DOCSLIB.ORG

Mouse Arpc4 Conditional Knockout Project (CRISPR/Cas9)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Mouse Arpc4 Conditional Knockout Project (CRISPR/Cas9) https://www.alphaknockout.com Mouse Arpc4 Conditional Knockout Project (CRISPR/Cas9) Objective: To create a Arpc4 conditional knockout Mouse model (C57BL/6J) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Arpc4 gene (NCBI Reference Sequence: NM_026552 ; Ensembl: ENSMUSG00000079426 ) is located on Mouse chromosome 6. 6 exons are identified, with the ATG start codon in exon 1 and the TAA stop codon in exon 6 (Transcript: ENSMUST00000156898). Exon 4~5 will be selected as conditional knockout region (cKO region). Deletion of this region should result in the loss of function of the Mouse Arpc4 gene. To engineer the targeting vector, homologous arms and cKO region will be generated by PCR using BAC clone RP23-339P1 as template. Cas9, gRNA and targeting vector will be co-injected into fertilized eggs for cKO Mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Exon 4~5 is not frameshift exon, and covers 52.98% of the coding region. The size of intron 3 for 5'-loxP site insertion: 2007 bp, and the size of intron 5 for 3'-loxP site insertion: 3110 bp. The size of effective cKO region: ~2079 bp. The cKO region does not have any other known gene. Page 1 of 8 https://www.alphaknockout.com Overview of the Targeting Strategy Wildtype allele 5' gRNA region gRNA region 3' 1 3 4 5 6 Targeting vector Targeted allele Constitutive KO allele (After Cre recombination) Legends Exon of mouse Arpc4 Homology arm cKO region loxP site Page 2 of 8 https://www.alphaknockout.com Overview of the Dot Plot Window size: 10 bp Forward Reverse Complement Sequence 12 Note: The sequence of homologous arms and cKO region is aligned with itself to determine if there are tandem repeats. Tandem repeats are found in the dot plot matrix. It may be difficult to construct this targeting vector. Overview of the GC Content Distribution Window size: 300 bp Sequence 12 Summary: Full Length(8579bp) | A(25.28% 2169) | C(22.83% 1959) | T(27.86% 2390) | G(24.02% 2061) Note: The sequence of homologous arms and cKO region is analyzed to determine the GC content. No significant high GC-content region is found. So this region is suitable for PCR screening or sequencing analysis. Page 3 of 8 https://www.alphaknockout.com BLAT Search Results (up) QUERY SCORE START END QSIZE IDENTITY CHROM STRAND START END SPAN ----------------------------------------------------------------------------------------------- browser details YourSeq 3000 1 3000 3000 100.0% chr6 + 113380833 113383832 3000 browser details YourSeq 288 854 2034 3000 93.7% chr10 - 7671410 8180404 508995 browser details YourSeq 252 904 2034 3000 90.2% chr1 - 33671099 33849592 178494 browser details YourSeq 166 507 1029 3000 90.3% chr15 - 98071462 98138517 67056 browser details YourSeq 162 431 1028 3000 83.3% chr10 - 71314048 71314432 385 browser details YourSeq 159 507 1029 3000 92.6% chr11 - 80358689 80359234 546 browser details YourSeq 157 845 1028 3000 94.5% chr4 - 130577481 130578149 669 browser details YourSeq 157 845 1029 3000 93.0% chr12 + 8209665 8209855 191 browser details YourSeq 156 853 1029 3000 96.0% chr14 - 121394905 121395087 183 browser details YourSeq 156 844 1030 3000 92.6% chr1 + 44109259 44109451 193 browser details YourSeq 155 853 1459 3000 84.9% chr8 - 106965235 106965799 565 browser details YourSeq 155 852 1030 3000 93.9% chr3 - 52993091 52993312 222 browser details YourSeq 155 844 1029 3000 92.5% chr17 - 34938939 34939131 193 browser details YourSeq 155 848 1028 3000 93.4% chr14 + 57584737 57594842 10106 browser details YourSeq 154 853 1028 3000 94.4% chr15 - 100044332 100044550 219 browser details YourSeq 154 853 1028 3000 94.3% chr15 - 100236650 100236829 180 browser details YourSeq 154 849 1028 3000 93.9% chr1 - 60145870 60146053 184 browser details YourSeq 154 842 1029 3000 92.5% chr11 + 98162405 98162765 361 browser details YourSeq 154 848 1029 3000 91.0% chr10 + 14592835 14593011 177 browser details YourSeq 153 853 1029 3000 93.8% chr11 - 95917782 95917963 182 Note: The 3000 bp section upstream of Exon 4 is BLAT searched against the genome. No significant similarity is found. BLAT Search Results (down) QUERY SCORE START END QSIZE IDENTITY CHROM STRAND START END SPAN ----------------------------------------------------------------------------------------------- browser details YourSeq 3000 1 3000 3000 100.0% chr6 + 113385912 113388911 3000 browser details YourSeq 468 613 1211 3000 93.6% chr1 + 172379010 172379628 619 browser details YourSeq 324 728 1213 3000 89.5% chr11 + 40712506 40713295 790 browser details YourSeq 105 793 942 3000 90.3% chr4 - 136348094 136348255 162 browser details YourSeq 105 774 926 3000 87.8% chr2 + 112488858 112489011 154 browser details YourSeq 99 811 957 3000 87.4% chr10 + 62933094 62933541 448 browser details YourSeq 98 833 1277 3000 92.4% chr15 + 31992474 31993064 591 browser details YourSeq 91 773 904 3000 84.3% chr17 + 36859653 36859781 129 browser details YourSeq 90 807 926 3000 91.1% chr8 + 124496782 124496911 130 browser details YourSeq 90 774 925 3000 81.3% chr19 + 19764394 19764524 131 browser details YourSeq 88 795 925 3000 88.5% chr13 - 62067140 62067270 131 browser details YourSeq 88 817 933 3000 90.2% chr4 + 101529563 101529682 120 browser details YourSeq 85 830 995 3000 88.2% chr12 + 85210683 85210910 228 browser details YourSeq 85 803 926 3000 92.3% chr1 + 75294771 75294906 136 browser details YourSeq 84 775 923 3000 82.2% chr15 + 76326035 76326165 131 browser details YourSeq 83 814 923 3000 92.9% chr5 - 71019043 71019153 111 browser details YourSeq 83 803 923 3000 88.0% chr16 - 20448590 20448710 121 browser details YourSeq 82 794 904 3000 88.7% chr1 - 153426330 153426452 123 browser details YourSeq 81 795 925 3000 89.4% chr15 - 7437291 7437423 133 browser details YourSeq 81 719 930 3000 75.3% chr14 - 24152156 24152274 119 Note: The 3000 bp section downstream of Exon 5 is BLAT searched against the genome. No significant similarity is found. Page 4 of 8 https://www.alphaknockout.com Gene and protein information: Arpc4 actin related protein 2/3 complex, subunit 4 [ Mus musculus (house mouse) ] Gene ID: 68089, updated on 12-Aug-2019 Gene summary Official Symbol Arpc4 provided by MGI Official Full Name actin related protein 2/3 complex, subunit 4 provided by MGI Primary source MGI:MGI:1915339 See related Ensembl:ENSMUSG00000079426 Gene type protein coding RefSeq status VALIDATED Organism Mus musculus Lineage Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus Also known as 20kDa; p20-Arc; AI327076; 5330419I20Rik Expression Ubiquitous expression in large intestine adult (RPKM 58.0), placenta adult (RPKM 48.0) and 28 other tissues See more Orthologs human all Genomic context Location: 6; 6 E3 See Arpc4 in Genome Data Viewer Exon count: 6 Annotation release Status Assembly Chr Location 108 current GRCm38.p6 (GCF_000001635.26) 6 NC_000072.6 (113378113..113390447) Build 37.2 previous assembly MGSCv37 (GCF_000001635.18) 6 NC_000072.5 (113328107..113340441) Chromosome 6 - NC_000072.6 Page 5 of 8 https://www.alphaknockout.com Transcript information: This gene has 4 transcripts Gene: Arpc4 ENSMUSG00000079426 Description actin related protein 2/3 complex, subunit 4 [Source:MGI Symbol;Acc:MGI:1915339] Gene Synonyms 5330419I20Rik, p20-Arc Location Chromosome 6: 113,378,115-113,390,448 forward strand. GRCm38:CM000999.2 About this gene This gene has 4 transcripts (splice variants), 256 orthologues, is a member of 1 Ensembl protein family and is associated with 7 phenotypes. Transcripts Name Transcript ID bp Protein Translation ID Biotype CCDS UniProt Flags Arpc4-201 ENSMUST00000156898.4 2270 168aa ENSMUSP00000114839.1 Protein coding CCDS20417 P59999 TSL:1 GENCODE basic APPRIS P1 Arpc4-203 ENSMUST00000203578.2 1323 78aa ENSMUSP00000145344.1 Protein coding CCDS85117 Q3TX55 TSL:1 GENCODE basic Arpc4-204 ENSMUST00000204802.1 794 78aa ENSMUSP00000144751.1 Protein coding CCDS85117 Q3TX55 TSL:3 GENCODE basic Arpc4-202 ENSMUST00000171058.7 695 91aa ENSMUSP00000131690.1 Protein coding CCDS51871 E9PWA7 TSL:5 GENCODE basic Page 6 of 8 https://www.alphaknockout.com 32.33 kb Forward strand 113.37Mb 113.38Mb 113.39Mb 113.40Mb Genes (Comprehensive set... Arpc4-201 >protein coding Ttll3-208 >lncRNA Arpc4-203 >protein coding Ttll3-201 >protein coding Arpc4-202 >protein coding Ttll3-206 >protein coding Arpc4-204 >protein coding Ttll3-202 >protein coding Ttll3-203 >protein coding Ttll3-209 >nonsense mediated decay Ttll3-205 >retained intron Contigs AC155287.6 > AC153910.6 > Genes < Tada3-201protein coding (Comprehensive set... < Tada3-203protein coding < Tada3-202protein coding < Tada3-206retained intron < Tada3-205retained intron < Tada3-204retained intron < Tada3-207protein coding Regulatory Build 113.37Mb 113.38Mb 113.39Mb 113.40Mb Reverse strand 32.33 kb Regulation Legend CTCF Enhancer Open Chromatin Promoter Promoter Flank Gene Legend Protein Coding merged Ensembl/Havana Ensembl protein coding Non-Protein Coding processed transcript RNA gene Page 7 of 8 https://www.alphaknockout.com Transcript: ENSMUST00000156898 12.33 kb Forward strand Arpc4-201 >protein coding ENSMUSP00000114... Superfamily Arp2/3 complex subunit 2/4 Pfam Actin-related protein 2/3 complex subunit 4 PIRSF Actin-related protein 2/3 complex subunit 4 PANTHER Actin-related protein 2/3 complex subunit 4 Gene3D Arp2/3 complex subunit 2/4 All sequence SNPs/i... Sequence variants (dbSNP and all other sources) Variant Legend synonymous variant Scale bar 0 20 40 60 80 100 120 140 168 We wish to acknowledge the following valuable scientific information resources: Ensembl, MGI, NCBI, UCSC. Page 8 of 8.
Load more

Recommended publications
  • Advancing a Clinically Relevant Perspective of the Clonal Nature of Cancer
    Advancing a clinically relevant perspective of the clonal nature of cancer Christian Ruiza,b, Elizabeth Lenkiewicza, Lisa Eversa, Tara Holleya, Alex Robesona, Jeffrey Kieferc, Michael J. Demeurea,d, Michael A. Hollingsworthe, Michael Shenf, Donna Prunkardf, Peter S. Rabinovitchf, Tobias Zellwegerg, Spyro Moussesc, Jeffrey M. Trenta,h, John D. Carpteni, Lukas Bubendorfb, Daniel Von Hoffa,d, and Michael T. Barretta,1 aClinical Translational Research Division, Translational Genomics Research Institute, Scottsdale, AZ 85259; bInstitute for Pathology, University Hospital Basel, University of Basel, 4031 Basel, Switzerland; cGenetic Basis of Human Disease, Translational Genomics Research Institute, Phoenix, AZ 85004; dVirginia G. Piper Cancer Center, Scottsdale Healthcare, Scottsdale, AZ 85258; eEppley Institute for Research in Cancer and Allied Diseases, Nebraska Medical Center, Omaha, NE 68198; fDepartment of Pathology, University of Washington, Seattle, WA 98105; gDivision of Urology, St. Claraspital and University of Basel, 4058 Basel, Switzerland; hVan Andel Research Institute, Grand Rapids, MI 49503; and iIntegrated Cancer Genomics Division, Translational Genomics Research Institute, Phoenix, AZ 85004 Edited* by George F. Vande Woude, Van Andel Research Institute, Grand Rapids, MI, and approved June 10, 2011 (received for review March 11, 2011) Cancers frequently arise as a result of an acquired genomic insta- on the basis of morphology alone (8). Thus, the application of bility and the subsequent clonal evolution of neoplastic cells with purification methods such as laser capture microdissection does variable patterns of genetic aberrations. Thus, the presence and not resolve the complexities of many samples. A second approach behaviors of distinct clonal populations in each patient’s tumor is to passage tumor biopsies in tissue culture or in xenografts (4, 9– may underlie multiple clinical phenotypes in cancers.
    [Show full text]
  • Supplemental Information
    Supplemental information Dissection of the genomic structure of the miR-183/96/182 gene. Previously, we showed that the miR-183/96/182 cluster is an intergenic miRNA cluster, located in a ~60-kb interval between the genes encoding nuclear respiratory factor-1 (Nrf1) and ubiquitin-conjugating enzyme E2H (Ube2h) on mouse chr6qA3.3 (1). To start to uncover the genomic structure of the miR- 183/96/182 gene, we first studied genomic features around miR-183/96/182 in the UCSC genome browser (http://genome.UCSC.edu/), and identified two CpG islands 3.4-6.5 kb 5’ of pre-miR-183, the most 5’ miRNA of the cluster (Fig. 1A; Fig. S1 and Seq. S1). A cDNA clone, AK044220, located at 3.2-4.6 kb 5’ to pre-miR-183, encompasses the second CpG island (Fig. 1A; Fig. S1). We hypothesized that this cDNA clone was derived from 5’ exon(s) of the primary transcript of the miR-183/96/182 gene, as CpG islands are often associated with promoters (2). Supporting this hypothesis, multiple expressed sequences detected by gene-trap clones, including clone D016D06 (3, 4), were co-localized with the cDNA clone AK044220 (Fig. 1A; Fig. S1). Clone D016D06, deposited by the German GeneTrap Consortium (GGTC) (http://tikus.gsf.de) (3, 4), was derived from insertion of a retroviral construct, rFlpROSAβgeo in 129S2 ES cells (Fig. 1A and C). The rFlpROSAβgeo construct carries a promoterless reporter gene, the β−geo cassette - an in-frame fusion of the β-galactosidase and neomycin resistance (Neor) gene (5), with a splicing acceptor (SA) immediately upstream, and a polyA signal downstream of the β−geo cassette (Fig.
    [Show full text]
  • Role and Regulation of the P53-Homolog P73 in the Transformation of Normal Human Fibroblasts
    Role and regulation of the p53-homolog p73 in the transformation of normal human fibroblasts Dissertation zur Erlangung des naturwissenschaftlichen Doktorgrades der Bayerischen Julius-Maximilians-Universität Würzburg vorgelegt von Lars Hofmann aus Aschaffenburg Würzburg 2007 Eingereicht am Mitglieder der Promotionskommission: Vorsitzender: Prof. Dr. Dr. Martin J. Müller Gutachter: Prof. Dr. Michael P. Schön Gutachter : Prof. Dr. Georg Krohne Tag des Promotionskolloquiums: Doktorurkunde ausgehändigt am Erklärung Hiermit erkläre ich, dass ich die vorliegende Arbeit selbständig angefertigt und keine anderen als die angegebenen Hilfsmittel und Quellen verwendet habe. Diese Arbeit wurde weder in gleicher noch in ähnlicher Form in einem anderen Prüfungsverfahren vorgelegt. Ich habe früher, außer den mit dem Zulassungsgesuch urkundlichen Graden, keine weiteren akademischen Grade erworben und zu erwerben gesucht. Würzburg, Lars Hofmann Content SUMMARY ................................................................................................................ IV ZUSAMMENFASSUNG ............................................................................................. V 1. INTRODUCTION ................................................................................................. 1 1.1. Molecular basics of cancer .......................................................................................... 1 1.2. Early research on tumorigenesis ................................................................................. 3 1.3. Developing
    [Show full text]
  • Requirements for Arabidopsis ATARP2 and ATARP3 During Epidermal Development
    Current Biology, Vol. 13, 1341–1347, August 5, 2003, 2003 Elsevier Science Ltd. All rights reserved. DOI 10.1016/S0960-9822(03)00493-7 Requirements for Arabidopsis ATARP2 and ATARP3 during Epidermal Development Jie Le, Salah El-Din El-Assal, Dipanwita Basu, stage-specific swelling and reduced branch elongation Mohamed E. Saad, and Daniel B. Szymanski* defects (data not shown). Because dis1-1 was a pre- Agronomy Department dicted null allele of DIS1 (see below), we used this allele Purdue University for all of our detailed phenotypic characterizations. Mea- Lily Hall surements with scanning electron microscopy (SEM) 915 West State Street demonstrated that 40% (n ϭ 43) of dis1-1 stage 4 tri- West Lafayette, Indiana 47907-2054 chomes had a cell diameter of more than 30 ␮m. In the wild-type, a stage 4 cell diameter exceeding 30 ␮m was not observed in either this (n ϭ 45) or previous studies Summary [4]. During stage 6, papillae or tubercles decorate the surface of highly expanded trichomes. Papillae on the Plant cells employ the actin cytoskeleton to stably stalks of wild-type trichomes were slightly oval and var- ␮ ف ␮ ف position organelles, as tracks for long distance trans- ied in length from 1.5 mto 3 m (Figure 1C). In port, and to reorganize the cytoplasm in response to mature dis1 trichomes, papillae at the tips of abortive developmental and environmental cues [1]. While di- branches were often absent (Figure 1D). In obviously ␮ ف verse classes of actin binding proteins have been im- swollen regions of the stalk, papillae up to 9 min plicated in growth control, the mechanisms of cy- length were common.
    [Show full text]
  • Tumour-Stroma Signalling in Cancer Cell Motility and Metastasis
    Tumour-Stroma Signalling in Cancer Cell Motility and Metastasis by Valbona Luga A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy, Department of Molecular Genetics, University of Toronto © Copyright by Valbona Luga, 2013 Tumour-Stroma Signalling in Cancer Cell Motility and Metastasis Valbona Luga Doctor of Philosophy Department of Molecular Genetics University of Toronto 2013 Abstract The tumour-associated stroma, consisting of fibroblasts, inflammatory cells, vasculature and extracellular matrix proteins, plays a critical role in tumour growth, but how it regulates cancer cell migration and metastasis is poorly understood. The Wnt-planar cell polarity (PCP) pathway regulates convergent extension movements in vertebrate development. However, it is unclear whether this pathway also functions in cancer cell migration. In addition, the factors that mobilize long-range signalling of Wnt morphogens, which are tightly associated with the plasma membrane, have yet to be completely characterized. Here, I show that fibroblasts secrete membrane microvesicles of endocytic origin, termed exosomes, which promote tumour cell protrusive activity, motility and metastasis via the exosome component Cd81. In addition, I demonstrate that fibroblast exosomes activate autocrine Wnt-PCP signalling in breast cancer cells as detected by the association of Wnt with Fzd receptors and the asymmetric distribution of Fzd-Dvl and Vangl-Pk complexes in exosome-stimulated cancer cell protrusive structures. Moreover, I show that Pk expression in breast cancer cells is essential for fibroblast-stimulated cancer cell metastasis. Lastly, I reveal that trafficking in cancer cells promotes tethering of autocrine Wnt11 to fibroblast exosomes. These studies further our understanding of the role of ii the tumour-associated stroma in cancer metastasis and bring us closer to a more targeted approach for the treatment of cancer spread.
    [Show full text]
  • Oral Administration of Lactobacillus Plantarum 299V
    Genes Nutr (2015) 10:10 DOI 10.1007/s12263-015-0461-7 RESEARCH PAPER Oral administration of Lactobacillus plantarum 299v modulates gene expression in the ileum of pigs: prediction of crosstalk between intestinal immune cells and sub-mucosal adipocytes 1 1,4 1,5 1 Marcel Hulst • Gabriele Gross • Yaping Liu • Arjan Hoekman • 2 1,3 1,3 Theo Niewold • Jan van der Meulen • Mari Smits Received: 19 November 2014 / Accepted: 28 March 2015 / Published online: 11 April 2015 Ó The Author(s) 2015. This article is published with open access at Springerlink.com Abstract To study host–probiotic interactions in parts of ileum. A higher expression level of several B cell-specific the intestine only accessible in humans by surgery (je- transcription factors/regulators was observed, suggesting junum, ileum and colon), pigs were used as model for that an influx of B cells from the periphery to the ileum humans. Groups of eight 6-week-old pigs were repeatedly and/or the proliferation of progenitor B cells to IgA-com- orally administered with 5 9 1012 CFU Lactobacillus mitted plasma cells in the Peyer’s patches of the ileum was plantarum 299v (L. plantarum 299v) or PBS, starting with stimulated. Genes coding for enzymes that metabolize a single dose followed by three consecutive daily dosings leukotriene B4, 1,25-dihydroxyvitamin D3 and steroids 10 days later. Gene expression was assessed with pooled were regulated in the ileum. Bioinformatics analysis pre- RNA samples isolated from jejunum, ileum and colon dicted that these metabolites may play a role in the scrapings of the eight pigs per group using Affymetrix crosstalk between intestinal immune cells and sub-mucosal porcine microarrays.
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name actin related protein 2/3 complex, subunit 4, 20kDa Gene Symbol ARPC4 Organism Human Gene Summary This gene encodes one of seven subunits of the human Arp2/3 protein complex. This complex controls actin polymerization in cells and has been conserved throughout eukaryotic evolution. This gene encodes the p20 subunit which is necessary for actin nucleation and high-affinity binding to F-actin. Alternative splicing results in multiple transcript variants. Naturally occurring read-through transcription exists between this gene and the downstream tubulin tyrosine ligase-like family member 3 (TTLL3) which results in the production of a fusion protein. Gene Aliases ARC20, MGC13544, P20-ARC RefSeq Accession No. NC_000003.11, NT_022517.18 UniGene ID Hs.323342 Ensembl Gene ID ENSG00000241553 Entrez Gene ID 10093 Assay Information Unique Assay ID qHsaCED0002460 Assay Type SYBR® Green Detected Coding Transcript(s) ENST00000498623, ENST00000397261, ENST00000433034, ENST00000287613 Amplicon Context Sequence TTTTAAACCATCTGGCTGGATCTCGTGGCCTTCCCCCTCAGACTACCCATGTCTC CACGAAGGCGTCCTGGAGTCACTCCCCGAGCAGCG Amplicon Length (bp) 60 Chromosome Location 3:9847894-9847983 Assay Design Exonic Purification Desalted Validation Results Efficiency (%) 104 R2 0.9987 cDNA Cq 19.57 cDNA Tm (Celsius) 81.5 Page 1/5 PrimePCR™Assay Validation Report gDNA Cq 24.52 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 2/5 PrimePCR™Assay Validation Report ARPC4,
    [Show full text]
  • 4036.Full.Pdf
    The Journal of Immunology Disruption of Thrombocyte and T Lymphocyte Development by a Mutation in ARPC1B Raz Somech,*,† Atar Lev,*,† Yu Nee Lee,*,† Amos J. Simon,*,†,‡ Ortal Barel,†,x Ginette Schiby,{ Camila Avivi,{ Iris Barshack,{ Michele Rhodes,‖ Jiejing Yin,‖ Minshi Wang,‖ Yibin Yang,‖ Jennifer Rhodes,‖ Nufar Marcus,# Ben-Zion Garty,# Jerry Stein,** Ninette Amariglio,†,‡,x,†† Gideon Rechavi,†,x David L. Wiest,‖,1 and Yong Zhang‖,1 Regulation of the actin cytoskeleton is crucial for normal development and function of the immune system, as evidenced by the severe immune abnormalities exhibited by patients bearing inactivating mutations in the Wiskott–Aldrich syndrome protein (WASP), a key regulator of actin dynamics. WASP exerts its effects on actin dynamics through a multisubunit complex termed Arp2/3. Despite the critical role played by Arp2/3 as an effector of WASP-mediated control over actin polymerization, mutations in protein components of the Arp2/3 complex had not previously been identified as a cause of immunodeficiency. Here, we describe two brothers with hematopoietic and immunologic symptoms reminiscent of Wiskott–Aldrich syndrome (WAS). However, these patients lacked mutations in any of the genes previously associated with WAS. Whole-exome sequencing revealed a homozygous 2 bp deletion, n.c.G623DEL-TC (p.V208VfsX20), in Arp2/3 complex component ARPC1B that causes a frame shift resulting in premature termination. Modeling of the disease in zebrafish revealed that ARPC1B plays a critical role in supporting T cell and thrombocyte development. Moreover, the defects in development caused by ARPC1B loss could be rescued by the intact human ARPC1B ortholog, but not by the p.V208VfsX20 variant identified in the patients.
    [Show full text]
  • Genome-Wide CRISPR Screening Identifies TMEM106B As a Proviral Host Factor for SARS-Cov-2
    ARTICLES https://doi.org/10.1038/s41588-021-00805-2 Genome-wide CRISPR screening identifies TMEM106B as a proviral host factor for SARS-CoV-2 Jim Baggen 1 ✉ , Leentje Persoons 1,8, Els Vanstreels 1,8, Sander Jansen 1,8, Dominique Van Looveren 1,2, Bram Boeckx3,4, Vincent Geudens 5, Julie De Man1, Dirk Jochmans 1, Joost Wauters6, Els Wauters 5, Bart M. Vanaudenaerde5, Diether Lambrechts3,4, Johan Neyts1, Kai Dallmeier 1, Hendrik Jan Thibaut 1,2, Maarten Jacquemyn 1, Piet Maes7 and Dirk Daelemans 1 ✉ The ongoing COVID-19 pandemic has caused a global economic and health crisis. To identify host factors essential for corona- virus infection, we performed genome-wide functional genetic screens with severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) and human coronavirus 229E. These screens uncovered virus-specific as well as shared host factors, including TMEM41B and PI3K type 3. We discovered that SARS-CoV-2 requires the lysosomal protein TMEM106B to infect human cell lines and primary lung cells. TMEM106B overexpression enhanced SARS-CoV-2 infection as well as pseudovirus infection, sug- gesting a role in viral entry. Furthermore, single-cell RNA-sequencing of airway cells from patients with COVID-19 demonstrated that TMEM106B expression correlates with SARS-CoV-2 infection. The present study uncovered a collection of coronavirus host factors that may be exploited to develop drugs against SARS-CoV-2 infection or future zoonotic coronavirus outbreaks. he COVID-19 pandemic, caused by SARS-CoV-2, has to address the current high medical need, but also to quickly con- resulted in a worldwide health crisis1 and few effective drugs tain zoonotic events in the future.
    [Show full text]
  • Molecular Architecture of the Chick Vestibular Hair Bundle
    RE so UR c E Molecular architecture of the chick vestibular hair bundle Jung-Bum Shin1,2,8, Jocelyn F Krey2,8, Ahmed Hassan3, Zoltan Metlagel3, Andrew N Tauscher3, James M Pagana1,2, Nicholas E Sherman4, Erin D Jeffery4, Kateri J Spinelli2, Hongyu Zhao2, Phillip A Wilmarth5, Dongseok Choi6, Larry L David5, Manfred Auer3 & Peter G Barr-Gillespie2,7 Hair bundles of the inner ear have a specialized structure and protein composition that underlies their sensitivity to mechanical stimulation. Using mass spectrometry, we identified and quantified >1,100 proteins, present from a few to 400,000 copies per stereocilium, from purified chick bundles; 336 of these were significantly enriched in bundles. Bundle proteins that we detected have been shown to regulate cytoskeleton structure and dynamics, energy metabolism, phospholipid synthesis and cell signaling. Three-dimensional imaging using electron tomography allowed us to count the number of actin-actin cross-linkers and actin- membrane connectors; these values compared well to those obtained from mass spectrometry. Network analysis revealed several hub proteins, including RDX (radixin) and SLC9A3R2 (NHERF2), which interact with many bundle proteins and may perform functions essential for bundle structure and function. The quantitative mass spectrometry of bundle proteins reported here establishes a framework for future characterization of dynamic processes that shape bundle structure and function. An outstanding example of a specialized organelle devoted to a single ­identified those proteins selectively targeted to bundles. Many bundle- purpose, the vertebrate hair bundle transduces mechanical signals enriched proteins are expressed from deafness-associated genes, for the inner ear, converting sound and head movement to electrical confirming their essential function in the inner ear.
    [Show full text]
  • Table S1. 103 Ferroptosis-Related Genes Retrieved from the Genecards
    Table S1. 103 ferroptosis-related genes retrieved from the GeneCards. Gene Symbol Description Category GPX4 Glutathione Peroxidase 4 Protein Coding AIFM2 Apoptosis Inducing Factor Mitochondria Associated 2 Protein Coding TP53 Tumor Protein P53 Protein Coding ACSL4 Acyl-CoA Synthetase Long Chain Family Member 4 Protein Coding SLC7A11 Solute Carrier Family 7 Member 11 Protein Coding VDAC2 Voltage Dependent Anion Channel 2 Protein Coding VDAC3 Voltage Dependent Anion Channel 3 Protein Coding ATG5 Autophagy Related 5 Protein Coding ATG7 Autophagy Related 7 Protein Coding NCOA4 Nuclear Receptor Coactivator 4 Protein Coding HMOX1 Heme Oxygenase 1 Protein Coding SLC3A2 Solute Carrier Family 3 Member 2 Protein Coding ALOX15 Arachidonate 15-Lipoxygenase Protein Coding BECN1 Beclin 1 Protein Coding PRKAA1 Protein Kinase AMP-Activated Catalytic Subunit Alpha 1 Protein Coding SAT1 Spermidine/Spermine N1-Acetyltransferase 1 Protein Coding NF2 Neurofibromin 2 Protein Coding YAP1 Yes1 Associated Transcriptional Regulator Protein Coding FTH1 Ferritin Heavy Chain 1 Protein Coding TF Transferrin Protein Coding TFRC Transferrin Receptor Protein Coding FTL Ferritin Light Chain Protein Coding CYBB Cytochrome B-245 Beta Chain Protein Coding GSS Glutathione Synthetase Protein Coding CP Ceruloplasmin Protein Coding PRNP Prion Protein Protein Coding SLC11A2 Solute Carrier Family 11 Member 2 Protein Coding SLC40A1 Solute Carrier Family 40 Member 1 Protein Coding STEAP3 STEAP3 Metalloreductase Protein Coding ACSL1 Acyl-CoA Synthetase Long Chain Family Member 1 Protein
    [Show full text]
  • An Actin-Filament-Binding Interface on the Arp2/3 Complex Is Critical for Nucleation and Branch Stability
    An actin-filament-binding interface on the Arp2/3 complex is critical for nucleation and branch stability Erin D. Goleya,2, Aravind Rammohanb,3, Elizabeth A. Znameroskia, Elif Nur Firat-Karalara, David Septb,4, and Matthew D. Welcha,1 aDepartment of Molecular and Cell Biology, University of California, Berkeley CA 94720; and bDepartment of Biomedical Engineering and Center for Computational Biology, Washington University, St. Louis, MO 63130 Edited* by Thomas D. Pollard, Yale University, New Haven, CT, and approved February 24, 2010 (received for review October 8, 2009) The Arp2/3 complex polymerizes new actin filaments from the branched filament geometry is proposed to be particularly suited sides of existing filaments, forming Y-branched networks that for harnessing actin polymerization to generate motile force (11). are critical for actin-mediated force generation. Binding of the Atomic-resolution structures of the Arp2/3 complex with and Arp2/3 complex to the sides of actin filaments is therefore central without bound nucleotide and inhibitors have been determined to its actin-nucleating and branching activities. Although a model (12–15). Moreover, structural models of the Y-branch junction of the Arp2/3 complex in filament branches has been proposed have been constructed using electron microscopy (16, 17), culmi- based on electron microscopy, this model has not been validated nating in a 2.6-nm resolution 3D model derived from docking using independent approaches, and the functional importance of crystal structures of Arp2/3 complex and actin into a reconstruc- predicted actin-binding residues has not been extensively tested. tion from electron tomography (18).
    [Show full text]