DOCSLIB.ORG

An Actin-Filament-Binding Interface on the Arp2/3 Complex Is Critical for Nucleation and Branch Stability

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
An Actin-Filament-Binding Interface on the Arp2/3 Complex Is Critical for Nucleation and Branch Stability An actin-filament-binding interface on the Arp2/3 complex is critical for nucleation and branch stability Erin D. Goleya,2, Aravind Rammohanb,3, Elizabeth A. Znameroskia, Elif Nur Firat-Karalara, David Septb,4, and Matthew D. Welcha,1 aDepartment of Molecular and Cell Biology, University of California, Berkeley CA 94720; and bDepartment of Biomedical Engineering and Center for Computational Biology, Washington University, St. Louis, MO 63130 Edited* by Thomas D. Pollard, Yale University, New Haven, CT, and approved February 24, 2010 (received for review October 8, 2009) The Arp2/3 complex polymerizes new actin filaments from the branched filament geometry is proposed to be particularly suited sides of existing filaments, forming Y-branched networks that for harnessing actin polymerization to generate motile force (11). are critical for actin-mediated force generation. Binding of the Atomic-resolution structures of the Arp2/3 complex with and Arp2/3 complex to the sides of actin filaments is therefore central without bound nucleotide and inhibitors have been determined to its actin-nucleating and branching activities. Although a model (12–15). Moreover, structural models of the Y-branch junction of the Arp2/3 complex in filament branches has been proposed have been constructed using electron microscopy (16, 17), culmi- based on electron microscopy, this model has not been validated nating in a 2.6-nm resolution 3D model derived from docking using independent approaches, and the functional importance of crystal structures of Arp2/3 complex and actin into a reconstruc- predicted actin-binding residues has not been extensively tested. tion from electron tomography (18). In this model, Arp2 and Using a combination of molecular dynamics and protein-protein Arp3 interact with the pointed end of the daughter filament, docking simulations, we derived an independent structural model and all seven subunits contact the mother filament. ARPC2 of the interaction between two subunits of the Arp2/3 complex and ARPC4 comprise the major mother-filament-binding inter- that are key to actin binding, ARPC2 and ARPC4, and the side of face, consistent with earlier data from chemical cross-linking (19), an actin filament. This model agreed remarkably well with the pre- Arp2/3 complex reconstitution (20), and antibody-inhibition ex- periments (21). However, despite advances in our understanding vious results from electron microscopy. Complementary mutagen- BIOCHEMISTRY esis experiments revealed numerous residues in ARPC2 and ARPC4 of Y-branch structure, the functional importance of Arp2/3 that were required for the biochemical activity of the entire com- complex residues implicated in mother-filament binding has plex. Functionally critical residues clustered together and defined a not been extensively tested apart from an analysis of ARPC2 arc35 Saccharomyces cerevisiae surface that was predicted by protein-protein docking to be buried ( ) mutants in , which demonstrated in the interaction with actin. Moreover, key residues at this inter- an important role for ARPC2 residues in Arp2/3 complex nucle- face were crucial for actin nucleation and Y-branching, high-affinity ating activity in vitro and in growth and endocytosis in vivo (22). F-actin binding, and Y-branch stability, demonstrating that the In this study we used molecular dynamics and protein-protein affinity of Arp2/3 complex for F actin independently modulates docking simulations to generate an independent model of the interaction between the ARPC2 and ARPC4 subunits of the branch formation and stability. Our results highlight the utility Arp2/3 complex and the side of an actin filament. Using informa- of combining computational and experimental approaches to tion from this and previous models, we tested the role of amino study protein-protein interactions and provide a basis for further acid residues on the exposed surfaces of ARPC2 and ARPC4 by elucidating the role of F-actin binding in Arp2/3 complex activation examining the biochemical properties of mutant Arp2/3 com- and function. plexes. Using this approach we defined key residues that play a specific and critical role in F-actin binding, actin nucleation, and cytoskeleton ∣ actin branching Y-branch stability. he actin cytoskeleton plays an essential role in diverse cellular Results Tprocesses ranging from motility to division. A key control Protein-Protein Docking Simulations Yield an Independent Structural point in the cycle of actin filament (F actin) assembly is the Model of ARPC2/ARPC4 Bound to F Actin. Numerous lines of evidence rate-limiting nucleation step, which can be accelerated in a regu- suggest that the ARPC2 and ARPC4 subunits of the Arp2/3 lated manner by the action of nucleating factors. One of the complex constitute the primary F-actin side-binding interface major actin-nucleating factors in cells is the Arp2/3 complex, a (19–21). To generate an independent structural model of the in- protein complex that consists of seven subunits including the teraction between these proteins, we performed protein-protein actin-related proteins (Arp) Arp2 and Arp3 and the additional docking simulations using the crystal structures of an ARPC2/ Arp2/3 complex (ARPC) polypeptides ARPC1–ARPC5. The ARPC4 heterodimer (12) and an actin filament consisting of Arp2/3 complex has been conserved during the evolution of most eukaryotic cells and plays an important functional role in cell mi- gration, endocytosis, phagocytosis, and pathogen infection (1). Author contributions: E.D.G., A.R., D.S., and M.D.W. designed research; E.D.G., A.R., E.A.Z., E.N.F.-K., and D.S. performed research; E.D.G., D.S., and M.D.W. analyzed data; and On its own the Arp2/3 complex is inactive, but it is activated to E.D.G., D.S., and M.D.W. wrote the paper. polymerize actin by binding to proteins called nucleation-promot- The authors declare no conflict of interest. ing factors (NPFs) (1) as well as to ATP (2, 3). Moreover, the *This Direct Submission article had a prearranged editor. nucleating activity of the Arp2/3 complex is stimulated by binding 1To whom correspondence should be addressed. E-mail: [email protected]. to F actin (4, 5), a phenomenon that results in autocatalytic actin 2Present address: Department of Developmental Biology, Stanford University School of assembly (6). Once activated, the complex nucleates the polymer- Medicine, Stanford, CA 94305. ization of daughter filaments that emerge from the sides of 3Present address: Corning Incorporated, Modeling & Simulation, Corning, NY 14831. mother filaments in a stereotypical Y-branch orientation with 4Present address: Department of Biomedical Engineering and Center for Computational an approximate branch angle of 70° (7–9). Such Arp2/3-contain- Medicine and Bioinformatics, University of Michigan, Ann Arbor, MI 48109. ing branched structures have been observed in the actin network This article contains supporting information online at www.pnas.org/cgi/content/full/ within lamellipodia at the leading edge of motile cells (10). This 0911668107/DCSupplemental. www.pnas.org/cgi/doi/10.1073/pnas.0911668107 PNAS Early Edition ∣ 1of6 Downloaded by guest on October 4, 2021 eight monomers corresponding to the Holmes F-actin model A actin 1 (23). To capture the conformational flexibility of the two docking actin 2 partners, we used Nanoscale Molecular Dynamics (NAMD) (24) R190 to perform a 100-ns molecular dynamics simulation of the full K58 Arp2/3 complex and a 30-ns simulation of the actin filament. D80 Structures were extracted every 10 ns for the ARPC2/ARPC4 E100 D81 heterodimer and every 5 ns for F actin, resulting in 10 and 6 R95 structures, respectively. For each combination of structures, we performed 100 docking simulations using Rosetta-Dock software R158 (25, 26), resulting in a total of 6,000 docked structures. D143 Using the best-scoring model from this initial protein-protein ARPC4 ARPC2 docking run as a starting point, we carried out a perturbation run actin 3 in which the two docking partners were subjected to an additional 10,000 rounds of random translation/rotation and redocking. B ARPC1 When we examined the resulting energy landscape using the final ARPC5 best-scoring structure as a reference, we observed a funnel of Arp2 docking scores converging on the lowest-scoring structure at 0 Å rmsd (Fig. S1). Score funnels such as this one were found 90 to be a strong indicator of the robustness of the docking model, ARPC4 as the low-scoring model in such funnels often corresponded with atomic-level accuracy to the structure determined experimentally by x-ray crystallography in the Critical Assessment of Predicted Interactions (CAPRI) protein-protein docking experiment (27). ARPC3 Thus, the model with the lowest docking score from the pertur- ARPC2 Arp3 bation run, shown in Fig. 1A and B and Movie S1, represents a robust computationally derived model of the ARPC2/ARPC4-F- C actin-binding interaction. Strikingly, when we overlaid our model of the ARPC2/ 90 90 ARPC4-F-actin interaction on the one derived from electron microscopy (Movie S1), we found they were very similar, with aCα rmsd of only 5.9 Å. The similarity between these models provides independent support for the results from electron mi- Arp2 Arp3 ARPC1 ARPC2 ARPC3 ARPC4 ARPC5 croscopy studies. Moreover, the robustness of the protein-protein docking model is highlighted by the fact that it was derived Fig. 1. Protein-protein docking simulations identify a putative mother independently of information from electron microscopy. filament binding site on the Arp2/3 complex. (A) Surface rendering of the Encouraged by the similarity of our protein-protein docking structures of an ARPC2/ARPC4 heterodimer and a portion of the actin fila- model with models from electron microscopy, we identified ment, with residues predicted to form salt bridges highlighted in red (acidic) the interaction surface on ARPC2/ARPC4 that is predicted to and blue (basic), and the surface predicted to be within 4 Å of the other bind- lie within 5 Å of F actin based on the protein-protein docking ing partner in yellow, based on molecular dynamics and protein-protein docking simulations.
Load more

Recommended publications
  • Advancing a Clinically Relevant Perspective of the Clonal Nature of Cancer
    Advancing a clinically relevant perspective of the clonal nature of cancer Christian Ruiza,b, Elizabeth Lenkiewicza, Lisa Eversa, Tara Holleya, Alex Robesona, Jeffrey Kieferc, Michael J. Demeurea,d, Michael A. Hollingsworthe, Michael Shenf, Donna Prunkardf, Peter S. Rabinovitchf, Tobias Zellwegerg, Spyro Moussesc, Jeffrey M. Trenta,h, John D. Carpteni, Lukas Bubendorfb, Daniel Von Hoffa,d, and Michael T. Barretta,1 aClinical Translational Research Division, Translational Genomics Research Institute, Scottsdale, AZ 85259; bInstitute for Pathology, University Hospital Basel, University of Basel, 4031 Basel, Switzerland; cGenetic Basis of Human Disease, Translational Genomics Research Institute, Phoenix, AZ 85004; dVirginia G. Piper Cancer Center, Scottsdale Healthcare, Scottsdale, AZ 85258; eEppley Institute for Research in Cancer and Allied Diseases, Nebraska Medical Center, Omaha, NE 68198; fDepartment of Pathology, University of Washington, Seattle, WA 98105; gDivision of Urology, St. Claraspital and University of Basel, 4058 Basel, Switzerland; hVan Andel Research Institute, Grand Rapids, MI 49503; and iIntegrated Cancer Genomics Division, Translational Genomics Research Institute, Phoenix, AZ 85004 Edited* by George F. Vande Woude, Van Andel Research Institute, Grand Rapids, MI, and approved June 10, 2011 (received for review March 11, 2011) Cancers frequently arise as a result of an acquired genomic insta- on the basis of morphology alone (8). Thus, the application of bility and the subsequent clonal evolution of neoplastic cells with purification methods such as laser capture microdissection does variable patterns of genetic aberrations. Thus, the presence and not resolve the complexities of many samples. A second approach behaviors of distinct clonal populations in each patient’s tumor is to passage tumor biopsies in tissue culture or in xenografts (4, 9– may underlie multiple clinical phenotypes in cancers.
    [Show full text]
  • Supplemental Information
    Supplemental information Dissection of the genomic structure of the miR-183/96/182 gene. Previously, we showed that the miR-183/96/182 cluster is an intergenic miRNA cluster, located in a ~60-kb interval between the genes encoding nuclear respiratory factor-1 (Nrf1) and ubiquitin-conjugating enzyme E2H (Ube2h) on mouse chr6qA3.3 (1). To start to uncover the genomic structure of the miR- 183/96/182 gene, we first studied genomic features around miR-183/96/182 in the UCSC genome browser (http://genome.UCSC.edu/), and identified two CpG islands 3.4-6.5 kb 5’ of pre-miR-183, the most 5’ miRNA of the cluster (Fig. 1A; Fig. S1 and Seq. S1). A cDNA clone, AK044220, located at 3.2-4.6 kb 5’ to pre-miR-183, encompasses the second CpG island (Fig. 1A; Fig. S1). We hypothesized that this cDNA clone was derived from 5’ exon(s) of the primary transcript of the miR-183/96/182 gene, as CpG islands are often associated with promoters (2). Supporting this hypothesis, multiple expressed sequences detected by gene-trap clones, including clone D016D06 (3, 4), were co-localized with the cDNA clone AK044220 (Fig. 1A; Fig. S1). Clone D016D06, deposited by the German GeneTrap Consortium (GGTC) (http://tikus.gsf.de) (3, 4), was derived from insertion of a retroviral construct, rFlpROSAβgeo in 129S2 ES cells (Fig. 1A and C). The rFlpROSAβgeo construct carries a promoterless reporter gene, the β−geo cassette - an in-frame fusion of the β-galactosidase and neomycin resistance (Neor) gene (5), with a splicing acceptor (SA) immediately upstream, and a polyA signal downstream of the β−geo cassette (Fig.
    [Show full text]
  • Role and Regulation of the P53-Homolog P73 in the Transformation of Normal Human Fibroblasts
    Role and regulation of the p53-homolog p73 in the transformation of normal human fibroblasts Dissertation zur Erlangung des naturwissenschaftlichen Doktorgrades der Bayerischen Julius-Maximilians-Universität Würzburg vorgelegt von Lars Hofmann aus Aschaffenburg Würzburg 2007 Eingereicht am Mitglieder der Promotionskommission: Vorsitzender: Prof. Dr. Dr. Martin J. Müller Gutachter: Prof. Dr. Michael P. Schön Gutachter : Prof. Dr. Georg Krohne Tag des Promotionskolloquiums: Doktorurkunde ausgehändigt am Erklärung Hiermit erkläre ich, dass ich die vorliegende Arbeit selbständig angefertigt und keine anderen als die angegebenen Hilfsmittel und Quellen verwendet habe. Diese Arbeit wurde weder in gleicher noch in ähnlicher Form in einem anderen Prüfungsverfahren vorgelegt. Ich habe früher, außer den mit dem Zulassungsgesuch urkundlichen Graden, keine weiteren akademischen Grade erworben und zu erwerben gesucht. Würzburg, Lars Hofmann Content SUMMARY ................................................................................................................ IV ZUSAMMENFASSUNG ............................................................................................. V 1. INTRODUCTION ................................................................................................. 1 1.1. Molecular basics of cancer .......................................................................................... 1 1.2. Early research on tumorigenesis ................................................................................. 3 1.3. Developing
    [Show full text]
  • Requirements for Arabidopsis ATARP2 and ATARP3 During Epidermal Development
    Current Biology, Vol. 13, 1341–1347, August 5, 2003, 2003 Elsevier Science Ltd. All rights reserved. DOI 10.1016/S0960-9822(03)00493-7 Requirements for Arabidopsis ATARP2 and ATARP3 during Epidermal Development Jie Le, Salah El-Din El-Assal, Dipanwita Basu, stage-specific swelling and reduced branch elongation Mohamed E. Saad, and Daniel B. Szymanski* defects (data not shown). Because dis1-1 was a pre- Agronomy Department dicted null allele of DIS1 (see below), we used this allele Purdue University for all of our detailed phenotypic characterizations. Mea- Lily Hall surements with scanning electron microscopy (SEM) 915 West State Street demonstrated that 40% (n ϭ 43) of dis1-1 stage 4 tri- West Lafayette, Indiana 47907-2054 chomes had a cell diameter of more than 30 ␮m. In the wild-type, a stage 4 cell diameter exceeding 30 ␮m was not observed in either this (n ϭ 45) or previous studies Summary [4]. During stage 6, papillae or tubercles decorate the surface of highly expanded trichomes. Papillae on the Plant cells employ the actin cytoskeleton to stably stalks of wild-type trichomes were slightly oval and var- ␮ ف ␮ ف position organelles, as tracks for long distance trans- ied in length from 1.5 mto 3 m (Figure 1C). In port, and to reorganize the cytoplasm in response to mature dis1 trichomes, papillae at the tips of abortive developmental and environmental cues [1]. While di- branches were often absent (Figure 1D). In obviously ␮ ف verse classes of actin binding proteins have been im- swollen regions of the stalk, papillae up to 9 min plicated in growth control, the mechanisms of cy- length were common.
    [Show full text]
  • Tumour-Stroma Signalling in Cancer Cell Motility and Metastasis
    Tumour-Stroma Signalling in Cancer Cell Motility and Metastasis by Valbona Luga A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy, Department of Molecular Genetics, University of Toronto © Copyright by Valbona Luga, 2013 Tumour-Stroma Signalling in Cancer Cell Motility and Metastasis Valbona Luga Doctor of Philosophy Department of Molecular Genetics University of Toronto 2013 Abstract The tumour-associated stroma, consisting of fibroblasts, inflammatory cells, vasculature and extracellular matrix proteins, plays a critical role in tumour growth, but how it regulates cancer cell migration and metastasis is poorly understood. The Wnt-planar cell polarity (PCP) pathway regulates convergent extension movements in vertebrate development. However, it is unclear whether this pathway also functions in cancer cell migration. In addition, the factors that mobilize long-range signalling of Wnt morphogens, which are tightly associated with the plasma membrane, have yet to be completely characterized. Here, I show that fibroblasts secrete membrane microvesicles of endocytic origin, termed exosomes, which promote tumour cell protrusive activity, motility and metastasis via the exosome component Cd81. In addition, I demonstrate that fibroblast exosomes activate autocrine Wnt-PCP signalling in breast cancer cells as detected by the association of Wnt with Fzd receptors and the asymmetric distribution of Fzd-Dvl and Vangl-Pk complexes in exosome-stimulated cancer cell protrusive structures. Moreover, I show that Pk expression in breast cancer cells is essential for fibroblast-stimulated cancer cell metastasis. Lastly, I reveal that trafficking in cancer cells promotes tethering of autocrine Wnt11 to fibroblast exosomes. These studies further our understanding of the role of ii the tumour-associated stroma in cancer metastasis and bring us closer to a more targeted approach for the treatment of cancer spread.
    [Show full text]
  • Oral Administration of Lactobacillus Plantarum 299V
    Genes Nutr (2015) 10:10 DOI 10.1007/s12263-015-0461-7 RESEARCH PAPER Oral administration of Lactobacillus plantarum 299v modulates gene expression in the ileum of pigs: prediction of crosstalk between intestinal immune cells and sub-mucosal adipocytes 1 1,4 1,5 1 Marcel Hulst • Gabriele Gross • Yaping Liu • Arjan Hoekman • 2 1,3 1,3 Theo Niewold • Jan van der Meulen • Mari Smits Received: 19 November 2014 / Accepted: 28 March 2015 / Published online: 11 April 2015 Ó The Author(s) 2015. This article is published with open access at Springerlink.com Abstract To study host–probiotic interactions in parts of ileum. A higher expression level of several B cell-specific the intestine only accessible in humans by surgery (je- transcription factors/regulators was observed, suggesting junum, ileum and colon), pigs were used as model for that an influx of B cells from the periphery to the ileum humans. Groups of eight 6-week-old pigs were repeatedly and/or the proliferation of progenitor B cells to IgA-com- orally administered with 5 9 1012 CFU Lactobacillus mitted plasma cells in the Peyer’s patches of the ileum was plantarum 299v (L. plantarum 299v) or PBS, starting with stimulated. Genes coding for enzymes that metabolize a single dose followed by three consecutive daily dosings leukotriene B4, 1,25-dihydroxyvitamin D3 and steroids 10 days later. Gene expression was assessed with pooled were regulated in the ileum. Bioinformatics analysis pre- RNA samples isolated from jejunum, ileum and colon dicted that these metabolites may play a role in the scrapings of the eight pigs per group using Affymetrix crosstalk between intestinal immune cells and sub-mucosal porcine microarrays.
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name actin related protein 2/3 complex, subunit 4, 20kDa Gene Symbol ARPC4 Organism Human Gene Summary This gene encodes one of seven subunits of the human Arp2/3 protein complex. This complex controls actin polymerization in cells and has been conserved throughout eukaryotic evolution. This gene encodes the p20 subunit which is necessary for actin nucleation and high-affinity binding to F-actin. Alternative splicing results in multiple transcript variants. Naturally occurring read-through transcription exists between this gene and the downstream tubulin tyrosine ligase-like family member 3 (TTLL3) which results in the production of a fusion protein. Gene Aliases ARC20, MGC13544, P20-ARC RefSeq Accession No. NC_000003.11, NT_022517.18 UniGene ID Hs.323342 Ensembl Gene ID ENSG00000241553 Entrez Gene ID 10093 Assay Information Unique Assay ID qHsaCED0002460 Assay Type SYBR® Green Detected Coding Transcript(s) ENST00000498623, ENST00000397261, ENST00000433034, ENST00000287613 Amplicon Context Sequence TTTTAAACCATCTGGCTGGATCTCGTGGCCTTCCCCCTCAGACTACCCATGTCTC CACGAAGGCGTCCTGGAGTCACTCCCCGAGCAGCG Amplicon Length (bp) 60 Chromosome Location 3:9847894-9847983 Assay Design Exonic Purification Desalted Validation Results Efficiency (%) 104 R2 0.9987 cDNA Cq 19.57 cDNA Tm (Celsius) 81.5 Page 1/5 PrimePCR™Assay Validation Report gDNA Cq 24.52 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 2/5 PrimePCR™Assay Validation Report ARPC4,
    [Show full text]
  • 4036.Full.Pdf
    The Journal of Immunology Disruption of Thrombocyte and T Lymphocyte Development by a Mutation in ARPC1B Raz Somech,*,† Atar Lev,*,† Yu Nee Lee,*,† Amos J. Simon,*,†,‡ Ortal Barel,†,x Ginette Schiby,{ Camila Avivi,{ Iris Barshack,{ Michele Rhodes,‖ Jiejing Yin,‖ Minshi Wang,‖ Yibin Yang,‖ Jennifer Rhodes,‖ Nufar Marcus,# Ben-Zion Garty,# Jerry Stein,** Ninette Amariglio,†,‡,x,†† Gideon Rechavi,†,x David L. Wiest,‖,1 and Yong Zhang‖,1 Regulation of the actin cytoskeleton is crucial for normal development and function of the immune system, as evidenced by the severe immune abnormalities exhibited by patients bearing inactivating mutations in the Wiskott–Aldrich syndrome protein (WASP), a key regulator of actin dynamics. WASP exerts its effects on actin dynamics through a multisubunit complex termed Arp2/3. Despite the critical role played by Arp2/3 as an effector of WASP-mediated control over actin polymerization, mutations in protein components of the Arp2/3 complex had not previously been identified as a cause of immunodeficiency. Here, we describe two brothers with hematopoietic and immunologic symptoms reminiscent of Wiskott–Aldrich syndrome (WAS). However, these patients lacked mutations in any of the genes previously associated with WAS. Whole-exome sequencing revealed a homozygous 2 bp deletion, n.c.G623DEL-TC (p.V208VfsX20), in Arp2/3 complex component ARPC1B that causes a frame shift resulting in premature termination. Modeling of the disease in zebrafish revealed that ARPC1B plays a critical role in supporting T cell and thrombocyte development. Moreover, the defects in development caused by ARPC1B loss could be rescued by the intact human ARPC1B ortholog, but not by the p.V208VfsX20 variant identified in the patients.
    [Show full text]
  • Genome-Wide CRISPR Screening Identifies TMEM106B As a Proviral Host Factor for SARS-Cov-2
    ARTICLES https://doi.org/10.1038/s41588-021-00805-2 Genome-wide CRISPR screening identifies TMEM106B as a proviral host factor for SARS-CoV-2 Jim Baggen 1 ✉ , Leentje Persoons 1,8, Els Vanstreels 1,8, Sander Jansen 1,8, Dominique Van Looveren 1,2, Bram Boeckx3,4, Vincent Geudens 5, Julie De Man1, Dirk Jochmans 1, Joost Wauters6, Els Wauters 5, Bart M. Vanaudenaerde5, Diether Lambrechts3,4, Johan Neyts1, Kai Dallmeier 1, Hendrik Jan Thibaut 1,2, Maarten Jacquemyn 1, Piet Maes7 and Dirk Daelemans 1 ✉ The ongoing COVID-19 pandemic has caused a global economic and health crisis. To identify host factors essential for corona- virus infection, we performed genome-wide functional genetic screens with severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) and human coronavirus 229E. These screens uncovered virus-specific as well as shared host factors, including TMEM41B and PI3K type 3. We discovered that SARS-CoV-2 requires the lysosomal protein TMEM106B to infect human cell lines and primary lung cells. TMEM106B overexpression enhanced SARS-CoV-2 infection as well as pseudovirus infection, sug- gesting a role in viral entry. Furthermore, single-cell RNA-sequencing of airway cells from patients with COVID-19 demonstrated that TMEM106B expression correlates with SARS-CoV-2 infection. The present study uncovered a collection of coronavirus host factors that may be exploited to develop drugs against SARS-CoV-2 infection or future zoonotic coronavirus outbreaks. he COVID-19 pandemic, caused by SARS-CoV-2, has to address the current high medical need, but also to quickly con- resulted in a worldwide health crisis1 and few effective drugs tain zoonotic events in the future.
    [Show full text]
  • Molecular Architecture of the Chick Vestibular Hair Bundle
    RE so UR c E Molecular architecture of the chick vestibular hair bundle Jung-Bum Shin1,2,8, Jocelyn F Krey2,8, Ahmed Hassan3, Zoltan Metlagel3, Andrew N Tauscher3, James M Pagana1,2, Nicholas E Sherman4, Erin D Jeffery4, Kateri J Spinelli2, Hongyu Zhao2, Phillip A Wilmarth5, Dongseok Choi6, Larry L David5, Manfred Auer3 & Peter G Barr-Gillespie2,7 Hair bundles of the inner ear have a specialized structure and protein composition that underlies their sensitivity to mechanical stimulation. Using mass spectrometry, we identified and quantified >1,100 proteins, present from a few to 400,000 copies per stereocilium, from purified chick bundles; 336 of these were significantly enriched in bundles. Bundle proteins that we detected have been shown to regulate cytoskeleton structure and dynamics, energy metabolism, phospholipid synthesis and cell signaling. Three-dimensional imaging using electron tomography allowed us to count the number of actin-actin cross-linkers and actin- membrane connectors; these values compared well to those obtained from mass spectrometry. Network analysis revealed several hub proteins, including RDX (radixin) and SLC9A3R2 (NHERF2), which interact with many bundle proteins and may perform functions essential for bundle structure and function. The quantitative mass spectrometry of bundle proteins reported here establishes a framework for future characterization of dynamic processes that shape bundle structure and function. An outstanding example of a specialized organelle devoted to a single ­identified those proteins selectively targeted to bundles. Many bundle- purpose, the vertebrate hair bundle transduces mechanical signals enriched proteins are expressed from deafness-associated genes, for the inner ear, converting sound and head movement to electrical confirming their essential function in the inner ear.
    [Show full text]
  • Table S1. 103 Ferroptosis-Related Genes Retrieved from the Genecards
    Table S1. 103 ferroptosis-related genes retrieved from the GeneCards. Gene Symbol Description Category GPX4 Glutathione Peroxidase 4 Protein Coding AIFM2 Apoptosis Inducing Factor Mitochondria Associated 2 Protein Coding TP53 Tumor Protein P53 Protein Coding ACSL4 Acyl-CoA Synthetase Long Chain Family Member 4 Protein Coding SLC7A11 Solute Carrier Family 7 Member 11 Protein Coding VDAC2 Voltage Dependent Anion Channel 2 Protein Coding VDAC3 Voltage Dependent Anion Channel 3 Protein Coding ATG5 Autophagy Related 5 Protein Coding ATG7 Autophagy Related 7 Protein Coding NCOA4 Nuclear Receptor Coactivator 4 Protein Coding HMOX1 Heme Oxygenase 1 Protein Coding SLC3A2 Solute Carrier Family 3 Member 2 Protein Coding ALOX15 Arachidonate 15-Lipoxygenase Protein Coding BECN1 Beclin 1 Protein Coding PRKAA1 Protein Kinase AMP-Activated Catalytic Subunit Alpha 1 Protein Coding SAT1 Spermidine/Spermine N1-Acetyltransferase 1 Protein Coding NF2 Neurofibromin 2 Protein Coding YAP1 Yes1 Associated Transcriptional Regulator Protein Coding FTH1 Ferritin Heavy Chain 1 Protein Coding TF Transferrin Protein Coding TFRC Transferrin Receptor Protein Coding FTL Ferritin Light Chain Protein Coding CYBB Cytochrome B-245 Beta Chain Protein Coding GSS Glutathione Synthetase Protein Coding CP Ceruloplasmin Protein Coding PRNP Prion Protein Protein Coding SLC11A2 Solute Carrier Family 11 Member 2 Protein Coding SLC40A1 Solute Carrier Family 40 Member 1 Protein Coding STEAP3 STEAP3 Metalloreductase Protein Coding ACSL1 Acyl-CoA Synthetase Long Chain Family Member 1 Protein
    [Show full text]
  • Mouse Arpc4 Conditional Knockout Project (CRISPR/Cas9)
    https://www.alphaknockout.com Mouse Arpc4 Conditional Knockout Project (CRISPR/Cas9) Objective: To create a Arpc4 conditional knockout Mouse model (C57BL/6J) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Arpc4 gene (NCBI Reference Sequence: NM_026552 ; Ensembl: ENSMUSG00000079426 ) is located on Mouse chromosome 6. 6 exons are identified, with the ATG start codon in exon 1 and the TAA stop codon in exon 6 (Transcript: ENSMUST00000156898). Exon 4~5 will be selected as conditional knockout region (cKO region). Deletion of this region should result in the loss of function of the Mouse Arpc4 gene. To engineer the targeting vector, homologous arms and cKO region will be generated by PCR using BAC clone RP23-339P1 as template. Cas9, gRNA and targeting vector will be co-injected into fertilized eggs for cKO Mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Exon 4~5 is not frameshift exon, and covers 52.98% of the coding region. The size of intron 3 for 5'-loxP site insertion: 2007 bp, and the size of intron 5 for 3'-loxP site insertion: 3110 bp. The size of effective cKO region: ~2079 bp. The cKO region does not have any other known gene. Page 1 of 8 https://www.alphaknockout.com Overview of the Targeting Strategy Wildtype allele 5' gRNA region gRNA region 3' 1 3 4 5 6 Targeting vector Targeted allele Constitutive KO allele (After Cre recombination) Legends Exon of mouse Arpc4 Homology arm cKO region loxP site Page 2 of 8 https://www.alphaknockout.com Overview of the Dot Plot Window size: 10 bp Forward Reverse Complement Sequence 12 Note: The sequence of homologous arms and cKO region is aligned with itself to determine if there are tandem repeats.
    [Show full text]