Cyddc Functions As a Cytoplasmic Cystine Reductase to Sensitize Escherichia Coli to Oxidative Stress and Aminoglycosides

CydDC functions as a cytoplasmic cystine reductase to sensitize Escherichia coli to oxidative stress and aminoglycosides

Alexander Mironova,b, Tatyana Sereginaa,b, Konstantin Shatalinc, Maxim Nagornykha, Rustem Shakulova, and Evgeny Nudlerc,d,1

aDepartment of Molecular Biology, Engelhardt Institute of Molecular Biology, Russian Academy of Science, 119991 Moscow, Russia; bCenter for Precision Genome Editing and Genetic Technologies for Biomedicine, Engelhardt Institute of Molecular Biology, Russian Academy of Sciences, 119991 Moscow, Russia; cDepartment of Biochemistry and Molecular Pharmacology, New York University School of Medicine, New York, NY 10016; and dHHMI, New York University School of Medicine, New York, NY 10016

Edited by James J. Collins, Massachusetts Institute of Technology, Boston, MA, and approved August 6, 2020 (received for review April 22, 2020)

L-cysteine is the source of all bacterial sulfurous biomolecules. dependent manner (10, 13, 14). However, whether CydDC is However, the cytoplasmic level of L-cysteine must be tightly reg- involved in exporting L-cysteine or GSH to the periplasm of living ulated due to its propensity to reduce iron and drive damaging cells remains unknown, as is the mechanism by which this complex Fenton chemistry. It has been proposed that in Escherichia coli the maintains the cellular redox status. component of cytochrome bd-I terminal oxidase, the CydDC com- Because of its highly labile nature, dynamic distribution be- plex, shuttles excessive L-cysteine from the cytoplasm to the peri- tween cellular compartments, and overall low concentration, direct plasm, thereby maintaining redox homeostasis. Here, we provide and accurate measurement of intracellular L-cysteine has been evidence for an alternative function of CydDC by demonstrating highly challenging, leading to inconclusive and sometime contra- that the cydD phenotype, unlike that of the bona fide L-cysteine eamA tcyP. dictory results (3, 8). Recently, we demonstrated that the accumu- exporter , parallels that of the L-cystine importer Chro- E. coli mosomal induction of eamA, but not of cydDC, from a strong lation of L-cysteine in directly correlates with the level of enzymatically produced H2S (15). The sequential action of cyto- pLtetO-1 promoter (Ptet) leads to the increased level of extracellu- BIOCHEMISTRY lar L-cysteine, whereas induction of cydDC or tcyP causes the ac- plasmic aspartate aminotransferase (AspC) and 3-mercaptopyruvate cumulation of cytoplasmic L-cysteine. Congruently, inactivation of sulfurtransferase (3MST) accounts for most H2Sproductionin cydD renders cells resistant to hydrogen peroxide and to amino- E. coli grown in rich media (15). Cytoplasmic AspC and 3MST, glycoside antibiotics. In contrast, induction of cydDC sensitizes which are constitutively expressed, utilize L-cysteine as their pri- cells to oxidative stress and aminoglycosides, which can be sup- mary substrate, helping to maintain its concentration at nontoxic pressed by eamA overexpression. Furthermore, inactivation of the levels under normal growth and stress conditions (15–17). Volatile fur) cydDC tcyP ferric uptake regulator ( in Ptet- or Ptet- cells results and freely diffusible 3MST-derived H2S can be readily detected in in dramatic loss of survival, whereas catalase (katG) overexpres- a growing culture. We used this quantitative measurement of in- sion suppresses the hypersensitivity of both strains to H2O2. tracellular L-cysteine to study the role of CydDC in the L-cysteine/ These results establish CydDC as a reducer of cytoplasmic cys- cystine shuttle system and its impact on cellular resistance to tine, as opposed to an L-cysteine exporter, and further elucidate a oxidative stress and antibiotics. link between oxidative stress, antibiotic resistance, and sulfur metabolism. Significance

bacteria | oxidative stress | L-cysteine | aminoglycosides | cytochrome The CydDC complex is involved in the assembly of cytochrome bd-I, a terminal oxidase of the respiratory chain required for -cysteine is an essential building block and source of redox- growth under low oxygen conditions. It has been suggested Lactive sulfhydryl groups for proteins, glutathione (GSH), and that CydDC shuttles excessive L-cysteine from the cytoplasm to many other biomolecules. Yet, L-cysteine is also toxic because of the periplasm, thereby maintaining bacterial redox homeosta- its ability to promote the Fenton reaction and generate damag- sis. Here, we demonstrate that the principle function of CydDC ing hydroxyl radicals (1–6). Therefore, bacterial cells maintain is in maintaining the reduced state of cytoplasmic L-cysteine, as the low level of intracellular L-cysteine by coordinating its bio- opposed to exporting L-cysteine, thereby providing an impor- synthesis, utilization, oxidation, and transport (7). Escherichia coli tcyP tcyJ, tant connection between sulfur metabolism, oxidative stress, Two L-cysteine/cystine importers, and and resistance to antibiotics. In particular, we establish the function synchronously with the L-cysteine exporter EamA (8) to critical role of cytoplasmic L-cysteine in mediating the toxicity constitute the L-cysteine/cystine shuttle system, which plays an of aminoglycosides. Thus, understanding the mechanisms that important role in oxidative stress tolerance by providing reducing control the bacterial redox state can lead to more effective equivalents to the periplasm (9). It has also been suggested that a strategies to counter bacterial resistance and tolerance. putative ABC-type transporter, CydDC, a heterodimeric compo- bd nent of cytochrome -I terminal oxidase, is involved in L-cysteine Author contributions: E.N. designed research; A.M., T.S., K.S., and M.N. performed re- efflux from the cytoplasm to the periplasm (10). Cells deficient in search; R.S. contributed new reagents/analytic tools; A.M., T.S., M.N., and R.S. analyzed cydD or cydC exhibit hypersensitivity to high concentrations of data; and E.N. wrote the paper. L-cysteine and DTT (10, 11), suggesting that CydDC could be The authors declare no competing interest. involved in periplasmic sulfhydryl homeostasis. Additional phe- This article is a PNAS Direct Submission. notypes of cydDC include temperature sensitivity and stationary Published under the PNAS license. phase arrest, which can be suppressed by exogenous reductants 1To whom correspondence may be addressed. Email: [email protected]. (12). The conclusion that CydDC exports L-cysteine and GSH to This article contains supporting information online at https://www.pnas.org/lookup/suppl/ the periplasm was based on the observation that everted membrane doi:10.1073/pnas.2007817117/-/DCSupplemental. vesicles uptake L-cysteine or GSH in an ATP- and CydDC-

www.pnas.org/cgi/doi/10.1073/pnas.2007817117 PNAS Latest Articles | 1of6 Downloaded by guest on October 1, 2021 Results and Discussion Ptet-mstA (SI Appendix,Fig.S1). The level of H2SinΔcydD cells -cydDC H S Production as a Function of the L-Cysteine/Cystine Shuttle System. was approximately the same as in the control, whereas Ptet 2 B To establish the relationship between the E. coli L-cysteine/cystine cells generated more H2S (Fig. 1 ), arguing that hyperactive L shuttle system and H2SproductionweutilizedH2S-deficient cells CydDC increases, and does not decrease, the level of -cysteine in (ΔmstA) and cells carrying a chromosomal copy of mstA under a the cytoplasm. Indeed, CydDC and EamA demonstrated the op- A B strong pLtetO-1 promoter (P -mstA) that generate ∼2.5-fold posite effects on H2S production (compare Fig. 1 and ). tet -cydDC ΔeamA more H S than do wild-type (WT) cells (15) (Fig. 1A). These Moreover, a combination of Ptet with further in- 2 ΔeamA -cydDC reference strains were used as the genetic backgrounds for the creased H2Sproductionascomparedto or Ptet B construction of chromosomal deletions and Ptet versions of the alone (Fig. 1 ). principle L-cysteine/cystine shuttle genes: tcyP and eamA (SI Ap- It has been noted that the overexpression of CydDC from a pendix,TableS1). Deletion of the L-cystine importer, tcyP,low- high-copy-number plasmid does not result in the accumulation of ered H2SinWTandPtet-mstA cells, whereas the inactivation of L-cysteine in the culture medium (18), contrary to what is expected the L-cysteine exporter eamA increases H2SinWTandPtet-mstA of a putative L-cysteine exporter. Accordingly, we also failed to - cells (Fig. 1A). The contrasting effects of tcyP and eamA on H2S detect any increase of L-cysteine in the culture medium of Ptet production became even more apparent when the two genes were cydDC cells, as compared to WT cells (Fig. 1C). In contrast, cells eamA overexpressed. Ptet-eamA cells exhibited a drastic drop in H2S overexpressing EamA (Ptet- ) significantly increased the production, whereas Ptet-tcyP cells produced substantially more H2S L-cysteine concentration in the growth medium. These data argue as compared to control cells (Fig. 1A). These results demonstrate that CydDC does not export reduced thiols from the cytoplasm. that the level of MstA-derived H2S reflects the distribution of We hypothesized that CydDC elevates the level of cytoplasmic L-cysteine/cystine between the cytoplasm and periplasm and can be L-cysteine, and, hence, that of MstA-derived H2S, by stimulating used to quantitatively assess the cytoplasmic L-cysteine content. cytoplasmic cystine reduction. Indeed, deleting cydD in Ptet-tcyP cells, which overproduce the dedicated cystine importer, diminished CydDC Does Not Export L-Cysteine from Cytoplasm, but Rather H2S production, whereas the addition of exogenous reductants such Reduces Cytoplasmic Cystine. It has been proposed that the as DTT, GSH, or L-cysteine restored the high level of H2Sinthose CydDC complex shuttles cytoplasmic L-cysteine (10), acting similarly cells (Fig. 1D). Taken together, these findings support the function to a dedicated L-cysteine exporter EamA. To test this hypothesis, we of the CydDC complex in maintaining the reduced state of the cy- placed a chromosomal copy of cydDC under Ptet and compared H2S toplasm, rather than exporting L-cysteine to the periplasm. production in this strain with that of ΔcydD. The expression of both E. Coli cydD and cydC by Ptet-cydDC cells was ∼20-fold higher compared CydDC Sensitizes to Oxidative Stress. The accumulation of with that in WT cells (SI Appendix,Fig.S1). No significant differ- cytoplasmic L-cysteine renders bacteria sensitive to H2O2 by pro- ence in growth rate was observed between the WT, ΔcydD,andPtet- moting the Fenton reaction (2, 3, 16). TcyP and EamA, therefore, cydDC cells (SI Appendix,Fig.S1). However, ΔcydD cells exhibited are important in H2O2 detoxification by curbing the amount of cy- a longer lag-phase, which was partially restored by introducing toplasmic L-cysteine, while also providing the reducing equivalents

A C

B D

Fig. 1. The CydDC complex is not involved in cysteine transport. (A) Opposite effects of the cystine importer (TcyP) and cysteine exporter (EamA) on H2S production. Pb(Ac)2-soaked paper strips show a PbS brown stain as a result of reaction with H2S. Strips were affixed to the inner wall of a culture tube above the level of the liquid culture of bacteria for 18 h. The values (percentages) are means from three experiments with a less than 10% margin of error. (B)

Overexpression or deletion of cydDC genes has little effect on H2S production in WT cells. (C) In contrast to EamA, CydDC overexpression does not increase extracellular cysteine concentration. Bacterial cultures were grown in M9 medium with 0.2% glucose to OD600 0.4. Samples were collected at different times by rapid filtration through 0.45-μm filters. The concentration of cysteine in samples was determined by the method of Gaitonde32.(D) In the background of

overexpressed tcyP, the deletion of cydD leads to diminished H2S production, which is reversed by the addition of DTT, GSH, or L-cysteine.

2of6 | www.pnas.org/cgi/doi/10.1073/pnas.2007817117 Mironov et al. Downloaded by guest on October 1, 2021 to the periplasm (8, 9). We reasoned that, in contrast to TcyP and which should diminish cystine import, also suppressed peroxide EamA, CydDC-mediated reduction of cystine in cytoplasm should toxicity (SI Appendix, Fig. S3). -cydDC render bacteria more sensitive to H2O2. To test this hypothesis, These results argue that the hypersensitivity of Ptet and -tcyP we performed survival experiments using serial dilutions of mid- Ptet cells to oxidative stress is due to the accumulation of exponential cultures of ΔtcyP, ΔeamA,andΔcydD mutants, which intracellular L-cysteine, which promotes the damaging Fenton were spotted onto H O -containing Luria-Bertani (LB) agar plates, reaction (2, 3, 16). Accordingly, we observed the largest decrease 2 2 -cydDC -tcyP followed by incubation at 30 °C for 24 h. As expected, TcyP- and in survivability of Ptet and Ptet cells after inactivating fur (Fig. 3 A and B). As expected, deleting fur in ΔcydD cells also EamA-deficient cells displayed increased sensitivity to H2O2,as compared to WT cells (Fig. 2A). Survival experiments (Fig. 2B and increased peroxide toxicity. Fur deficiency promotes the Fenton SI Appendix,Fig.S2andTableS2) also demonstrate that ΔcydD reaction due to the accumulation of intracellular free iron (19, 20). Furthermore, KatG overexpression suppressed the hyper- cells exhibited a substantially higher tolerance to H2O2 than did sensitivity of Ptet-cydDC and Ptet-tcyP cells to H2O2 (Fig. 3 A and WT cells. B zwf We next performed a complementary experiment using cells ). Consistently, inactivation of , which is responsible for tcyP, eamA cydD generation of NADPH, also suppressed the hypersensitivity of the overexpressing ,and from chromosomal Ptet. -cydDC EamA induction rendered cells more tolerant to peroxide (Fig. 2 A Ptet mutant to H2O2 (Fig. 3). The high similarity between the cydDC and tcyP phenotypes with respect to oxidative stress and B and SI Appendix, Fig. S2 and Table S2), consistent with suggests that while TcyP provides a high flux of cystine into the previously published data (8). In striking contrast, cells over- cytoplasm, CydDC is responsible for reducing it to L-cysteine. expressing CydDC showed a significantly higher sensitivity to To further support the role of CydDC in sensitizing E. coli to H2O2, as compared to WT cells. Notably, cells overexpressing TcyP - oxidative stress, we compared the activation of the DNA damage exhibited approximately the same hypersensitivity to H2O2 as Ptet response system (SOS response) between WT cells and cells cydDC cells (Fig. 2 A and B and SI Appendix, Fig. S2). bd lacking CydD or overproducing CydDC. We utilized a pCol- As CydDC participates in the assembly of the cytochrome -I D’::lux reporter plasmid to monitor SOS activation as a function complex, we examined whether the cydDC phenotypes we ob- of H2O2 concentrations (15). Fig. 3C displays the biolumines- served were due to the inactivation of bd-I. We constructed an cence induction as a function of H2O2 concentration in WT, isogenic cydB deletion as well as chromosomal P -cydAB in the tet ΔcydD, and Ptet-cydDC cells carrying pColD’::lux. In WT cells, same MG1655 background. Both mutants exhibited a similar SOS induction reached a maximum at ∼2mMH2O2 followed by sensitivity to H2O2 as did the WT cells (Figs. 2 and 3). Thus, the a decrease of bioluminescence due to cell death. In ΔcydD cells, cydD bd BIOCHEMISTRY increased resistance of to H2O2 cannot be explained by -I the bioluminescence intensity peaked at a significantly higher inactivation. H O concentration (∼7 mM). In contrast, the maximum SOS -cydDC 2 2 In liquid culture (LB), Ptet displayed no growth defects; response in Ptet-cydDC cells occurred at a much lower H2O2 C however, 2 mM H2O2 completely inhibited its growth (Fig. 2 ). concentration (∼0.6 mM). Remarkably, the introduction of ad- Remarkably, reducing the level of cytoplasmic L-cysteine in these ditional mutations, Ptet-eamA or Ptet-katG, led to a shift of bio- cells by overexpressing EamA greatly suppressed peroxide tox- luminescence intensity peaks at higher H2O2 concentrations (∼1 icity (Fig. 2 A–C). Likewise, deleting tcyP in Ptet-cydDC cells, and ∼4 mM, respectively). These results indicate that CydDC

Fig. 2. CydDC sensitizes cells to oxidative stress. (A) Representative efficiencies of colony formation of WT (MG1655) and mutant E. coli cells in the presence of

1.2 mM H2O2. Cells were spotted on LB agar plates in serial 10-fold dilutions and incubated at 30 °C for 24 h. (B) Overnight cultures of indicated E. coli strains were diluted with fresh LB 1:100 and grown to ∼2 × 107. H2O2 was added to 1.5 mM for 10 min. Cell survival was determined by counting cfu and is shown as the

mean ± SD from three independent experiments. (C) Overnight cultures of Ptet-cydDC (triangles) and Ptet-cydDC Ptet-eamA (circles) were inoculated in LB liquid medium and grown to OD600 ∼ 0.2 followed by the addition of 2 mM H2O2 (black) or water (white). Cells were grown in triplicate at 37 °C with aeration using a Bioscreen C automated growth analysis system. The curves represent the averaged values from three parallel experiments with a margin of error of less than 5%.

Mironov et al. PNAS Latest Articles | 3of6 Downloaded by guest on October 1, 2021 AB

Fig. 3. The survivability of Ptet-cydDC and Ptet-tcyP cell is drastically compromised by fur inactivation and rescued by katG overexpression. (A) Representative efficiencies of colony formation of WT and mutant E. coli cells in the presence of 1 mM H2O2. Cells were spotted on LB agar plates in serial 10-fold dilutions and incubated at 30 °C for 24 h. (B) Overnight cultures of indicated E. coli strains were diluted 1:100 with fresh LB and grown to ∼2 × 107. H2O2 was added to 1.5 mM for 10 min. Cell survival was determined by counting cfu and is shown as the mean ± SD from three independent experiments. (C) Overexpression of

CydDC renders cells more susceptible to DNA damage as evidenced by the lower H2O2 concentration necessary to induce the SOS response in Ptet-cydDC cells. The SOS response was monitored by bioluminescence of the lux biosensor (pColD:lux) in Ptet-cydDC,Ptet-cydDC Ptet-eamA,Ptet-cydDC Ptet-katG, ΔcydD,and WT cells in the presence of different concentrations of H2O2. J/Jk indicates the induction factor in percentage compared with the maximal intensity of bioluminescence of samples in the presence of H2O2. Values are means ± SD from three experiments.

activity is associated with the higher level of reactive oxygen species by promoting the accumulation of cytoplasmic L-cysteine, we (ROS) and compromises cellular tolerance to the Fenton reaction. hypothesized that CydDC should also sensitize bacteria to bactericidal antibiotics that cause rapid translational arrest and, E. coli CydDC Sensitizes to Aminoglycosides. The mounting body of hence, the accumulation of potentially unused reduced L-cysteine. evidence implicates ROS in antibiotic toxicity (21–24). Irre- To test this hypothesis, we examined the effect of cydD deletion spective of the primary cellular target, different classes of anti- and CydDC overexpression on the sensitivity of E. coli to members biotics appear to trigger a common chain of events leading to the of the aminoglycoside class of antibiotics, which effectively block oxidative damage of DNA and proteins that contribute to their ribosome translocation (26). Indeed, the ΔcydD mutant cells were lethality (25). As CydDC sensitizes E. coli cells to oxidative stress highly tolerant to gentamicin (Gm) and kanamycin (Km), whereas

Fig. 4. CydDC sensitizes cells to aminoglycosides. (A) Representative efficiencies of colony formation of WT and mutant E. coli cells in the presence of 1.5 μg/mL Gm and 4 μg/mL Km. Cells were spotted on LB agar plates in serial 10-fold dilutions and incubated at 30 °C for 24 h. (B) Overnight cultures of indicated E. coli strains were diluted 1:100 with fresh LB and grown to ∼2 × 107. Cells were then treated with Gm or Km, and after 90 min of incubation, samples were diluted and plated on LB agar and incubated at 37 °C for 24 h. Cell survival was determined by counting cfu and is shown as the mean ± SD from three independent experiments.

4of6 | www.pnas.org/cgi/doi/10.1073/pnas.2007817117 Mironov et al. Downloaded by guest on October 1, 2021 Ptet-cydDC cells were considerably more sensitive to these anti- Scientific) (30). P1 transduction was used to introduce mutations into new biotics than WT cells (Fig. 4 and SI Appendix, Fig. S4 and Table strains (31). When necessary, Cam or Kan drug resistance markers were ex- cised from strains using the FLP activity of pCP20, followed by loss of the S2). We suggest that the resistance of the ΔcydD mutant to H2O2 and antibiotics may be a consequence of decreased intracellular plasmid at the nonpermissive temperature (32). All mutations were verified by PCR and gel analysis. DNA manipulation and the transformation of E. coli cysteine pools, which hinders the Fenton reaction and, thereby, strains were performed according to standard methods (33). LB complete prevents hydroxyl radical formation. medium was used for the routine growth of E. coli. When appropriate, In support of this idea, we observed a sixfold increase in the antibiotics were added at 40 μg/mL (for Km), 30 μg/mL (for chlorampheni- level of cysB expression in the ΔcydD mutant (SI Appendix, Fig. col), and 100 μg/mL (for ampicillin). For solid medium, 1.5% agar was added. S5). CysB is a master transcriptional regulator of sulfur metab- eamA cydDC katG olism that senses the level of endogenous L-cysteine (27). As we Isolation of Ptet- ,Ptet- ,andPtet- Constructions. To construct cysB the eamA, cydDC, and katG overexpression strains the native promoter of showed earlier (15), the induction of is a consequence of R low intracellular cysteine. In contrast, the higher sensitivity of these genes was substituted by PLtet-O1 (34). Briefly, the P Ltet-O1-attL-Cm - P -cydDC cells to aminoglycosides (Fig. 4 and SI Appendix, Fig. attR cassette integrated into the AM3009 strain mstA gene (16) was ampli- tet fied with primers 5′-aagtaaattcagcta agttgattgcttacaaaagatcgctcaagttagtataaa- S4 and Table S2) is due to the transient accumulation of intra- aaagct-3′ and 5′-taccagtagcgccaacaccccatcttttcgcga catggtacctttctcctcttt- cellular L-cysteine. Consistently, the overexpression of 3MST, aatga-3′ (for eamA gene); 5′-gaacgctacctcgatggtttagctgacgcaaataacg ctcaag- which converts L-cysteine to H2S, suppressed the sensitivity of ttagtataaaaaagct-3 and 5′-ccagcgggttaactctttttgacgagatttattcatggtacctttctc- ′ ′ Ptet-cydDC cells to selected aminoglycosides (Fig. 4). Notably, ctctttaatga-3 (for cydDC genes); and 5 -gggaaaataaggttatcagccttgttttctccc- cells overexpressing TcyP exhibited approximately the same hy- tcacgctcaagttagtataaaaaagct-3′ and 5′-ggctgt ggtgttatggatatcgtctgacgtgct catggtacctttctcctctttaatga-3′ (for katG gene). The first primers contained persensitivity to antibiotics as did Ptet-cydDC cells, which can be suppressed by P -mstA (SI Appendix, Fig. S6). Remarkably, we the upstream region of eamA, cydDC, and katG genes and the sequence of tet attR, while the second primers contain the coding region of corresponding also found that the deletion of cysB, which prevents de novo genes and the sequence of PLtet-O1. The PCR fragments were transformed L-cysteine synthesis and import, led to an even greater resistance into MG1655 containing pKD46 (32). CmR clones were tested in the presence E. coli ΔcydD SI Appendix R of cells to aminoglycosides than ( , Fig. of the PLtet-O1-attL-Cm -attR cassette by PCR with primers 5′-cggcagtgcgtttcg- S7 and Table S2). Ptet-cydDC partially reversed this phenotype of ttatg-3′ and 5′-agccggaaaagcgaccagc-3′ (for eamA gene); 5′-acgtgatggatc- cysB. These results further demonstrate that the action of ami- acatttatcg 3′ and 5′-gcaatgatcaatatgccgctc-3′ (for cydDC gene); and 5′-gag- ′ ′ ′ noglycosides depends on intracellular reduced L-cysteine. cacaaaatgctgcctcg-3 and 5 -ccccgcactctggtcgtg-3 (for katG gene). All constructs In summary, our data demonstrate the requirement for the were sequenced for verification and introduced into corresponding chromo- CydDC complex in maintaining the reduced state of the bacterial somal loci according to ref. 30. All strains bearing Ptet constructs do not contain the tetR gene and, therefore, exhibit constitutive expression of target genes. BIOCHEMISTRY cytoplasm and support a model (Fig. 5) that explains the inter- play between CydDC, cysteine transport, and oxidative stress in E. coli Generation of Growth Curves. Growth curves were obtained on a Bioscreen C . The proposed model of CydDC function is consistent automated growth analysis system. Subcultures of specified strains were with available structural and biochemical data. Thus, it has been grown overnight at 37 °C, diluted 1:100 in fresh medium, inoculated into shown that CydDC binds heme very tightly (28). Whereas heme honeycomb wells in triplicate, and grown at 37 °C with maximum shaking on is unlikely to play any specific role in the transport of thiols, it may the platform of the Bioscreen C instrument. When the cultures reached an well be a constituent of a reductase domain of CydDC, as it is in optical density (OD600) of 0.2, cells were treated by H2O2 (2 mM) and incu- many other known reductases. Furthermore, the cydD mutant and bated at 37 °C for 10 h. OD600 values were recorded automatically at spec- E. coli dsb mutants deficient in periplasmic thiol:disulfide oxido- ified times, and the means of the triplicate cultures were plotted. reductases display very similar phenotypes (29), implying that the Generation of Survival Curves. Overnight cultures were inoculated into LB and CydDC complex may also exhibit reductase activity. grown at 37 °C to ∼2 × 107 cells per mL. Cells were then treated with the

indicated concentration of H2O2, and after 10 or 20 min of incubation, cell Materials and Methods samples were diluted and plated on LB agar and incubated at 37 °C for 24 h. Strains and Growth Conditions. All E. coli strains used in this work are listed in Cell survival was determined by counting colony-forming units (cfu) and is SI Appendix, Table S1. BW25113 and their derivatives (single gene deletion shown as the mean ± SD from three independent experiments. For antibiotic mutants) were obtained from the E. coli Keio Knockout Collection (Thermo survival assays, overnight bacterial cultures were diluted 100-fold and grown at 37 °C to ∼2 × 107 cells per mL, treated with the indicated concentration of Gm or Km, and after 90 min of incubation, samples were diluted and plated on LB agar and incubated at 37 °C for 24 h. Cell survival was determined by counting cfu and is shown as the mean ± SD from three independent experiments. To determine representative efficiencies of colony formation, ∼ cells were grown to OD600 0.4, and serial 10-fold dilutions were spotted on LB agar plates containing the indicated concentrations of H2O2 or antibiotics and incubated at 30 °C for 24 h.

H2S Detection. H2S production in WT and mutant cells was monitored by a lead acetate detection method (35). Paper strips saturated by 2% of Pb(Ac)2 were affixed to the inner wall of a cultural tube, above the level of the liquid culture of WT or mutant bacteria. Overnight cultures were diluted 1:50 in LB and incubated for 18–20 h at 37 °C with aeration. Stained paper strips were scanned and quantified with an Alpha Imager (Imgen Technologies), and the results were normalized per ODs.

Determination of Extracellular Cysteine. Extracellular cysteine was determined Fig. 5. A model explaining the role of CydDC in maintaining redox ho- in 40-mL samples by the method of Gaitonde (36). Bacterial cultures were

meostasis in E. coli. The CydDC complex drives the conversion of cystine grown in M9 medium with 0.2% glucose to OD600 0.4. Samples were col- imported from the periplasm by TcyP to L-cysteine. Inactivation of cydD leads lected after valine addition (final concentration 5 mg/mL) at different times. to oxidation of the cytoplasm, prevents reduction of cystine to L-cysteine, Samples were taken by rapid filtration through 0.45-μm filters. The filtrates suppression of the Fenton reaction, and resistance to aminoglycosides. were concentrated to 0.5 mL using a rotary evaporator RV 10 (IKA) at 65°. Overexpression of CydDC results in hyperreduction of the cytoplasm, in- Perchloric acid (at final concentration of 0.5 mM) was added to the samples crease of reduced L-cysteine, promotion of the Fenton reaction, and to precipitate organic substances. After 30 min, the suspension was centri- hypersensitivity to aminoglycosides. fuged (8,000 × g for 5 min), the supernatant was adjusted to pH 8.5 with

Mironov et al. PNAS Latest Articles | 5of6 Downloaded by guest on October 1, 2021 KOH, frozen, and centrifuged to eliminate potassium perchlorate. The samples cgactttcgacaggacttcg-3′). One microliter of the reverse transcription reac- were then treated with 0.5 mL 50 mM dithiotreitol for 10 min. The reaction tions was used as a template for real-time PCR. The gene def encoding mixture contained 500 μLofsampleand500μLreactiveGaitonde(250mg peptide deformylase was used for normalization. Each real-time PCR mixture ninhydrine, 4 mL HCl, and 16 mL glacial acetic acid). Standard curves were (25 μL) contained 10 μL SYBR Green I PCR Master Mix (Syntol), 12 μL nuclease-

prepared with known amounts of cysteine, which were treated as samples. free H2O, 1 μLof10μM forward primer, 1 μLof10μM reverse primer, and 1 μL of DNA template. Amplifications were carried out using DTlite S1 Measurement of Luminescent Reaction of Lux Biosensors. The SOS response CyclerSystem (DNA Technology). Reaction products were analyzed using 2% was examined using a pColD’::lux hybrid plasmid (37). This plasmid is a de- agarose electrophoresis to confirm that the signals detected originated from rivative of the pDEW201 vector containing luxCDABE of Photorhabdus products of expected lengths. Each qRT-PCR was performed at least in luminescens under the control of the LexA-regulated Pcda promoter (38). triplicate, and average data are reported. Error bars correspond to the SD The overnight culture of strains containing the pColD’::lux plasmid were (Figs. 1 A–C,2A and B,3A and B, and 4B). diluted to a concentration of 107 cells/mL in fresh LB medium and grown under aeration at 30 °C until the early exponential growth phase. Two Antibiotic and H2O2 minimum inhibitory concentration (MIC) Determination. hundred-microliter aliquots were transferred into special cuvettes; one of Standardized MICs were determined by the modified broth microdilution them served as a control (4 mL distilled water was added to the control method specified by the Clinical and Laboratory Standards Institute (40). cuvette), and 4 mL of peroxide or mitomycin C were introduced at various Briefly, the test antibiotic or H2O2 was serially diluted twofold in 100 μLLB. concentrations into the other cuvettes. Samples of lux biosensors thus pre- The bacteria inoculum was 100 μLofa1.0× 106 cfu/mL dilution in LB. The pared were placed in front of a photomultiplier in the LMAO1 (Beckman) MIC was the lowest concentration of antibiotic or H2O2 that prevented luminometer, and the intensities of bioluminescence of cell suspensions turbidity after 24 h of incubation at 37 °C. were measured at various times. The samples were incubated at room temperature. Bioluminescence intensity was determined according to ref. 39. Data Availability. All study data are included in the main text and SI Appendix.

RNA Extraction and qRT-PCR. E. coli cells were grown until OD = 0.6, and 600 ACKNOWLEDGMENTS. We thank G. Zavilgelsky for providing pColD’::lux total RNA was extracted using the RNeasy Mini Kit (QIAGEN) according to plasmid. We are also grateful to the members of the O. Oktyabrsky labora- ’ the manufacturer s protocol. All RNA samples were treated with DNaseI tory for helpful discussions and assistance. This work was supported, in part, (Fermentas). Five hundred nanograms of total RNA were reverse-transcribed by Russian Science Foundation Grant 17-74-30030 (to A.M., T.S., M.N., and with 100U of SuperScript III enzyme from the First-Strand Synthesis Kit for R.S.), Grant 075-15-2019-1660 from the Ministry of Science and Higher Edu- RT-PCR (Invitrogen) according to the manufacturer’s protocol in the pres- cation of the Russian Federation (to A.M. and T.S.), Department of Defense ence of cysB gene specific primers (5′-caacaacttcgctatattgttgag-3′ and 5′-cat Grant PR171734, the Blavatnik Family Foundation, and the HHMI (to E.N.).

1. J. Carlsson, G. P. Granberg, G. K. Nyberg, M. B. Edlund, Bactericidal effect of cysteine 21. M. A. Kohanski, D. J. Dwyer, B. Hayete, C. A. Lawrence, J. J. Collins, A common exposed to atmospheric oxygen. Appl. Environ. Microbiol. 37, 383–390 (1979). mechanism of cellular death induced by bactericidal antibiotics. Cell 130, 797–810 2. E. H. Berglin, M. B. Edlund, G. K. Nyberg, J. Carlsson, Potentiation by L-cysteine of the (2007). bactericidal effect of hydrogen peroxide in Escherichia coli. J. Bacteriol. 152,81–88 22. X. Zhao, K. Drlica, Reactive oxygen species and the bacterial response to lethal stress. (1982). Curr. Opin. Microbiol. 21,1–6 (2014). 3. S. Park, J. A. Imlay, High levels of intracellular cysteine promote oxidative DNA 23. X. Zhao, Y. Hong, K. Drlica, Moving forward with reactive oxygen species involvement damage by driving the Fenton reaction. J. Bacteriol. 185, 1942–1950 (2003). in antimicrobial lethality. J. Antimicrob. Chemother. 70, 639–642 (2015). 4. A. L. Turnbull, M. G. Surette, Cysteine biosynthesis, oxidative stress and antibiotic 24. D. J. Dwyer et al., Antibiotics induce redox-related physiological alterations as part of resistance in Salmonella typhimurium. Res. Microbiol. 161, 643–650 (2010). their lethality. Proc. Natl. Acad. Sci. U.S.A. 111, E2100–E2109 (2014). 5. K. R. Chonoles Imlay, S. Korshunov, J. A. Imlay, Physiological roles and adverse effects 25. D. Dwyer, J. Collins, G. Walker, Unraveling the physiological complexities of antibiotic – of the two cystine importers of Escherichia coli. J. Bacteriol. 197, 3629 3644 (2015). lethality. Annu. Rev. Pharmacol. Toxicol. 55, 313–332 (2015). 6. L. Reitzer, Death by cystine: An adverse emergent property from a beneficial series of 26. A. Tsai et al., The impact of aminoglycosides on the dynamics of translation elon- – reactions. J. Bacteriol. 197, 3626 3628 (2015). gation. Cell Rep. 3, 497–508 (2013). 7. M. Loddeke et al., Anaerobic cysteine degradation and potential metabolic coordi- 27. N. M. Kredich, G. M. Tomkins, The enzymic synthesis of L-cysteine in Escherichia coli nation in Salmonella enterica and Escherichia coli. J. Bacteriol. 199, e00117-e17 (2017). and Salmonella typhimurium. J. Biol. Chem. 241, 4955–4965 (1966). 8. I. Ohtsu et al., The L-cysteine/L-cystine shuttle system provides reducing equivalents to 28. M. Yamashita et al., Structure and function of the bacterial heterodimeric ABC – the periplasm in Escherichia coli. J. Biol. Chem. 285, 17479 17487 (2010). transporter CydDC: Stimulation of ATPase activity by thiol and heme compounds. 9. I. Ohtsu et al., Uptake of L-cystine via an ABC transporter contributes defense of J. Biol. Chem. 289, 23177–23188 (2014). oxidative stress in the L-cystine export-dependent manner in Escherichia coli. PLoS 29. R. A. Fabianek, H. Hennecke, L. Thöny-Meyer, Periplasmic protein thiol:disulfide ox- One 10, e0120619 (2015). idoreductases of Escherichia coli. FEMS Microbiol. Rev. 24, 303–316 (2000). 10. M. S. Pittman et al., Cysteine is exported from the Escherichia coli cytoplasm by 30. T. Baba et al., Construction of Escherichia coli K-12 in-frame, single-gene knockout CydDC, an ATP-binding cassette-type transporter required for cytochrome assembly. mutants: The Keio collection. Mol. Syst. Biol. 2, 2006 0008 (2006). J. Biol. Chem. 277, 49841–49849 (2002). 31. J. H. Miller, Experiments in Molecular Genetics, (Cold Spring Harbor Laboratory Press, 11. B. S. Goldman, K. K. Gabbert, R. G. Kranz, Use of heme reporters for studies of cy- Cold Spring Harbor, NY, 1972). tochrome biosynthesis and heme transport. J. Bacteriol. 178, 6338–6347 (1996). 32. K. A. Datsenko, B. L. Wanner, One-step inactivation of chromosomal genes in Es- 12. B. S. Goldman, K. K. Gabbert, R. G. Kranz, The temperature-sensitive growth and cherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. U.S.A. 97, 6640–6645 survival phenotypes of Escherichia coli cydDC and cydAB strains are due to defi- (2000). ciencies in cytochrome bd and are corrected by exogenous catalase and reducing 33. J. Sambrook, E. Fritsch, T. Maniatis, Molecular Cloning: A Laboratory Manual, (Cold agents. J. Bacteriol. 178, 6348–6351 (1996). Spring Harbor Lab Press, Cold Spring Harbor, NY, ed. 2, 1989). 13. M. S. Pittman, H. C. Robinson, R. K. Poole, A bacterial glutathione transporter (Escherichia 34. R. Lutz, H. Bujard, Independent and tight regulation of transcriptional units in Es- coli CydDC) exports reductant to the periplasm. J. Biol. Chem. 280, 32254–32261 (2005). 14. L. V. Holyoake, R. K. Poole, M. Shepherd, The CydDC Family of transporters and their cherichia coli via the LacR/O, the TetR/O and AraC/I1-I2 regulatory elements. Nucleic – roles in oxidase assembly and homeostasis. Adv. Microb. Physiol. 66,1–53 (2015). Acids Res. 25, 1203 1210 (1997). 35. B. Forbes, A. Weissfeld, D. Sahm, Bailey & Scott’s Diagnostic Microbiology, (Mosby, St. 15. A. Mironov et al., Mechanism of H2S-mediated protection against oxidative stress in Escherichia coli. Proc. Natl. Acad. Sci. U.S.A. 114, 6022–6027 (2017). Louis, ed. 10, 1998). 36. M. K. Gaitonde, A spectrophotometric method for the direct determination of cysteine in 16. K. Shatalin, E. Shatalina, A. Mironov, E. Nudler, H2S: A universal defense against – antibiotics in bacteria. Science 334, 986–990 (2011). the presence of other naturally occurring amino acids. Biochem. J. 104,627 633 (1967). 17. L. Luhachack, A. Rasouly, I. Shamovsky, E. Nudler, Transcription factor YcjW controls 37. M. K. Winson et al., Engineering the luxCDABE genes from Photorhabdus uminescens to provide a bioluminescent reporter for constitutive and promoter probe plasmids the emergency H2S production in E. coli. Nat. Commun. 10, 2868 (2019). 18. L. V. Holyoake et al., CydDC-mediated reductant export in Escherichia coli controls the and mini-Tn5 constructs. FEMS Microbiol. Lett. 163, 193–202 (1998). transcriptional wiring of energy metabolism and combats nitrosative stress. Biochem. 38. V. Y. Kotova, I. V. Manukhov, G. B. Zavilgelsky, Lux-biosensors for detection of SOS J. 473, 693–701 (2016). response, heat shock, and oxidative stress. Appl. Biochem. Microbiol. 46,781–788 (2010). 19. D. Touati, M. Jacques, B. Tardat, L. Bouchard, S. Despied, Lethal oxidative damage and 39. G. B. Zavilgelsky, V. Y. Kotova, I. V. Manukhov, Action of 1,1-dimethylhydrazine on mutagenesis are generated by iron in delta fur mutants of Escherichia coli: Protective bacterial cells is determined by hydrogen peroxide. Mutat. Res. 634, 172–176 (2007). role of superoxide dismutase. J. Bacteriol. 177, 2305–2314 (1995). 40. F. Cockerill, Methods for Dilution Antimicrobial Susceptibility Test for Bacteria that 20. K. Keyer, A. S. Gort, J. A. Imlay, Superoxide and the production of oxidative DNA Grow Aerobically Approves Standard, (Clinical and Laboratory Standards Institute, ed. damage. J. Bacteriol. 177, 6782–6790 (1995). 10, 2015).

6of6 | www.pnas.org/cgi/doi/10.1073/pnas.2007817117 Mironov et al. Downloaded by guest on October 1, 2021