PITTENGER, C. 2017. Ketamine-induced reduction in mGluR5 availability is associated with an antidepressant response: an [11C]ABP688 and PET imaging study in depression. ETTENBERG, A. & CAMP, C. H. 1986. Haloperidol induces a partial reinforcement extinction effect in rats: implications for a dopamine involvement in food reward. Pharmacol Biochem Behav, 25, 813-21. EVERITT, B. J. & ROBBINS, T. W. 2005. Neural systems of reinforcement for drug addiction: from actions to habits to compulsion. Nat Neurosci, 8, 1481-9. FANG, C. K., CHEN, H. W., WANG, W. H., LIU, R. S. & HWANG, J. J. 2013. Acute effects of three club drugs on the striatum of rats: Evaluation by quantitative autoradiography with [F-18]FDOPA. Applied Radiation and Isotopes, 77, 153-159. FEATHERSTONE, R. E., LIANG, Y., SAUNDERS, J. A., TATARD-LEITMAN, V. M., EHRLICHMAN, R. S. & SIEGEL, S. J. 2012. Subchronic ketamine treatment leads to permanent changes in EEG, cognition and the astrocytic glutamate transporter EAAT2 in mice. Neurobiol Dis, 47, 338-46. FERGUSON, S. A. & PAULE, M. G. 1997. Progressive ratio performance varies with body weight in rats. Behav Processes, 40, 177-82. FITZPATRICK, C. J. & MORROW, J. D. 2017. Subanesthetic ketamine decreases the incentive- motivational value of reward-related cues. J Psychopharmacol, 31, 67-74. FRENCH, E. D. & CECI, A. 1990. Non-competitive N-methyl-D-aspartate antagonists are potent activators of ventral tegmental A10 dopamine neurons. Neurosci Lett, 119, 159-62. FRENCH, E. D., PILAPIL, C. & QUIRION, R. 1985. Phencyclidine binding sites in the nucleus accumbens and phencyclidine-induced hyperactivity are decreased following lesions of the mesolimbic dopamine system. Eur J Pharmacol, 116, 1-9. FRENCH, E. D. & VANTINI, G. 1984. Phencyclidine-induced locomotor activity in the rat is blocked by 6-hydroxydopamine lesion of the nucleus accumbens: comparisons to other psychomotor stimulants. Psychopharmacology (Berl), 82, 83-8. FUSAR-POLI, P. & MEYER-LINDENBERG, A. 2013. Striatal presynaptic dopamine in schizophrenia, part II: meta-analysis of [(18)F/(11)C]-DOPA PET studies. Schizophr Bull, 39, 33-42.

213

GAISLER-SALOMON, I., MILLER, G. M., CHUHMA, N., LEE, S., ZHANG, H., GHODDOUSSI, F., LEWANDOWSKI, N., FAIRHURST, S., WANG, Y., CONJARD-DUPLANY, A., MASSON, J., BALSAM, P., HEN, R., ARANCIO, O., GALLOWAY, M. P., MOORE, H. M., SMALL, S. A. & RAYPORT, S. 2009a. Glutaminase-deficient mice display hippocampal hypoactivity, insensitivity to propsychotic drugs and potentiated latent inhibition: Relevance to schizophrenia. Neuropsychopharmacology, .34, pp. GAISLER-SALOMON, I., MILLER, G. M., CHUHMA, N., LEE, S., ZHANG, H., GHODDOUSSI, F., LEWANDOWSKI, N., FAIRHURST, S., WANG, Y., CONJARD-DUPLANY, A., MASSON, J., BALSAM, P., HEN, R., ARANCIO, O., GALLOWAY, M. P., MOORE, H. M., SMALL, S. A. & RAYPORT, S. 2009b. Glutaminase-deficient mice display hippocampal hypoactivity, insensitivity to propsychotic drugs and potentiated latent inhibition: relevance to schizophrenia. Neuropsychopharmacology, 34, 2305-22. GAISLER-SALOMON, I., MILLER, G. M., CHUHMA, N., LEE, S., ZHANG, H., GHODDOUSSI, F., LEWANDOWSKI, N., FAIRHURST, S., WANG, Y., CONJARD-DUPLANY, A., MASSON, J., BALSAM, P., HEN, R., ARANCIO, O., GALLOWAY, M. P., MOORE, H. M., SMALL, S. A. & RAYPORT, S. 2009c. Glutaminase-Deficient Mice Display Hippocampal Hypoactivity, Insensitivity to Pro- Psychotic Drugs and Potentiated Latent Inhibition: Relevance to Schizophrenia. Neuropsychopharmacology, 34, 2305-2322. GALLO, M., BIELAVSKA, E., ROLDAN, G. & BURES, J. 1998. Tetrodotoxin inactivation of the gustatory cortex disrupts the effect of the N-methyl-D-aspartate antagonist ketamine on latent inhibition of conditioned taste aversion in rats. Neurosci Lett, 240, 61-4. GAMBHIR, S. S. 2002. Molecular imaging of cancer with positron emission tomography. Nat Rev Cancer, 2, 683-93. GARNETT, E. S., FIRNAU, G. & NAHMIAS, C. 1983. Dopamine visualized in the basal ganglia of living man. Nature, 305, 137-8. GERBER, G. J., SING, J. & WISE, R. A. 1981. Pimozide attenuates lever pressing for water reinforcement in rats. Pharmacol Biochem Behav, 14, 201-5. GHASEMI, M., RAZA, M. & DEHPOUR, A. R. 2010. NMDA receptor antagonists augment antidepressant-like effects of lithium in the mouse forced swimming test. J Psychopharmacol, 24, 585-94. GOLDBERG, M. E., TORJMAN, M. C., SCHWARTZMAN, R. J., MAGER, D. E. & WAINER, I. W. 2011. Enantioselective pharmacokinetics of (R)- and (S)-ketamine after a 5-day infusion in patients with complex regional pain syndrome. Chirality, 23, 138-43. GOLDSTEIN, M. & DEUTCH, A. Y. 1992. Dopaminergic mechanisms in the pathogenesis of schizophrenia. Faseb j, 6, 2413-21. GOMEZ, J. L. & BONAVENTURA, J. 2017. Chemogenetics revealed: DREADD occupancy and activation via converted clozapine. 357, 503-507. GOS, T., KRELL, D., BIELAU, H., BRISCH, R., TRUBNER, K., STEINER, J., BERNSTEIN, H. G., JANKOWSKI, Z. & BOGERTS, B. 2008. Tyrosine hydroxylase immunoreactivity in the locus coeruleus is elevated in violent suicidal depressive patients. Eur Arch Psychiatry Clin Neurosci, 258, 513- 20. GOWDA, M. R., SRINIVASA, P., KUMBAR, P. S., RAMALINGAIAH, V. H., MUTHYALAPPA, C. & DURGOJI, S. 2016. Rapid Resolution of Grief with IV Infusion of Ketamine: A Unique Phenomenological Experience. Indian J Psychol Med, 38, 62-4. GRACE, A. A., FLORESCO, S. B., GOTO, Y. & LODGE, D. J. 2007. Regulation of firing of dopaminergic neurons and control of goal-directed behaviors. Trends Neurosci, 30, 220-7. GREIFENSTEIN, F. E., DEVAULT, M., YOSHITAKE, J. & GAJEWSKI, J. E. 1958. A study of a 1-aryl cyclo hexyl amine for anesthesia. Anesth Analg, 37, 283-94. GRIMWOOD, S., LE BOURDELLES, B., ATACK, J. R., BARTON, C., COCKETT, W., COOK, S. M., GILBERT, E., HUTSON, P. H., MCKERNAN, R. M., MYERS, J., RAGAN, C. I., WINGROVE, P. B. & WHITING,

214

P. J. 1996. Generation and characterisation of stable cell lines expressing recombinant human N-methyl-D-aspartate receptor subtypes. J Neurochem, 66, 2239-47. GRUBBS, F. E. 1950. Sample criteria for testing outlying observations. Annals of Mathematical Statistics, 21, 27-58. GUETTIER, J. M., GAUTAM, D., SCARSELLI, M., RUIZ DE AZUA, I., LI, J. H., ROSEMOND, E., MA, X., GONZALEZ, F. J., ARMBRUSTER, B. N., LU, H., ROTH, B. L. & WESS, J. 2009. A chemical-genetic approach to study G protein regulation of beta cell function in vivo. Proc Natl Acad Sci U S A, 106, 19197-202. HABER, S. N., FUDGE, J. L. & MCFARLAND, N. R. 2000. Striatonigrostriatal pathways in primates form an ascending spiral from the shell to the dorsolateral striatum. J Neurosci, 20, 2369-82. HAN, S. J., HAMDAN, F. F., KIM, S. K., JACOBSON, K. A., BLOODWORTH, L. M., LI, B. & WESS, J. 2005. Identification of an agonist-induced conformational change occurring adjacent to the ligand- binding pocket of the M(3) muscarinic acetylcholine receptor. J Biol Chem, 280, 34849-58. HANSEN, G., JENSEN, S. B., CHANDRESH, L. & HILDEN, T. 1988. The psychotropic effect of ketamine. J Psychoactive Drugs, 20, 419-25. HARADA, N., OHBA, H., FUKUMOTO, D., KAKIUCHI, T. & TSUKADA, H. 2004a. Potential of [(18)F]beta- CFT-FE (2beta-carbomethoxy-3beta-(4-fluorophenyl)-8-(2-[(18)F]fluoroethyl)nortropane) as a dopamine transporter ligand: A PET study in the conscious monkey brain. Synapse, 54, 37- 45. HARADA, N., OHBA, H., FUKUMOTO, D., KAKIUCHI, T. & TSUKADA, H. 2004b. Potential of [F-18]beta- CFT-FE (2 beta-carbomethoxy-3 beta-(4-fluorophenyl)-8-(2-[F-18]fluoroethyl)nortropane) as a dopamine transporter ligand: A PET study in the conscious monkey brain. Synapse, 54, 37- 45. HASHIMOTO, K., KAKIUCHI, T., OHBA, H., NISHIYAMA, S. & TSUKADA, H. 2016. Reduction of dopamine D2/3 receptor binding in the striatum after a single administration of esketamine, but not R-ketamine: a PET study in conscious monkeys. Eur Arch Psychiatry Clin Neurosci. HASHIMOTO, T., VOLK, D. W., EGGAN, S. M., MIRNICS, K., PIERRI, J. N., SUN, Z., SAMPSON, A. R. & LEWIS, D. A. 2003. Gene expression deficits in a subclass of GABA neurons in the prefrontal cortex of subjects with schizophrenia. J Neurosci, 23, 6315-26. HEIDBREDER, C. A., THOMPSON, A. C. & SHIPPENBERG, T. S. 1996. Role of extracellular dopamine in the initiation and long-term expression of behavioral sensitization to cocaine. J Pharmacol Exp Ther, 278, 490-502. HIROTA, K., HASHIMOTO, Y. & LAMBERT, D. G. 2002. Interaction of intravenous anesthetics with recombinant human M1-M3 muscarinic receptors expressed in chinese hamster ovary cells. Anesth Analg, 95, 1607-10, table of contents. HIRVONEN, J., VAN ERP, T. G., HUTTUNEN, J., AALTO, S., NAGREN, K., HUTTUNEN, M., LONNQVIST, J., KAPRIO, J., CANNON, T. D. & HIETALA, J. 2006. Brain dopamine d1 receptors in twins discordant for schizophrenia. Am J Psychiatry, 163, 1747-53. HOLDEN, J. E., DOUDET, D., ENDRES, C. J., CHAN, G. L., MORRISON, K. S., VINGERHOETS, F. J., SNOW, B. J., PATE, B. D., SOSSI, V., BUCKLEY, K. R. & RUTH, T. J. 1997. Graphical analysis of 6-fluoro- L-dopa trapping: effect of inhibition of catechol-O-methyltransferase. J Nucl Med, 38, 1568- 74. HOMAYOUN, H. & MOGHADDAM, B. 2007. NMDA receptor hypofunction produces opposite effects on prefrontal cortex interneurons and pyramidal neurons. J Neurosci, 27, 11496-500. HOMAYOUN, L., JACKSON, M. E. & MOGHADDAM, B. 2005. Activation of metabotropic glutamate 2/3 receptors reverses the effects of NMDA receptor hypofunction on prefrontal cortex unit activity in awake rats. Journal of Neurophysiology, 93, 1989-2001. HOOKS, M. S., DUFFY, P., STRIPLIN, C. & KALIVAS, P. W. 1994. Behavioral and neurochemical sensitization following cocaine self-administration. Psychopharmacology (Berl), 115, 265-72. HORVITZ, J. C. 2000. Mesolimbocortical and nigrostriatal dopamine responses to salient non-reward events. Neuroscience, 96, 651-6.

215

HORVITZ, J. C., STEWART, T. & JACOBS, B. L. 1997. Burst activity of ventral tegmental dopamine neurons is elicited by sensory stimuli in the awake cat. Brain Res, 759, 251-8. HOU, Y., ZHANG, H., XIE, G., CAO, X., ZHAO, Y., LIU, Y., MAO, Z., YANG, J. & WU, C. 2013. Neuronal injury, but not microglia activation, is associated with ketamine-induced experimental schizophrenic model in mice. Prog Neuropsychopharmacol Biol Psychiatry, 45, 107-16. HOWES, O., MCCUTCHEON, R. & STONE, J. 2015. Glutamate and dopamine in schizophrenia: an update for the 21st century. J Psychopharmacol, 29, 97-115. HOWES, O. D., BOSE, S. K., TURKHEIMER, F., VALLI, I., EGERTON, A., VALMAGGIA, L. R., MURRAY, R. M. & MCGUIRE, P. 2011. Dopamine synthesis capacity before onset of psychosis: a prospective [18F]-DOPA PET imaging study. Am J Psychiatry, 168, 1311-7. HOWES, O. D., KAMBEITZ, J., KIM, E., STAHL, D., SLIFSTEIN, M., ABI-DARGHAM, A. & KAPUR, S. 2012. The nature of dopamine dysfunction in schizophrenia and what this means for treatment. Arch Gen Psychiatry, 69, 776-86. HOWES, O. D. & KAPUR, S. 2009. The dopamine hypothesis of schizophrenia: version III--the final common pathway. Schizophr Bull, 35, 549-62. HOWES, O. D., MONTGOMERY, A. J., ASSELIN, M. C., MURRAY, R. M., VALLI, I., TABRAHAM, P., BRAMON-BOSCH, E., VALMAGGIA, L., JOHNS, L., BROOME, M., MCGUIRE, P. K. & GRASBY, P. M. 2009. Elevated striatal dopamine function linked to prodromal signs of schizophrenia. Arch Gen Psychiatry, 66, 13-20. HOWES, O. D. & MURRAY, R. M. 2014. Schizophrenia: an integrated sociodevelopmental-cognitive model. Lancet, 383, 1677-87. HOWES, O. D., WILLIAMS, M., IBRAHIM, K., LEUNG, G., EGERTON, A., MCGUIRE, P. K. & TURKHEIMER, F. 2013. Midbrain dopamine function in schizophrenia and depression: a postmortem and positron emission tomographic imaging study. Brain, 136, 3242-51. IMPERATO, A., MELE, A., SCROCCO, M. G. & PUGLISI-ALLEGRA, S. 1992. Chronic cocaine alters limbic extracellular dopamine. Neurochemical basis for addiction. Eur J Pharmacol, 212, 299-300. IRIFUNE, M., FUKUDA, T., NOMOTO, M., SATO, T., KAMATA, Y., NISHIKAWA, T., MIETANI, W., YOKOYAMA, K., SUGIYAMA, K. & KAWAHARA, M. 1997. Effects of ketamine on dopamine metabolism during anesthesia in discrete brain regions in mice: comparison with the effects during the recovery and subanesthetic phases. Brain Research, 763, 281-284. IRIFUNE, M., SHIMIZU, T. & NOMOTO, M. 1991a. Ketamine-induced hyperlocomotion associated with alteration of presynaptic components of dopamine neurons in the nucleus accumbens of mice. Pharmacol Biochem Behav, 40, 399-407. IRIFUNE, M., SHIMIZU, T. & NOMOTO, M. 1991b. Ketamine-induced hyperlocomotion associated with alteration of presynaptic components of dopamine neurons in the nucleus accumbens of mice. Oct 1991. Pharmacology, Biochemistry and Behavior, .40, pp. IRIFUNE, M., SHIMIZU, T., NOMOTO, M. & FUKUDA, T. 1992. Ketamin-Induced Anesthesia Involves the N-Methyl-D-Aspartate Receptor-Channel Complex in Mice. Brain Research, 596, 1-9. IRIFUNE, M., SHIMIZU, T., NOMOTO, M. & FUKUDA, T. 1995. Involvement of N-Methyl-D-Aspartate (Nmda) Receptors in Noncompetitive Nmda Receptor Antagonist-Induced Hyperlocomotion in Mice. Pharmacology Biochemistry and Behavior, 51, 291-296. ISAACSON, J. S. & SCANZIANI, M. 2011. How inhibition shapes cortical activity. Neuron, 72, 231-43. JANN, M. W., LAM, Y. W. & CHANG, W. H. 1994. Rapid formation of clozapine in guinea-pigs and man following clozapine-N-oxide administration. Arch Int Pharmacodyn Ther, 328, 243-50. JANSEN, K. L. R. & THERON, L. 2003. Ketamine: Further observations on use, users and consequences. Adicciones, .15, pp. JEEVAKUMAR, V., DRISKILL, C., PAINE, A., SOBHANIAN, M., VAKIL, H., MORRIS, B., RAMOS, J. & KROENER, S. 2015. Ketamine administration during the second postnatal week induces enduring schizophrenia-like behavioral symptoms and reduces parvalbumin expression in the medial prefrontal cortex of adult mice. Behav Brain Res, 282, 165-75.

216

JENTSCH, J. D. & ROTH, R. H. 1999a. The neuropsychopharmacology of phencyclidine: from NMDA receptor hypofunction to the dopamine hypothesis of schizophrenia. Neuropsychopharmacology, 20, 201-25. JENTSCH, J. D. & ROTH, R. H. 1999b. The neuropsychopharmacology of phencyclidine: From NMDA receptor hypofunction to the dopamine hypothesis of schizophrenia. Mar 1999. Neuropsychopharmacology, .20, pp. JOHNSON, K., CHURCHILL, L., KLITENICK, M. A., HOOKS, M. S. & KALIVAS, P. W. 1996. Involvement of the ventral tegmental area in locomotion elicited from the nucleus accumbens or ventral pallidum. J Pharmacol Exp Ther, 277, 1122-31. JOHNSON, K. M., PHILLIPS, M., WANG, C. & KEVETTER, G. A. 1998. Chronic phencyclidine induces behavioral sensitization and apoptotic cell death in the olfactory and piriform cortex. J Neurosci Res, 52, 709-22. JOHNSTONE, M., EVANS, V. & BAIGEL, S. 1959. Sernyl (CI-395) in clinical anaesthesia. Br J Anaesth, 31, 433-9. JONKERS, N., SARRE, S., EBINGER, G. & MICHOTTE, Y. 2001. Benserazide decreases central AADC activity, extracellular dopamine levels and levodopa decarboxylation in striatum of the rat. J Neural Transm (Vienna), 108, 559-70. JOSEPH, M. H., DATLA, K. & YOUNG, A. M. 2003. The interpretation of the measurement of nucleus accumbens dopamine by in vivo dialysis: the kick, the craving or the cognition? Neurosci Biobehav Rev, 27, 527-41. JOSEPH, M. H., PETERS, S. L., MORAN, P. M., GRIGORYAN, G. A., YOUNG, A. M. & GRAY, J. A. 2000. Modulation of latent inhibition in the rat by altered dopamine transmission in the nucleus accumbens at the time of conditioning. Neuroscience, 101, 921-30. KAHLIG, K. M. & GALLI, A. 2003. Regulation of dopamine transporter function and plasma membrane expression by dopamine, amphetamine, and cocaine. Eur J Pharmacol, 479, 153-8. KALIVAS, P. W. & DUFFY, P. 1990. Effect of acute and daily cocaine treatment on extracellular dopamine in the nucleus accumbens. Synapse, 5, 48-58. KALIVAS, P. W. & DUFFY, P. 1993. Time course of extracellular dopamine and behavioral sensitization to cocaine. I. Dopamine axon terminals. J Neurosci, 13, 266-75. KAMIYAMA, H., MATSUMOTO, M., OTANI, S., KIMURA, S. I., SHIMAMURA, K. I., ISHIKAWA, S., YANAGAWA, Y. & TOGASHI, H. 2011. Mechanisms underlying ketamine-induced synaptic depression in rat hippocampus-medial prefrontal cortex pathway. Neuroscience, 177, 159- 69. KAPUR, S. & MANN, J. J. 1992. Role of the dopaminergic system in depression. Biol Psychiatry, 32, 1- 17. KAPUR, S. & SEEMAN, P. 2002a. NMDA receptor antagonists ketamine and PCP have direct effects on the dopamine D2 and serotonin 5-HT2 receptors - Implications for models of schizophrenia. Molecular Psychiatry, .7, pp. KAPUR, S. & SEEMAN, P. 2002b. NMDA receptor antagonists ketamine and PCP have direct effects on the dopamine D(2) and serotonin 5-HT(2)receptors-implications for models of schizophrenia. Mol Psychiatry, 7, 837-44. KATALINIC, N., LAI, R., SOMOGYI, A., MITCHELL, P. B., GLUE, P. & LOO, C. K. 2013. Ketamine as a new treatment for depression: a review of its efficacy and adverse effects. Aust N Z J Psychiatry, 47, 710-27. KAYE, H. & PEARCE, J. M. 1984. The strength of the orienting response during Pavlovian conditioning. J Exp Psychol Anim Behav Process, 10, 90-109. KE, J. J., HO, M. C., CHERNG, C. G., TSAI, Y. P. N., TSAI, C. W. & YU, L. 2008. Ketamine pretreatment exacerbated 3,4-methylenedioxymethamphetamine-induced central dopamine toxicity. Chinese Journal of Physiology, 51, 65-70. KEGELES, L. S., ABI-DARGHAM, A., ZEA-PONCE, Y., RODENHISER-HILL, J., MANN, J. J., VAN HEERTUM, R. L., COOPER, T. B., CARLSSON, A. & LARUELLE, M. 2000a. Modulation of amphetamine-

217

induced striatal dopamine release by ketamine in humans: implications for schizophrenia. Biol Psychiatry, 48, 627-40. KEGELES, L. S., ABI-DARGHAM, A., ZEA-PONCE, Y., RODENHISER-HILL, J., MANN, J. J., VAN HEERTUM, R. L., COOPER, T. B., CARLSSON, A. & LARUELLE, M. 2000b. Modulation of amphetamine- induced striatal dopamine release by ketamine in humans: Implications for schizophrenia. Biological Psychiatry, 48, 627-640. KEGELES, L. S., MARTINEZ, D., KOCHAN, L. D., HWANG, D. R., HUANG, Y., MAWLAWI, O., SUCKOW, R. F., VAN HEERTUM, R. L. & LARUELLE, M. 2002. NMDA antagonist effects on striatal dopamine release: positron emission tomography studies in humans. Synapse, 43, 19-29. KEGELES, L. S., MARTINEZ, D., KOCHAN, L. D., SIMPSON, N., HWANG, U. K., MAWLAWI, O., WEISS, R., PRATAP, M., COOPER, T., MANN, J. J., VAN HEERTUM, R. & LARUELLE, M. 2000c. Mesolimbic and nigrostriatal ketamine-induced dopamine release measured by [C-11]raclopride PET in humans. Journal of Nuclear Medicine, 41, 26p-27p. KEILHOFF, G., BECKER, A., GRECKSCH, G., WOLF, G. & BERNSTEIN, H. G. 2004. Repeated application of ketamine to rats induces changes in the hippocampal expression of parvalbumin, neuronal nitric oxide synthase and cFOS similar to those found in human Schizophrenia. Neuroscience, 126, 591-598. KESNER, R. P. & DAKIS, M. 1993. Phencyclidine disrupts acquisition and retention performance within a spatial continuous recognition memory task. Pharmacol Biochem Behav, 44, 419-24. KEW, J. N. & KEMP, J. A. 2005. Ionotropic and metabotropic glutamate receptor structure and pharmacology. Psychopharmacology (Berl), 179, 4-29. KIM, E., HOWES, O. D. & KAPUR, S. 2013. Molecular imaging as a guide for the treatment of central nervous system disorders. Dialogues Clin Neurosci, 15, 315-28. KIM, S. Y., LEE, H., KIM, H. J., BANG, E., LEE, S. H., LEE, D. W., WOO, D. C., CHOI, C. B., HONG, K. S., LEE, C. & CHOE, B. Y. 2011a. In vivo and ex vivo evidence for ketamine-induced hyperglutamatergic activity in the cerebral cortex of the rat: Potential relevance to schizophrenia. Nmr in Biomedicine, 24, 1235-1242. KIM, S. Y., LEE, H., KIM, H. J., BANG, E., LEE, S. H., LEE, D. W., WOO, D. C., CHOI, C. B., HONG, K. S., LEE, C. & CHOE, B. Y. 2011b. In vivo and ex vivo evidence for ketamine-induced hyperglutamatergic activity in the cerebral cortex of the rat: Potential relevance to schizophrenia. NMR Biomed, 24, 1235-42. KLIMKE, A., LARISCH, R., JANZ, A., VOSBERG, H., MULLER-GARTNER, H. W. & GAEBEL, W. 1999. Dopamine D2 receptor binding before and after treatment of major depression measured by [123I]IBZM SPECT. Psychiatry Res, 90, 91-101. KNOWLTON, B. J., MANGELS, J. A. & SQUIRE, L. R. 1996. A neostriatal habit learning system in humans. Science, 273, 1399-402. KOIKE, H., FUKUMOTO, K., IIJIMA, M. & CHAKI, S. 2013. Role of BDNF/TrkB signaling in antidepressant-like effects of a group II metabotropic glutamate receptor antagonist in animal models of depression. Behav Brain Res, 238, 48-52. KOIKE, H., IIJIMA, M. & CHAKI, S. 2011. Involvement of the mammalian target of rapamycin signaling in the antidepressant-like effect of group II metabotropic glutamate receptor antagonists. Neuropharmacology, 61, 1419-23. KOKKINOU, M., ASHOK, AH. ,HOWES OD. In press. The effects of ketamine on dopaminergic function: meta-analysis and review of the implications for neuropsychiatric disorders. KONRADI, C., YANG, C. K., ZIMMERMAN, E. I., LOHMANN, K. M., GRESCH, P., PANTAZOPOULOS, H., BERRETTA, S. & HECKERS, S. 2011. Hippocampal interneurons are abnormal in schizophrenia. Schizophr Res, 131, 165-73. KOOB, G. F. 1992. Drugs of abuse: anatomy, pharmacology and function of reward pathways. Trends Pharmacol Sci, 13, 177-84.

218

KOSAKA, J., TAKAHASHI, H., ITO, H., TAKANO, A., FUJIMURA, Y., MATSUMOTO, R., NOZAKI, S., YASUNO, F., OKUBO, Y., KISHIMOTO, T. & SUHARA, T. 2010. Decreased binding of [11C]NNC112 and [11C]SCH23390 in patients with chronic schizophrenia. Life Sci, 86, 814-8. KOSAKA, T., KOSAKA, K., HATAGUCHI, Y., NAGATSU, I., WU, J. Y., OTTERSEN, O. P., STORM- MATHISEN, J. & HAMA, K. 1987. Catecholaminergic neurons containing GABA-like and/or glutamic acid decarboxylase-like immunoreactivities in various brain regions of the rat. Exp Brain Res, 66, 191-210. KROOK-MAGNUSON, E. & SOLTESZ, I. 2015. Beyond the hammer and the scalpel: selective circuit control for the epilepsies. Nat Neurosci, 18, 331-8. KRYSTAL, J. H., KARPER, L. P., SEIBYL, J. P., FREEMAN, G. K., DELANEY, R., BREMNER, J. D., HENINGER, G. R., BOWERS, M. B., JR. & CHARNEY, D. S. 1994. Subanesthetic effects of the noncompetitive NMDA antagonist, ketamine, in humans. Psychotomimetic, perceptual, cognitive, and neuroendocrine responses. Arch Gen Psychiatry, 51, 199-214. KUMAKURA, Y. & CUMMING, P. 2009. PET studies of cerebral levodopa metabolism: a review of clinical findings and modeling approaches. Neuroscientist, 15, 635-50. KUMAKURA, Y., CUMMING, P., VERNALEKEN, I., BUCHHOLZ, H. G., SIESSMEIER, T., HEINZ, A., KIENAST, T., BARTENSTEIN, P. & GRUNDER, G. 2007. Elevated [18F]fluorodopamine turnover in brain of patients with schizophrenia: an [18F]fluorodopa/positron emission tomography study. J Neurosci, 27, 8080-7. KUMARI, V., COTTER, P. A., MULLIGAN, O. F., CHECKLEY, S. A., GRAY, N. S., HEMSLEY, D. R., THORNTON, J. C., CORR, P. J., TOONE, B. K. & GRAY, J. A. 1999. Effects of d-amphetamine and haloperidol on latent inhibition in healthy male volunteers. J Psychopharmacol, 13, 398- 405. KYONO, K., TAKASHIMA, T., KATAYAMA, Y., KAWASAKI, T., ZOCHI, R., GOUDA, M., KUWAHARA, Y., TAKAHASHI, K., WADA, Y., ONOE, H. & WATANABE, Y. 2011. Use of [18F]FDOPA-PET for in vivo evaluation of dopaminergic dysfunction in unilaterally 6-OHDA-lesioned rats. EJNMMI Res, 1, 25. LAHTI, A. C., KOFFEL, B., LAPORTE, D. & TAMMINGA, C. A. 1995. Subanesthetic doses of ketamine stimulate psychosis in schizophrenia. Neuropsychopharmacology, 13, 9-19. LAHTI, A. C., WARFEL, D., MICHAELIDIS, T., WEILER, M. A., FREY, K. & TAMMINGA, C. A. 2001. Long- term outcome of patients who receive ketamine during research. Biol Psychiatry, 49, 869-75. LALLY, N., NUGENT, A. C., LUCKENBAUGH, D. A., AMELI, R., ROISER, J. P. & ZARATE, C. A. 2014. Anti- anhedonic effect of ketamine and its neural correlates in treatment-resistant bipolar depression. Transl Psychiatry, 4, e469. LAMMEL, S., STEINBERG, E. E., FOLDY, C., WALL, N. R., BEIER, K., LUO, L. & MALENKA, R. C. 2015. Diversity of transgenic mouse models for selective targeting of midbrain dopamine neurons. Neuron, 85, 429-38. LAPIN, I. P. & ROGAWSKI, M. A. 1995. Effects of D1 and D2 dopamine receptor antagonists and catecholamine depleting agents on the locomotor stimulation induced by dizocilpine in mice. Behav Brain Res, 70, 145-51. LARUELLE, M. 2000. Imaging synaptic neurotransmission with in vivo binding competition techniques: a critical review. J Cereb Blood Flow Metab, 20, 423-51. LARUELLE, M., ABI-DARGHAM, A., GIL, R., KEGELES, L. & INNIS, R. 1999. Increased dopamine transmission in schizophrenia: relationship to illness phases. Biol Psychiatry, 46, 56-72. LARUELLE, M., ABI-DARGHAM, A., VAN DYCK, C. H., GIL, R., D'SOUZA, C. D., ERDOS, J., MCCANCE, E., ROSENBLATT, W., FINGADO, C., ZOGHBI, S. S., BALDWIN, R. M., SEIBYL, J. P., KRYSTAL, J. H., CHARNEY, D. S. & INNIS, R. B. 1996. Single photon emission computerized tomography imaging of amphetamine-induced dopamine release in drug-free schizophrenic subjects. Proc Natl Acad Sci U S A, 93, 9235-40.

219

LERANTH, C., ROTH, R. H., ELSWORTH, J. D., NAFTOLIN, F., HORVATH, T. L. & REDMOND, D. E., JR. 2000. Estrogen is essential for maintaining nigrostriatal dopamine neurons in primates: implications for Parkinson's disease and memory. J Neurosci, 20, 8604-9. LEVIEL, V., GOBERT, A. & GUIBERT, B. 1990. The glutamate-mediated release of dopamine in the rat striatum: further characterization of the dual excitatory-inhibitory function. Neuroscience, 39, 305-12. LEVITA, L., DALLEY, J. W. & ROBBINS, T. W. 2002. Nucleus accumbens dopamine and learned fear revisited: a review and some new findings. Behav Brain Res, 137, 115-27. LI, B., LIU, M. L., WU, X. P., JIA, J., CAO, J., WEI, Z. W. & WANG, Y. J. 2015a. Effects of ketamine exposure on dopamine concentrations and dopamine type 2 receptor mRNA expression in rat brain tissue. Int J Clin Exp Med, 8, 11181-7. LI, L. & VLISIDES, P. E. 2016. Ketamine: 50 Years of Modulating the Mind. Front Hum Neurosci, 10, 612. LI, Y., ZHU, Z. R., OU, B. C., WANG, Y. Q., TAN, Z. B., DENG, C. M., GAO, Y. Y., TANG, M., SO, J. H., MU, Y. L. & ZHANG, L. Q. 2015b. Dopamine D2/D3 but not dopamine D1 receptors are involved in the rapid antidepressant-like effects of ketamine in the forced swim test. Behav Brain Res, 279, 100-5. LINDEFORS, N., BARATI, S. & O'CONNOR, W. T. 1997a. Differential effects of single and repeated ketamine administration on dopamine, serotonin and GABA transmission in rat medial prefrontal cortex. Brain Res, 759, 205-12. LINDEFORS, N., BARATI, S. & OCONNOR, W. T. 1997b. Differential effects of single and repeated ketamine administration on dopamine, serotonin and GABA transmission in rat medial prefrontal cortex. Brain Research, 759, 205-212. LISMAN, J. E., COYLE, J. T., GREEN, R. W., JAVITT, D. C., BENES, F. M., HECKERS, S. & GRACE, A. A. 2008. Circuit-based framework for understanding neurotransmitter and risk gene interactions in schizophrenia. Trends Neurosci, 31, 234-42. LITTLEWOOD, C. L., JONES, N., O'NEILL, M. J., MITCHELL, S. N., TRICKLEBANK, M. & WILLIAMS, S. C. 2006a. Mapping the central effects of ketamine in the rat using pharmacological MRI. Psychopharmacology (Berl), 186, 64-81. LITTLEWOOD, C. L., JONES, N., O'NEILL, M. J., MITCHELL, S. N., TRICKLEBANK, M. & WILLIAMS, S. C. R. 2006b. Mapping the central effects of ketamine in the rat using pharmacological MRI. Psychopharmacology, .186, pp. LIVAK, K. J. & SCHMITTGEN, T. D. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods, 25, 402-8. LODGE, D. J. & GRACE, A. A. 2006. The hippocampus modulates dopamine neuron responsivity by regulating the intensity of phasic neuron activation. Neuropsychopharmacology, 31, 1356- 61. LORRAIN, D. S., BACCEI, C. S., BRISTOW, L. J., ANDERSON, J. J. & VARNEY, M. A. 2003. Effects of ketamine and N-methyl-D-aspartate on glutamate and dopamine release in the rat prefrontal cortex: Modulation by a group II selective metabotropic glutamate receptor agonist LY379268. Neuroscience, 117, 697-706. LU, Z. L. & HULME, E. C. 1999. The functional topography of transmembrane domain 3 of the M1 muscarinic acetylcholine receptor, revealed by scanning mutagenesis. J Biol Chem, 274, 7309-15. LUBOW, R. E. 1973. Latent inhibition. Psychol Bull, 79, 398-407. LUBOW, R. E. & GEWIRTZ, J. C. 1995. Latent inhibition in humans: data, theory, and implications for schizophrenia. Psychol Bull, 117, 87-103. LUDOLPH, A. G., KASSUBEK, J., SCHMECK, K., GLASER, C., WUNDERLICH, A., BUCK, A. K., RESKE, S. N., FEGERT, J. M. & MOTTAGHY, F. M. 2008. Dopaminergic dysfunction in attention deficit hyperactivity disorder (ADHD), differences between pharmacologically treated and never

220

treated young adults: a 3,4-dihdroxy-6-[18F]fluorophenyl-l-alanine PET study. Neuroimage, 41, 718-27. LUSCHER, C. & UNGLESS, M. A. 2006. The mechanistic classification of addictive drugs. PLoS Med, 3, e437. MACLAREN, D. A., BROWNE, R. W. & SHAW, J. K. 2016. Clozapine N-Oxide Administration Produces Behavioral Effects in Long-Evans Rats: Implications for Designing DREADD Experiments. 3. MADDOX, V. H., GODEFROI, E. F. & PARCELL, R. F. 1965. THE SYNTHESIS OF PHENCYCLIDINE AND OTHER 1-ARYLCYCLOHEXYLAMINES. J Med Chem, 8, 230-5. MAHLER, S. V., VAZEY, E. M., BECKLEY, J. T., KEISTLER, C. R., MCGLINCHEY, E. M., KAUFLING, J. & WILSON, S. P. 2014. Designer receptors show role for ventral pallidum input to ventral tegmental area in cocaine seeking. 17, 577-85. MALHOTRA, A. K., PINALS, D. A., WEINGARTNER, H., SIROCCO, K., MISSAR, C. D., PICKAR, D. & BREIER, A. 1996. NMDA receptor function and human cognition: the effects of ketamine in healthy volunteers. Neuropsychopharmacology, 14, 301-7. MANDELKERN, M. & RAINES, J. 2002. Positron emission tomography in cancer research and treatment. Technol Cancer Res Treat, 1, 423-39. MARTINOT, M., BRAGULAT, V., ARTIGES, E., DOLLE, F., HINNEN, F., JOUVENT, R. & MARTINOT, J. 2001. Decreased presynaptic dopamine function in the left caudate of depressed patients with affective flattening and psychomotor retardation. Am J Psychiatry, 158, 314-6. MASUZAWA, M., NAKAO, S., MIYAMOTO, E., YAMADA, M., MURAO, K., NISHI, K. & SHINGU, K. 2003a. Pentobarbital inhibits ketamine-induced dopamine release in the rat nucleus accumbens: a microdialysis study. Anesth Analg, 96, 148-52, table of contents. MASUZAWA, M., NAKAO, S., MIYAMOTO, E., YAMADA, M., MURAO, K., NISHI, K. & SHINGU, K. 2003b. Pentobarbital inhibits ketamine-induced dopamine release in the rat nucleus accumbens: A microdialysis study. Anesthesia and Analgesia, 96, 148-152. MATSUMURA, A., MIZOKAWA, S., TANAKA, M., WADA, Y., NOZAKI, S., NAKAMURA, F., SHIOMI, S., OCHI, H. & WATANABE, Y. 2003. Assessment of microPET performance in analyzing the rat brain under different types of anesthesia: comparison between quantitative data obtained with microPET and ex vivo autoradiography. Neuroimage, 20, 2040-50. MCCOWN, T. J., MUELLER, R. A. & BREESE, G. R. 1983. Effects of anesthetics and electrical stimulation on nigrostriatal dopaminergic neurons. J Pharmacol Exp Ther, 224, 489-93. MCNALLY, J. M., MCCARLEY, R. W. & BROWN, R. E. 2013. Chronic Ketamine Reduces the Peak Frequency of Gamma Oscillations in Mouse Prefrontal Cortex Ex vivo. Front Psychiatry, 4, 106. MEIL, W. M., ROLL, J. M., GRIMM, J. W., LYNCH, A. M. & SEE, R. E. 1995. Tolerance-like attenuation to contingent and noncontingent cocaine-induced elevation of extracellular dopamine in the ventral striatum following 7 days of withdrawal from chronic treatment. Psychopharmacology (Berl), 118, 338-46. MELCHER, C. L. 2000. Scintillation crystals for PET. J Nucl Med, 41, 1051-5. MELCHER, C. L., SCHWITZER, J. S. 1992. Cerium-doped Lutetium Oxyorthosilicate: A Fast, Efficient New Scintillator IEEE TRANSACTIONS ON NUCLEAR SCIENCE, 39. MEYER-LINDENBERG, A., MILETICH, R. S., KOHN, P. D., ESPOSITO, G., CARSON, R. E., QUARANTELLI, M., WEINBERGER, D. R. & BERMAN, K. F. 2002. Reduced prefrontal activity predicts exaggerated striatal dopaminergic function in schizophrenia. Nat Neurosci, 5, 267-71. MEYER, J. H., GINOVART, N., BOOVARIWALA, A., SAGRATI, S., HUSSEY, D., GARCIA, A., YOUNG, T., PRASCHAK-RIEDER, N., WILSON, A. A. & HOULE, S. 2006. Elevated monoamine oxidase a levels in the brain: an explanation for the monoamine imbalance of major depression. Arch Gen Psychiatry, 63, 1209-16. MEYER, J. H., KRUGER, S., WILSON, A. A., CHRISTENSEN, B. K., GOULDING, V. S., SCHAFFER, A., MINIFIE, C., HOULE, S., HUSSEY, D. & KENNEDY, S. H. 2001. Lower dopamine transporter binding potential in striatum during depression. Neuroreport, 12, 4121-5.

221

MICHELETTI, G., LANNES, B., HABY, C., BORRELLI, E., KEMPF, E., WARTER, J. M. & ZWILLER, J. 1992. Chronic Administration of Nmda Antagonists Induces D2 Receptor Synthesis in Rat Striatum. Molecular Brain Research, 14, 363-368. MICKLEY, G. A., HOXHA, Z., DISORBO, A., WILSON, G. N., REMUS, J. L., BIESAN, O., KETCHESIN, K. D., RAMOS, L., LUCHSINGER, J. R., PRODAN, S., ROGERS, M., WILES, N. R. & HOXHA, N. 2014. Latent inhibition of a conditioned taste aversion in fetal rats. Dev Psychobiol, 56, 435-47. MILLER, D. W. & ABERCROMBIE, E. D. 1996. Effects of MK-801 on spontaneous and amphetamine- stimulated dopamine release in striatum measured with in vivo microdialysis in awake rats. Brain Res Bull, 40, 57-62. MOGHADDAM, B., ADAMS, B., VERMA, A. & DALY, D. 1997a. Activation of glutamatergic neurotransmission by ketamine: A novel step in the pathway from NMDA receptor blockade to dopaminergic and cognitive disruptions associated with the prefrontal cortex. Journal of Neuroscience, 17, 2921-2927. MOGHADDAM, B., ADAMS, B., VERMA, A. & DALY, D. 1997b. Activation of glutamatergic neurotransmission by ketamine: a novel step in the pathway from NMDA receptor blockade to dopaminergic and cognitive disruptions associated with the prefrontal cortex. J Neurosci, 17, 2921-7. MOGHADDAM, B. & BUNNEY, B. S. 1989. Differential effect of cocaine on extracellular dopamine levels in rat medial prefrontal cortex and nucleus accumbens: comparison to amphetamine. Synapse, 4, 156-61. MONAGHAN, D. T. & COTMAN, C. W. 1986. Identification and properties of N-methyl-D-aspartate receptors in rat brain synaptic plasma membranes. Proc Natl Acad Sci U S A, 83, 7532-6. MONTE, A. S., DE SOUZA, G. C., MCINTYRE, R. S., SOCZYNSKA, J. K., DOS SANTOS, J. V., CORDEIRO, R. C., RIBEIRO, B. M., DE LUCENA, D. F., VASCONCELOS, S. M., DE SOUSA, F. C., CARVALHO, A. F. & MACEDO, D. S. 2013. Prevention and reversal of ketamine-induced schizophrenia related behavior by minocycline in mice: Possible involvement of antioxidant and nitrergic pathways. J Psychopharmacol, 27, 1032-43. MORGAN, C. J. & CURRAN, H. V. 2006. Acute and chronic effects of ketamine upon human memory: a review. Psychopharmacology (Berl), 188, 408-24. MORGAN, C. J. & CURRAN, H. V. 2012. Ketamine use: a review. Addiction, 107, 27-38. MORGAN, C. J. A., REES, H. & CURRAN, H. V. 2008. Attentional bias to incentive stimuli in frequent ketamine users. Psychological Medicine, 38, 1331-1340. MOSER, P. C., HITCHCOCK, J. M., LISTER, S. & MORAN, P. M. 2000. The pharmacology of latent inhibition as an animal model of schizophrenia. Brain Res Brain Res Rev, 33, 275-307. MULLER, J., PENTYALA, S., DILGER, J. & PENTYALA, S. 2016. Ketamine enantiomers in the rapid and sustained antidepressant effects. Ther Adv Psychopharmacol, 6, 185-92. MURA, A., JACKSON, D., MANLEY, M. S., YOUNG, S. J. & GROVES, P. M. 1995. Aromatic L-amino acid decarboxylase immunoreactive cells in the rat striatum: a possible site for the conversion of exogenous L-DOPA to dopamine. Brain Res, 704, 51-60. NAGAI, T., MCGEER, P. L. & MCGEER, E. G. 1983. Distribution of GABA-T-intensive neurons in the rat forebrain and midbrain. J Comp Neurol, 218, 220-38. NARENDRAN, R., FRANKLE, W. G., KEEFE, R., GIL, R., MARTINEZ, D., SLIFSTEIN, M., KEGELES, L. S., TALBOT, P. S., HUANG, Y., HWANG, D.-R., KHENISSI, L., COOPER, T. B., LARUELLE, M. & ABI- DARGHAM, A. 2005. Altered prefrontal dopaminergic function in chronic recreational ketamine users. The American Journal of Psychiatry, .162, pp. NAWARATNE, V., LEACH, K., SURATMAN, N., LOIACONO, R. E., FELDER, C. C., ARMBRUSTER, B. N., ROTH, B. L., SEXTON, P. M. & CHRISTOPOULOS, A. 2008. New insights into the function of M4 muscarinic acetylcholine receptors gained using a novel allosteric modulator and a DREADD (designer receptor exclusively activated by a designer drug). Mol Pharmacol, 74, 1119-31.

222

NEUBIG, R. R., SPEDDING, M., KENAKIN, T. & CHRISTOPOULOS, A. 2003. International Union of Pharmacology Committee on Receptor Nomenclature and Drug Classification. XXXVIII. Update on terms and symbols in quantitative pharmacology. Pharmacol Rev, 55, 597-606. NEWPORT, D. J., CARPENTER, L. L., MCDONALD, W. M., POTASH, J. B., TOHEN, M. & NEMEROFF, C. B. 2015. Ketamine and Other NMDA Antagonists: Early Clinical Trials and Possible Mechanisms in Depression. Am J Psychiatry, 172, 950-66. NODA, A., TAKAMATSU, H., MINOSHIMA, S., TSUKADA, H. & NISHIMURA, S. 2003. Determination of kinetic rate constants for 2-[18F]fluoro-2-deoxy-D-glucose and partition coefficient of water in conscious macaques and alterations in aging or anesthesia examined on parametric images with an anatomic standardization technique. J Cereb Blood Flow Metab, 23, 1441-7. O'LOINSIGH, E. D., BOLAND, G., KELLY, J. P. & O'BOYLE, K. M. 2001. Behavioural, hyperthermic and neurotoxic effects of 3,4-methylenedioxymethamphetamine analogues in the Wistar rat. Prog Neuropsychopharmacol Biol Psychiatry, 25, 621-38. OKUBO, Y., SUHARA, T., SUZUKI, K., KOBAYASHI, K., INOUE, O., TERASAKI, O., SOMEYA, Y., SASSA, T., SUDO, Y., MATSUSHIMA, E., IYO, M., TATENO, Y. & TORU, M. 1997. Decreased prefrontal dopamine D1 receptors in schizophrenia revealed by PET. Nature, 385, 634-6. OLARTE-SANCHEZ, C. M., VALENCIA-TORRES, L., CASSADAY, H. J., BRADSHAW, C. M. & SZABADI, E. 2015. Quantitative analysis of performance on a progressive-ratio schedule: effects of reinforcer type, food deprivation and acute treatment with Delta(9)-tetrahydrocannabinol (THC). Behav Processes, 113, 122-31. OLNEY, J. W. & FARBER, N. B. 1995. Glutamate receptor dysfunction and schizophrenia. Arch Gen Psychiatry, 52, 998-1007. ONOE, H., INOUE, O., SUZUKI, K., TSUKADA, H., ITOH, T., MATAGA, N. & WATANABE, Y. 1994. Ketamine Increases the Striatal N-[C-11]Methylspiperone Binding in-Vivo - Positron Emission Tomography Study Using Conscious Rhesus-Monkey. Brain Research, 663, 191-198. OPACKA-JUFFRY, J., AHIER, R. G. & CREMER, J. E. 1991. Nomifensine-induced increase in extracellular striatal dopamine is enhanced by isoflurane anaesthesia. Synapse, 7, 169-71. ORDWAY, G. A., SMITH, K. S. & HAYCOCK, J. W. 1994. Elevated tyrosine hydroxylase in the locus coeruleus of suicide victims. J Neurochem, 62, 680-5. OYE, I., PAULSEN, O. & MAURSET, A. 1992. Effects of ketamine on sensory perception: evidence for a role of N-methyl-D-aspartate receptors. J Pharmacol Exp Ther, 260, 1209-13. PARSEY, R. V., OQUENDO, M. A., ZEA-PONCE, Y., RODENHISER, J., KEGELES, L. S., PRATAP, M., COOPER, T. B., VAN HEERTUM, R., MANN, J. J. & LARUELLE, M. 2001. Dopamine D(2) receptor availability and amphetamine-induced dopamine release in unipolar depression. Biol Psychiatry, 50, 313-22. PATEL, V. D., LEE, D. E., ALEXOFF, D. L., DEWEY, S. L. & SCHIFFER, W. K. 2008. Imaging dopamine release with Positron Emission Tomography (PET) and (11)C-raclopride in freely moving animals. Neuroimage, 41, 1051-66. PATLAK, C. S. & BLASBERG, R. G. 1985. Graphical evaluation of blood-to-brain transfer constants from multiple-time uptake data. Generalizations. J Cereb Blood Flow Metab, 5, 584-90. PATLAK, C. S., BLASBERG, R. G. & FENSTERMACHER, J. D. 1983. Graphical evaluation of blood-to- brain transfer constants from multiple-time uptake data. J Cereb Blood Flow Metab, 3, 1-7. PAXINOS G., F. K. B. J. 2013. Paxinos and Franklin's the Mouse Brain in Stereotaxic Coordinates. Academic Press. PECINA, S., CAGNIARD, B., BERRIDGE, K. C., ALDRIDGE, J. W. & ZHUANG, X. 2003. Hyperdopaminergic mutant mice have higher "wanting" but not "liking" for sweet rewards. J Neurosci, 23, 9395- 402. PEI, Y., ROGAN, S. C., YAN, F. & ROTH, B. L. 2008. Engineered GPCRs as tools to modulate signal transduction. Physiology (Bethesda), 23, 313-21. PERALA, J., SUVISAARI, J., SAARNI, S. I., KUOPPASALMI, K., ISOMETSA, E., PIRKOLA, S., PARTONEN, T., TUULIO-HENRIKSSON, A., HINTIKKA, J., KIESEPPA, T., HARKANEN, T., KOSKINEN, S. &

223

LONNQVIST, J. 2007. Lifetime prevalence of psychotic and bipolar I disorders in a general population. Arch Gen Psychiatry, 64, 19-28. PEZZE, M. A. & FELDON, J. 2004. Mesolimbic dopaminergic pathways in fear conditioning. Prog Neurobiol, 74, 301-20. PHILLIPS, M., WANG, C. & JOHNSON, K. M. 2001. Pharmacological characterization of locomotor sensitization induced by chronic phencyclidine administration. J Pharmacol Exp Ther, 296, 905-13. PILOWSKY, L. S., BRESSAN, R. A., STONE, J. M., ERLANDSSON, K., MULLIGAN, R. S., KRYSTAL, J. H. & ELL, P. J. 2006. First in vivo evidence of an NMDA receptor deficit in medication-free schizophrenic patients. Mol Psychiatry, 11, 118-9. PIRMOHAMED, M., WILLIAMS, D., MADDEN, S., TEMPLETON, E. & PARK, B. K. 1995. Metabolism and bioactivation of clozapine by human liver in vitro. J Pharmacol Exp Ther, 272, 984-90. POGARELL, O., KOCH, W., KARCH, S., DEHNING, S., MULLER, N., TATSCH, K., POEPPERL, G. & MOLLER, H. J. 2012. Dopaminergic neurotransmission in patients with schizophrenia in relation to positive and negative symptoms. Pharmacopsychiatry, 45 Suppl 1, S36-41. POWELL, C. M. & MIYAKAWA, T. 2006. Schizophrenia-relevant behavioral testing in rodent models: a uniquely human disorder? Biol Psychiatry, 59, 1198-207. PRUT, L. & BELZUNG, C. 2003. The open field as a paradigm to measure the effects of drugs on anxiety-like behaviors: a review. Eur J Pharmacol, 463, 3-33. RAINEY, J. M., JR. & CROWDER, M. K. 1975. Prolonged psychosis attributed to phencyclidine: report of three cases. Am J Psychiatry, 132, 1076-8. RAPER, J., MORRISON, R. D., DANIELS, J. S., HOWELL, L., BACHEVALIER, J., WICHMANN, T. & GALVAN, A. 2017. Metabolism and Distribution of Clozapine-N-oxide: Implications for Nonhuman Primate Chemogenetics. 8, 1570-1576. RAZOUX, F., GARCIA, R. & LENA, I. 2007. Ketamine, at a dose that disrupts motor behavior and latent inhibition, enhances prefrontal cortex synaptic efficacy and glutamate release in the nucleus accumbens. Neuropsychopharmacology, 32, 719-27. REITH, J., DYVE, S., KUWABARA, H., GUTTMAN, M., DIKSIC, M. & GJEDDE, A. 1990. Blood-brain transfer and metabolism of 6-[18F]fluoro-L-dopa in rat. J Cereb Blood Flow Metab, 10, 707- 19. RESENDEZ, S. L., JENNINGS, J. H., UNG, R. L., NAMBOODIRI, V. M., ZHOU, Z. C., OTIS, J. M., NOMURA, H., MCHENRY, J. A., KOSYK, O. & STUBER, G. D. 2016. Visualization of cortical, subcortical and deep brain neural circuit dynamics during naturalistic mammalian behavior with head- mounted microscopes and chronically implanted lenses. Nat Protoc, 11, 566-97. REYNOLDS, G. P., ZHANG, Z. J. & BEASLEY, C. L. 2001. Neurochemical correlates of cortical GABAergic deficits in schizophrenia: selective losses of calcium binding protein immunoreactivity. Brain Res Bull, 55, 579-84. RICCARDI, P., LI, R., ANSARI, M. S., ZALD, D., PARK, S., DAWANT, B., ANDERSON, S., DOOP, M., WOODWARD, N., SCHOENBERG, E., SCHMIDT, D., BALDWIN, R. & KESSLER, R. 2006. Amphetamine-induced displacement of [18F] fallypride in striatum and extrastriatal regions in humans. Neuropsychopharmacology, 31, 1016-26. RICHARDSON, N. R. & ROBERTS, D. C. 1996. Progressive ratio schedules in drug self-administration studies in rats: a method to evaluate reinforcing efficacy. J Neurosci Methods, 66, 1-11. ROBBINS, T. W. & EVERITT, B. J. 1996. Neurobehavioural mechanisms of reward and motivation. Curr Opin Neurobiol, 6, 228-36. ROBINSON, D. L., VENTON, B. J., HEIEN, M. L. & WIGHTMAN, R. M. 2003. Detecting subsecond dopamine release with fast-scan cyclic voltammetry in vivo. Clin Chem, 49, 1763-73. ROBINSON, T. E. & BERRIDGE, K. C. 1993. The neural basis of drug craving: an incentive-sensitization theory of addiction. Brain Res Brain Res Rev, 18, 247-91. ROBINSON, T. E., JURSON, P. A., BENNETT, J. A. & BENTGEN, K. M. 1988. Persistent sensitization of dopamine neurotransmission in ventral striatum (nucleus accumbens) produced by prior

224

experience with (+)-amphetamine: a microdialysis study in freely moving rats. Brain Res, 462, 211-22. ROMERO-ALEJO, E., PUIG, M. M. & ROMERO, A. 2016. Inhibition of astrocyte activation is involved in the prevention of postoperative latent pain sensitization by ketamine and gabapentin in mice. J Pharmacol Pharmacother, 7, 22-4. ROSA, A. O., LIN, J., CALIXTO, J. B., SANTOS, A. R. & RODRIGUES, A. L. 2003. Involvement of NMDA receptors and L-arginine-nitric oxide pathway in the antidepressant-like effects of zinc in mice. Behav Brain Res, 144, 87-93. ROSS, M. W., MATTISON, A. M. & FRANKLIN, D. R., JR. 2003. Club drugs and sex on drugs are associated with different motivations for gay circuit party attendance in men. Subst Use Misuse, 38, 1173-83. ROTHMAN, D. L., BEHAR, K. L., HYDER, F. & SHULMAN, R. G. 2003. In vivo NMR studies of the glutamate neurotransmitter flux and neuroenergetics: implications for brain function. Annu Rev Physiol, 65, 401-27. ROWLAND, L. M., BUSTILLO, J. R., MULLINS, P. G., JUNG, R. E., LENROOT, R., LANDGRAF, E., BARROW, R., YEO, R., LAURIELLO, J. & BROOKS, W. M. 2005. Effects of ketamine on anterior cingulate glutamate metabolism in healthy humans: a 4-T proton MRS study. Am J Psychiatry, 162, 394-6. RUSH, A. J., TRIVEDI, M. H., WISNIEWSKI, S. R., NIERENBERG, A. A., STEWART, J. W., WARDEN, D., NIEDEREHE, G., THASE, M. E., LAVORI, P. W., LEBOWITZ, B. D., MCGRATH, P. J., ROSENBAUM, J. F., SACKEIM, H. A., KUPFER, D. J., LUTHER, J. & FAVA, M. 2006. Acute and longer-term outcomes in depressed outpatients requiring one or several treatment steps: a STAR*D report. Am J Psychiatry, 163, 1905-17. SALAMONE, J. D. & CORREA, M. 2012. The mysterious motivational functions of mesolimbic dopamine. Neuron, 76, 470-85. SANACORA, G. 2017. Ketamine for the Treatment of Depression-Reply. JAMA Psychiatry. SANACORA, G., FRYE, M. A., MCDONALD, W., MATHEW, S. J., TURNER, M. S., SCHATZBERG, A. F., SUMMERGRAD, P. & NEMEROFF, C. B. 2017. A Consensus Statement on the Use of Ketamine in the Treatment of Mood Disorders. JAMA Psychiatry, 74, 399-405. SANACORA, G., GUEORGUIEVA, R., EPPERSON, C. N., WU, Y. T., APPEL, M., ROTHMAN, D. L., KRYSTAL, J. H. & MASON, G. F. 2004. Subtype-specific alterations of gamma-aminobutyric acid and glutamate in patients with major depression. Arch Gen Psychiatry, 61, 705-13. SANDHU EC., F. A., IRVINE EE., TOSSELL K., KOKKINOU M., GLEGOLA J., SMITH MA., HOWES OD., WITHERS DJ., UNGLESS MA. In review. Phasic stimulation of midbrain dopamine neuron activity reduces salt consumption SCHULTZ, W. 2002. Getting formal with dopamine and reward. Neuron, 36, 241-63. SCOFIELD, M. D., HEINSBROEK, J. A., GIPSON, C. D., KUPCHIK, Y. M., SPENCER, S., SMITH, A. C., ROBERTS-WOLFE, D. & KALIVAS, P. W. 2016. The Nucleus Accumbens: Mechanisms of Addiction across Drug Classes Reflect the Importance of Glutamate Homeostasis. Pharmacol Rev, 68, 816-71. SEEMAN, P., KO, F. & TALLERICO, T. 2005. Dopamine receptor contribution to the action of PCP, LSD and ketamine psychotomimetics. Mol Psychiatry, 10, 877-83. SEGAL, D. S. & KUCZENSKI, R. 1992. Repeated cocaine administration induces behavioral sensitization and corresponding decreased extracellular dopamine responses in caudate and accumbens. Brain Res, 577, 351-5. SELVARAJ, S., ARNONE, D., CAPPAI, A. & HOWES, O. 2014. Alterations in the serotonin system in schizophrenia: a systematic review and meta-analysis of postmortem and molecular imaging studies. Neurosci Biobehav Rev, 45, 233-45. SESACK, S. R., HAWRYLAK, V. A., MATUS, C., GUIDO, M. A. & LEVEY, A. I. 1998. Dopamine axon varicosities in the prelimbic division of the rat prefrontal cortex exhibit sparse immunoreactivity for the dopamine transporter. J Neurosci, 18, 2697-708.

225

SHAH, P. J., OGILVIE, A. D., GOODWIN, G. M. & EBMEIER, K. P. 1997. Clinical and psychometric correlates of dopamine D2 binding in depression. Psychol Med, 27, 1247-56. SIMPSON, E. H., KELLENDONK, C., WARD, R. D., RICHARDS, V., LIPATOVA, O., FAIRHURST, S., KANDEL, E. R. & BALSAM, P. D. 2011. Pharmacologic rescue of motivational deficit in an animal model of the negative symptoms of schizophrenia. Biol Psychiatry, 69, 928-35. SIMPSON, E. H., WALTZ, J. A., KELLENDONK, C. & BALSAM, P. D. 2012. Schizophrenia in translation: dissecting motivation in schizophrenia and rodents. Schizophr Bull, 38, 1111-7. SINGH, J. B., FEDGCHIN, M., DALY, E., XI, L., MELMAN, C., DE BRUECKER, G., TADIC, A., SIENAERT, P., WIEGAND, F., MANJI, H., DREVETS, W. C. & VAN NUETEN, L. 2016. Intravenous Esketamine in Adult Treatment-Resistant Depression: A Double-Blind, Double-Randomization, Placebo- Controlled Study. Biol Psychiatry, 80, 424-31. SMITH, G. S., SCHLOESSER, R., BRODIE, J. D., DEWEY, S. L., LOGAN, J., VITKUN, S. A., SIMKOWITZ, P., HURLEY, A., COOPER, T., VOLKOW, N. D. & CANCRO, R. 1998a. Glutamate modulation of dopamine measured in vivo with positron emission tomography (PET) and 11C-raclopride in normal human subjects. Neuropsychopharmacology, 18, 18-25. SMITH, G. S., SCHLOESSER, R., BRODIE, J. D., DEWEY, S. L., LOGAN, J., VITKUN, S. A., SIMKOWITZ, P., HURLEY, A., COOPER, T., VOLKOW, N. D. & CANCRO, R. 1998b. Glutamate modulation of dopamine measured in vivo with positron emission tomography (PET) and 11C-raclopride in normal human subjects. Jan 1998. Neuropsychopharmacology, .18, pp. SMITH, G. S., SCHLOESSER, R., BRODIE, J. D., DEWEY, S. L., LOGAN, J., VITKUN, S. A., SIMKOWITZ, P., HURLEY, A., COOPER, T., VOLKOW, N. D. & CANCRO, R. 1998c. Glutamate modulation of dopamine measured in vivo with positron emission tomography (PET) and C-11-raclopride in normal human subjects. Neuropsychopharmacology, 18, 18-25. SMITH, K. S., BERRIDGE, K. C. & ALDRIDGE, J. W. 2011. Disentangling pleasure from incentive salience and learning signals in brain reward circuitry. Proc Natl Acad Sci U S A, 108, E255-64. SNOW, B. J., TOOYAMA, I., MCGEER, E. G., YAMADA, T., CALNE, D. B., TAKAHASHI, H. & KIMURA, H. 1993. Human positron emission tomographic [18F]fluorodopa studies correlate with dopamine cell counts and levels. Ann Neurol, 34, 324-30. SOLOMON, P. R., CRIDER, A., WINKELMAN, J. W., TURI, A., KAMER, R. M. & KAPLAN, L. J. 1981. Disrupted latent inhibition in the rat with chronic amphetamine or haloperidol-induced supersensitivity: relationship to schizophrenic attention disorder. Biol Psychiatry, 16, 519-37. SORCE, S., SCHIAVONE, S., TUCCI, P., COLAIANNA, M., JAQUET, V., CUOMO, V., DUBOIS-DAUPHIN, M., TRABACE, L. & KRAUSE, K. H. 2010. The NADPH Oxidase NOX2 Controls Glutamate Release: A Novel Mechanism Involved in Psychosis-Like Ketamine Responses. Journal of Neuroscience, 30, 11317-11325. SORG, B. A., DAVIDSON, D. L., KALIVAS, P. W. & PRASAD, B. M. 1997. Repeated daily cocaine alters subsequent cocaine-induced increase of extracellular dopamine in the medial prefrontal cortex. J Pharmacol Exp Ther, 281, 54-61. STEWART, C. E. 2001. Ketamine as a street drug. Emerg Med Serv, 30, 30, 32, 34 passim. STONE, J. M. 2011. Glutamatergic antipsychotic drugs: a new dawn in the treatment of schizophrenia? Ther Adv Psychopharmacol, 1, 5-18. STONE, J. M., DIETRICH, C., EDDEN, R., MEHTA, M. A., DE SIMONI, S., REED, L. J., KRYSTAL, J. H., NUTT, D. & BARKER, G. J. 2012. Ketamine effects on brain GABA and glutamate levels with 1H-MRS: relationship to ketamine-induced psychopathology. Mol Psychiatry, 17, 664-5. STONE, J. M., HOWES, O. D., EGERTON, A., KAMBEITZ, J., ALLEN, P., LYTHGOE, D. J., O'GORMAN, R. L., MCLEAN, M. A., BARKER, G. J. & MCGUIRE, P. 2010. Altered relationship between hippocampal glutamate levels and striatal dopamine function in subjects at ultra high risk of psychosis. Biol Psychiatry, 68, 599-602. STONE, J. M., MORRISON, P. D. & PILOWSKY, L. S. 2007. Glutamate and dopamine dysregulation in schizophrenia--a synthesis and selective review. J Psychopharmacol, 21, 440-52.

226

STONE, J. M., PEPPER, F., FAM, J., FURBY, H., HUGHES, E., MORGAN, C. & HOWES, O. D. 2014. Glutamate, N-acetyl aspartate and psychotic symptoms in chronic ketamine users. Psychopharmacology (Berl), 231, 2107-16. STRONG, C. E., SCHOEPFER, K. J., DOSSAT, A. M., SALAND, S. K., WRIGHT, K. N. & KABBAJ, M. 2017. Locomotor sensitization to intermittent ketamine administration is associated with nucleus accumbens plasticity in male and female rats. Neuropharmacology, 121, 195-203. STURGEON, R. D., FESSLER, R. G., LONDON, S. F. & MELTZER, H. Y. 1981. A comparison of the effects of neuroleptics on phencyclidine-induced behaviors in the rat. Eur J Pharmacol, 76, 37-53. SUZUKI, K., NOSYREVA, E., HUNT, K. W., KAVALALI, E. T. & MONTEGGIA, L. M. 2017. Effects of a ketamine metabolite on synaptic NMDAR function. Nature, 546, E1-e3. SWERDLOW, N. R., BRAFF, D. L., HARTSTON, H., PERRY, W. & GEYER, M. A. 1996. Latent inhibition in schizophrenia. Schizophr Res, 20, 91-103. SZLACHTA, M., PABIAN, P., KUSMIDER, M., SOLICH, J., KOLASA, M., ZURAWEK, D., DZIEDZICKA- WASYLEWSKA, M. & FARON-GORECKA, A. 2017. Effect of clozapine on ketamine-induced deficits in attentional set shift task in mice. Psychopharmacology (Berl), 234, 2103-2112. TAN, S., LAM, W. P., WAI, M. S., YU, W. H. & YEW, D. T. 2012. Chronic ketamine administration modulates midbrain dopamine system in mice. PLoS One, 7, e43947. TOYAMA, H., ICHISE, M., LIOW, J. S., MODELL, K. J., VINES, D. C., ESAKI, T., COOK, M., SEIDEL, J., SOKOLOFF, L., GREEN, M. V. & INNIS, R. B. 2004. Absolute quantification of regional cerebral glucose utilization in mice by 18F-FDG small animal PET scanning and 2-14C-DG autoradiography. J Nucl Med, 45, 1398-405. TRUJILLO, K. A., ZAMORA, J. J. & WARMOTH, K. P. 2008. Increased response to ketamine following treatment at long intervals: implications for intermittent use. Biol Psychiatry, 63, 178-83. TSAKANIKOS, E. 2003. Latent inhibtion and psychometrically defined schizotypy: an experimental investigation. Doctor of Philosophy, University College London, UK. TSUKADA, H., HARADA, N., NISHIYAMA, S., OHBA, H., SATO, K., FUKUMOTO, D. & KAKIUCHI, T. 2000a. Ketamine decreased striatal [(11)C]raclopride binding with no alterations in static dopamine concentrations in the striatal extracellular fluid in the monkey brain: multiparametric PET studies combined with microdialysis analysis. Synapse, 37, 95-103. TSUKADA, H., HARADA, N., NISHIYAMA, S., OHBA, H., SATO, K., FUKUMOTO, D. & KAKIUCHI, T. 2000b. Ketamine decreased striatal [C-11]raclopride binding with no alterations in static dopamine concentrations in the striatal extracellular fluid in the monkey brain: Multiparametric PET studies combined with microdialysis analysis. Synapse, 37, 95-103. TSUKADA, H., NISHIYAMA, S., KAKIUCHI, T., OHBA, H., SATO, K. & HARADA, N. 2001. Ketamine alters the availability of striatal dopamine transporter as measured by [C-11]beta-CFT and [C- 11]beta-CIT-FE in the monkey brain. Synapse, 42, 273-280. TSUKADA, H., NISHIYAMA, S., KAKIUCHI, T., OHBA, H., SATO, K., HARADA, N. & NAKANISHI, S. 1999. Isoflurane anesthesia enhances the inhibitory effects of cocaine and GBR12909 on dopamine transporter: PET studies in combination with microdialysis in the monkey brain. Brain Res, 849, 85-96. UCHIHASHI, Y., KURIBARA, H. & TADOKORO, S. 1992. Assessment of the ambulation-increasing effect of ketamine by coadministration with central-acting drugs in mice. Jpn J Pharmacol, 60, 25- 31. UHL, S., SCHMID, P. & SCHLATTER, C. 1986. Pharmacokinetics of pentachlorophenol in man. Arch Toxicol, 58, 182-6. UNODC, W. D. R. URBAN, D. J. & ROTH, B. L. 2015. DREADDs (designer receptors exclusively activated by designer drugs): chemogenetic tools with therapeutic utility. Annu Rev Pharmacol Toxicol, 55, 399- 417.

227

USUN, Y., EYBRARD, S., MEYER, F. & LOUILOT, A. 2013a. Ketamine increases striatal dopamine release and hyperlocomotion in adult rats after postnatal functional blockade of the prefrontal cortex. Behav Brain Res, 256, 229-37. USUN, Y., EYBRARD, S., MEYER, F. & LOUILOT, A. 2013b. Ketamine increases striatal dopamine release and hyperlocomotion in adult rats after postnatal functional blockade of the prefrontal cortex. Behavioural Brain Research, 256, 229-237. VAISANEN, J., IHALAINEN, J., TANILA, H. & CASTREN, E. 2004. Effects of NMDA-receptor antagonist treatment on c-fos expression in rat brain areas implicated in schizophrenia. Cell Mol Neurobiol, 24, 769-80. VARDY, E., ROBINSON, J. E., LI, C., OLSEN, R. H., DIBERTO, J. F., GIGUERE, P. M., SASSANO, F. M., HUANG, X. P., ZHU, H., URBAN, D. J., WHITE, K. L., RITTINER, J. E., CROWLEY, N. A., PLEIL, K. E., MAZZONE, C. M., MOSIER, P. D., SONG, J., KASH, T. L., MALANGA, C. J., KRASHES, M. J. & ROTH, B. L. 2015. A New DREADD Facilitates the Multiplexed Chemogenetic Interrogation of Behavior. Neuron, 86, 936-46. VERMA, A. & MOGHADDAM, B. 1996a. NMDA receptor antagonists impair prefrontal cortex function as assessed via spatial delayed alternation performance in rats: modulation by dopamine. J Neurosci, 16, 373-9. VERMA, A. & MOGHADDAM, B. 1996b. NMDA receptor antagonists impair prefrontal cortex function as assessed via spatial delayed alternation performance in rats: Modulation by dopamine. Journal of Neuroscience, 16, 373-379. VERNALEKEN, I., KLOMP, M., MOELLER, O., RAPTIS, M., NAGELS, A., ROSCH, F., SCHAEFER, W. M., CUMMING, P. & GRUNDER, G. 2013. Vulnerability to psychotogenic effects of ketamine is associated with elevated D-2/3-receptor availability. International Journal of Neuropsychopharmacology, 16, 745-754. VERNALEKEN, I., KUMAKURA, Y., CUMMING, P., BUCHHOLZ, H. G., SIESSMEIER, T., STOETER, P., MULLER, M. J., BARTENSTEIN, P. & GRUNDER, G. 2006. Modulation of [18F]fluorodopa (FDOPA) kinetics in the brain of healthy volunteers after acute haloperidol challenge. Neuroimage, 30, 1332-9. VEZINA, P. 2004. Sensitization of midbrain dopamine neuron reactivity and the self-administration of psychomotor stimulant drugs. Neurosci Biobehav Rev, 27, 827-39. VINGERHOETS, F. J., SNOW, B.J., SCHULZER, M., MORRISON, S., RUTH, T.J., HOLDEN, J.E., COOPER, S., CALNE D.B. 1994. Reproducibility of fluorine-18-6-fluorodopa positron emission tomography in normal human subjects. . Journal of Nuclear Medicine : Official Publication, Society of Nuclear Medicine, 35, 18-24. VIRDEE, K., CUMMING, P., CAPRIOLI, D., JUPP, B., ROMINGER, A., AIGBIRHIO, F. I., FRYER, T. D., RISS, P. J. & DALLEY, J. W. 2012. Applications of positron emission tomography in animal models of neurological and neuropsychiatric disorders. Neurosci Biobehav Rev, 36, 1188-216. VOLK, D. W., AUSTIN, M. C., PIERRI, J. N., SAMPSON, A. R. & LEWIS, D. A. 2000. Decreased glutamic acid decarboxylase67 messenger RNA expression in a subset of prefrontal cortical gamma- aminobutyric acid neurons in subjects with schizophrenia. Arch Gen Psychiatry, 57, 237-45. VOLKOW, N. D., FOWLER, J. S. & WANG, G. J. 2003. Positron emission tomography and single-photon emission computed tomography in substance abuse research. Semin Nucl Med, 33, 114-28. VOLKOW, N. D., WANG, G. J., TELANG, F., FOWLER, J. S., LOGAN, J., CHILDRESS, A. R., JAYNE, M., MA, Y. & WONG, C. 2006. Cocaine cues and dopamine in dorsal striatum: mechanism of craving in cocaine addiction. J Neurosci, 26, 6583-8. VOLLENWEIDER, F. X., LEENDERS, K. L., SCHARFETTER, C., ANTONINI, A., MAGUIRE, P., MISSIMER, J. & ANGST, J. 1997. Metabolic hyperfrontality and psychopathology in the ketamine model of psychosis using positron emission tomography (PET) and [18F]fluorodeoxyglucose (FDG). Eur Neuropsychopharmacol, 7, 9-24. VOLLENWEIDER, F. X., VONTOBEL, P., OYE, I., HELL, D. & LEENDERS, K. L. 2000a. Effects of (S)- ketamine on striatal dopamine: A. Journal of Psychiatric Research, .34, pp.

228

VOLLENWEIDER, F. X., VONTOBEL, P., OYE, I., HELL, D. & LEENDERS, K. L. 2000b. Effects of (S)- ketamine on striatal dopamine: a [11C]raclopride PET study of a model psychosis in humans. J Psychiatr Res, 34, 35-43. WALI, B., ISHRAT, T., WON, S., STEIN, D. G. & SAYEED, I. 2014. Progesterone in experimental permanent stroke: a dose-response and therapeutic time-window study. Brain, 137, 486- 502. WALKER, M. D., DINELLE, K., KORNELSEN, R., LEE, A., FARRER, M. J., STOESSL, A. J. & SOSSI, V. 2013a. Measuring dopaminergic function in the 6-OHDA-lesioned rat: a comparison of PET and microdialysis. EJNMMI Res, 3, 69. WALKER, M. D., DINELLE, K., KORNELSEN, R., MCCORMICK, S., MAH, C., HOLDEN, J. E., FARRER, M. J., STOESSL, A. J. & SOSSI, V. 2013b. In-vivo measurement of LDOPA uptake, dopamine reserve and turnover in the rat brain using [18F]FDOPA PET. J Cereb Blood Flow Metab, 33, 59-66. WANAT, M. J. & BONCI, A. 2008. Dose-dependent changes in the synaptic strength on dopamine neurons and locomotor activity after cocaine exposure. Synapse, 62, 790-5. WARLOW, S. M., ROBINSON, M. J. F. & BERRIDGE, K. C. 2017. Optogenetic central amygdala stimulation intensifies and narrows motivation for cocaine. J Neurosci. WEINER, I. & ARAD, M. 2009. Using the pharmacology of latent inhibition to model domains of pathology in schizophrenia and their treatment. Behav Brain Res, 204, 369-86. WEINER, I. & FELDON, J. 1997. The switching model of latent inhibition: an update of neural substrates. Behav Brain Res, 88, 11-25. WEISS, F., PAULUS, M. P., LORANG, M. T. & KOOB, G. F. 1992. Increases in extracellular dopamine in the nucleus accumbens by cocaine are inversely related to basal levels: effects of acute and repeated administration. J Neurosci, 12, 4372-80. WESS, J., NAKAJIMA, K. & JAIN, S. 2013. Novel designer receptors to probe GPCR signaling and physiology. Trends Pharmacol Sci, 34, 385-92. WHITEFORD, H. A., DEGENHARDT, L., REHM, J., BAXTER, A. J., FERRARI, A. J., ERSKINE, H. E., CHARLSON, F. J., NORMAN, R. E., FLAXMAN, A. D., JOHNS, N., BURSTEIN, R., MURRAY, C. J. & VOS, T. 2013. Global burden of disease attributable to mental and substance use disorders: findings from the Global Burden of Disease Study 2010. Lancet, 382, 1575-86. WHO 2016. Fact file on ketamine. WIEBER, J., GUGLER, R., HENGSTMANN, J. H. & DENGLER, H. J. 1975. Pharmacokinetics of ketamine in man. Anaesthesist, 24, 260-3. WILEY, J. L., EVANS, R. L., GRAINGER, D. B. & NICHOLSON, K. L. 2011. Locomotor activity changes in female adolescent and adult rats during repeated treatment with a cannabinoid or club drug. Pharmacol Rep, 63, 1085-92. WILLUHN, I., BURGENO, L. M., GROBLEWSKI, P. A. & PHILLIPS, P. E. 2014. Excessive cocaine use results from decreased phasic dopamine signaling in the striatum. 17, 704-9. WILLUHN, I., WANAT, M. J., CLARK, J. J. & PHILLIPS, P. E. 2010. Dopamine signaling in the nucleus accumbens of animals self-administering drugs of abuse. Curr Top Behav Neurosci, 3, 29-71. WINTON-BROWN, T. T., FUSAR-POLI, P., UNGLESS, M. A. & HOWES, O. D. 2014. Dopaminergic basis of salience dysregulation in psychosis. Trends Neurosci, 37, 85-94. WISE, R. A. 2002. Brain reward circuitry: insights from unsensed incentives. Neuron, 36, 229-40. WISE, R. A. 2004. Dopamine, learning and motivation. Nat Rev Neurosci, 5, 483-94. WISE, R. A., SPINDLER, J., DEWIT, H. & GERBERG, G. J. 1978. Neuroleptic-induced "anhedonia" in rats: pimozide blocks reward quality of food. Science, 201, 262-4. WITKIN, J. M., MONN, J. A., SCHOEPP, D. D., LI, X., OVERSHINER, C., MITCHELL, S. N., CARTER, G., JOHNSON, B., RASMUSSEN, K. & RORICK-KEHN, L. M. 2016. The Rapidly Acting Antidepressant Ketamine and the mGlu2/3 Receptor Antagonist LY341495 Rapidly Engage Dopaminergic Mood Circuits. J Pharmacol Exp Ther, 358, 71-82. WITT, A., MACDONALD, N. & KIRKPATRICK, P. 2004. Memantine hydrochloride. Nat Rev Drug Discov, 3, 109-10.

229

WRIGHT, L. K., PEARSON, E. C., HAMMOND, T. G. & PAULE, M. G. 2007. Behavioral effects associated with chronic ketamine or remacemide exposure in rats. Neurotoxicol Teratol, 29, 348-59. XU, X. & DOMINO, E. F. 1994. Phencyclidine-induced behavioral sensitization. Pharmacol Biochem Behav, 47, 603-8. YAMAMOTO, S., OHBA, H., NISHIYAMA, S., HARADA, N., KAKIUCHI, T., TSUKADA, H. & DOMINO, E. F. 2013a. Subanesthetic doses of ketamine transiently decrease serotonin transporter activity: A PET study in conscious monkeys. Neuropsychopharmacology, .38, pp. YAMAMOTO, S., OHBA, H., NISHIYAMA, S., HARADA, N., KAKIUCHI, T., TSUKADA, H. & DOMINO, E. F. 2013b. Subanesthetic doses of ketamine transiently decrease serotonin transporter activity: a PET study in conscious monkeys. Neuropsychopharmacology, 38, 2666-74. YEH, S. H., LIN, M. H., KONG, F. L., CHANG, C. W., HWANG, L. C., LIN, C. F., HWANG, J. J. & LIU, R. S. 2014a. Evaluation of inhibitory effect of recreational drugs on dopaminergic terminal neuron by PET and whole-body autoradiography. Biomed Res Int, 2014, 157923. YEH, S. H. H., LIN, M. H., KONG, F. L., CHANG, C. W., HWANG, L. C., LIN, C. F., HWANG, J. J. & LIU, R. S. 2014b. Evaluation of Inhibitory Effect of Recreational Drugs on Dopaminergic Terminal Neuron by PET and Whole-Body Autoradiography. Biomed Research International. YOUNG, A. M. 1993. Intracerebral microdialysis in the study of physiology and behaviour. Rev Neurosci, 4, 373-95. YOUNG, A. M. 2004. Increased extracellular dopamine in nucleus accumbens in response to unconditioned and conditioned aversive stimuli: studies using 1 min microdialysis in rats. J Neurosci Methods, 138, 57-63. YOUNG, A. M., AHIER, R. G., UPTON, R. L., JOSEPH, M. H. & GRAY, J. A. 1998. Increased extracellular dopamine in the nucleus accumbens of the rat during associative learning of neutral stimuli. Neuroscience, 83, 1175-83. YOUNG, A. M., MORAN, P. M. & JOSEPH, M. H. 2005. The role of dopamine in conditioning and latent inhibition: what, when, where and how? Neurosci Biobehav Rev, 29, 963-76. ZAHM, D. S. & HEIMER, L. 1993. Specificity in the efferent projections of the nucleus accumbens in the rat: comparison of the rostral pole projection patterns with those of the core and shell. J Comp Neurol, 327, 220-32. ZANOS, P., MOADDEL, R., MORRIS, P. J., GEORGIOU, P., FISCHELL, J., ELMER, G. I., ALKONDON, M., YUAN, P., PRIBUT, H. J., SINGH, N. S., DOSSOU, K. S., FANG, Y., HUANG, X. P., MAYO, C. L., WAINER, I. W., ALBUQUERQUE, E. X., THOMPSON, S. M., THOMAS, C. J., ZARATE, C. A., JR. & GOULD, T. D. 2016. NMDAR inhibition-independent antidepressant actions of ketamine metabolites. Nature, 533, 481-6. ZANOS, P., MOADDEL, R., MORRIS, P. J., GEORGIOU, P., FISCHELL, J., ELMER, G. I., ALKONDON, M., YUAN, P., PRIBUT, H. J., SINGH, N. S., DOSSOU, K. S. S., FANG, Y., HUANG, X. P., MAYO, C. L., ALBUQUERQUE, E. X., THOMPSON, S. M., THOMAS, C. J., ZARATE, C. A. & GOULD, T. D. 2017. Zanos et al. reply. Nature, 546, E4-e5. ZARATE, C. A., JR., SINGH, J. B., CARLSON, P. J., BRUTSCHE, N. E., AMELI, R., LUCKENBAUGH, D. A., CHARNEY, D. S. & MANJI, H. K. 2006. A randomized trial of an N-methyl-D-aspartate antagonist in treatment-resistant major depression. Arch Gen Psychiatry, 63, 856-64. ZHANG, Y., BEHRENS, M. M. & LISMAN, J. E. 2008. Prolonged exposure to NMDAR antagonist suppresses inhibitory synaptic transmission in prefrontal cortex. J Neurophysiol, 100, 959-65. ZHANG, Z. J. & REYNOLDS, G. P. 2002. A selective decrease in the relative density of parvalbumin- immunoreactive neurons in the hippocampus in schizophrenia. Schizophr Res, 55, 1-10. ZHOU, Z., ZHANG, G., LI, X., LIU, X., WANG, N., QIU, L., LIU, W., ZUO, Z. & YANG, J. 2015. Loss of phenotype of parvalbumin interneurons in rat prefrontal cortex is involved in antidepressant- and propsychotic-like behaviors following acute and repeated ketamine administration. Mol Neurobiol, 51, 808-19.

230

ZHU, M. Y., KLIMEK, V., DILLEY, G. E., HAYCOCK, J. W., STOCKMEIER, C., OVERHOLSER, J. C., MELTZER, H. Y. & ORDWAY, G. A. 1999. Elevated levels of tyrosine hydroxylase in the locus coeruleus in major depression. Biol Psychiatry, 46, 1275-86. ZIMMER, M. B. & GOSHGARIAN, H. G. 2007. GABA, not glycine, mediates inhibition of latent respiratory motor pathways after spinal cord injury. Exp Neurol, 203, 493-501.

231

Appendix

) n s

m 2 0 0 0 0 c

( W T

d n s

e D A T C re p o s itiv e l

l 1 5 0 0 0

0 1 0 0 0 0

a t

s 5 0 0 0

a t

o 0 T

5 1 y y a a D D

Appendix Figure: Two-way ANOVA with genotype and day as independent factors was performed to examine the effect of genotype on ketamine-induced locomotor activity. There was no significant effect of group (F1, 25 = 2.90, p>0.05), there was a significant effect of day (F1, 25 = 25.53, p<0.001) and no interaction between genotype and day (F1, 25 = 2.31, p>0.05).

232