TARGETED MUTAGENESIS OF ZEBRAFISH HAIR CELL
MECHANOTRANSDUCTION-RELATED GENES USING CRISPR/CAS9
by
Shengxuan Wang
Submitted in partial fulfillment of the requirements
for the degree of Master of Science
Thesis Advisor:
Brian M. McDermott Jr., Ph.D.
Department of Biology
CASE WESTERN RESERVE UNIVERSITY
January, 2019
1 CASE WESTERN RESERVE UNIVERSITY
SCHOOL OF GRADUATE STUDIES
We here approve the thesis/dissertation of
Shengxuan Wang
Candidate for the Master of Science degree*.
Karen Abbott, Ph.D.
Chair of Committee
Brian M. McDermott, Ph.D.
Ruben Stepanyan, Ph.D.
Sarah Diamond, Ph.D.
(date) 08/29/2018
*We also verify the written approval has been obtained for any proprietary material contained there.
2 TABLE OF CONTENTS
LIST OF FIGURES ...... 4 ACKNOWLEDEGMENT ...... 5 LIST OF ABREVIATIONS ...... 6 ABSTRACT ...... 8 CHAPTER 1: INTRODUCTION ...... 9 Hearing ...... 10 Hair cell ...... 11 Tip link ...... 15 Zebrafish as a model organism...... 16 CRISPR/Cas9 ...... 17 CHAPTER 2: MATERIALS AND METHODS ...... 20 CHAPTER 3: TARGETING MET CHANNEL RELATED GENE USING CRISPR/CAS9 ...... 28 MET channel apparatus candidate genes ...... 29 TMC protein family ...... 30 LHFPL5 ...... 33 MACF1 ...... 34 RESULTS ...... 38 Using CRISPR/Cas9 to knock out tmc5 in zebrafish ...... 38 Using CRISPR/Cas9 to knock out lhfpl5b in zebrafish ...... 48 Using CRISPR/Cas9 to knock out macf1b in zebrafish ...... 54 DISCUSSION ...... 59 REFERENCE ...... 61
3 LIST OF FIGURES FIGURE 1………………………………………………………………………………………………………………………11 FIGURE 2………………………………………………………………………………………………………………………12 FIGURE 3………………………………………………………………………………………………………………………14 FIGURE 4………………………………………………………………………………………………………………………15 FIGURE 5………………………………………………………………………………………………………………………18 FIGURE 6………………………………………………………………………………………………………………………19 FIGURE 7………………………………………………………………………………………………………………………22 FIGURE 8………………………………………………………………………………………………………………………30 FIGURE 9………………………………………………………………………………………………………………………31 FIGURE 10…………………………………………………………………………………………………………………….34 FIGURE 11…………………………………………………………………………………………………………………….35 FIGURE 12……….……………………………………………………………………………………………………………36 FIGURE 13………………………………………………………………………………………………………………….…37 FIGURE 14………………………………………………………………………………………………………………….…39 FIGURE 15…………………………………………………………………………………………………………………….40 FIGURE 16…………………………………………………………………………………………………………….………43 FIGURE 17…………………………………………………………………………………………………………………….45 FIGURE 18…………………………………………………………………………………………………………………….46 FIGURE 19…………………………………………………………………………………………………………………….47 FIGURE 20…………………………………………………………………………………………………………………….48 FIGURE 21…………………………………………………………………………………………………………………….49 FIGURE 22…………………………………………………………………………………………………………………….51 FIGURE 23…………………………………………………………………………………………………………………….54 FIGURE 24…………………………………………………………………………………………………………………….56 FIGURE 25…………………………………………………………………………………………………………………….57 TABLE 1………………………………………………………………………………………………………………………..23 TABLE 2………………………………………………………………………………………………………………………..24 TABLE 3………………………………………………………………………………………………………………………..25
4 ACKNOWLEDGEMENT
First of all, I want to express my deepest and sincerest appreciation to my advisor
Dr. Brian M. McDermott. He encouraged me to chase my dream with his patience and caring, he lead my direction to science with his excellent guidance. Most importantly, he is a thoughtful friend that cares me and willing to support me as always.
I would also like to express gratitude to the rest of my committee members, Dr.
Ruben Stepanyan and DR. Sarah Diamond for their patience and encouragement. I greatly appreciate their time talking to me and answering my questions. Also I would like to express my thanks to the Department of Biology for the opportunity to let me study in a great university.
My special thanks to Shaoyuan Zhu and Zongwei Chen, they are good friends and always willing to instruct me to overcome difficulties in science. I would also like to thank other lab members, Ahlam Salameh, Hoa Nguyen, Kayla Kindig, Michael Dercoli, Shenyu
Sun. They give me many helps not only in research, but also in my life.
Finally, I would like to thank my parents and my boyfriend Yi Cai, they give me continuous love that are important more than everything in the world. They give me courage to face all the problems and difficulties in my life. Thank you for your support and
I will always love you.
5 List of Abbreviations
OHCs outer hair cells
IHCs inner hair cells
MET mechanotransduction channel
CDH23 cadherin 23
PCDH15 protocadherin 15 dpf days post fertilization
PCR polymerase chain reaction
ZFNs zinc-finger nuclease
TALENs transcription activator–like effector nucleases
CRISPR clustered regularly interspaced short palindromic repeats
Cas9 CRISPR associated protein 9
DSBs DNA double strand breaks sgRNA single-guide RNA (sgRNA) nt nucleotide
NEHJ nonhomologous end-joining
HDR homology-directed repair bp base pair
PAM protospacer adjacent motifs
BLAST basic local Alignment search tool
NCBI National Center for Biotechnology Information
PCR polymerase chain reaction
6 TMIE transmembrane inner ear
TMC transmembrane channel-like
LHFPL5 lipoma HMGIC fusion partner – like 5
TMHS tetraspan membrane protein of hair cell stereocilia
MACF1 microtubule actin cross-linking factor 1
ACF7 actin crosslinking family protein 7
ABD actin binding domain
GAR Gas2-related
AM anterior macula
PC posterior crista
UTR untranslated region
4-Di-2-ASP 4-(4-diethylaminostyryl)-1-methylpyridinium iodide
PFA paraformaldehyde
PBS phosphate buffered saline
GS goat serum crRNA CRISPR RNA tracrRNA trans-activating crRNA
7 Targeted mutagenesis of zebrafish hair cell
mechanotransduction-related genes using CRISPR/Cas9
Abstract
The senses of hearing and balance depend on sensory receptors called hair cells that exist in the ear. Hair cells convert mechanical stimuli into electrical signals and transmit them to the brain. These cells have a unique structure on their apical surface called the hair bundle that allows for mechanotransduction. This ensemble is composed of stereocilia that insert into the hair cell’s cuticular plate. Mechanotransduction is essential for normal hearing function, but the molecular identity of the mechanotransduction channel is still unknown. In this study, several genes that are potentially related to mechanotransduction channels have been successfully mutagenized using CRISPR/Cas9.
The resulting knock out fish can be studied to determine the role of each gene.
8
Chapter 1: Introduction
9 Hearing
Hearing is one of the most important senses in the human body. However, according to the estimates on the magnitude of disabling hearing loss by the World Health
Organization in 2012, 5.3% of the world’s population is suffering hearing loss. In 2018, around 466 million people worldwide have disabling hearing loss and 34 million of these are children. It is estimated that by 2050, over 900 million people will have disabling hearing loss. Therefore, it is extremely important to study the molecular mechanisms of hearing.
Hearing in humans relies on the structure of the ear, which collects the sound waves from vibrations in the air and translates them to neural impulses that are interpreted by the brain. The mammalian ear has three components: the outer ear, the middle ear and the inner ear (Figure 1). Of the outer ear, the most apparent part is the auricle. The auricle captures sound waves and transfer them to the middle ear through the external auditory canal. The middle ear is an air-filled pouch in which airborne sound stimulates the tympanum and leads to the vibration of three tiny bones: the malleus, incus, and stapes. The stapes is partially inserted into the oval window, which is a membrane-covered opening to the cochlea. Vibrations of the stapes stimulates the cochlea, thus transmitting the sound waves into the inner ear. The inner ear is composed of a cochlear and a vestibular system. The cochlea is responsible for hearing, and the vestibular system is responsible for balance. The cochlea is a coiled structure filled with liquid. In the cochlea, the organ of Corti is the receptor organ of sound. Vibrations of the fluid in the cochlea result in a shear motion between the tectorial membrane and the
10 basilar membrane, which triggers the depolarization of the hair cells and transduce the mechanical stimuli into the electrical signals (Figure 2).
Figure 1. The structure of the human ear. Figure adapted from Kandel et al., 2012.
Hair cell
There are two classes of hair cells in the mammalian cochlea, the outer hair cells
(OHCs) and the inner hair cells (IHCs). The mammalian cochlea contains one row of IHCs and three rows of OHCs (Figure 2). They have distinct functions. During a hearing process, the main function of IHCs is to translate sound into electrical signals, whereas the main
11
Figure 2. The organ of Corti. When vibrated, the up and down force between tectorial membrane and basilar membrane will be converted to back and forth deflection of the hair cells. Figure adapted from Fettiplace et al., 2006.
function of OHCs is to increase the amplitude of vibration, thus boosting the stimulus
(Fettiplace et al., 2006). Hair cells also exist in the vestibular organs. Protruding from the
12 apical surface of the hair cell is the hair bundle, which is composed of hundreds of actin- based stereocilia arranged in a staircase shape (Figure 3). The highest row of the stereocilia is adjacent to a single kinocilium, which is not essential for hearing and will degrade around the date of birth in the mammalian cochlea (Vollrath et al., 2007).
The mechanotransduction (MET) channel is located on tips of shorter stereocilium.
Due to the oscillation of the basilar membrane, stereocilia will deflect towards the kinocilium upon stimulation. Deflection of the bundle towards the tallest stereocilia will trigger the opening of the MET channel (LeMasurier, et al., 2005). After the opening of
MET channels, positive ions such as potassium and calcium will flow into the hair cell and result in depolarization of the hair cell. The voltage sensitive Ca2+ channels will open and allow calcium influx into the hair cell (Kandel et al., 2012). Elevated Ca2+ levels will result in the release of neurotransmitter at the glutamatergic synapses. Thus, mechanical stimulation is transduced to electrical signals and transferred to the afferent spiral ganglion neurons.
13
Figure 3. Inner hair cell. Around its apex, the hair cell is connected to the non-sensory supporting cells. Figure adapted from Kandel et al., 2012.
14 Tip link
MET channels are located near the tip of each stereocilium, and stereocilia are connected by tip links (Figure 4). Tip links are extracellular filaments that connect adjacent stereocilia of different heights (Kandel et al., 2012; Pepermans et al., 2015). The tip link is composed of protocadherin 15 (PCDH15), which forms the lower third of the tip links, and cadherin 23 (CDH23), which localizes to the upper two-thirds (Kazmierczak et al., 2007).
These two cadherins join in a Ca2+ sensitive manner (Kandel et al., 2012).
Figure 4. Diagram showing the tip link and the components of tip link. Protocadherin 15
(PCDH15) forms the lower third of the tip links, and cadherin 23 (CDH23) localize to the upper two third of the structure. Figure adapted from (Zhao, et al., 2015)
A rapid increase of calcium can be detected when the hair bundle is deflected.
Studies using high-speed calcium imaging show that MET channels only locate at the
15 lower end of the tip links (Beurg et al., 2009). How tip links regulate the opening of MET channels is still unknown. There are two probable models supported by electron micrographic images (Fettiplace et al., 2014). The first model suggests that MET channels are activated by the change of membrane tension. The other model suggests that MET channels are connected to the tip links and anchored into the cytoskeleton. Tip links act as force sensors to regulate the opening of MET channels.
Zebrafish as a model organism
Zebrafish (Danio rerio) have become an excellent model for researchers, not only in hearing-related studies, but also in other research areas. Zebrafish have both technical advantage and cost-effective advantages. First of all, zebrafish genes are close to human genes. According to the comparison between human and zebrafish reference genomes, zebrafish have 70% similarity to humans (Howe et al., 2013). Also, the transparency of zebrafish embryos and larvae enables the observation of phenotypic changes, and make it easier to directly observe fluorescent proteins under a microscope in live fish (Segner and Helmut, 2009).
Zebrafish have a much smaller size compared to rats and mice, which means that zebrafish are much easier to maintain. Usually, female could lay around 200 eggs every week. Most organs will mature at 4dpf (days post fertilization). Furthermore, zebrafish embryos can be easily manipulated because the mother’s eggs are fertilized externally
(Segner and Helmut, 2009).
16 At embryonic stage, zebrafish ear contains of 5 sensory patches: three cristae and two maculae. Multiple mutations that affect zebrafish ear structure have been isolated and at least 5 of them have provided models for human hearing loss (Whitifiel et al., 2002).
Furthermore, zebrafish have a lateral line system, which is a sensory system that is also present in amphibians. The lateral line system is responsible for water motion detection and also involves in other behaviors such as prey detection and mating (Dambly-
Chaudière et al., 2003). The lateral line consists of sets of sensory organs called neuromast along the head and body (Metcalfe et al., 1995; Ghysen et al., 2004). Hair cells that in neuromast are easily visualized using fluorescent dyes (Chiu et al., 2008), which makes the zebrafish to be a convenient model to study the hair cell in vivo.
In conclusion, zebrafish is an excellent model for studying both hearing disorders and other scientific topics.
CRISPR/Cas9 (clustered regularly interspaced short palindromic repeats)
To study a particular gene, multiple genomic engineering tools have been developed. These tools modify the DNA sequence of that particular gene, therefore, dissecting the gene’s function. These technologies include zinc-finger nuclease (ZFNs), transcription activator–like effector nucleases (TALENs), and CRISPR/Cas9 (CRISPR associated protein 9) (Figure 5). ZFNs and TALENS induce DNA double strand breaks
(DSBs) into targeted loci by tethering endonuclease DNA- cleavage domains (Ran et al.,
2013). In comparison, CRISPR/Cas9 uses a single-guide RNA (sgRNA) leading Cas9
17 nuclease to introduce a mutation in the target site. CRSIPR/Cas9 system is easy to design and more efficient (Ran et al., 2013).
Figure 5. (A) DSBs can be repaired in two ways: nonhomologous end-joining (NEHJ) and homology-directed repair (HDR). (B) Zinc finger (ZF) and transcription activator-like effectors (TALEs) recognize DNA-binding domains and assemble at targeted sequences.
(C) Cas9 nuclease, led by sgRNA, binds to a DNA target site and creates a double strand cleavage event. Figure adapted from Hsu et al., 2014.
The CRISPR/Cas9 system was first discovered from a bacteria immune system.
Bacteria use the CRISPR/Cas9 system to protect themselves from exogenous DNA like
18 plasmids or viruses (Sander et al., 2014). DNA pieces are stored in the bacteria as a
“memory” to recognize similar DNA sequences in the future. When these sequences are detected, they guide Cas proteins to cut them.
Cas9 is an RNA-guided DNA endonuclease. It belongs to the Cas protein family.
Cas9 is led by sgRNA that is 20-nucleotides (nt) long (Figure 6). The guide sequence is complementary to the DNA target site. The sgRNA sequence is followed by a 3-nt long protospacer adjacent motifs (PAM) (Gagnon et al., 2014). Cas9 creates a double-strand lesion in the DNA target site that is repaired either by nonhomologous end-joining (NEHJ) or homology-directed repair (HDR), if this strategy is being implemented. A mutation by deletion or insertion is expected in the target site.
Figure 6. Schematic of sgRNA and Cas9. Cas9 nuclease cuts the target site with the guidance of sgRNA. PAM sequence usually consists of NGG. In this specific example, cas9 creates nicks on both strands upstream of PAM (red triangle). Figure adapted from Ran et al., 2013.
19
Chapter 2: Materials and Methods
20 Zebrafish husbandry
Zebrafish from Tübingen strain were maintained and bred at 28 °C according to a standard zebrafish protocol. Zebrafish were kept with the approval of Case Western
Reserve University Animal Care and Use Committee.
CRISPR/cas9 target site design
Target sites were selected using the CHOPCHOP online tool
(http://chopchop.cbu.uib.no/). The CHOPCHOP online tool provides many options for target site selection (Montague et al., 2014). Selected target site sequences need to be further screened for their specificity; here we use the basic local Alignment search tool
(BLAST) from National Center for Biotechnology Information (NCBI). This tool allows us to screen target sites among the whole zebrafish genome, to make sure these target sites are specific within zebrafish.
SgRNA template generation and in vitro transcription
To generate sgRNA template, first a gene-specific oligo was generated (Figure 7).
This oligonucleotide consists of a T7 promoter (5ʹ-TAATACGACTCACTATA-3ʹ), a 20- nucleotide target site, and a region that is complementary with the constant oligo (5’-
AAAAGCACCGACTCGGTGCCACTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATT
TCTAGCTCTAAAAC-3’). The target site oligo and constant oligo were purchased from
Integrated DNA Technologies, Inc. Then the gene-specific oligo and constant oligo were annealed together. T4 DNA polymerase (New England Biolab) and dNTPs (Invitrogen)
21 were used to fill in the single-strand overhangs. The double strand DNA template was then purified using an EZ-10 Spin Column PCR Products Purification Kit from Bio Basic Inc.
The purified DNA’s length needs to be verified by electrophoresis. At the end, the DNA double strands were transcribed into sgRNA using the mMESSAGE mMACHINE T7
Transcription Kit from Thermo Fisher Scientific Inc.
Figure 7: SgRNA template was assembled using gene-specific oligo and constant oligo, and filled in with T4 DNA polymerase. The template was then purified and transcribed into a sgRNA. Figure adapted from Gagnon et al., 2014.
Microinjection
Here we use both Cas9 mRNA and protein in different editing protocols. Cas9 mRNA was generated by in vitro transcription using a mMESSAGE mMACHINE SP6
22 Transcription kit from Thermo Fisher Scientific Inc. Cas9 protein was purchased from PNA
BIO INC. For Cas9 mRNA, the construct for injection was mixed with sgRNA, Cas9 mRNA, phenol red, and Danieau’s buffer (58 mM NaCl, 0.7 mM KCl, 0.4 mM MgSO4, 0.6 mM
Ca(NO3)2, 5 Mm HEPES, pH=7.6). For Cas9 protein, the construct for injection was mixed with sgRNA, Cas9 protein, phenol red, and DEPC-treated water. The volume and concentration of each component are listed in Table 1.
Table 1: Injection mixture for tmc5, lhfpl5b and macf1b.
Component Volume Final Concentration tmc5 CRISPR38 sgRNA (825 ng/μL) 2.2 μL 300 ng/μL
Cas9 mRNA (1300ng/μL) 1.6 μL 350 ng/μL
0.5% Phenol red 1 μL 0.08%
1 x Danieau’s Buffer To 6 μL lhfpl5b CRISPR3 sgRNA (1195ng/ μL) 1.5 μL 300 ng/μL
Cas9 mRNA (1300ng/μL) 1.6 μL 350 ng/μL
0.5% Phenol red 1 μL 0.08%
1 x Danieau’s Buffer To 6 μL macf1b CRISPR3 sgRNA (1120 ng/μL) 1.3 μL 500 ng/μL
Cas9 protein (2000ng/μL) 1 700 ng/μL
0.5% Phenol red 0.48 0.08%
DEPC-treated water To 3 μL
23 Genomic DNA extraction
Zebrafish embryos at 3 or 4 dpf were used to extract DNA. First, the embryos were incubated with 50 μL base solution (25 mM NaOH, 0.2 mM Na2EDTA; pH=12) at 95 °C for
30 minutes. After cooling down to 4 °C , 50 μL of neutralization solution (40 mM Tris-HCL; pH = 5) was added. Before using, the extracted DNA was centrifuged at room temperature for 5 minutes.
Polymerase chain reaction (PCR)
PCR was used to amplify the extracted DNA using the Taq DNA polymerase from
NEW ENGLAND BioLabds Inc. The PCR reaction was assembled by the mixture of 18.9 μL of DNAase free water, 2.5 μL of 10 x standard buffer, 0.5 μL of dNTPs, 0.5 μL of 10 μM forward primer and reverse primer, 0.125 μL of Taq DNA polymerase, and 2ul of extracted
DNA. The thermocycler program for PCR is shown in Table 2. All the primers used in PCR are shown in Table 3.
Table 2: Thermocycler program
Temperature (°C ) Time 95 30s
95 30s
Tm 30s 35 cycles
72 30s
72 5min
4 forever
24 Table 3: List of sequencing primers, primers’ names with their sequence, PCR product length and annealing temperature are shown below.
Primer name Primer sequence (5’ – 3') Product Tm length (bp) (°C ) tmc5 CRISPR38 seq F’ GATCGGGGGCAGATTTGGCACT 597 66 tmc5 CRISPR38 seq R’ TTACAGAAGCCTCCAGGCAGCAGT lhfpl5b CRISPR3 seq F’ AGCTACGATATAACCGGAGGTGTAAG 432 55 lhfpl5b CRISPR3 seq R’ CTGCTGATTGTGGGCACCATTGTG
Lhfpl5b CRISPR31 seq F’ TAGGAGGCAGTCGAAAATAGATAGC
535 60 Lhfpl5b CRISPR31 seq R’ TTCACTCTGGGCAACCGGCA
macf1b CRISPR3 seq F’ CCATATTGTAGATATGACGCACA
380 55 macf1b CRISPR3 seq R’ GAACAAACTAACCATGCTTCACT
Sequencing and Subcloning
After PCR, the PCR product was purified using an EZ-10 Spin Column PCR Products
Purification Kit. The PCR product size was confirmed by electrophoresis, and then the products were sent to Eurofins Genomics Company for sequencing. The sequencing result was analyzed with MacVector (MacVector Inc).
25 The sequencing results of some samples may show multiple peaks, which means the target site region contain several types of mutations. In this case, the PCR products need to be subcloned into a PCR4 TOPO vector (Thermofisher Scientific Company). The subcloning reaction was generally 4.5 μL of PCR product, 1 μL of salt solution, and 0.5 μL of PCR4 TOPO vector. The reaction was incubated at room temperature for 5 minutes.
Then the vector was transformed into 25 μL of One Shot TOP 10 chemically competent E. coli cells (Thermofisher Scientific Company) and incubated on ice for 20 minutes. After incubation, the competent cells were heat-shocked in a 42 °C water bath for 30 seconds.
Then, 150 μL of S.O.C medium was added into the tubes and incubated in a shaker incubator at 37°C and 225 rpm for 1 hour. An LB broth agar (BIO BASIC CANADA INC) plate with 60 ng/ μL was prepared and 50 μL or 100 μL of culture medium was spread on each plate.
The plates with cultured cells were incubated in 37 °C overnight. 8 or 16 single colonies were picked up from each plate and incubated in LB broth medium (37 °C and shaking at 225rpm) overnight. The vectors were then extracted by miniprep using the EZ-
10 Spin Column Plasmid DNA Miniprep Kit (BIO BASIC CANADA INC) and sent to Eurofins
Genomics Company for sequencing. Here we use the M13 Forward Primer (5’-
GTAAAACGACGGCCAG-3’).
Fin Clip
Adult zebrafish were placed in a petri dish of 1x tricaine until they stopped moving.
The fish were then moved to a clean petri dish and a small piece of tail fin was cut. The fin was placed in a PCR tube in order to perform DNA extraction.
26 Labeling zebrafish lateral line neuromasts with 4-(4-diethylaminostyryl)-1- methylpyridinium iodide (4-Di-2-ASP)
Fish water was used to dilute 4-Di-2-ASP (Thermo Fisher Scientific Inc) to 20 μM.
Fish to be examined were transferred with transfer pipettes from the petri-dish to a net- well. The fish was imbedded in the dye solution for 30s in a 24-well plate. The net-well with fish from well A1 to A2 was transferred to a solution that contains ~ 5 mL of 1 x tricaine, and was incubated for 5 min. The rinsing was repeated twice. The fish were imaged under a Leica DMI6000 microscope.
Whole-mount embryonic zebrafish immunostaining
The embryos were fixed with 4% paraformaldehyde (PFA) (Electron Microscopy
Science) at 4 °C overnight. Next, samples were rinsed with phosphate buffered saline (PBS)
(Fisher Scientific) 4 times, each time for 5 minutes. Samples were then permeabilized with
3% triton X-100 at room temperature and rotated overnight. The samples were rinsed again 4 times using PBS. Then the samples were blocked with 5% goat serum at room temperature for 4 to 6 hours and rotated. 2% Alexa Fluor-633 phalloidin was added in and samples were then incubated at 4 °C overnight with rotation. The samples were rinsed with 5% GS twice, each time for 1 hour. At last, GS was removed and mounting media
(vectashield ;Vector Laboratories Inc) was added in as the mounting media. The samples were stored at 4 °C. Zebrafish were then imaged using a Leica SP8 confocal microscope.
27
Chapter 3: Targeting MET channel related gene using CRISPR/Cas9
28 MET channel apparatus candidate genes
The MET channel is a main molecular apparatus in hair cells that enables hearing.
In recent years, multiple genes haven been studied to see if they are a component of the
MET channel complex (Wu and Müller, 2016). Some proteins have been indicated as directly involved in the MET channel, like transmembrane inner ear (TMIE) protein, transmembrane channel-like (TMC) 1, transmembrane channel-like (TMC) 2, and lipoma
HMGIC fusion partner-like 5(LHFPL5). Even though the functions of these proteins are still unknown, they all interact with PCDH15, which is a component of the tip link (Figure 8).
LHFPL5 and TMIE interact with PCDH15 at the lower end of the tip link, which joint the tip link and the shorter stereocilium. The MET channel is localized at the shorter stereocilia tip (Beurg et al., 2009), which makes LHFPL5 and TMIE possible candidates for the channel apparatus. It has been shown that TMC1 localizes near the tips of stereocilia
(Kurima et al., 2015). TMIE has been shown by a yeast two-hybrid screen to be the linker between LHFPL5 and PCDH15 (Zhao et al., 2014), and TMIE uniquely binds to the C- terminus of PCDH15-CD2. Another study showed that both TMC1 and LHFPL5 interact with PCDH15 and LHFPL5 down-regulates TMC1 (Beurg et al., 2015). The MET channel plays an essential role in the hearing process, so studying the components of the MET channel or proteins that relate to the MET channel is important for understanding the process of audition.
29
Figure 8. MET channel complex model. LHFPL5 acts as a connector for TMIE and PCDH15.
TMC1 and TMC2 also interact with PCDH15. LHFPL5 down-regulates TMC1. Figure adapted from (Wu and Müller, 2016).
TMC protein family
Recently, there has been a great deal of focus on the TMC protein family, for the reason that TMC1 and TMC2 have been demonstrated to be components of the MET channel. It is possible that other proteins that belong to the TMC protein family may also be involved in hearing.
In 2002, Kurima et al. found that a dominant mutation in TMC1 can lead to hearing loss in both mice and humans (Kurima et al., 2002). At first, TMC1 and its ortholog were named as transmembrane cochlear-expressed gene 1, because Tmc1 mRNA was found to
30 express in hair cells of the mouse cochlea (Vreugde et al., 2002). Afterwards, studies showed that other TMC genes are expressed in different tissues and related to many phenotypes, so these genes were renamed as transmembrane channel-like genes (Kurima et al., 2003).
Using RT-PCR, Keresztes et al. found that vertebrates have eight TMC genes, from
TMC1 to TMC8 (Keresztes et al., 2003). All eight mammalian TMC genes have numerous transmembrane domains and one TMC domain (Kurima et al., 2003). Based on the similarity of amino acid sequences, all TMCs were categorized into 3 subfamilies. TMC1,
TMC2 and TMC3 were grouped into subfamily A. TMC5 and TMC6 were grouped into subfamily B. TMC4, TMC7 and TMC8 were grouped into subfamily C (Figure 9).
31 Figure 9. Three subfamilies of vertebrate and invertebrate TMC proteins. This phylogenetic tree shows the relationships between TMC proteins in human (Hs), mammalian (Mm), Fugu rubripes (Fr), Drosophila melanogaster (Dm), Anopheles gambiae (Ag), and Caenorhabditis elegans (Ce). Figure adapted from Keresztes et al.,
2003.
A study of mouse deafness models that carry two different mutations in Tmc1,
Beethoven (Bth, a semidominant point mutation) and deafness (dn, a recessive in-frame
1.6 kb deletion), showed normal mechanotransduction function (Marcotti et al., 2006).
This study suggested that TMC1 is not required for mechanotransduction, but is required for hair cell maturation. Kawashima et al. also suggested that the expression of TMC2 in
Tmc1 mutant mice might have accounted for normal transduction (Kawashima et al.,
2011). They also found that Tmc2 mutant mice were phenotypically normal, whereas
Tmc1 mutant mice were deaf. However, Tmc1 and Tmc2 double mutant mice had normal hair cells, but were deaf and lacked all mechanotransduction activity (Kawashima et al.,
2011). To investigate if TMC1 and TMC2 are components of the MET channel, Pan et al. recorded currents from mouse hair cells and found that Tmc1 mutant mice showed reduced Ca2+ permeability and reduced current, while cells expressing TMC2 showed high
Ca2+ permeability and larger currents. Hair cells expressing both TMC1 and TMC2 had normal currents (Pan et al., 2013). Their results proposed that TMC1 and TMC2 are related to the normal function of the MET channel. Other research on the expression of
TMC1-mCherry and TMC2-AcGFP suggests that both proteins are localized to the tips of
32 stereocilia (Kurima et al., 2015). Our lab performed in situ hybridization, and the results showed expression of Tmc5 in zebrafish hair cells.
LHFPL5
LHFPL5 is also named as tetraspan membrane protein of hair cell stereocilia
(TMHS). It belongs to the tetraspan superfamily. Tetraspan could regulate the signaling and trafficking properties (Caplan et al., 2007). The tetraspan superfamily encodes a wide range of proteins, like tetraspanins, gap junction proteins, tight junction proteins and ion- channel subunits (Xiong et al., 2012).
Mutations in LHFPL5 could cause recessive nonsyndromic hearing loss (Kalay et al.,
2006; Shabbir et al., 2006). These findings indicated that LHFPL5 is essential for normal human hearing function. Using immunohistochemistry, Xiong et al. found that TMHS localized near the tip link region (Figure 10). In Tmhs−/− mice, tip links were rarely observed and mechanotransduction was defective. Another research suggested that
LHFPL5 interacted with PCDH15, which consisted of tip links (Beurg et al., 2015). All these results conclude that LHFPL5 is a potential component of the hair cell’s mechanotransduction machinery. However, how does LHFPL5 interact with PCDH15 and
TMC1 to maintain normal MET current is still unknown. Our lab is focused on studying lhfpl5 in zebrafish.
33
Figure 10. Immunohistochemistry studies in TMHS. Images showed hair cells from wild- type mice at P5. Hair cells were stained with phalloidin (green) and TMHS antibody (red).
Arrows point to TMHS that localized near the tip link region. Figure adapted from Xiong et al., 2012.
MACF1
Microtubule Actin Cross-linking Factor 1 (MACF1), previously named as actin crosslinking family protein 7 (ACF7), is a member of the spectraplakin family. The spectraplakin family is a group of cytoskeleton crosslinking proteins that contain both actin and microtubule binding domains (Röper et al., 2002; Kodama et al., 2003). Gong et al. demonstrated that MACF1 has features from two classes of cytoskeletal proteins, plectin and dystrophin (Gong et al., 2001). ACF7 null cultures failed to maintain polarizing
34 signals and coordinate migration. To rescue these defects, ACF7’s actin and microtubule binding domains were required (Kodama et al., 2003). These findings demonstrate that
ACF7 is essential for microtubule dynamics. There are several different isoforms of MACF1 with different combinations of domains and structures, but they all share major main functional domains (Figure 11).
Figure 11. Isoforms of MACF1. There are several domains that are shared by all MACF1 isoforms, including actin a binding domain (ABD), a plakin domain, spectrin repeats domains, two EF Hand motifs, Gas2 related (GAR) domain. Figure adapted from (Hu et al.,
2016).
In zebrafish, Gupta et al. reported that macf1a regulates the animal-vegetal polarity in the oocyte (Gupta et al, 2010). Furthermore, our lab demonstrated that macf1a
35 is expressed in the zebrafish anterior macula (AM) and posterior crista (PC). Acf7a is positioned to integrate cytoskeletal networks and is located between the cuticular plate and somatic tubulin (Figure 12) (Antonellis et al., 2014).
Figure 14. A B C
Figure 12. Localization of Acf7a in zebrafish hair cells. A-C, Images of Gt(macf1a– citrine)ct68a/+ zebrafish. A and B, hair cells from a lateral crista, F-actin was labeled with phalloidin (red), hair cells expressing Acf7a- Citrine (yellow) have fusion protein around the CP. Arrows point out the hair bundle, CPs are marked in brackets. B, the volume of red-yellow overlap from A is showed in white. C, immunolabeled microtubules (red) and expression of Acf7a- Citrine demonstrate that Acf7a is located towards the end of the microtubules, around the apical surface of cells. Arrowheads indicate kinocilium, n denotes the position of nucleus. Figure adapted from (Antonellis et al., 2014).
To determine whether ACF7 acts as a linker that join the CP actin to the microtubules near the apical surface of hair cell, our lab used electron tomography, which is a sensitive tool to uncover detailed regions within hair cell (Vranceanu et al., 2012). The
36 result demonstrated that there are filamentous connections between CP actin and microtubule, and ACF7 may be a potential linker (Figure 13) (Antonellis et al., 2014).
37 Figure 13. A, 2D transmission electron microscopy of an inner hair cell from 6 dpf zebrafish. Arrowhead showed a microtubule that terminate with CP. B, tomographic 3D reconstruction corresponds to the 2D projection from A. C, a large view from the rectangle in B. Arrowhead indicates a filamentous connection. D and E, surface rendering of the segmented volume through the 3D reconstruction, microtubule depicted in mint, connecting filament in red and actin meshwork in purple. E, there is a gap between microtubule and actin meshwork, which is connected by the connecting filament. F, three models of ACF7 in zebrafish hair cells, ACF7 is shown in red. Model 1, ACF7 links a microtubule (green) that insert into CP with the F-actin of CP. Model 2, ACF7 links a microtubule to the F-actin of the circumferential band. Model 3, ACF7 links a microtubule that emanates from the basal body with F-actin of the CP. Figure adapted from (Antonellis et al., 2014).
RESULTS
Using CRISPR/Cas9 to knock out tmc5 in zebrafish
We use Ensemble zebrafish database GRCz10 (https://www.ensembl.org/ )to study this gene and design CRISPR. Zebrafish tmc5 (ENSDARG00000013252) is on chromosome 3’ forward strand. According to Ensemble’s prediction, tmc5 contains 18 coding exons, and its translation length is 685 residues (Figure 14 A). In order to knock out as many functional domains as possible, I screened target sites from second exon for the reason that the first exon is 5 prime UTR (untranslated region). Furthermore, to make sure that the target site is not only unique in zebrafish, but also has a higher possibility to
38 exist in human and mouse. I used MacVector to make an amino acid sequences alignment with ClustalW among TMC5 of zebrafish, human (Homo sapiens), and mouse (Mus musculus) (Figure 14 B). Then I decided to screen target sites from exon 4 and exon 6, because these two exons showed higher similarity to human and mouse than other exons.
After selecting target sites using the Chop-Chop website and confirming specificity using
BLAST from NCBI, one target site from exon 4 was selected and named as tmc5 CRISPR38.
The sequence of CRISPR38 is 5’- AGAGGACTTGAGCTGCTCACTGG-3’.
A.
17.66 kb Forward strand
tmc5-201 > protein coding
B.
39 Figure 14. A, a schematic of the tmc5 genomic locus in zebrafish. B, amino acid sequences alignment among zebrafish, mouse, and human. Asterisks identify conserved sequence, dots mark semi-conservative sequence. Black box shows the translated sequence of exon
4, green box shows exon6. Red lines indicate predicted transmembrane domains; there are 8 transmembrane domains in total. Blue line indicates the predicted TMC domain.
After the tmc5 CRISPR38 target site was confirmed by PCR, using wild-type zebrafish genomic DNA as a template and sequencing primers ordered from INTEGRATED
DNA TECHNOLOGIES, double strand DNA template was generated. The quality and size of
DNA was confirmed by electrophoresis. Then, tmc5 CRISPR38 sgRNA was transcribed and sent to the Agilent Tape Station to test its quality by RNA electrophoresis (Figure 15).
A Ladder tmc5 CRISPR38 Cas9 mRNA
40 B
Figure 15. Tape station result for tmc5 CRISPR38 sgRNA. (A) Gel image of tmc5 CRISPR38 sgRNA that analyzed by Agilent tape station. Ladder showed in the left lane, tmc5
CRISPR38 showed in the middle lane, Cas9 mRNA showed in the right lane. The sgRNA had the correct length at 120bp. The Cas9 mRNA has the right length at 4,200bp. (B) The sgRNA peak table for tmc5 CRISPR38. The lower peak at 25bp is the internal control. The sgRNA had a single peak at 120bp.
Cas9 mRNA was generated from the vector MLM3613. The 4,200bp mRNA was synthesized via in vitro transcription and qualified by tape station (Figure 17 A). Then it was co-injected with tmc5 CRISPR38 sgRNA into one-cell stage zebrafish embryos.
Genomic DNA extracted from eight 4-dpf larvae were used to amplify the target site
41 region by PCR and the PCR products were purified and sent for sequencing to detect mutation. From the sequencing result, it shows that multiple mutations were created
(Figure 16 A). From the target site region, the peak heights slightly decreased and double peaks appeared, which means that multiple mutations were generated. For the reason that CRISPR injected zebrafish is mosaic, it is difficult to read the mutation type from sequencing. A subclone experiment was needed to figure out the mutation type. The purified PCR product was sublconed into a TOPO PCR4 vector and transformed into TOP10
E. coli competent cells. Then I used an EZ-10 Spin Column Plasmid DNA Miniprep Kit to extract the plasmid and send for sequencing (Figure 16 B). Four different mutations were detected from different colonies. They were 1bp insertion, 11bp insertion, 6bp deletion and 7bp deletion. The somatic mutation rate of CRISPR/Cas9 induced mutations for tmc5 is 28.5%. After confirming that tmc5 CRISPR38 sgRNA injected fish contain several types of mutation, more embryos were injected and raised up into adult fish, which are the founder generation (F0). The adult potential founders were then bred with wild-type fish for founder screening. Eight F1 embryos were used to extract DNA, and the genomic DNA were then genotyped by PCR direct sequencing (Figure 16 C). For positive F1, only one type mutation will be observed, so clear double peak should show within the target site region. The germline transmission rate for tmc5 is 50%, with 2 out of 4 F1 fish that we screened holding mutations. Currently, two founders have been discovered and bred with wild-type fish to get F1 fish.
42 A
B
AATAACTCACCACGC-----CAGTGA-GCAGCTCAAGTCCTCT Wild-type
AATAACTCACCACGC-----CAG------CTCAAGTCCTCT -7bp
AATAACTCACCACGC----TCAAG------CTCAAGTCCTCT +1bp, -6bp
AATAACTCACCACGCCAGTTCAAGTTCGCAGCTCAAGTCCTCT +11bp
C
Figure 16: tmc5 CRISPR38 sequencing and subcloing and founder screening results.
(A) Sequencing result from tmc5 CRISPR38 sgRNA injected fish. Highlight region was target site. Top lane is wild-type sequence and bottom lane is the mutant one. From the
43 target site region, the heights of the peaks slightly decreased and double peak appeared, which means that multiple mutations were generated. (B) PCR products that showed double peaks were subcloned and sequenced, alignments between wild-type sequence and mutant sequence were generated with MacVector. Target site was labeled in red and
PAM site was labeled in blue. Four different mutations were recognized. (C) tmc5
CRISPR38 founder screening results. Eight embryos from potential founder crossed with wild-type zebrafish were used to perform PCR and sequencing, two founders were discovered. Highlight showed target site.
F1 fish were then raised to adulthood and genotyped by fin-clip and direct sequencing. Eleven F1 fish were discovered and four different mutations have been found.
Mutations included 1 bp deletion, 2 bp deletion, 7 bp deletion and 8 bp deletion. F1 fish that had the same type of mutation were in-crossed. Adult F2 fish were then genotyped by fin-clip and screened for homo fish. Currently seven F2 homozygous fish have been found. Phenotypic analyses demonstrated that no significant different phenotype was detected between wild-type and tmc5-/- fish by immunostaining (Figure 17).
Immunostaining was performed on 6dpf of homozygous larvae and TU larvae. Then, larvae were imaged using a Leica SP8 confocal microscope. 4-Di-2-ASP hair cell uptake assays were then used on larvae at 6dpf (Figure 18). For the reason that fluorophore transverses MET channel, we could tell that both tmc5-/- and tmc5+/+ larvae had normally functional MET channels in neuromast hair cells. Then, a quantitative test was performed on the zebrafish that stained by 4-Di-2-ASP (Figure 19). The mean fluorescence intensity
44 of neuromast of tmc5-/- fish and wild-type fish were calculated. Mean fluorescence intensity of tmc5-/- ± SEM = 76.58 ± 5.70 (n = 25). Mean fluorescence intensity of tmc5+/+
(WT) ± SEM = 77.87 ± 3.82 (n = 24). This result indicates that tmc5 doesn’t affect the neuromast to take up the dye. Furthermore, startle response was used to test if tmc5-/- zebrafish has hearing defects. The experiment showed that tmc5-/- zebrafish responded normally to the startle.
A tmc5-/- B tmc5+/+
C tmc5-/- D tmc5+/+
Figure 17. Phalloidin labeling of zebrafish of 6 dpf tmc5-/- and tmc5+/+ larvae. Hair cells were immunolabeled with 633 phalloidin (red). A and B, neuromast hair cells from tmc5-
45 /- zebrafish (A) and tmc5+/+ zebrafish (B). Two neuromasts present similar numbers of hair cells. C and D, lateral crista hair cells from tmc5-/- zebrafish (C) and tmc5+/+ fish (D)
A tmc5-/-
B tmc5+/+
Figure 18. Zebrafish lateral line neuromasts at 6dpf were labeled with 4-Di-2-ASP. In neuromasts of tmc5-/- larvae (A) and tmc5+/+ larvae (B), almost all the neuromasts take up the fluorophore.
46 A tmc5-/- B tmc5+/+ B A
C
Figure 19. A and B, Qualitative confocal images of hair cells labeled with 4-Di-2-ASP. Scale bar= 8 μm. C, Mean fluorescence intensity of 4-Di-2-ASP uptake of neuromasts. P=0.85.
Kruskal–Wallis test ****P < 0.0001, ***P = 0.001, **P = 0.0215
47 Using CRISPR/Cas9 to knock out lhfpl5b in zebrafish
We use the Ensemble zebrafish database GRCz10 to study lhfpl5b and design
CRISPR. Lhfpl5b (ENSDARG00000056458) is on chromosome 8 reverse strand with 2 exons. Lhfpl5b has two transcripts. They both contains 221 amino acids. The only difference is one transcript contains a 5 prime UTR. Furthermore, to make sure that the target site is not only specific in zebrafish, but also has a similar region in the human and the mouse. I used MacVector to make amino acid alignment among zebrafish, human
(Homo sapiens), and mouse (Mus musculus) (Figure 20). Both exons show high similarity among three species. Also, lhfpl5b is short so I designed target sites on both exons. Two target sites were selected after using BLAST tool to make sure the specificity, lhfpl5b
CRIPSR3 on exon1 with the sequence of 5’- GTGCGAAACTCCAGAGCCATCGG-3’, and lhfpl5b CRIPSR31 on exon2 with the sequence of 5’-GATGGGGTGTATGATTTATCCGG-3’.
Figure 20. Amino acid sequences alignment of lhfpl5b between zebrafish, mouse, and human. Asterisks mark conserved sequence, dots identify semi-conservative sequence.
48 Blue box indicates the first exon. Red line indicates lhfpl5b CRIPSR3, and green line indicates lhfpl5b CRIPSR31.
After the lhfpl5b CRISPR3 and lhfpl5b CRISPR31 target sites were confirmed by PCR, using wild-type zebrafish genomic DNA as a template and sequencing primers ordered from INTEGRATED DNA TECHNOLOGIES, double strand DNA template was generated. The quality and size of DNA was confirmed by electrophoresis. Then, the lhfpl5b CRISPR3 sgRNA and lhfpl5b CRISPR31 sgRNA were transcribed and sent to the Agilent Tape Station to test their quality (Figure 21).
A Ladder lhfpl5b CRISPR3 lhfpl5b CRISPR31
49 B
Figure 21. Tape station result for lhfpl5b CRISPR3 sgRNA and lhfpl5b CRISPR31 sgRNA. (A)
Gel image of lhfpl5b CRISPR3 sgRNA and lhfpl5b CRISPR31 sgRNA that analyzed by Agilent tape station. Ladder showed in the left lane. Lhfpl5b CRISPR3 showed in the middle lane.
Lhfpl5b CRISPR31 sgRNA showed in the right lane. The sgRNA had the correct length at
120 bp. The Cas9 mRNA has the correct length at 4,200 bp. (B) The sgRNA peak table for lhfpl5b CRISPR3 and lhfpl5b CRISPR31. The lower peak at 25 bp is the internal control, the sgRNA had a single peak at 120bp.
Cas9 mRNA was co-injected with lhfpl5b CRISPR3 sgRNA or lhfpl5b CRISPR31 sgRNA into one-cell stage zebrafish embryos. Genomic DNA extracted from eight 4-dpf larvae were used to amplify the target site region by PCR and the PCR products were purified and sent for sequencing to detect mutations. The sequencing result showed that multiple mutations were created (Figure 22 A). From the target site region, the peak heights slightly decreased and double peaks appeared, which means that multiple
50 mutations were generated. The purified PCR product was subcloned into a TOPO PCR4 vector and transformed into TOP10 E. coli competent cells. Then I used the EZ-10 Spin
Column Plasmid DNA Miniprep Kit to extract the plasmid and send for sequencing (Figure
22 B C). Seven different mutations were detected from lhfpl5b CRISPR3 different colonies, including deletions of 1 bp, 5 bp, 6 bp, 7 bp, and insertions of 1 bp, 13 bp, 18 bp, and 22 bp. For the reason that CRISPR31 was on exon 2, and the mutation ratio was 1/6, which is much lower than CRISPR3, I decided to use lhfpl5b CRIPSR3 to perform further experiments. More embryos were injected and raised up into adult fish, which are the founder generation (F0). The adult potential founders were then bred with wild-type fish for founder screening. 8 F1 embryos were used to extract DNA, and the genomic DNA were than genotyped by PCR direct sequencing (Figure 22 D). The somatic mutation rate of CRISPR/Cas9 induced mutations for lhfpl5b is 62.5%, and the germline transmission is
50%. For positive F1, clear double peak should be observed. Currently two founders have been discovered and bred with wild-type fish to get F1 fish.
A
B
TTATGTGCGAAACTC------CAGAG-----CCATCGGCGTCATGTGG Wild-type1
TTATGTGCGAAACTC------CAGAG-----C------GTCATGTGG -7bp
TTATGTGCGAAACTCTTCGCACATAATGATGGCGAAGAAACTCCATCGGCGTCATGTGG +22bp
51 TTATGTGCGAAACGC------CATCG-----G------CGTCATGTGG +1bp
TTATGTGCGAAACTC------CAGAG------CCTNNGCGTCATGTGG -1bp
TTATGTGCGAAACTCCAGAGC------CATCGGCGTCATGTGGGCA wild-type2
TTATGTGCGAAACTCCA------TCGGCGTCATGTGGGCA -6bp
TTATGTGCGAAACTCCAGAGC------A +18bp
TTATGTGCGAAACTCCAGAGCATGTGCGAAACTCCATCGGCGTCATGTGGGCA +13bp
TTATGTGCGAAACTCC------CATCGGCGTCATGTGGGCA -5bp
C
D
Figure 22. lhfpl5b CRISPR3 and lhfpl5b CRISPR31 sequencing and subcloning and founder screening results. (A) Sequencing result from lhfpl5b CRISPR3 sgRNA injected fish.
52 Highlighted region was the target site. From the target site region, the heights of peaks significantly decreased and double peaks appeared, indicating mutations were generated.
(B) lhfpl5b CRISPR3 PCR products that showed double peaks were subcloned and sequenced, alignments between wild-type sequence and mutant sequence were generated with Macvector. Target site was labeled in red and PAM site was labeled in blue. Eight different mutations from two embryos were recognized. (C) lhfpl5b CRIPSR31
PCR products were sequenced, an 11 bp deletion was read from the sequencing result.
(D) lhfpl5b CRISPR3 founder screening result. Eight embryos from potential founder crosses with wild-type zebrafish were used to perform PCR and sequencing; two founders were discovered. Highlight showed target site.
53 Using CRISPR/Cas9 to knock out macf1b in zebrafish
Macf1b is a large gene that encodes a large protein that contains numerous spectrin domains. In zebrafish, Macf1b is on the forward strand of chromosome 16. On
Ensemble database GRCz10, maf1b is a small gene with only 5 exons. On the genomic database NCBI, maf1b consists of 40 exons and encodes a protein that is 2086 amino acids long, which makes the NCBI sequence more complete. Therefore, the sequence of zebrafish maf1b from NCBI was used to design maf1b CRISPR. Exon 4 was chosen to search for a target site because it is the first region that shows high similarity between zebrafish, human, and mouse sequences (Figure 23 A).
A
54 B
Figure 23. (A) Amino acid sequences alignment of Macf1b between zebrafish, mouse, and human. Red box indicates exon 4. Asterisks identify conserved sequence, dots mark semi- conservative sequence. (B) Functional domains predicted in zebrafish Mac1b. Red box indicates exon 4. Yellow shows 6 spectrin domains. Red line shows EF Hand motif. Green line indicates GAR domain.
Macf1b CRISPR3 with the sequence of 5’ GATACAGGAGGGTCCACCCCTGG-3’ was selected after confirming its specificity by BLAST. After generating macf1b CRISPR3 sgRNA and sending to the tape station to inspect its quality (Figure 24), macf1b CRISPR3 sgRNA and Cas9 protein were co-injected into one cell stage zebrafish embryos.
55 A Ladder macf1b CRIPSR3
B
Figure 24. Tape station result for macf1b CRISPR3 sgRNA. (A) Gel image of macf1b
CRISPR3 sgRNA that analyzed by Agilent tape station. Ladder showed in the left lane, macf1b CRISPR3 showed in the right lane. The sgRNA has the correct length at 120 bp. (B)
The sgRNA peak table for macf1b CRISPR3. The lower peak at 25 bp is the internal control, the sgRNA had a single peak at 120bp.
56 A
B
AGAGGATGATACAGGAGGGTCCACCCCTGGCAGAGGAG wild-type
AGAGGATGATACAGGAGGGTCCA-----GGCAGAGGAG -5bp
AGAGGATGATACAGGAGGGTCC-----TGGCAGAGGAG -5bp
AGAGGATGATACAGGAGGGT-----CCTGGCAGAGGAG -5bp
C
Figure 25. Macf1b CRISPR3 sequencing and subcloning and founder screening results.
(A) Sequencing result from macf1b CRISPR3 sgRNA injected fish. Highlighted region was target site. From the target site region, the heights of the peaks slightly decreased and double peak appeared, multiple mutations were generated. (B) PCR products that showed double peaks were subcloned and sequenced, alignments between wild-type sequence and mutant sequence were generated with Macvector. Target site was labeled in red and
PAM site was labeled in blue. One mutation in different positions was recognized. (C)
57 macf1b CRISPR3 founder screening results. Eight embryos from each potential founder were used to perform PCR and sequencing, two founders were identified. Highlight shows target site. Arrows clearly indicate double peaks.
Genomic DNA extracted from eight 4-dpf larvae were used to perform PCR, the
PCR products were then purified and sent for sequencing to detect mutations. Sequencing result revealed that multiple mutations were created (Figure 25 A). A subclone experiment was needed to characterize the type of mutations. The purified PCR product was subcloned into a TOPO PCR4 vector and transformed into E. coli competent cells.
Then, an EZ-10 Spin Column Plasmid DNA Miniprep Kit was used to extract the plasmid
(Figure 25 B). A 5 bp deletion was in macf1b CRISPR3 sequencing results. More embryos were injected and raised up into adult fish, which were founder generation (F0). The potential founders were then bred with wild-type fish for founder screening. 8 F1 embryos were used to extract DNA, and the genomic DNA was then genotyped by PCR direct sequencing (Figure 25 C). The somatic mutation rate is 37.5% and the germline transmission rate is 33.3%. For positive F1, clear double peak should be observed.
Currently two founders have been discovered and bred with wild-type fish to get F1 fish.
58 Discussion
To better study the MET channel, our lab has been utilizing different powerful tools to knock out genes that may play an essential role in hair cell development and function. ZFN and TALEN technologies have been used before and successfully knocked out several tmc genes and other genes. In this study, I use an easier and more efficient tool, CRISPR/Cas9, to knock out tmc5, lhfpl5b, and macf1b. The mutation rate from
CRISPR/Cas9 varies a lot. Moreno-Mateos et al. observed that enrichment of guanine and deletion of adenine in sgRNA could make it more stable and better activated. Hence,
CRISPR/Cas9 activity is modulated by sgRNA sequence (Moreno-Mateos et al., 2015).
However, for some short genes like lhfpl5b, there are limited number of target sites.
Recently, a new method of CRIPSR/Cas9 has been developed. Compared to traditional methods using Cas9 nuclease and sgRNA to introduce mutations, this new method developed a dual RNA/Cas9 RNP complex containing Cas9 protein assembled with separate crRNA (CRISPR RNA) and tracrRNA (trans-activating crRNA). The design of sgRNA was based on crRNA and tracrRNA that exist naturally. As described before, when bacteria is attacked by a foreign DNA, short pieces of that foreign DNA were insert into the CRISPR locus as spacer DNA (Barrangou et al., 2007). CrRNA acts as a guide for targeting and breaking the foreign DNA. Gasiunas et al. demonstrated a CRISPR3/Cas9 system with a complex of crRNA and Cas9 proteins that introduced a double-strand break at a specific site within the DNA (Gasiunas et al.,2012). In type-II CRISPR/Cas system, tracrRNA is required for the maturation of crRNA (Chylinski et al., 2013). For some genes that are
59 difficult to find good target sites or have lower mutation efficiency, we could try crRNA and tracrRNA complex instead of sgRNA.
After obtaining homozygous fish, several functional assays could be performed to examine the function of these genes. First, startle response could be used to test if those homozygous fish have hearing defects (Bang et al., 2012). Secondly, a 4-Di-2-ASP dye could be used to examine the mechanotransduction function since this dye enters into hair cells through the MET channel (Seiler et al., 1999). If homozygous fish have MET channel defects, the hair cells in the lateral line system can’t take up the dye. Here we demonstrated that tmc5-/- zebrafish cannot take up the dye. Thirdly, we can measure stimulus-evoked microphonic potentials from zebrafish larvae. These experiments can tell us if hair cells could normally process mechanotransduction to generate voltage- dependent current (Corey et al., 1983).
In tmc5 studies, we did not observe obviously defects in homozygous zebrafish by immunostaining. Since TMC1 and TMC2 are both necessary for hair cells mechanotransduction in mouse (Kawashima et al., 2011). Knock out of tmc5 did not lead to a defect maybe because of genetic redundancy. It is possible that two or more genes are performing the same function as tmc5. In the future, we can create double knockouts by breeding tmc5-/- zebrafish with other knockout strains, or by microinjection of two different sgRNAs. In summary, I have targeted three genes tmc5, lhfpl5b and macf1b to yield insight into how hair cells function.
60 References
Antonellis, Patrick J., et al. "ACF7 is a hair-bundle antecedent, positioned to integrate
cuticular plate actin and somatic tubulin." Journal of Neuroscience 34.1 (2014):
305-312.
Bang, Pascal I., et al. "High-throughput behavioral screening method for detecting
auditory response defects in zebrafish." Journal of neuroscience methods 118.2
(2002): 177-187.
Barrangou, Rodolphe, et al. "CRISPR provides acquired resistance against viruses in
prokaryotes." Science 315.5819 (2007): 1709-1712.
Beurg, Maryline, et al. "Subunit determination of the conductance of hair-cell
mechanotransducer channels." Proceedings of the National Academy of
Sciences 112.5 (2015): 1589-1594.
Beurg, Maryline, et al. "Localization of inner hair cell mechanotransducer channels using
high-speed calcium imaging." Nature neuroscience 12.5 (2009): 553.
Caplan, Michael J., Erik-Jan Kamsteeg, and Amy Duffield. "Tetraspan proteins: regulators
of renal structure and function." Current opinion in nephrology and
hypertension16.4 (2007): 353-358.
Chiu, Lynn L., et al. "Using the zebrafish lateral line to screen for ototoxicity." Journal of
the Association for Research in Otolaryngology 9.2 (2008): 178.
Chylinski, Krzysztof, Anaïs Le Rhun, and Emmanuelle Charpentier. "The tracrRNA and Cas9
families of type II CRISPR-Cas immunity systems." RNA biology 10.5 (2013): 726-
737.
61 Chylinski, Krzysztof, Anaïs Le Rhun, and Emmanuelle Charpentier. "The tracrRNA and Cas9
families of type II CRISPR-Cas immunity systems." RNA biology 10.5 (2013): 726-
737.
Corey, D. P., and A. J. Hudspeth. "Analysis of the microphonic potential of the bullfrog's
sacculus." Journal of Neuroscience3.5 (1983): 942-961.
Dambly-Chaudière, Christine, et al. "The lateral line of zebrafish: a model system for the
analysis of morphogenesis and neural development in vertebrates." Biology of the
Cell95.9 (2003): 579-587.
Department of Biochemistry and Molecular Biophysics Thomas Jessell, Steven Siegelbaum,
and A. J. Hudspeth. Principles of neural science. Eds. Eric R. Kandel, James H.
Schwartz, and Thomas M. Jessell. Vol. 4. New York: McGraw-hill, 2000.
Fettiplace, Robert, and Carole M. Hackney. "The sensory and motor roles of auditory hair
cells." Nature Reviews Neuroscience 7.1 (2006): 19.
Fettiplace, Robert, and Kyunghee X. Kim. "The physiology of mechanoelectrical
transduction channels in hearing." Physiological reviews 94.3 (2014): 951-986.
Gagnon, James A., et al. "Efficient mutagenesis by Cas9 protein-mediated oligonucleotide
insertion and large-scale assessment of single-guide RNAs." PloS one 9.5 (2014):
e98186.
Gasiunas, Giedrius, et al. "Cas9–crRNA ribonucleoprotein complex mediates specific DNA
cleavage for adaptive immunity in bacteria." Proceedings of the National Academy
of Sciences 109.39 (2012): E2579-E2586.
62 Ghysen, Alain, and Christine Dambly-Chaudiere. "Development of the zebrafish lateral
line." Current opinion in neurobiology 14.1 (2004): 67-73.
Gong, Tzy-Wen L., Cagri G. Besirli, and Margaret I. Lomax. "MACF1 gene structure: a
hybrid of plectin and dystrophin." Mammalian genome 12.11 (2001): 852-861.
Gupta, Tripti, et al. "Microtubule actin crosslinking factor 1 regulates the Balbiani body
and animal-vegetal polarity of the zebrafish oocyte." PLoS genetics 6.8 (2010):
e1001073.
Howe, Kerstin, et al. "The zebrafish reference genome sequence and its relationship to
the human genome." Nature496.7446 (2013): 498.
Hsu, Patrick D., Eric S. Lander, and Feng Zhang. "Development and applications of CRISPR-
Cas9 for genome engineering." Cell 157.6 (2014): 1262-1278.
Hu, Lifang, et al. "Isoforms, structures, and functions of versatile spectraplakin
MACF1." BMB reports 49.1 (2016): 37.
Kalay, Ersan, et al. "Mutations in the lipoma HMGIC fusion partner-like 5 (LHFPL5) gene
cause autosomal recessive nonsyndromic hearing loss." Human mutation 27.7
(2006): 633-639.
Kawashima, Yoshiyuki, et al. "Mechanotransduction in mouse inner ear hair cells requires
transmembrane channel–like genes." The Journal of clinical investigation 121.12
(2011): 4796-4809.
Keresztes, Gabor, Hideki Mutai, and Stefan Heller. "TMC and EVER genes belong to a
larger novel family, the TMC gene family encoding transmembrane
proteins." BMC genomics 4.1 (2003): 24.
63 Kodama, Atsuko, et al. "ACF7: an essential integrator of microtubule
dynamics." Cell 115.3 (2003): 343-354.
Kurima, Kiyoto, et al. "Dominant and recessive deafness caused by mutations of a novel
gene, TMC1, required for cochlear hair-cell function." Nature genetics 30.3 (2002):
277.
Kurima, Kiyoto, et al. "TMC1 and TMC2 localize at the site of mechanotransduction in
mammalian inner ear hair cell stereocilia." Cell reports 12.10 (2015): 1606-1617.
LeMasurier, Meredith, and Peter G. Gillespie. "Hair-cell mechanotransduction and
cochlear amplification." Neuron48.3 (2005): 403-415.
Marcotti, Walter, et al. "Tmc1 is necessary for normal functional maturation and survival
of inner and outer hair cells in the mouse cochlea." The Journal of
physiology 574.3 (2006): 677-698.
Metcalfe, Walter K., Charles B. Kimmel, and Eric Schabtach. "Anatomy of the posterior
lateral line system in young larvae of the zebrafish." Journal of Comparative
Neurology 233.3 (1985): 377-389.
Montague, Tessa G., et al. "CHOPCHOP: a CRISPR/Cas9 and TALEN web tool for genome
editing." Nucleic acids research 42.W1 (2014): W401-W407.
Moreno-Mateos, Miguel A., et al. "CRISPRscan: designing highly efficient sgRNAs for
CRISPR-Cas9 targeting in vivo." Nature methods 12.10 (2015): 982.
Pan, Bifeng, et al. "TMC1 and TMC2 are components of the mechanotransduction channel
in hair cells of the mammalian inner ear." Neuron 79.3 (2013): 504-515.
64 Pepermans, Elise, and Christine Petit. "The tip-link molecular complex of the auditory
mechano-electrical transduction machinery." Hearing research 330 (2015): 10-17.
Ran, F. Ann, et al. "Genome engineering using the CRISPR-Cas9 system." Nature
protocols 8.11 (2013): 2281.
Ran, F. Ann, et al. "Double nicking by RNA-guided CRISPR Cas9 for enhanced genome
editing specificity." Cell 154.6 (2013): 1380-1389.
Röper, Katja, Stephen L. Gregory, and Nicholas H. Brown. "TheSpectraplakins':
cytoskeletal giants with characteristics of both spectrin and plakin
families." Journal of cell science115.22 (2002): 4215-4225.
Sander, Jeffry D., and J. Keith Joung. "CRISPR-Cas systems for editing, regulating and
targeting genomes." Nature biotechnology 32.4 (2014): 347.
Segner, Helmut. "Zebrafish (Danio rerio) as a model organism for investigating endocrine
disruption." Comparative Biochemistry and Physiology Part C: Toxicology &
Pharmacology 149.2 (2009): 187-195.
Seiler, Christoph, and Teresa Nicolson. "Defective calmodulin-dependent rapid apical
endocytosis in zebrafish sensory hair cell mutants." Journal of neurobiology 41.3
(1999): 424-434.
Shabbir, Muhammad Imran, et al. "Mutations of human TMHS cause recessively inherited
non-syndromic hearing loss." Journal of medical genetics 43.8 (2006): 634-640.
Vollrath, Melissa A., Kelvin Y. Kwan, and David P. Corey. "The micromachinery of
mechanotransduction in hair cells." Annu. Rev. Neurosci. 30 (2007): 339-365.
65 Vranceanu, Florin, et al. "Striated organelle, a cytoskeletal structure positioned to
modulate hair-cell transduction." Proceedings of the National Academy of
Sciences 109.12 (2012): 4473-4478.
Vreugde, Sarah, et al. "Beethoven, a mouse model for dominant, progressive hearing loss
DFNA36." Nature genetics30.3 (2002): 257.
Whitfield, Tanya T., et al. "Development of the zebrafish inner ear." Developmental
dynamics: an official publication of the American Association of Anatomists 223.4
(2002): 427-458.
Wu, Zizhen, and Ulrich Müller. "Molecular identity of the mechanotransduction channel
in hair cells: not quiet there yet." Journal of Neuroscience 36.43 (2016): 10927-
10934.
Xiong, Wei, et al. "TMHS is an integral component of the mechanotransduction machinery
of cochlear hair cells." Cell151.6 (2012): 1283-1295.
Zhao, Bo, and Ulrich Müller. "The elusive mechanotransduction machinery of hair
cells." Current opinion in neurobiology 34 (2015): 172-179.
Zhao, Bo, et al. "TMIE is an essential component of the mechanotransduction machinery
of cochlear hair cells." Neuron 84.5 (2014): 954-967.
66