Rescuing TTC7A Mutant Phenotypes Associated with Very Early Onset Inflammatory Bowel Disease Via High Throughput Drug Screening

Rescuing TTC7A mutant phenotypes associated with Very Early Onset Inflammatory Bowel Disease via high throughput drug screening

Sasha Lee Jardine

A thesis submitted in conformity with the requirements for the degree of Master of Science Department of Biochemistry University of Toronto

Rescuing TTC7A mutant phenotypes associated with Very Early Onset Inflammatory Bowel Disease via high throughput drug screening

Sasha Lee Jardine

Master of Science

Department of Biochemistry University of Toronto

2018 Abstract

Mutations in tetratricopeptide repeat domain 7A (TTC7A) cause a severe form of Very Early Onset

Inflammatory Bowel Disease (VEOIBD). Since 2013, >52 patients were reported with TTC7A- deficiency, having poor survival outcomes with combined primary immunodeficiency and severe intestinal phenotypes, including apoptotic enterocolitis and multiple intestinal atresia. Human

TTC7A-knockout cells demonstrated abnormal phenotypes related to morphology and apoptosis. ttc7a-mutant zebrafish displayed abberant intestinal features, recapitulating patient disease features and establishing a novel model system for TTC7A and VEOIBD. A high-throughput drug screen identified FDA-approved drugs that rescued the apoptotic phenotype in the knockout cells. Hits of interest were further validated with orthogonal cell and zebrafish phenotypes. Our lead compound, a drug used to treat inflammatory diseases, was identified as a novel therapy to rescue TTC7A- deficiency phenotypes. Since there is no treatment option for TTC7A-deficiency and the pathobiology remains unclear, target-agnostic phenotypic drug discovery was an efficient strategy to identify novel therapeutics.

Acknowledgments

Children and families affected by TTC7A-deficiency- Thank you for your involvement in past and present endeavors to understand the nature of the disease affecting your lives. Your participation is contributing to a future where precision medicine may become a reality.

Aleixo- I wanted to pursue a Masters so that I could gain more real-world experience in research. Thank you for the opportunity to “do” science and the independence to direct this project. Your research and my time in the lab has changed me and my perspectives on science, and I can’t wait to share my experiences with my students. The Muise Lab research is impactful and I’m so appreciative to have had the opportunity be a part of something that could make a difference in someone else’s life.

James Dowling and Roman Melnyk- Thank you for your continued support and insights. All advice was on-point and really helped to guide this project. Roman, your drug discovery class was a game changer, it confirmed what I should be doing and made me aware of things I had not considered in drug discovery. James, I attended one of your talks and your insights on drug repurposing and rare diseases resonated with me early on in this project and solidified the rationale for much of this work.

Hui- Thank you for always encouraging me to “try it”. Your positive attitude, supportive words, and expertise were inspiring. I hope that I can guide others in the way you guide all the students that come through the lab.

Gaby- Thank you for always listening, troubleshooting, and teaching me how to work with zebrafish. You’ve been a critical source of guidance and a wonderful mentor.

Khalid- The learning curve was steep when I came into this Masters. You were the best teacher I could have hoped for. Your patience, thoughtfulness, thoroughness and high standards for quality were always in the back of my mind throughout these years. Thank you.

Neil- Thank you for the continued support, thoughtful feedback, and fantastic advice. I’ll never forget how you helped me to troubleshoot through those initial pilot screening issues.

iii

Neel- You have always been so generous with your time and willing to help with anything (i.e. lysing 20 plates under time and temperature sensitive conditions!). Thank you for teaching me about TTC7A, it was nice brainstorming with someone who was also invested in TTC7A.

Muise Lab, Past and Present Members- Jie, Karoline, Takashi, Ryan, Cornelia, Maggie, Vritika, Zuhra, Eileen, Alessia, Neda, Qi, Frozan, Lin, and Emily. They say that it’s the combination of the work and people that make for a good graduate school experience. Thank you for your wisdom, creating a supportive atmosphere, and all the fun times. Gnocchi forever.

Mark Jen, Jenny Wang, Adrian Pasculescu and Alessandro Datti- Your expertise, insights, and commitment stand out in my mind. Thank you for your help in developing the drug screen and seeing it through to the validation stages.

Emily Yu, Emanuela Pannia, Ramil Noche and the Zebrafish Core Facility- Thank you for your thoughtfulness and diligence in caring for our fish and this project. Working with the zebrafish facility aided in the efficiency of experiments and helped to push this project further along.

Melanie Peralta and UHN Pathology- Thank you for your professionalism and patience in working with our teenie-tiny-almost-invisible zebrafish.

DPCDSB and St. Marguerite d’Youville SS colleagues- Thank you for giving me the unprecedented time-off to pursue a Master’s degree. I hope that this Masters provides further insights into the world of research for our budding scientists.

My family- The last 2 years have been a little bit of a balancing act. Tom, not only you have been contributing to more than your share of the parenting, but you were always there with encouraging words. I could not have done this without your support. Ben and Frances, thank you for being silly. Mom, throughout my life you have always told me that I could do whatever I wanted, thank you for instilling confidence in me. You are so thoughtful and always willing to lend a helping hand, you kept us afloat during these years. My wonderful family, thank you for your patience and support in allowing me to pursue one of my dreams.

Thank you to the CIHR, Helmsley Charitable Trust, The Hospital for Sick Children, and the University of Toronto for supporting this research.

Table of Contents

Acknowledgments...... iii

Table of Contents ...... v

List of Tables ...... viii

List of Figures ...... ix

Abbreviations ...... xi

List of Appendices ...... xvi

Epigraph ...... xvii

Chapter 1 Introduction ...... 1

1.1 Normal intestinal physiology and function ...... 2

1.1.1 Tissues and cells of the GI tract ...... 3

1.2 IBD ...... 7

1.2.1 Features of UC and CD ...... 7

1.2.2 Genetic involvement in IBD ...... 9

1.2.3 Environmental triggers in IBD...... 10

1.2.4 The microbiome and IBD ...... 10

1.2.5 Immune dysregulation in IBD ...... 11

1.3 Treatment regimen for IBD ...... 13

1.4 VEOIBD ...... 15

1.4.1 Genetics in VEOIBD ...... 15

1.4.2 Understanding genetics in VEOIBD can inform clinical action ...... 17

1.5 TTC7A ...... 18

1.5.1 Patient genetics, phenotypes and clinical background ...... 18

1.5.2 Heterogeneous TTC7A disease phenotypes ...... 23

1.5.3 HSCT in IBD and efficacy in treating TTC7A-deficiency ...... 24

1.5.4 Genotype/phenotype correlations in TTC7A-deficiency ...... 25

1.5.5 Molecular biology of TTC7A ...... 26

1.5.6 Cell biology of TTC7A ...... 29

1.5.7 Biochemistry of TTC7A ...... 33

1.5.8 Models for IBD and TTC7A study ...... 36

1.6 Drug discovery ...... 45

1.6.1 Target-based drug discovery ...... 45

1.6.2 Phenotypic drug discovery ...... 46

1.6.3 High-throughput screening and the drug discovery pipeline ...... 47

1.6.4 Drug repurposing and rare diseases ...... 49

Hypothesis and specific aims ...... 51

Chapter 2 Materials and Methods ...... 52

2.1 Cell lines ...... 52

2.2 Cell culture and drug treatment...... 53

2.3 Microscopy ...... 53

2.4 Fluorescent cell staining ...... 54

2.5 Flow cytometry ...... 54

2.6 Viability assay ...... 55

2.7 Adhesion assay...... 55

2.8 Western blot ...... 56

2.9 Caspase activity assay ...... 57

2.10 High-throughput drug screen ...... 58

2.11 Zebrafish ttc7a-/- model ...... 59

2.12 Peristalsis assays ...... 59

2.13 Histology ...... 60

2.14 Statistical analysis ...... 60

Chapter 3 Results ...... 61

3.1 Confirmation of a novel TTC7A-knockout cell line...... 61

3.2 TTC7A-KO cells exhibit phenotypes associated with apoptosis ...... 63

3.3 ttc7a-mutant zebrafish display aberrant intestinal phenotypes ...... 70

3.4 Phenotypic drug screen model ...... 77

3.5 Identification of small molecules that could rescue the apoptotic phenotype in TTC7A-KO cells ...... 80

3.6 Hit compounds rescue concomitant phenotypes related to TTC7A-deficiency ...... 85

3.7 Abnormal ROCK-activity is unlikely to drive apoptosis ...... 93

3.8 Candidate drugs improve ttc7a-mutant zebrafish intestinal phenotypes ...... 96

Chapter 4 Discussion ...... 104

4.1 Drug screen ...... 106

4.2 TTC7A phenotypes ...... 108

4.3 Zebrafish model ...... 113

4.4 Concluding remarks ...... 115

Appendices ...... 130

vii

List of Tables

Table 1: TTC7A patients reported in 2013 …………………………………………………….. 20

Table 2: TTC7A patients reported in 2014……………………………………………………... 21

Table 3: TTC7A patients reported in 2015-2017……………………………………………….. 22

Table 4: IC50 values of hit compounds in 3 different TTC7A-mutant cell lines …….. ……….. 83

Table 5: Summary of hit compounds that were able to rescue the apoptotic phenotype ……… 84

viii

List of Figures

Figure 1. Histology samples from small and large intestine ...... 6

Figure 2. Hallmark features associated with CD and UC ...... 8

Figure 3. Genetics, immune function, and the intestinal epithelial barrier can affect the development of IBD ...... 9

Figure 4. Domain architecture and ribbon diagram for TTC7 ...... 28

Figure 5. TTC7A patient-derived organoids showed aberrant polarity ...... 32

Figure 6. Model for TTC7A’s role in recruiting PI4K to the plasma membrane ...... 34

Figure 7. Model for the PI4KIIIα-complex at the plasma membrane ...... 35

Figure 8. Hematoxylin and eosin staining of the zebrafish GI-tract at 5-6 dpf ...... 39

Figure 9. Confirming the HAP1 TTC7A-KO cell line ...... 62

Figure 10. Cell morphology of WT and TTC7A-KO cells with DIC microscopy ...... 65

Figure 11. Phalloidin staining of WT and TTC7A-KO cells ...... 67

Figure 12. Increased Annexin V-FITC staining in TTC7A-KO cells ...... 68

Figure 13. Reduced cell viability and increased cleaved Caspase 3 in TTC7A-KO cells ...... 69

Figure 14. DNA and protein sequences for ttc7a-mutant zebrafish ...... 72

Figure 15. Phenotypes associated with ttc7a-mutant zebrafish ...... 74

Figure 16. Zebrafish intestinal histology ...... 76

Figure 17. Phenotypic drug screening model and workflow ...... 79

Figure 18. Drug classification families and relative Caspase-inhibition of hit compounds ...... 82

Figure 19. Concentration-response curves for Leflunomide ...... 83

Figure 20. Orthogonal validation of candidate drugs in TTC7A-KO cell line ...... 88

Figure 21. Phalloidin staining after drug treatment ...... 90

Figure 22. TTC7A-KO cell viability after drug treatment ...... 92

Figure 23. ROCK activity and the apoptotic phenotype in TTC7A-KO cells ...... 95

Figure 24. Candidate drugs improve ttc7a-mutant zebrafish phenotypes ...... 98

Figure 25. Zebrafish histology with schematics indicating features of interest ...... 100

Figure 26. Zebrafish histology after drug treatments...... 103

Figure 27. Project summary ...... 105

Figure 28. Suggested model linking TTC7A-deficiency and apoptosis ...... 112

Abbreviations

4-PBA- 4-phenylbutyrate 5-ASA- 5-aminosalicyclic acid, anti-inflammatory ADAM-17- Disintegrin and metalloproteinase domain-containing protein 17 ADD3- Adducin 3, cytoskeletal protein in cell-cell contact ADMET- absorption, distribution, metabolism, excretion, and toxicology profiles AKT- RAC-alpha serine/threonine-protein kinase, also known as protein kinase B AMPs- antimicrobial peptides ANOVA- analysis of variance ATG16L1- autophagy related protein 16-1 B-cells- Bone marrow maturing lymphocytes BAD- Bcl-2 associated death promoter BMP- bone morphogenic protein Caco-2 - Human epithelial colonic adenocarcinoma cells Calcein AM- calcein acetoxymethyl, cell permeable viability substrate Cas9- CRISPR associated protein 9 CD- Crohns disease CD4+-cluster differentiation type 4, extracellular glycoprotein on helper T cells CD8+-cluster differentiation type 8, extracellular glycoprotein on cytotoxic T cells cdipt hi559 - CDP-diacylglycerol–inositol 3-phosphatidyltransferase, generated from crossing hi559 heterozygotes CID- combined immunodeficiency disorder CRISPR- Clustered Regularly Interspaced Short Palindromic Repeats Cxcl8/IL-8 - chemokine or interleukin 8 CYANO- Cyanocobalamin

DAG- diacylglycerol, part of the IP3 pathway DAPI- 4′,6-diamidino-2-phenylindole DCFH-DA - 2’,7’-Dichrolodihydrofluorescein diacetate DIC- Differential interference contrast microscopy DMARD- Disease Modifying Anti-Rheumatic Drug

DMSO- Dimethyl sulfoxide dpf- days post fertilization DSS- dextran sulfate sodium EFR3A/B- EFR3 homolog A/B EGF-epidermal growth factor ERM- Ezrin, Radixin, Moesin F-actin- filamentous actin FAS - Fasudil FAM126A/B- Family with sequence similarity 126, A/B member FBS- fetal bovine serum FDA- Food and Drug Administration FEN- Fenbufen FITC- Fluorescein isothiocyanate FLAG- epitope DYKDDDDK FMT- fecal microbiome transplant FOXP3-forkhead box P3, transcription factor fan- flaky skin mice GALT- gut-associated lymphoid tissue GI- Gastrointestinal GPCR- G-protein coupled receptor GVHD- graft versus host disease GWAS- genome-wide association studies H&E- hematoxylin and eosin staining HAP1- near-haploid human cell line, derived from chronic myeloid leukemia cells HEK 293T- human embryonic kidney 293T cells HeLa- cervical tumour taken from Henrietta Lacks HLA- human leukocyte antigen hpf- hours post fertilization HRM- high melt resolution genotyping HSCT- hematopoietic stem cell transplantation HT-29- human colorectal adenocarcinoma

xii

IBD- inflammatory bowel disease IBDU- Inflammatory bowel disease unclassified

IC50- half-maximal inhibitory concentration IEC- intestinal epithelial cell IFNγ- interferon gamma IL- interleukin cytokine IPEX- X-linked immune dysregulation, polyendocrinopathy, and enteropathy Ki-67- proliferation marker from MKI67 gene LEF- Leflunomide LGR5- leucine-rich repeat containing G-protein coupled receptor 5 LRBA- lipopolysaccharide (LPS)-responsive and beige-like anchor protein M- cells- microfold intestinal epithelial cells mGluR5- Metabotropic glutamate receptor 5, G protein-coupled receptor MIA- multiple intestinal atresia MLC- myosin light chain mTORC2- mammalian/mechanistic target of rapamycin complex 2 Muc2- mucin 2 Myc- epitope EQKLISEEDL NADPH- Nicotinamide adenine dinucleotide phosphate NEC- Necrotizing Enterocolitis NF-ĸβ- nuclear factor kappa-light-chain-enhancer of activated B cells NOD2- nucleotide-binding oligomerization domain-containing protein 2 NSAID- nonsteroidal anti-inflammatory drug PBS- phosphate buffered saline PDK1- 3-Phosphoinositide-dependent kinase 1 PH- pleckstrin homology

PI (3,4,5) P3- phosphatidylinositol-3,4,5-trisphosphate

PI (4,5) P2- phosphatidylinositol-4,5-bisphosphate PI- phosphatidylinositol PI3K- phosphatidylinositol 3-kinase PI4KIII- Phosphatidylinositol 4-kinase Type III Alpha

xiii

PI4P- phosphatidylinositol 4-phosphate PIP- phosphatidylinositol phosphates PTU- 1-phenyl 2-thiourea R&D- research and development RFU- relative fluorescence units RhoA- Ras homolog gene family, member A RLU- relative light/luminescence units ROCK- rho-associated, coiled-coil-containing protein kinase SCID- Severe combined immunodeficiency SD/THE- Tricho-hepato-enteric syndrome SDS-PAGE- sodium dodecyl sulfate polyacrylamide gel electrophoresis shRNA- short hairpin RNA SNPs- single nucleotide polymorphisms T cells- thymus maturing/T-receptor lymphocytes TGFβ- transforming growth factor beta Th1- Type 1 helper T cell Th17- Type 17 helper T cell Th2- Type 2 helper T cell TIA- Tiaprofenic acid TLR- toll-like receptors TMEM150A- Transmembrane Protein 150A TNBS- trinitrobenzene sulfonic acid TNFα- tumor necrosis factor alpha TPR- Tetratricopeptide Repeat TTC37-tetratricopeptide repeat domain 37 TTC7A -/- - zebrafish homozygous for Exon 14 11 base pair deletion ttc7a -/- - zebrafish homozygous for Exon 14 11 base pair deletion TTC7A +/- - zebrafish heterozygous for Exon 14 11 base pair deletion ttc7a +/- - zebrafish heterozygous for Exon 14 11 base pair deletion TTC7A- tetratricopeptide repeat domain 7A TTC7A-KO- TTC7A knockout

xiv

TTC7B- tetratricopeptide repeat domain 7B UC- Ulcerative colitis VEOIBD- Very Early Onset Inflammatory Bowel Disease WES- Whole exome sequencing wpf- weeks post fertilization WT- Wildtype XIAP- X-linked inhibitor of apoptosis

List of Appendices

Uncropped western blots ……………………………………………………………………… 130

xvi

Epigraph

Nature is nowhere accustomed more openly to display her secret mysteries than in cases where she shows traces of her workings apart from the beaten path; nor is there any better way to advance the proper practice of medicine than to give our minds to the discovery of the usual law of nature by the careful investigation of cases of rarer forms of disease. For it has been found in almost all things, that what they contain of useful or of applicable nature, is hardly perceived unless we are deprived of them, or they become deranged in some way.

William Harvey (1578–1657)

xvii

Chapter 1 Introduction

Inflammatory bowel disease (IBD) has garnered attention in the last two decades due to increasing prevalence rates in Europe and North America, as well as rising incidence rates globally. Nationally, there are more than 10,200 new cases of IBD diagnosed each year, making Canada among the countries with the highest incidence rates.1 The etiology of IBD is not fully understood due to the idiopathic and multifactorial nature of the disease. In genetically susceptible individuals, IBD may be triggered by environmental, lifestyle, immune, and luminal microbiotic stressors. In contrast, in children (<6 years of age) diagnosed with very early onset inflammatory disease (VEOIBD), there are higher rates of consanguinity and/or a precedence of familial IBD compared with the adult disease, thus, providing confidence that genetics plays an important role in the disease.2 Moreover, VEOIBD is unlike typical IBD because there are few effective treatment options, severe phenotypes, and poor patient outcomes.3 Whole exome sequencing (WES) of patients and their parents’ DNA has revealed that VEOIBD can be caused by several rare genetic mutations. 4

Rare autosomal recessive variants in tetratricopeptide repeat domain 7A (TTC7A) have been uncovered in the most severe forms of VEOIBD.5 Patients with TTC7A mutations present with conditions affecting the intestinal epithelium and immune system. Mounting evidence suggests that loss of function TTC7A mutations can also result in a severe form of VEOIBD.5-7 Since 2013, there have been over 52 TTC7A-cases reported in literature, and unfortunately, 2/3 of these children succumbed to the disease, with a median survival age of <12 months.2 There have been over 20 distinct TTC7A gene mutations described, from homozygous recessive to compound heterozygous. Multiple mutations in the TTC7A gene combined with clinical phenotype heterogeneity has made it difficult to correlate phenotype and genotype. 5-12 The structure, interactions, targets, and mechanistic details of TTC7A remain to be elucidated. Presently, as more TTC7A patients are being discovered, there is a great need to identify effective drug treatments for this severe and often fatal condition.

1 2

The need for therapies targeting TTC7A-deficiency motivated the search for effective treatment options. Given that the rising prevalence of IBD in Canada is driven by the rapidly increasing incidence in children, the unmet need for therapeutics has become more apparent.13 The role of TTC7A in the pathogenesis of VEOIBD is largely unknown. Specifically, establishing models for TTC7A research and defining mutant phenotypes in vitro and in vivo will allow for development of a phenotypic drug screen and identification of novel and/or repurposed drugs for use in clinical settings. The overall research goal is to identify compounds that can rescue aberrant phenotypes induced by the TTC7A defect via high-throughput drug screening.

1.1 Normal intestinal physiology and function

The intake and metabolism of nutrients is one of the defining characteristics of life. Normal functioning of the gastrointestinal (GI) tract is thus essential for humans to survive and thrive. In an adult, the GI tract is a continuous tube approximately 9 meters in length that is involved in food intake, coordinated intestinal motility, digestion of food, absorption of nutrients and water, and excretion of waste.14 The GI tract is the source of the largest exposure to the external environment, making it an organ important in both digestion and in the immune system. 14

Nature’s theme of aligning structure and function is no better represented than in the GI tract. For example, nutrient absorption in the GI tract is achieved because of the presence of microvilli, villi, and plicae, structures that work together to create large surface area. The lower GI tract consists mainly of the small and large intestines or bowels. The small intestine is histological diverse and can be further divided in the duodenum, jejunum, and ileum, while the large intestine includes the ascending, transverse, descending, and sigmoid colon, finally terminating at the rectum and anal sphincter. Throughout the GI tract, a consistent intestinal epithelial barrier must be maintained in order to prevent pathogenic bacteria and other agents from entering tissues and the circulatory system.15

The small intestine accounts for most of the length of the GI tract, highlighting its obligatory function in the absorption of sugars, carbohydrates, fats, proteins, and other nutrients bound for the bloodstream.16 The main function of the large intestine or colon is to reabsorb water and electrolytes via osmosis. Specifically, the absorption of solutes drives the osmotic gradient that allows water absorption to be coupled through ion exchange, including Na+ channels and transporters on apical membranes and Na+/K+ ATPases on the basolateral membranes.17 Furthermore, the failure of solutes or water to be absorbed results in diarrhea.18

1.1.1 Tissues and cells of the GI tract

Histologically, the GI tract is composed of specialized layers of tissue. The mucosa is closest to the intestinal lumen, followed by the submucosa, muscularis and the serosa (Figure 1).19 The mucosa is the surface that has the greatest interaction with the external environment of the intestinal lumen. The mucosa includes an epithelial layer that is attached to extracellular matrix components of the loose connective tissue below, known as the lamina propria.20 Intestinal epithelial cells (IECs) or enterocytes represent the most abundant cell type of the GI tract and these cells are tightly joined to maintain the epithelial barrier.15,21 IECs have a brush border morphology on the luminal side is composed of microvilli. Enterocytes are arranged as a single monolayer of simple columnar epithelial cells, which are adapted for nutrient uptake via their microvilli and expression of apical enzymes that catabolize further nutrient breakdown to amino acids, sugars, and simple fats for cellular absorption. On the apical surface of the IEC is a matrix-like substance known as the glycocalyx, made of several glycolipid and glycoprotein moieties thought to be important in cell signaling between internal and external microenvironments, cell adhesion, and cell recognition. 22

Among the IECs are mucin-producing goblet cells, whose primary role is to secrete another protective covering made of mucinous glycoproteins. The mucous layer acts as a lubricant, for the passage of materials, and a physical barrier, blocking pathogenic agents and contributing to the immunologic host defense system.23 The large intestine has a greater

4 concentration of goblet cells compared with the small intestine, which is thought to be chemically and mechanically protective as well as creating a microenvironment for commensal bacteria. In addition to absorptive IECs and goblet cells, Leucine-rich repeat containing G- protein coupled receptor 5 (LGR5) expressing intestinal stem cells are at the base of intestinal glands (or crypts of Lieberkühn).24 Intestinal stem cells can divide and differentiate to absorptive enterocytes, goblet cells, enteroendocrine cells, M cells, Cup cells, Tuft cells, and Paneth cells. Enteroendocrine cells are important for the secretion of GI hormones. Microfold “M” cells are associated with Peyer’s patches, sampling antigens from the lumen and transporting them across the epithelia to antigen presenting dendritic and B cells. 15 Cup and tuft cells have largely uncharacterized functions. Finally, Paneth cells are located at the bases of crypts in the small intestine, produce growth factors for intestinal stem cells, and secrete peptides for regulating the microbiome. 15 Furthermore, as intestinal stem cells give rise to the various types of IECs, these cells migrate away from crypts and become progressively differentiated as they near villi tips. Eventually, enterocytes are shed via apoptosis (programmed cell death), completing a 4- to 7-day epithelial renewal cycle.15 The composition of the intestinal epithelia in the small and large intestine are generally similar, notwithstanding the presence of villi and Paneth cells exclusively in the small intestine and increased abundance of goblet cells in the large intestine.15 The presence of cell-cell junctions near apical surfaces are an important feature shared among all IEC types that maintains barrier function.25

IECs are tightly coupled to the immune system; for example, IECs can initiate immune responses via their expression of surface receptors able to recognize various antigens and microbes.14,15,21,26 Beneath the surface epithelium of the GI tract, the loose connective tissue of the lamina propria houses villous capillaries (small blood vessels), bridging nutrient absorptive enterocytes and the circulatory system.20 Notably, cells in the lamina propria include but are not limited to extracellular matrix-secreting fibroblasts, macrophages, and lymphocytes. The loose connective tissue of the lamina propria is typically elastic, allowing the GI tract to move with the circular and longitudinal contractions that coordinate in peristalsis.27 Capillaries and lymphatic vessels (lacteals) also serve as vehicles connecting lymphocytes to the epithelia and, consequently, the lamina propria is where lymphocytic infiltration can be observed during inflammatory responses.28 The body is protected against antigens via gut-associated lymphoid tissue (GALT), which is present throughout the GI tract. GALT contains the largest antibody

5 producing plasma B-cells relative to other areas in the lymphatic system. In the ileum, Peyer’s patches are a component of GALT in the lamina propria. Peyer’s patches are made of small lymphoid nodules associated with both T and B lymphocytes that monitor and trap pathogenic bacteria and facilitate intestinal immune responses. 28

The mucosa is delineated by a thin smooth muscle layer called the muscularis mucosae, which is involved in gut motility.19,27 Past the mucosa, the submucosa is a collection of dense connective tissue also containing lymph vessels, blood vessels, and the enteric neuronal network that controls motility and neurotransmitter signaling. The submucosa is demarcated by the muscularis externa, consisting of an inner circular and outer longitudinal layer, separated by the myenteric nerve that regulates peristalsis. 29,30 Coordinated gut motility is an important component of healthy intestinal functioning, where abnormal peristaltic activity may result in diarrhea, constipation, pseudo-obstruction, intestinal distension, and bacterial over growth in the small bowel. Finally, the serosa (or adventitia in the small bowel) consists of connective tissue and is the outer layer of the GI tract. 29,30

The intestinal epithelium facilitates crosstalk between luminal microbes and the host immune system.15,31 The importance of gut microbiome has certainly been appreciated given the increased prominence in both scientific and public spheres over the past decade.32 The Human Microbiome Project sequenced and published the genomes of common microorganisms in 2012. The human microbiome is estimated to have over 100 trillion bacteria, with microbiomes being diverse and unique from individual to individual.33 The immune system and microbiota have a symbiotic relationship where the immune system allows commensal bacteria to thrive while the commensal bacteria regulate the activation of toll-like receptors (TLRs) on IECs if pathogenic bacteria are present.34 In this way, IECs can internalize luminal pathogenic signals and secrete chemical signals important in recruiting and activating macrophages and other immune cells. The intestinal microbiota has been shown to directly influence the integrity of the mucosa. Research with germ-free mice revealed that the lack of luminal microbes resulted in the thinning of the mucosa and weakening of the intestinal barrier, making mice more susceptible to antigens.15 The microbiome is thought to influence many aspects of health outside of digestion, as well as having a complex relationship with the GI tract and the immune system.

Figure 1. Histology samples from small and large intestine

Small intestine sample was taken from the jejunum. Note that the small intestine has villi that project into the lumen, while the large intestine lack villi. H&E images were adapted from http://myhistologydiagrams.blogspot.com/2016/02/special-histology-specific-points.html 35

1.2 IBD

Inflammation is our body’s attempt to heal itself after injury or exposure to stimuli and inflammatory responses can be acute, lasting a few days, or chronic.36 Inflammation is typically associated with swelling, increased blood flow, loss of function, and pain, all part of the immune system’s attempt to clear the insult and heal the affected tissue.36 IBD involves chronic relapsing inflammation of the GI tract, changing its normal physiology and function. Canada has one of the highest rates of IBD, with over 200,000 affected individuals.1 In addition to the $2.8 billion economic burden, IBD also has significant impacts on quality of life and increased risk of mortality.1 Although IBD is prevalent in Western countries, there is increasing incidence in parts of the world where IBD was not previously found.3 IBD is an umbrella term that includes Crohn’s disease (CD) and ulcerative colitis (UC). When phenotypic and symptomatic overlap renders it difficult to classify as UC or CD, an IBD unclassified (IBDU) diagnosis is applied.37 The etiology of IBD is not fully understood due to the interaction of various factors contributing to the disease, including lifestyle, environment, immune function, gut microbiota, and genetic involvement. Variability in age of onset, pathophysiology, phenotypic heterogeneity, severity of disease, and efficacy of treatment also confounds our understanding of IBD. In most cases, there is no cure for IBD, and patient symptoms can include, but are not limited to, diarrhea with or without blood, pain, poor psychological and social states, bowel obstruction, weight loss, and fatigue.37

1.2.1 Features of UC and CD

There are many hallmark features of UC and CD; however, the main differences are related to the location of inflammation and the appearance of affected tissues (Figure 2). Chronic inflammation increases the risk of developing of colorectal cancer, GI fibrosis, and organ failure.38 Fibrosis, or stiffened tissue, results from scarring that can lead to loss of bowel function, reduced motility, stricturing, obstructions, and surgical resections. Although UC and

CD share over 100 disease susceptibility loci as per genome-wide association studies (GWAS), the site of inflammation in UC is usually limited to the colon, whereas the entire GI tract (from mouth to anus) can be affected in CD.13 Imaging via colonoscopy reveals that the mucosal lining in UC is ulcerated, contributing to bloody diarrhea, whereas lesions in CD usually extend deep into and beyond the intestinal mucosa.39 Furthermore, CD afflicted colons present with cobblestone-like morphology due to the presence of interrupted healthy and inflamed regions, whereas UC colons have a continuous pattern of inflammation. GI tracts affected by CD may also have the presence of granulomas (collection of compact immune cells and foreign material), strictures, fissures, abscesses (pus), and fistulas (abnormal connections between different tissues). Extraintestinal manifestations affecting hair, skin, joints, and eyes can be associated with both UC and CD. With increased understanding of the factors affecting IBD, the range and variability in phenotypes is suggestive of a spectrum of severity and extent, perhaps more complex than simply UC and CD designations.39

Figure 2. Hallmark features associated with CD and UC

CD features can be found throughout entire GI tract, whereas UC disease features are limited to the colon or large intestine. Figure obtained from Wagnerova and Gardlik 2013.40

1.2.2 Genetic involvement in IBD

IBD is incompletely understood, due in part to the multifactorial nature of the disease. Genetic susceptibility for IBD may not be enough to develop the disease whereas additional immune, environmental, lifestyle, and microbiota stressors may favour the development of IBD.39 The first gene linked to increased susceptibility for CD was the nucleotide-binding oligomerization domain-containing protein 2 (NOD2), a gene that encodes an intracellular receptor important in recognizing a conserved motif in bacteria.31 NOD2 is expressed in epithelial and innate immune cells and regulates intestinal innate immune responses.31 Furthermore, the advances in DNA sequencing and GWAS have led to the identification of more than 200 polygenic IBD susceptibility loci, contributing to the overall risk of disease.37 Of the susceptibility loci, both UC and CD share about half, whereas 23 and 30 gene loci are specific to UC and CD, respectively. 31 These IBD susceptibility loci are associated with the epithelial barrier and innate/adaptive immune regulation (Figure 3). Interestingly, 93 of the susceptibility IBD loci are associated with epigenetic regulation of DNA, where variants map near DNA binding regulatory sites.13 The presence of IBD susceptibility loci only explains about a quarter of the IBD cases, and it is possible that there are outstanding genes to be discovered and that auxiliary gene interactions may contribute to IBD pathogenesis. 31

Figure 3. Genetics, immune function, and the intestinal epithelial barrier can affect the development of IBD

Loss of the epithelial barrier can result in bacterial infiltration and mucosal inflammation. AMPs= antimicrobial peptides. Adapted from Coskun 2014.41

1.2.3 Environmental triggers in IBD

Diet, smoking, psychosocial triggers, and geography are some of the environmental risk factors for developing IBD.1 Confoundingly, cigarette smoke has a protective effect in the development of UC, while smoking increases the risk for CD.31 There has also been mounting evidence linking Vitamin D deficiency with increased risk of IBD.42 For example, it is not uncommon for patients with IBD to have Vitamin D deficiency, and IBD mouse models supplemented with Vitamin D were reported to have reduced inflammation.42 The use of nonsteroidal anti- inflammatory drugs (NSAIDs) and early exposure to antibiotics (within the first year of life) are additional environmental factors that have been associated with increased risk of developing IBD.31 In terms of psychosocial triggers, the roles of stress, anxiety, and depression as risk factors for IBD are debated. Research has shown that increased severity of IBD is correlated with increased depression, where antidepressants were able to improve clinical outcomes, suggesting that psychological factors may have a role in the pathogenesis of CD and UC.43,44 More research is needed to fully characterize the environmental risk factors contributing to the development of IBD and to understand how these factors interact with host genetics, immunity, and microbiome.

1.2.4 The microbiome and IBD

The entire human gut microbiota is estimated to consist of 1150 species of bacteria, with a tenth of that in any given individual.33 Firmicutes and Bacteroidetes are the most represented phyla in the human microbiota.33 The biodiversity of the UC and CD gut microbiome is reduced or unstable compared to healthy controls. For example, Firmicutes and Bacteroidetes are reduced in CD, while both UC and CD are linked to mucosal increases in Escherichia coli (E. coli).31 In CD, E. coli has been reported to penetrate the epithelia and propagate in macrophages. E.coli’s presence in granulomas suggests a role in the pathogenesis of CD.31 Fecal microbiome transplant (FMT) has been shown to re-establish a healthy microbiota. Several clinical trials have shown

11 that FMT can abrogate inflammation, thus highlighting the role of the microbiota in IBD and establishing the microbiota as a possible avenue for therapy.32

1.2.5 Immune dysregulation in IBD

Of the 230 IBD susceptibility loci, more than 100 single-nucleotide polymorphisms (SNPs) are shared with other autoimmune diseases such as Rheumatoid Arthritis (chronic inflammation and destruction of joints).3 The link between IBD and immune involvement is well researched and aberrations may exist in both innate and adaptive immune cells and mechanisms.

1.2.5.1 Examples of innate immune dysregulation in IBD

The mucous layer and epithelial barrier represent the first level of defense in innate immunity. Mucin is a critical component of the protective mucous layer and Muc2 knockout mice were found to have more severe colitis (increased histologic damage) due to increased microbial interactions with the epithelia.34 Innate immune responses rely on the identification of bacterial and viral motifs via extracellular TLRs and intracellular NOD-type receptors by epithelial cells, macrophages, monocytes, natural killer cells, dendritic cells, and neutrophils.34 A reduction in TLRs and NOD receptors are found in IBD, linking poor microbe recognition with impaired innate responses. Defects in autophagy (‘self-eating’ or autophagocytosis) and the epithelial barrier also represent aspects of innate immunity that increase susceptibility to developing IBD.13,31 Mutations in ATG16L1, a gene that affects general autophagy, was linked to CD. Defects in antimicrobial autophagy result in a loss of homeostasis, activating the unfolded protein response, which results in endoplasmic reticulum stress leading to cellular apoptosis.13,31 Loss of epithelial barrier function results in increased bacterial infiltration of the mucosa and a reduction in glycocalyx peptides, which also keep bacteria away from the mucosa.22 Innate immune cells (i.e., macrophages, natural killer cells, neutrophils, mast cells, and eosinophils) on

12 the basolateral surface of the epithelial layer maintain barrier function by secreting epidermal growth factor (EGF) that activates repair processes, and can secrete proinflammatory cytokines to limit bacterial infiltration into the mucosa.45 Furthermore, chronic exposure of epithelial cells to proinflammatory cytokines such as tumor necrosis factor alpha (TNFα) and interferon gamma (IFNγ) drives abnormal IEC differentiation via epithelial-mesenchymal transition. Once IECs begin to differentiate, they lose defining epithelial features such as their polarized structure, monolayer organization, adhesions, and barrier function, which in turn heightens immune and inflammatory responses.46

1.2.5.2 Examples of adaptive immune dysregulation in IBD

The T-cell adaptive immune response has been well studied in IBD, where helper T-cell, Th1 (IL-12/27 induced) and Th2 (IL-4/5/13 induced), responses are thought to drive CD and UC, respectively.47 Furthermore, in the presence of the IL-6 cytokine and transforming growth factor beta (TGFβ), T cells differentiate to Th17 cells, which secrete IL-17/22, abundant cytokines found in CD and UC mucosa. Mucosal infiltration by macrophages, dendritic cells, neutrophils, T cells and B cells is typical when there is chronic inflammation. Protection against pathogens is mediated by CD4+ effector T cells, mainly Th1, Th2, and Th17 cells, while regulatory T cells are important in limiting CD4+ effector T cell activity and autoimmunity.47 Either the over-activation of CD4+ effector T cells or poor regulatory T cell immunosuppression can drive aberrant immune responses in IBD. Increased numbers of cytotoxic CD8+ T cells have also been found in IBD patients, highlighting the failure to discern “self” and inducing an autoimmune response. Germ-free mice show decreased numbers of CD4+, CD8+, and regulatory T cells, all of which were reestablished upon microbiota introduction, suggesting a link between adaptive immunity and the microbiome.13 Normal immune function is critical in maintaining intestinal homeostasis via coordination with the microbiome, antigenic tolerance, and epithelial barrier.

1.3 Treatment regimen for IBD

While there is typically no cure for IBD, the standard of care for IBD treatment is well established and patient symptoms can usually be effectively managed. Since periods of remission and relapse are common in IBD, treatment regimens can be further stratified for symptomatic induction of remission or maintenance.1 Current strategies for IBD treatment generally follow a step-wise approach, which corresponds to increasing disease severity. Treatments that target mild to worse symptoms include: antibiotics, anti-inflammatory agents, steroids, immunomodulators, biologics, and surgery.48

Increased levels of colonic E. coli have been linked with IBD; thus, antibiotics may be effective in reducing levels of pathogenic bacteria.31 Common antibiotics used for IBD treatment include metronidazole and ciprofloxacin; however, they result in modest improvements for IBD patients. Potential consequences of antibiotic use include reduced biodiversity of gut microbes, development of antibiotic resistance, and increased risk for Clostridium difficile infection resulting from dysbiosis (microbial imbalance) and immunosuppression.49,50 IBD treatment also begins with anti-inflammatory agents such as 5-aminosalicyclic acid (5-ASA)/mesalazine, which can be effective for both induction of remission and maintenance.48 The efficacy of anti- inflammatory agents is higher in UC as compared with CD. Systemic corticosteroids (i.e., prednisolone, budesonide) are used for inducing remission; however, they are not ideally used for long-term maintenance due to significant side effects, including, but not limited to, osteoporosis, increased risk of infection, cataracts, and diabetes.48

Immunomodulators can reduce immune activity and include such drugs as methotrexate and azathioprine. In recent years, immunomodulators and biologics have become popular treatment options in IBD since they can be used long-term to maintain remission and in combination with lower doses of steroids.51 Significant adverse effects associated with immunomodulators include bone marrow suppression, leukopenia, increased risk of infection, and various cancers.52

The use of anti-TNFα monoclonal antibodies was first reported in the early nineties and showed considerable improvement in CD activity (i.e., pain, GI-tissue damage, diarrhea).53 Several biologics have since been developed to treat CD and UC, these include anti-integrin (to reduce leukocyte tissue-infiltration) and anti-TNFα biologics, infliximab (Remicade®, Janssen) and adalimumab (Humira®, Abbott) being the most well-known.54 For UC and CD patients, biologics are generally well tolerated, shown to be effective for induction and maintenance and can be used in combination with other IBD therapies. Loss of response has been reported in some patients, and some develop antibodies against biologics due to their immunogenic nature.55 Since most IBD patients have used biologics in combination with other drugs, it is difficult to assess toxicity solely attributed to biologics; thus, it is unknown what the long-term safety profile of biologics will reveal.56 High cost of treatment aside, increased risk of infections, immunogenicity, injection-site reactions, and malignancies represent the risks of biologic use.55,56

It is estimated that 25-35% of UC patients and 70%-90% of CD patients will require surgical intervention when therapies fail or complications result, such as bowel obstruction in CD.49 In UC, severe colitis with flares lasting more than 7 days and in combination with poor response to treatment, is an indication for colectomy. Colonic perforation or signs of perforation are strong indicators for surgery, associated with 27-57% of deaths in UC patients.57 Fistulas and obstructions (acute and chronic) are a common complication in CD. Chronic obstructions tend to be permanent structures that are unresponsive to therapeutic interventions since they are fibrotic in nature, resulting from scarring associated with chronic inflammation.38 It is estimated that 40- 70% of patients that have undergone surgical resection will require additional surgical interventions, highlighting the increased rates of relapse and the poor outcome of therapeutic interventions.58

An imbalanced microbiota has been shown to have negative impacts on the epithelial barrier and immune system.13 The balance of pathogenic and commensal microbes (bacteria, fungi, viruses) in the fecal matter from IBD patients is altered relative to healthy controls; thus, this change in the microbiome represents a therapeutic target. An emergent therapy that aims to re-establish a healthy microbiome is FMT.32 Meta-analysis of various reports found that FMT was more effective in establishing remission in CD (61%) than in UC (22%) patients.59 While

15 the safety profile of FMT is in its infancy, there have been adverse effects, including, but not limited to, fevers, increased inflammation, and flare relapses, all suggesting that more work is necessary to understand when and to whom FMT would be efficacious.32,59

1.4 VEOIBD

Relative to adult IBD, the subset of children under 10 years of age diagnosed with IBD shows a faster rising incidence.60 In Ontario alone, the prevalence (number of individuals with the disease/time period) of pediatric IBD rose approximately 4% from 1994 to 2009, while adult IBD increased by 0.4% over a similar time period.60 The current incidence (the rate of newly diagnosed cases) and prevalence of VEOIBD is 4.37/100,000 and 14/100,000 children, respectively.61 Criteria for a VEOIBD diagnosis in children less than 6 years old may include the presence of the following: autoimmunity, primary immunodeficiency, lymphoid mucosal infiltration, ileal inflammation, general colonic inflammation, histological features in line with CD, UC or IBDU, growth delay, penetrating lesions, stricturing, perianal disease, and/or diarrhea.3,4 The severity and extent of GI tract inflammation varies between adult and the pediatric subset, where approximately 43% of children have extensive ileocolonic inflammation, compared to 3% in the adult group.13 Furthermore, the younger the children at the age of diagnosis, the greater the proportion (one-third) with IBDU phenotypes, highlighting the complexity and diverse phenotypic range of VEOIBD disease features.4

1.4.1 Genetics in VEOIBD

While IBD can be multifactorial among the adult subset, patients with VEOIBD are more likely to have affected family members and/or consanguineous parents.3,5 The early age of diagnosis is also suggestive of a strong genetic component since children have not had adequate time to acquire environmental, microbiome, or lifestyle insults. In contrast, in children more than 7 years

16 of age, the frequency of IBD due to several associated gene variants (polygenic IBD) increases.4 Patients diagnosed with VEOIBD tended to be enriched for causative monogenic or Mendelian rare variants.4 For example, mutations in IL-10 signaling, XIAP, LRBA, or FOXP3 were highly penetrant variants identified through WES in VEOIBD patients.4 Uhlig and colleagues (2014) noted that the presentation of IBD-like phenotypes associated with monogenic rare variants consistently correlates with early onset diagnoses.4 To corroborate these findings, a recent unpublished study analyzing sequencing data from over 1000 retrospective patients (from a single center), identified 67 genes that were thought to drive pediatric monogenic VEOIBD. Thus, there was a single gene thought to be causative in 4.1% of VEOIBD patients.62

As reviewed by Uhlig and colleagues, monogenic variants caused IBD-like features including disruptions to the epithelial barrier, reduced bacterial clearance, and over-active immune responses.4 Mutations in TTC7A and ADAM-17 (a protein that cleaves TNFα from the membrane) are cited as causing epithelial dysfunction with and without immunodeficiency. Mutations in components forming the NADPH oxidase complex (i.e., NCF2/p67phox) were shown to be associated with reduced reactive-oxygen species, poor bacterial killing, increased susceptibility for chronic granulomatous disease, and IBD-like characteristics. Defects in XIAP are associated with perianal disease and CD-like immune involvement. Regulatory T cells, macrophages, and B cells produce the IL-10 anti-inflammatory cytokine. Defects in IL-10 or its receptor (IL-10R), consistently result in VEOIBD with complete penetrance. Since many cell types express IL-10R, patients with IL-10 mutations have both intestinal and extraintestinal phenotypes, including arthritis, dermatologic manifestations, and growth delay. Mutations in FOXP3 can cause X-linked immune dysregulation, polyendocrinopathy, and enteropathy (IPEX) syndrome. FOXP3 mutations are also associated with immunodeficiency and autoimmunity, reduced goblet cells, and Graft-Versus-Host Disease (GVHD) intestinal phenotypes.4

1.4.2 Understanding genetics in VEOIBD can inform clinical action

Genetic screening of children suspected of having monogenic IBD is necessary because the results can inform therapeutic interventions. VEOIBD patients are less responsive to standard IBD anti-inflammatory agents and immunomodulators/immunosuppressors, and are more likely to undergo surgery within their first year.3,4 Although there is little published work on the efficacy of therapies targeting VEOIBD, higher morbidity and mortality rates in VEOIBD compared with adult IBD suggests that conventional therapies may not induce or sustain remission in this young subset.4

Patients with IBD-like phenotypes that are immune-driven, such as those with IL-10 or XIAP monogenic VEOIBD, are suitable candidates for allogenic hematopoietic stem cell transplantation (HSCT).63 The efficacy of HSCT can be more reliably predicted if the cause of VEOIBD is known. There is also little data on how standard IBD therapies, typically used in adults, affect the growth and development of children. Furthermore, in contrast to adult IBD where the average age of onset is 30 years, the adverse effects of lifelong exposure to standard IBD therapies in children are unknown. Causative monogenic variants in VEOIBD continue to be identified, however; much work remains in terms of functionally validating candidate genes, especially when the pathology of noncoding variants (i.e. affecting gene stability, expression and/or splicing) are more difficult to test. The identification of monogenetic causes of IBD is also useful for genetic counselling of parents with a family history of IBD or consanguinity.8

1.5 TTC7A

1.5.1 Patient genetics, phenotypes and clinical background

As William Harvey’s words on rare diseases alluded to (see the epigraph), proteins like TTC7A seem inconsequential relative to well-known proteins, that is, until their existence is made apparent only through their absence. The first publication citing a rare and damaging variant in TTC7A, identified via WES, appeared in 2013 with several papers emerging with each subsequent year.12 A summary of publications reporting TTC7A patients is found in Tables 1-3. Samuels and colleagues looked at a cohort of French-Canadian patients with hereditary multiple intestinal atresias (MIA), a severe and fatal form of congenital bowel obstruction necessitating surgical intervention.12 Surgical intervention to treat MIA serves as a temporary solution since atresias typically reoccur, and the underlying pathophysiology remains unknown. Combined immunodeficiency (CID) (a primary immunodeficiency characterized by decreases in both B and T lymphocyte responses) can be associated with MIA, suggesting that MIA may be have immunopathological ties. Patients with CID (75% of cases) were found to have hypoplastic thymus’, which is thought to disrupt T cell maturation and result in lymphocytopenia.8 Low blood immunoglobulin levels were also suggestive of reduced B cells or B cell functioning. Lymphocytopenia in combination with disruption of the epithelial barrier results in increased risk for pathogenic proliferation and infection, and consequently, many TTC7A-related fatalities have resulted from sepsis.5-12,64

In the Samuels cohort, five patients from four separate families had no other variants in genes predicted to have deleterious effects, except for a homozygous mutation near a splice site in TTC7A.12 The predicted protein truncation and significant loss of TTC7A function was thought to drive the MIA-CID phenotype in the Samuels cohort. The increased incidence of TTC7A rare variants in the French-Canadian cohort was not surprising since there was a known ‘founder effect’ in the Quebecois population, resulting from the expansion of 8500 settlers in the 17th and 18th centuries to a population of 6-million to date.65 Aside from the French-Canadian cohort, other TTC7A patients were of Caucasian, Middle Eastern, European, East Asian and

South Asian ethnicities.8 Two patients from the cohort received surgical bowel resections, one received HSCT, yet all five of the patients succumbed to their disease during infancy.12 Although the MIA-CID phenotype is thought to result from large deletions in TTC7A, Woutsas et al. reported a patient with MIA-CID that was homozygous for a substitution mutation at a conserved site (p. L346P).9 Furthermore, HEK293T cells expressing the p. L346P mutation, termed a “hypomorphic variant”, showed expression levels that were stable and similar to wildtype (WT) TTC7A levels. The findings of Woutsas and Samuels highlight the range of mutations in TTC7A that can result in the MIA-CIA phenotype.9,12

Avitzur and colleagues reported several patients with VEOIBD, hypothesized to be driven by mutations in TTC7A.5 Missense mutations in TTC7A resulting in the substitution of one amino acid for another are thought to result in hypomorphic protein variants, causing a monogenic form VEOIBD. Patient 1 exhibited secretory diarrhea from birth, chronic inflammation, disrupted mucosal integrity, apoptotic enterocolitis, lymphocytopenia and hypogammaglobulinemia. While the patient was compound heterozygous for missense (p. E71K) and truncation (p. Q526X) mutations, they showed no signs of atresias. Like the findings from Samuels et al., patient 2 had mutations affecting splice acceptor sites resulting in the skipping of exons and premature stop codons.12 Accordingly, the patient with a truncated TTC7A presented with atresias, severe inflammation, and increased intestinal cell apoptosis. Lastly, consanguineous parents with 2 affected daughters were WES-confirmed for having homozygous mutations (p. A832T) in a tetratricopeptide repeat (TPR) domain region. The sisters presented with diarrhea, severe inflammation, loss of intestinal architecture, and apoptotic enterocolitis, yet no atresias.5

Table 1: TTC7A patients reported in 2013

B= B cell, T= T cell, and NK=natural killer cells Adapted from Lien et al. 2017

Table 2: TTC7A patients reported in 2014

B= B cell, T= T cell, and NK=natural killer cells Adapted from Lien et al. 2017

Table 3: TTC7A patients reported in 2015-2017

B= B cell, T= T cell, and NK=natural killer cells Adapted from Lien et al. 2017

1.5.2 Heterogeneous TTC7A disease phenotypes

TTC7A mutations can result in heritable MIA with CID, suggesting that TTC7A’s role is connected to both gut and immune homeostasis.5-12,64 The complexity associated with the pathophysiology of TTC7A-deficiency was highlighted in a study by Lemoine and colleagues (2014).7 They described a large consanguineous family of 13 affected individuals possessing a homozygous missense mutation (p. E71K), and presenting with Enterocolitis-Lymphopenia- Alopecia syndrome. All members of the family presented with IBD and their symptoms included severe diarrhea, bleeding, and poor weight gain during early infancy. Although 1 family member died due to intestinal defects, it is noteworthy that the severity of gut phenotypes decreased with age. Patients over 4 years of age no longer required total parenteral nutrition, although these patients were affected by dermatological features, epidermal hyperplasia and ichthyosis (scaly, fish-like skin).7 Overall, patients presented with an assortment of conditions, including severe stomach and colon inflammation, loss in intestinal architecture, loss of mucin, pseudostratified epithelia, IEC apoptosis, increased T and B cells, eosinophil and macrophage infiltrate in the lamina propria, alopecia (hair follicles attacked by immune system), onychopathy (disease of nails), autoimmune hepatitis, hemolytic anemia, psoriasis, type 1 diabetes, and thyroiditis. As of the 2014 publication, 9/14 patients were alive and exhibited IBD, while 2 patients died despite HSCT (<1 year), 1 died of enteropathy (<1 year), 1 died of sepsis (4 years), and 1 died of gastric adenocarcinoma (14 years).7 From this large family possessing the same homozygous p. E71K TTC7A hypomorphic mutation, the heterogenous range of resulting phenotypes affecting the intestinal and immunological milieu could be appreciated.7

1.5.3 HSCT in IBD and efficacy in treating TTC7A-deficiency

HSCT to treat IBD has become popular for patients who want to avoid resection surgery or for those with immune-driven pathologies.66 Blood and immune cells (myeloid and lymphoid) arise from multipotent hematopoietic stem cells, found in bone marrow, cord-blood, or peripheral/circulating blood. HSCT includes 3 main steps: first, donor human leukocyte antigen (HLA) matched stem cells are released of from the bone marrow, collected, isolated from peripheral blood, and cryopreserved. Second, the transplant recipient then undergoes chemotherapy to remove existing immune cells. Lastly, HSCT is administered intravenously along with steroid treatment to improve tolerance. 66 The HSCT process can take up to 10 weeks from beginning to end and, generally, survival rate is 85%, with 30% being curative for various indications.67 Complications and death may arise from GVHD and infection.68 In a TTC7A patient follow-up after HSCT by Kammermeier et al., it was reported that 4 patients, at various ages (2 patients under 1 year and 2 patients under 2 years) likely had immune reconstitution post- transplant.2 However, 3 of these patients nonetheless required subsequent resection surgeries for recurrent stricturing, 2 required immunosuppression therapy, all required intravenous nutrition, and all had unresolved intestinal inflammation. Previous to Kammermeier’s report, 6 other TTC7A patients with HSCT were reported, but aberrant intestinal phenotypes persisted beyond the transplant and 5/6 patients ultimately succumbed to their disease. As reported by Lien et al., HSCT should correct immune defects and may increase survival of those with immunodeficiency; however, it does not improve phenotypes related to intestinal epithelial defects. Aside from the possibility of small bowel transplantation, no other therapy exists to target and resolve TTC7A-related epithelial defects.8

1.5.4 Genotype/phenotype correlations in TTC7A-deficiency

Since 2013, there have been over 52 patients reported with over 20 distinct mutations in TTC7A, making it difficult to correlate genotype with phenotype and overall clinical severity.5-12,64 As described above, the MIA-CID phenotype is associated with greater morbidity and mortality and tends to be associated with TTC7A loss of function via protein truncations.8 Conversely, hypomorphic variants result in GI tract inflammation and drive monogenic IBD/VEOIBD. Lien and colleagues analyzed 49 previously reported patients to identify genotype and phenotype associations.8 In the cohort, 41% survived and approximately half had IBD. Phenotypes among the 49 patients included: 16 with MIA-CID, 14 with IBD-CID, 8 with MIA, 8 with MIA-CID- IBD, and 3 with IBD. There were 98 mutant alleles associated with the 49 patients, where 47 were missense variants, 32 deletions, 9 splicing, 9 nonsense, and 1 insertion. Most of the mutations affected non-TPR-domain exons 2 and 7, while 10 of the alleles were in exon 20, a TPR-domain containing exon. Sepsis (10 patients), bowel obstruction (8 patients), viral pneumonia (4 patients) and HSCT (2 patients) were among the top four causes of mortality in patients who succumbed to their disease. Kaplan-Meier analysis, a statistical test looking at survival over time, showed that patients with autoimmune defects and biallelic missense mutations that do not affect TPR-domains had better survival outcomes.8 HSCT was able improve immune pathology related to infection; however, it did not improve diarrhea, nor did it increase survival outcome since 6/9 patients died post-transplant. Interestingly, an 8-month old patient with MIA-CID (with unknown genetic mutations) had restored intestinal motility and normal feeding after a small bowel transplant. To date, no TT7CA patient has received an intestinal transplant, and given the lack of donors, the authors recommend prenatal termination for parents who have identical affected alleles in TPR-domains.8

Clinical phenotypes related to TTC7A-deficiency are complex, including, but not limited to, MIA, immunodeficiency, autoimmunity, VEOIBD and a range of extraintestinal manifestations. The relationship between genotype and phenotype is also complex, where patients with hypomorphic mutations tend to have VEOIBD. Truncated TTC7A-variants, with complete loss off function, tend to be associated with the severe and often fatal MIA phenotype; however, there were exceptions to these associations.5,6,9 Furthermore, there exists some

26 evidence to suggest that homozygous mutations disrupting TPR-domains concomitant with immunodeficiency results in worse patient prognoses.8 Currently, there exists no effective treatment that can maintain a deep state of clinical remission in TTC7A patients.2,8

1.5.5 Molecular biology of TTC7A

TTC7A is a conserved gene and has homologs in the chimpanzee, mouse, chicken, zebrafish, and frog. 69 Located on chromosome 2 at p21, TTC7A is approximately 160,000 bp in length comprised of 20 exons and is inherited in an autosomal recessive manner. TTC7A has a paralog, TTC7B with 49.47% sequence identity, and both (independently) are involved in the conserved PI4KIIIα-complex.70 TTC7B is 843 amino acids long, 94.2 kDa, and ubiquitously expressed in the body with higher expression in the brain and fat.71 TTC7B is highly expressed in the small bowel and it may have a redundant role since small bowel areas of TTC7A patients were generally unaffected.7 Although there are 2 splice isoforms, the most common TTC7A splice variant is 858 amino acids long and 96.2 kDa.72 TTC7A contains 9 TPR-domains, a helix-turn- helix structurally conserved motif found in a wide range of proteins and organisms (Figure 4). 69 Although TPR-domains have been identified in more than 5000 proteins across all kingdoms of life, specifics regarding their function is limited.73

The TPR-domain is approximately 34 amino acids long and contains conserved and variable residues. Within a protein, TPR-domains are usually found in multiples, forming repeated structures.73,74 The consensus sequence usually includes conserved residues at positions 4, 7, 8, 11, 20, 24, 27, and 32, where positions 4, 7, 11, and 24 are conserved hydrophobic amino acids, and positions 8, 20, and 27 are usually highly conserved Alanines.73,74 Although TPR- domain structural motifs have sequence variation, they form highly conserved secondary and tertiary structures where side-by-side antiparallel alpha-helices separated by a loop arrange themselves to form a super helix (Figure 4). The super helix has a large amount of surface area which may act as a scaffold for multiple protein interactions.74 Furthermore, the super helix structure results in large concave and convex surface. Although the crystal structure of TTC7A

27 has yet to be resolved, the crystal structure of TTC7B corroborates the presence of concave and convex surfaces. Baskin et al. showed that TTC7B has a very large concave interface (approximately 6000 Å, where anything upwards of 2000 Å is considered large) that can facilitate binding with PI4KIIIα, FAM126A and EFR3, members of the PI4KIIIα complex.75 Scaffolding proteins with conserved TPR-domain structures are important regulators in signaling pathways because they can tether multiple proteins into a complex. Lien and colleagues found that TTC7A mutations affecting TPR-domains, and theoretically the super helix interface, tended to result in the worse patient prognoses, suggesting that TPR-domain structure is critical to TTC7A’s scaffolding function.8 Therefore, in TTC7A-deficiency, poor fidelity in TPR-domains tended to be associated with more severe phenotypes and poor outcomes.

TTC7A is expressed in many tissues at low levels. However, patients with TTC7A mutations have phenotypes related to both gut and immune dysfunction, suggesting that TTC7A plays an important role in these affected areas.72 Interestingly, Tricho-Hepato Enteric syndrome, another severe condition defined by intractable infant diarrhea as well as hair and immune abnormalities, is caused by defects in TTC37, another TPR containing protein.11 Similar to TTC7A, little is also known of the protein encoded by the TTC37 gene and how mutations in both of these TPR-domain containing proteins contribute to immune and gut dysfunction.4 A complete understanding of the molecular biology of TTC7A, including structural and biochemical data, remains to be elucidated.

Figure 4. Domain architecture and ribbon diagram for TTC7

TTC7A has 9 TPR-domains that span the length between the N and C-termini. TPR-domains form a conserved 3D structure of 2 alpha helices connected by a loop, and multiple TPR- domains result in a large concave surface area able to accommodate multiple-bound proteins. While the complete structure of TTC7A has yet to be elucidated, the 3D structure of TTC7B is provided and the dashed grey lines indicate the homology between TTC7A and TTC7B. TTC7A domain architecture adapted from Avitzur et al. 2014 5 and TTC7B ribbon diagram adapted from Baskin et al. 2016 75.

1.5.6 Cell biology of TTC7A

TTC7A is expressed in all tissues, with particularly high RNA expression in lymphoid and skin cell lines.5,72 Baskin and colleagues show that HeLa cells transfected with TTC7B-mCherry localizes to the cytosol and plasma membrane as puncta like structures.75 Human epithelial colonic adenocarcinoma cells (Caco-2) transfected with Myc-TTC7A shows diffuse cytoplasmic localization, whereas E71K, Q526X, and A832T mutants appear to localize to cytoplasmic puncta.5 Immunohistochemistry staining of healthy control intestinal biopsies reveals that TTC7A highly expresses in intestinal cells and localizes intracellularly at the plasma membrane.5 Staining of patient biopsy samples with truncating TTC7A mutations show a total loss of protein staining, suggesting that truncations result in nonsense mediated decay of TTC7A mRNA transcripts.5 Loss of TTC7A in immunohistochemical staining is also consistent with the increased phenotypic severity in patients with MIA-CID, further suggesting that truncations result in loss of function.

TTC7A knockdown of intestinal Henle-407 cells with short hairpin RNA (shRNA) disrupts their characteristic cobblestone morphology and impairs adhesion to collagen/fibronectin.5 These features are in line with endoscopic observations from patients showing loss of epithelial integrity and mucosal sloughing. TTC7A knockdown also results in increased Caspase 3 cleavage, a cysteine-aspartic acid protease important in mediating apoptosis and activated by protein cleavage.5,76 These findings suggest that TTC7A-deficiency results in increased susceptibility to apoptosis, consistent with patient histology showing increased IEC apoptosis.5

The formation of atretic tissues in the GI tract suggests that TTC7A-deficiency indirectly or directly influences the integrity of the intestinal epithelia.6 The importance of form and function in gut epithelia is clear from the polarized monolayer of IECs, which not only forms a protective barrier, but also regulates nutrient absorption as well as immune system homeostasis. The presence of atresias suggests that highly organized epithelial cells lose an aspect of their polarity, which normally restricts their growth to a monolayer.15,21 In biliary atresia, obstructions in the bile duct results from a loss of epithelial cell integrity where cells become more fibrotic

30 and lose cell polarity.77 GWAS studies indicate that ADD3, a gene for actin cytoskeletal proteins involved in the regulation of cell-cell contacts in epithelial cells, is a putative risk factor for biliary atresia. The GWAS findings were consistent in add3a knockout zebrafish that exhibited biliary atresias.77 Thus, mutations that alter essential epithelial cell features (such as polarity) cause abnormalities such as atresias, resulting in an overall loss of epithelial tissue form and function.

The Saint Basile group, who had a cohort of 6 unrelated patients with MIA-CID, was the first to demonstrate that TTC7A-dysfunction results in aberrant IEC polarity.6 Ileum-derived intestinal organoids were cultured from a patient with homozygous p. A832fsX1 mutations, disrupting the final exon, affecting the 9th TPR-domain. The organoid donor was the only surviving member of the cohort and presented with intestinal atresias from birth, lymphocytopenia, hypogammaglobulinemia, and progressive skin conditions from 4 years of age. Typically, homozygous mutations for early stop codons result in loss of TTC7A protein expression due to nonsense mediated decay of transcripts, suggesting a complete loss of function.6 Furthermore, the location of the mutation in a TPR-domain also suggests a critical impact on protein function. Given that the patient survived, and their organoids could be cultured, it is tempting to speculate that the severity of the early stop codon was offset by the C- terminal location of the mutation, suggesting that TTC7A remained somewhat functional. The authors did not provide any data to indicate TTC7A expression levels in their organoid model, so it is unknown whether TTC7A was hypomorphic or absent (with complete loss of function).

Patient-derived organoids were stained for IEC polarity markers, filamentous-actin (F- actin) and alpha-6 (α6) integrin, which designate apical and basal membranes, respectively (Figure 5).6 Control organoids are demarcated by consistent and exclusive F-actin staining on the apical membrane (luminal side/interior), while α6 integrin is present only on the basal membrane (exterior surface). TTC7A patient-derived organoids (homozygous p. A832fsX1 mutation) have F-actin staining on the basal membrane, while the lumen is not clearly delineated. The mutant organoids express α6 integrin in a disorganized pattern, effectively showing inverted apicobasal polarity. Out of 50 organoids after 5 days of growth, more than 80% of patient organoids show aberrant or inverted polarity, compared with fewer than 10% in the control group. Furthermore, patient derived organoids also show significantly reduced proliferation, assessed by survival

31 percentages over time and Ki-67 staining. Lastly, TTC7A mutant organoids are morphologically different from the controls, consisting of dense aggregates with no obvious luminal space and having less budding, signifying poor epithelial cell differentiation.6

Remarkably, exposure of the TTC7A patient-organoids to a small molecule Rho kinase/ROCK inhibitor (10 μM Y-27632 for 5 days) corrects the polarity defect and results in increased proliferation (for both control and TTC7A-deficient organoids) (Figure 5).6 The authors assessed organoids for polarity and epithelial integrity; however, they did not comment on whether TTC7A organoids achieved gross morphological improvements in line with control organoids. Apicobasal polarity is regulated by the RhoA pathway via cytoskeletal proteins that also regulate adhesion to extracellular matrix and adjacent cells.78 The health of epithelial monolayers depends on each cell being aligned in a correct orientation.79 It is thought that TTC7A acts to downregulate ROCK activity, since the addition of a ROCK-inhibitor rescues the polarity defect and increases proliferation of TTC7A patient-derived organoids.6 Downstream targets of ROCK, including myosin light chain (MLC) phosphatase and phosphorylated Ezrin/Radixin/Moesin (ERM) are also shown to be more abundant in TTC7A-mutant organoids, and subsequently reduced after treatment with the ROCK-inhibitor. MLC and ERM, among other targets in the RhoA pathway, are important in mediating cytoskeletal changes, and the aberrant regulation of these cytoskeletal proteins can alter IEC polarity, F-actin, stress fiber contractility, and adhesion (i.e., focal adhesions, integrins).6 These findings suggest that TTC7A mutations alter cell polarity via increased activation of ROCK, although the exact mechanism by which TTC7A is involved in the RhoA/ROCK-pathway is unknown.

Figure 5. TTC7A patient-derived organoids showed aberrant polarity

Control (subpanels A and C) and TTC7A patient-derived (subpanels B and D) organoids were stained with polarity markers that indicated apical (pink), and basal (green) IEC membranes. DAPI, in blue, is used to indicate nuclei. TTC7A patient-derived organoids show aberrant polarity (pink staining on the outside of the organoid), and treatment with ROCK-inhibitor Y27632, improves IEC polarity. These data suggest that TTC7A-deficiency results in increased ROCK-activity, although it is unknown how TTC7A is involved in the ROCK pathway. ROCK- activity mediates several cellular processes, including but not limited to; cytoskeletal changes, adhesion, polarity, and survival. Figure and concepts adapted from Bigorgne et al. 20146

In contrast to the IEC phenotypes associated with TTC7A-dysfunction, Lemoine and colleagues found that lymphocytes lacking TTC7A have increased proliferation, adhesion, and migration, all of which were reduced with ROCK-inhibitor treatment.7 These data suggest that TTC7A also regulates the actin cytoskeleton in lymphocytes via the ROCK pathway. Increases in ROCK-activity in lymphocytes and IEC disrupt normal cell homeostasis and epithelial- immune dynamics contributing to inflammation.7,26 These data highlight the complexity associated with TTC7A function, suggesting that multiple therapies targeted to epithelial cells and immune cells may be required to treat the nuances of TTC7A-deficiency.

1.5.7 Biochemistry of TTC7A

An extensive understanding of TTC7A’s function in cells has yet to be elucidated. PI4KIIIα was identified as a TTC7A-binding partner through co-immunoprecipitation experiments in which TTC7A was overexpressed in HEK293T cells.5 Co-immunoprecipitated proteins were digested and protein fragments were subsequently analyzed by tandem mass spectrometry. PI4KIIIα spectral hit levels are significantly reduced in TTC7A hypomorphic mutants (p. E71K) relative to hit counts with WT TTC7A, and these findings were validated via co-immunoprecipitation experiments.5

PI4KIII is recruited and targeted to the plasma membrane by TTC7A (Figure 6). The TTC7A-PI4K complex is then stabilized by an adaptor protein, FAM126A, and, once at the plasma membrane, tethered by EFR3B, a membrane bound protein.80 TTC7A is diffusely localized in the cytosol; however, when co-expressed with EFR3, it localizes to the plasma membrane, further suggesting a scaffolding role for PI4KIIIα to EFR3.80 Formation of the PI4KIII-complex results in the phosphorylation of phosphatidylinositol (PI) to form phosphatidylinositol 4-phosphate (PI →PI4P), indicating that TTC7A has an upstream role in mediating PI4P synthesis.75,80,81 Plasma membrane PI4P synthesis is exclusively dependent on the proper functioning of PI4KIII, and homeostatic levels of the anionic PI4Ps are important for plasma membrane identity, polarity, cell survival, and production of phosphatidylinositol 4,5- 82 bisphosphate [PI(4,5)P2] and phosphatidylinositol 3,4,5-trisphosphate [PI(3,4,5)P3]. In mice, transient loss of PI4KIIIα in fibroblasts results in cell death and germline loss results in embryonic lethality, suggesting that PI4KIIIα has a critical role in survival pathways.80

The scaffolding role of TPR-domains is supported by research from Lees et al. and Baskin et al., who demonstrated the formation of EFR3B-TTC7A-PI4KIII and FAM126- TTC7A- PI4KIII-EFR3B protein complexes, respectively (Figure 7).75,81 Cryo-electron microscopy recently reveals that the PI4KIII-complex can dimerize to form a large and stable “super assembly” (Figure 7).81 Two PI4KIII enzymes form a homodimer, where the dimerization interface is held at two contact positions by TTC7, suggesting that TTC7 plays an

34 important role in stabilizing the large PI4KIII-heterodimer complex. The formation of the PI4KIII-complex is possible with hypomorphic TTC7A-mutations as shown with co- immunoprecipitation experiments; however, alterations to the structures of TTC7A and PI4KIII may nonetheless affect kinase activity.5 Specifically, mutations in the C-terminus of TTC7A and N-terminus of PI4KIII still result in PI4KIII complex formation, whereas kinase activity is lost.81 The PI4KIII-complex is conserved from yeast to humans, where PI4KIII interaction with TTC7 and FAM126 restricts its conformation so that its kinase domain can interact with PIs in the plasma membrane.81 The activity and localization of the PI4KIII-complex depend on several contact sites between the FAM126-TTC7A- PI4KIII-EFR3B proteins and the plasma membrane, providing grounds for how hypomorphic TTC7A mutations may have critical functional consequences for the tightly regulated PI4KIII complex.

Figure 6. Model for TTC7A’s role in recruiting PI4K to the plasma membrane

The left panel shows normal PI4K-complex recruitment and the right panel shows TTC7A- patient mutations, reported by Avitzur et al. 2014.5 TTC7A binds and recruits PI4K to the plasma membrane, where PI4K is stabilized by EFR3. PI4K converts PI to PI4P, an important phospholipid in cell polarity and survival. TTC7A-deficiency results in poor TTC7A-PI4K binding, potentially compromising trafficking to the plasma membrane and resulting in decreased PI4P levels (shown via immunostaining). Adapted with permission from Avitzur et al. 2014.5

In the absence of TTC7, TMEM150A, a membrane bound protein, is able to stabilize the 80 PI4K-EFRB complex. Specific inhibition of PI4KIIIα results in decreased levels of PI(4,5)P2; however, overexpression of TMEM150A is able to reestablish the levels of PI(4,5)P2, suggesting that the production of PI4P, the precursor for PI(4,5)P2, is regulated in part by TMEM150A. Truncating TTC7A mutations results in significant decreases in the levels of plasma membrane PI4P, shown by immunostaining in TTC7A-knockdown Henle-407 cells.5 Other reports also show that alterations to any of the components of the PI4KIIIα-complex results in significantly reduced PI4P levels relative to controls.5,75,80

Figure 7. Model for the PI4KIIIα-complex at the plasma membrane

TTC7 and FAM126A recruit PI4KIIIα to the membrane and a basic patch (positively charged indicated by the plus sign) at PI4KIIIα’s C-terminus interacts with the inner leaflet of the plasma membrane. The proposed model for the PI4KIIIα-complex at the plasma membrane shows that PI4KIIIα is dimerized and stabilized by TTC7/FAM126A/Efr3. The complex orients PI4KIIIα so that its active site is exposed to PI on the membrane. Reprinted with permission from Lees et al. 201881

While the PI4KIIIα-complex is responsible for PI4P synthesis at the plasma membrane, it is important to recognize the plasticity of PI4P levels and the dynamic nature of phosphoinositide phosphate lipids (PIPs) throughout the cell.82 Despite insults to the PI4KIIIα-complex, PI4Ps can

36 still be present at the plasma membrane due to several compensatory pathways, including but not limited to: other subcellular membranes with PI4P can fuse with the plasma membrane, TMEM150A stabilizes PI4KIIIα at the membrane in the absence of TTC7A, TTC7B redundancy, and other PIP kinases and phosphatases potentially replenishing pools of various plasma membrane PIPs.80 PI4P synthesis represents a critical regulatory threshold in the plasma membrane PI pathway and an important mediator of cellular homeostasis.82 PI4P and its role as a precursor in the PI pathway is partly dependent on a functional TTC7A, which is involved in tethering, shuttling, and stabilizing the conserved PI4KIIIα-complex. A thorough understanding of the pathobiology related to PI4P-levels in TTC7A-deficiency has yet to be elucidated.

1.5.8 Models for IBD and TTC7A study

1.5.8.1 Cell-based models

In vitro intestinal cellular models have been useful to study specific questions such as the changes in cell homeostasis with cytokine treatment or the effect of mutations on cell-cell adhesions. For example, HT-29 (human colorectal adenocarcinoma) cells can form a polarized monolayer with tight junctions, effectively modelling the epithelial barrier.15,83 Intestinal derived cell lines like HT-29 and Caco-2 are useful for studying epithelial barrier function via voltage impedance measurements. Schulzke et al. (2006) showed that small increases in the apoptotic rate in IECs result in increased transmembrane voltage conductance.83 These data can be extrapolated to explain how breaches in the epithelial monolayer may result in increased inflammation, release of water and ions into the lumen causing diarrhea, and increased immunogenic responses from microbiome-mucosa interactions. 15,83 In addition to IECs being more difficult to manipulate (i.e., poor transfection efficiencies), cell culture models are inherently artificial, and the lack of a physiologically relevant milieu means that the obtained data are more restricted relative to in vivo or ex vivo models.

1.5.8.2 Mouse models

More than 60 transgenic mouse models have been developed to study the factors that disrupt gut and immune homeostasis in IBD.34 Although many experimental models exist to study IBD, translatability from an in vivo model to the clinic remains challenging. Generally, intestinal inflammation can be generated via targeted genetic mutations that affect the intestinal epithelium and/or the immune system, as well as treatment with toxins such as dextran sulfate sodium (DSS) or trinitrobenzene sulfonic acid (TNBS).34 DSS is administered via drinking water and is toxic to intestinal epithelia, disrupting barrier function and resulting in UC-like colitis. TNBS is given intrarectally and results in CD-like features including transmural colitis and increased IFNγ production.13 TNBS, a haptenizing agent, is a non-immunogenic small molecule that attaches to a larger host molecule resulting in an immunogenic product or response.13 Colitis inducing chemicals have been used in many mouse models; however, inconsistencies in duration, doses, and animal responses represent challenges. Mouse models have been utilized to confirm that IFNγ can underscore the severe pathogenesis of IBD (resulting in 60% mortality) in DSS treated mice.84 Interestingly, IFNγ-/- mice were not susceptible to DSS stimulated intestinal inflammation, suggesting that an anti-IFNγ biologic therapy may be efficacious in IBD treatment. Other notable mouse models include: Muc2 (component in mucin) deficient mice that develop spontaneous colitis and Nod2 -/- mice that have inappropriate activation of NF-ĸβ as well as increased susceptibility to infection. From the seminal study by Hermiston and Gordon, chimeric mice with abnormal cell-cell adhesion showed the importance of the epithelial barrier.34,85,86

Finding a suitable animal model to study TTC7A has not been straightforward. For example, Ttc7 mutant mice display a flaky skin (i.e., fsn) phenotype, resembling human psoriasis.87 The fsn mice also present with anemia, testicular degeneration, CD4/CD8 imbalance, and apoptotic cecal IECs. The mutation in fsn mice arose spontaneously and was mapped to the chromosomal location near the Ttc7 gene. Upon sequencing, an insertion of an additional exon into a TPR-domain of Ttc7 was confirmed. As a result, there was a decrease in Ttc7 transcripts, and it was hypothesized that Ttc7 function was lost in fsn mice. 87 Psoriasis is a condition driven by autoimmunity, where the immune system attacks skin cells.88 Although fsn mice did not

38 recapitulate the primary phenotypes in TTC7A patients, the correlation between patients affected by IBD and psoriasis is 25%, compared with 2-4% of those affected with psoriasis alone in Western populations.88,89 Psoriasis has also been noted as an extraintestinal feature in non- infantile TTC7A patients with missense p.E71K mutations.7 The Ttc7 gene is similar to the human ortholog, having 20 exons and a similar number of TPR-domains. Interestingly, double mutant mice for Tt7c and severe combined immunodeficiency (fsn/fsn scid/scid) still maintain skin aberrations, yet have increased lifespans compared to fsn/fsn mice alone.12 The lack of SNPs in TTC7A associated with psoriasis in humans, and the lack of intestinal atresias in mice, suggests varying functional specificities between the human and mouse orthologs, nullifying Ttc7 mice as an appropriate model to study TTC7A-deficiency.

1.5.8.3 Zebrafish models

1.5.8.3.1 Intestinal homology and development

In the past 20 years, zebrafish (Danio rerio) have been established as relevant models to study human disease.90 Zebrafish serve as an economical model to bridge the gap between cellular and classical mammalian models. The GI tracts of zebrafish and humans have homologous structures, functions, tissues, and cell types (Figure 8); however, the transparency of zebrafish during the larval stage makes them an advantageous model for intestinal research.91 Zebrafish lack a stomach with gastric glands, but the intestinal bulb is an analogous structure that maintains a pH≥7.5.92 Gut development begins 26-30 hours post fertilization (hpf) and by 75 hpf, the lumen is an open tube lined by columnar and polarized IECs.91 Goblet cells appear in the mid-intestine and folds appear in the enlarging intestinal bulb at 4 dpf. The gut becomes fully functional at 5 days post fertilization (dpf).91 Once the yolk sac has been absorbed, zebrafish larvae will feed on small bacteria in their surroundings and, in the following weeks, various microbes will colonize the GI tract.91 Eventually, goblet cells are ubiquitously expressed throughout the gut, and at 12 dpf, folds will extend from the intestinal bulb to the posterior intestine, with folds and digestive

39 enzymes decreasing rostral-caudally. Like the proliferative crypts, zebrafish also have proliferative zones at the bases of villi-like folds.91 In addition to zebrafish lacking Paneth and M cells, the composition of their intestinal tissue is more simplified compared to humans (Figure 8).91 Lymphoid vessels are absent from villi and they also lack a submucosa, with circular and longitudinal smooth muscle layers directly attached to the mucosa. Similar to mammals, the differentiation and shedding of IECs takes approximately 5 days (or longer in posterior intestinal regions).91

Figure 8. Hematoxylin and eosin staining of the zebrafish GI-tract at 5-6 dpf

At 5 dpf, the GI tract in zebrafish larvae is fully functional. The GI tract is open tube lined by IECs (A) . In the intestinal bulb, arrows indicate proliferative zones between villi-like projections (B). Goblet cells (arrowheads) and vesicles filled with secretory mucin (arrows) are visible in the mid-intestine (C). The GI tract ends at the anus, terminating the posterior intestine (D). Zebrafish GI tissue lacks the submucosal layer found in humans. Figure and concepts adapted from Ng et al. 2005 91

1.5.8.3.2 Microbiome and immune system in zebrafish larvae

Given that zebrafish live in aquatic environments, their microbiome differs from that of humans.93 The predominant gut bacteria in zebrafish are Proteobacteria, while Bacteroidetes and Firmicutes are common in humans.93 Zebrafish raised in germ-free environments had poor differentiation of IECs, poor intestinal architecture, and altered expression of genes involved in epithelial renewal, innate immune factors, and nutrient breakdown. Interestingly, a quarter of the genes with altered expression in germ-free environments were shared in zebrafish and mice, suggesting a conserved relationship between the microbiota, epithelia, and intestinal innate immune responses.93 Zebrafish younger than 2-3 weeks post fertilization (wpf) generally lack adaptive immune function, making it possible to study the gut epithelia in isolation from the effects of the adaptive immune system (and the microbiome).94 Because mutations in TTC7A can cause both epithelial defects and lymphocytopenia in patients, the stratified development of the gut and the adaptive immune function in zebrafish can help to clarify multifactorial disease features. Although the thymus in zebrafish is not fully developed until 4 wpf, there are conflicting reports as to the earliest appearance of mature lymphocytes, with references to time points as early as 8 dpf. 92,94 After 24 hpf, innate immune cells such as dendritic cell-like antigen presenting cells, neutrophils and macrophages appear, whereas eosinophils appear in villi at 3 wpf.92 Innate immunity in zebrafish includes IEC produced antimicrobial peptides (AMPs), reactive oxygen species by the NADPH oxidase complex families, brush border alkaline phosphatases that alter outer lipid membranes of Gram-negative bacteria, NOD2 intracellular pattern recognition receptor, and Cxcl8 (IL-8) cytokines expressed by leukocytes/epithelial cells to attract neutrophils.95

1.5.8.3.3 Modeling IBD in zebrafish

Zebrafish have been established as an effective model for studying intestinal development and IBD.92,96 Transgenic zebrafish expressing reporter cell lines have been useful for understanding changes in the localization and function of immune cells after chemical inflammatory insults such as DSS and TNBS.97 Interestingly, zebrafish reared in germ-free environments were less susceptible to TNBS colitis.92 Changes to the intestinal epithelia after inflammation include loss of villi, disrupted IEC monolayer, loss of polarity, pseudostratification, increases or decreases in goblet cell numbers, increased proinflammatory cytokines, reduced IEC proliferation, and increases or decreases in lumen size.96 The epithelial changes seen in zebrafish after chemically- induced inflammation are reminiscent of the changes observed in mouse models. Likewise, the use of anti-inflammatories, steroids, and antibiotics were also successful in abrogating inflammatory features.92,96

Not only have zebrafish have been able to recapitulate IBD disease features with chemically-induced colitis agents, but they also have the potential to model genetic susceptibility to intestinal inflammation.92 For example, forward genetic screening identified a mutation (aa51.3pd1092) that resulted in intestinal epithelial barrier disruption via reduced methylation of TNFα in IECs, causing increased apoptosis, IEC shedding, lymphocyte recruitment, and chronic colitis. 92 The first ttc7a mutant zebrafish were described in a thesis entitled Congenital Diseases of the Intestine by D. Halim (2016).98 The author created mutant zebrafish with ttc7a exon 3 insertions and deletions (with no genotyping provided) that showed intestinal narrowing. Motility assays using fluorescent microspheres showed that 46% of homozygous mutants, compared to 37% WT/heterozygous fish, failed to excrete the fluorescent microspheres, suggesting increased transit times (and decreased gut motility) in homozygous ttc7a fish.98 The author noted that there was no evidence to suggest neuron or muscle aberrations related to the increased in GI transit time. The ttc7a mutant zebrafish further implicated TTC7A in GI defects and provided a precedent for using zebrafish as a vertebrate model to study TTC7A.98

1.5.8.3.4 Zebrafish in drug discovery

In drug discovery, zebrafish are becoming increasingly attractive due to their low costs, high reproductive output and rapid development. Given their small size and ability to survive in 96- well microtiter plates for several days, zebrafish are the only vertebrate model that can be used in automated high throughput phenotypic drug screens.90 Advancements in automated high-content imaging and similar technologies have facilitated the use of zebrafish as physiological models, considered more accurate in predicting drug responses compared to cell-based in vitro models. Because fish have historically been used to monitor acute toxicity of chemicals, there has been emphasis on zebrafish for toxicology studies, where accurate toxicity predictivity has generally ranged from 65% to >85%.99 Conversely, aberrant responses that are not visible may be overlooked in phenotypic monitoring. There is still much to be established in the use of zebrafish for drug discovery. For example, issues arising from various routes of administration, pharmacokinetics and physiological effects of continuous drug exposure, absorption, distribution, metabolism, excretion, and toxicology profiles (ADMET), timing, and dosing equivalencies, represent aspects in drug discovery that are generally uncharacterized in zebrafish.100

1.5.8.4 Organoid models

Organoids are three-dimensional (3D) tissue culture models derived from pluripotent or adult stem cells. Isolated stem cells, when grown with specific growth factors, can proliferate and differentiate so that cells self-organize into 3D structures resembling a tissue or organ of interest. As an ex vivo model, they serve to bridge the gap between cell-based and in vivo models. Organ specific adult stems cells can be cultured in ways that mimic their in vivo niches.101,102 For example, lung organoids can be stimulated with TGF and bone morphogenic protein (BMP) inhibitors (to increase proliferation), while intestinal organoids require Wnt/EGF cytokines. Intestinal stem cells can be sorted and isolated based on their LGR5+ protein expression. LGR5

43 is involved in the Wnt pathway, which regulates many cellular functions, including but not limited to cell differentiation, proliferation, and migration.103 The seminal work of the Clevers group (2009) established protocols for culturing primary tissue-derived intestinal organoids (also known as enteroids) from mouse intestinal tissue samples.104 Intestinal crypts were embedded in Matrigel® (Corning Life Sciences and BD Biosciences), a culture material that mimics laminin and collagen extracellular matrix, and treated with a cocktail including R-spondin-1 (stimulates Wnt signaling), EGF, and Noggin (inhibits BMP). Intestinal organoids form a spherical 3D structure, where the interior resembles the intestinal lumen. The buds on the exterior represent crypt-like proliferative regions while the protrusions in the interior resemble villi-like structures. Mimicking their in vivo function, LGR5+ stem cells in culture are self-renewing and divide to produce differentiated IECs. As IECs begin to differentiate, they become more distant from the proliferative zone. When they have migrated to the tips of villi-like structures, they are shed and continue to be replenished every few days.104

Since organoids can be directly cultured from patient stem cells, they provide a tremendous platform for the development of personalized medicine. Drug discovery is additionally challenging in rare diseases because there is a general lack understanding regarding the defect in question, and phenotypic heterogeneity can confound matters. Patient-derived organoids can allow for direct phenotypic and functional analysis as well as assessment of personalized drug responses.103,105,106 The potential uses for organoids in personalized medicine are abundant, as they are a promising source of tissue for regenerative medicine and can be used in high-throughput drug screening.106 Furthermore, patient-derived organoids can be biobanked for future studies, allowing researchers to comprehensively appreciate the spectrum of disease phenotypes.107

1.5.8.4.1 Examples of data generated from organoids

Limited data has been published on TTC7A patient-derived organoids, partly due to culturing difficulties. To date, organoids derived from patients with hypomorphic TTC7A variants (in contrast to truncated variants) seem to be the most viable in ex vivo culture.6,7 TTC7A organoids have been used in two studies from the Saint-Basile research group and have confirmed that the epithelial defect exists in isolation from the microbiome and aberrant immune responses.6,7 The morphology and proliferation of intestinal organoids have been assessed via immunofluorescence staining with various markers. Polarity markers have included F-actin, α6 integrin, zonula occulens ZO-1 tight junction protein, and E-cadherin, all showing mislocalization in TTC7A organoids. The rescue of the polarity defect in TTC7A patient-derived organoids with the small molecule ROCK-inhibitor, Y27632, has also served as proof of principle that the epithelial defects can be therapeutically abrogated. 6,7

Epithelial barrier permeability can also be assessed via swelling assays where various materials (i.e., toxins, microbes, chemicals) are microinjected into the organoid’s lumen.108 Apical barrier permeability can be analyzed by calculating the exit time of the injected material. Clostridium difficile is major cause of hospital-acquired diarrhea. Organoid swelling experiments with C. difficile (or its toxins) cause IEC damage and loss of cell-cell adhesions, resulting in epithelial barrier loss of function.109 Further analysis of organoid structures after C. difficile exposure reveals altered distribution of E-cadherin and loss of ZO-1 tight junction proteins at apical surfaces.109 IBD is complex and the interplay between various types of IECs in maintaining barrier function is not fully characterized. Intestinal organoids are informative tools for understanding how patient-specific aberrations in IECs can affect overall tissue function. A complete understanding of the interaction between the microbiome, immune system, and genetics is necessary to fully understand disease pathogenicity. Although no one model can fully recapitulate the complexity of IBD, each model can provide specific insights, contributing to a more comprehensive understanding of the disease.

1.6 Drug discovery

Historically, drug discovery began with cause-and-effect observations using traditional remedies and serendipitously, as in the case of Alexander Fleming. With advancements in chemistry, pharmacology, molecular biology, genetics, and biochemistry, drug discovery has become more intentional in the last century. Despite the leaps in scientific understanding, drug research and development (R&D) in Biotech and pharmaceutical industries has been substantially less efficient (developed drugs/billion US$ in R&D) compared to the 1950’s.110 In other words, the number of drugs discovered yearly since the 1950’s has been fairly constant, while associated yearly costs have risen excessively. Scannell and colleagues provided several reasons for the decline in drug development: the “low-hanging fruit” therapies have already been developed, there are reduced incentives to develop better drugs since already existing drugs work well- enough, increased safety regulations, and poor understanding of disease biology.111 Typically, many drug programs are directed at a small range of targets (protein kinases and G-protein coupled receptors)112; however, identifying new targets may be a means of improving drug R&D efficiency. For example, biologics have had growing success in clinical trials in the last decade relative to small-molecules (32% vs. 13% approval, respectively), partly because they are tapping into an unexploited area of novel drug targets.110

1.6.1 Target-based drug discovery

There are two broad categories of drug screening, target- or phenotype based.113 Traditionally, the target-based drug discovery pipeline is costly and time consuming during the initial stage of target identification. Identifying a target that drives disease requires the identification of appropriate models, functional studies to prove that the target is causative, validation of the target in multiple models, and often, proof-of-concept rescue experiments to show that the target is ‘druggable’.113,114 In the Scannell review discussing the drug R&D decline in efficiency, they note that overemphasis on a disease-causing target may be a factor in decreased drug

46 discovery.111 Because there are redundancies on many levels of biology, the chances that a single druggable target will cure a disease are small. For example, a small-molecule drug with high affinity binding to a disease target may be promising; however, off-target effects of small- molecules are not uncommon given that they may have promiscuous interactions with other protein moieties.110 The assay endpoint in a target-based screen may be different from a physiologic or diseased-state endpoint. In contrast to highly targeted in vitro molecular drug screens, phenotypic drug screening may be a less myopic means of discovery because it identifies compounds that alter phenotypes related to disease-endpoints.114

1.6.2 Phenotypic drug discovery

Traditionally, drug discovery was rooted in observational changes or phenotypes. However, technological advances in basic research have shifted drug discovery to a target-centered approach. Despite the fact that the majority of drug programs in the last 20 years relied on target- based approaches, phenotypic screens have had greater output of effective drugs.100 Notably, from 1999 to 2008, 62% first-in class drugs were identified via phenotypic drug screens.100,110 Potential reasons for success include: development of relevant disease models and 3D cultures, less time spent on target ascertainment and validation, direct identification of compounds that produce a biological effect, and the rapid identification and removal of compounds with acute toxic effects.100,107 Phenotypic drug discovery does not depend on the knowledge of a specific molecular target but assesses the overall effect on the disease phenotype. Knowledge of a drug’s mechanism of action is not necessary as long as its efficacy and safety profile are understood.114 Acetylsalicylic acid (Aspirin), an extract from Willow bark, was able to relieve inflammation and was manufactured for the masses since the late 1800’s. 115 There are reports that Aspirin was also found in clay tablets dating as far back as ancient Egyptian times.115 Aspirin is a famous example of phenotypic drug discovery, and it was 100 years after becoming a household drug that its mechanism of action was ascertained.115

One of the biggest challenges in phenotypic drug discovery is developing a clinically relevant disease model. The more relevant the model, the better the predictivity of the assay along the ‘chain of translability’.116 Vincent and colleagues developed the ‘Rule of 3’ as a guiding principle in the development of predictive phenotypic assays, associated with more successful drug translation.116 The first criterion is that the assay system should be relevant to the disease, where physiologically relevant models are preferred over artificial protein overexpression models. Second, the use of any stimulus required to recapitulate disease phenotypes should be minimized, avoiding hits biased to the stimulus. Finally, the assay readout should be clinically relevant; for example, an endpoint indicative of protein activity is more relevant than a reporter system for gene expression. Many biological pathways may be affected in order to alter a phenotype, and reverse-elucidation of the affected target is the most challenging aspect of phenotypic assays.107 The importance of identifying the molecular mechanism of action of a drug depends on the risk-benefit ratio, safety profile, indication, and clinical need. Approximately 7-18% of FDA approved drugs do not have a defined target.107 Although phenotypic drug discovery is more likely to yield candidates that translate beyond in vitro models, knowledge of molecular mechanisms are still necessary in order to understand disease pathogenesis and structure-activity relationships for future optimization. Ultimately, drug discovery programs that utilize both phenotypic and target-based discovery, “molecularly informed phenotypic discovery”, are thought to be the most advantageous.114

1.6.3 High-throughput screening and the drug discovery pipeline

High-throughput drug screening represents a new era of drug discovery wherein chemical libraries containing thousands of compounds can be screened. Compounds that elicit a desired response are selected as “hits” for further validation. The automation associated with drug screening has resulted in a 10-fold decrease in the cost of drug testing over the past 20 years.113 Commercial availability of large and diverse chemical screening libraries has been another reason for decreased automation costs.112 Compounds in chemical libraries are diverse, including vitamins, naturally-derived compounds, synthetic molecules, toxin-derived agents,

48 small molecules, and drug-like compounds. 112 Typically, these compounds are in dimethyl sulfoxide (DMSO), a versatile solvent that can dissolve most compounds.

Drug screens are developed so that the readout is unambiguous and allows for hit- identification. Hit rates can vary and depend on the nature of the drug screen. It is not uncommon for phenotypic screens to have hit rates of more than 1%,107 while inhibitory-readout screens typically yield higher hit rates than agonist-type screens.113 Notably, the computation of a Z’- factor considers the separation between positive and negative controls (the dynamic range) and their standard deviations, allowing for reliable hit-identification.117 If the dynamic range between the positive and negative control is large and the standard deviations in the controls are small, then it is unlikely that a false hit will be identified.117

In the preclinical stage of drug discovery, Lipinski’s Rule of Five is often used as a guide to predict whether hits or lead compounds will be readily absorbed or have the characteristics of a ‘good’ drug. Generally, molecules will have poor absorption if two of the following rules are violated: more than five H-bond donors, mass greater the 500g/mol, more than ten H-bond acceptors, and a logP greater than five (partition-coefficient indicating solubility as more aqueous than lipophilic).118

To narrow down a group of hits and identify a lead compound, hits can be tested in various ways (i.e., dose-responses, functional assays, responses in physiologically relevant models). Lead compounds can then be optimized further via chemical/structural alterations, dose-response assays, elucidation of the mechanism of action, identifying the most effective route of administration, potential drug interactions, and minimizing adverse effects.113

The preclinical phase of drug development requires understanding of the lead compound’s safety profile in cell-based in vitro and in vivo models.119 The clinical phases seek to understand the benefits and risks of the lead compound in human subjects and require FDA approval. Phase I is concerned with safety and dosing; 70% of drugs will move to Phase II. Phase II and III consider the efficacy and side effects (or adverse reactions) of the drug; both phases represent a bottleneck in the drug discovery pipeline since the majority (>60%) of drugs fail in these phases. If a drug shows a good risk-benefit profile in clinical trials, then FDA approval is next. The FDA committee reviews the New Drug Application, presenting all data

49 from the preclinical phase and onwards, and decides if the drug is effective and safe for its intended indication.119 In terms of average times, the breakdown for drug discovery is 3-6 years, preclinical testing is 3 years, phase I/II clinical trials are 3 years, phase III is 2 years, and FDA approval is 1-2 years.114 The average drug is estimated to take 12-16 years and $1-2 billion dollars to develop.110

1.6.4 Drug repurposing and rare diseases

In the case of life-threatening rare diseases, the FDA approval process can be expediated or waived on the grounds of ‘compassionate use’.120 Patients with life-threatening conditions have ‘expanded access’ to unapproved or investigational drugs in Canada (Special Access Programme) and the USA (Investigation New Drug application) when there are no other therapeutic options available.121 In the cases where repurposed drugs are sought out for compassionate use, drug discovery programs that utilize drug repurposing may provide more assurance in terms of known safety profiles, relative to those of completely novel therapies.

Drug repurposing screens use libraries containing already approved FDA drugs, generic drugs, drugs that were abandoned from past clinical trials, and compounds with known targets that elicit a biological response.122 Given that different diseases may share similar biological pathologies and that many biochemical pathways have cross-talk and redundancy, a particular drug may have more than one beneficial effect. Drug repurposing exploits the off-target effects of already approved drugs, and it is well established that most drugs have a handful of “off-label uses”.122 Drug repositioning projects are estimated to take 6 years and cost $300 million.110 Because drugs with already approved status have known safety profiles and few serious adverse effects, the chances of advancing through clinical phases are greater.122 Although repurposed drugs are less costly and time-consuming to develop, several barriers exist, such as acquiring new patents, absorbing the economic risk of developing a new drug indication, going through phase I trials again if a different dose is required, and the risk of the drug not stacking up to comparable drugs in the existing competitive landscape.123 Regardless of the barriers in drug

50 repurposing, it is estimated that repurposed drugs represent 30% of drugs approved each year, highlighting the untapped potential of existing drugs.122

Since there are approximately 7000 rare diseases, the majority of which lack effective treatment, the need to expedite drug discovery via drug repurposing is evident.124 TTC7A- deficiency is one among thousands of rare diseases where there are no effective drug treatments. Cumulatively, 350 million individuals are living with rare diseases globally, rivalling the third most populous country (USA).125 The rare-disease paradox is that approximately one in twelve Canadians are affected by “rare” diseases, 50% of these being children.126 Approximately half of all known rare diseases are attributed to monogenic causes and advances in new technologies resulted in pharmaceutical research identifying over 300 new drugs for rare diseases in the past 25 years.127 However, only a fraction of these novel therapies are for children.128 Rare diseases are poorly understood, complex, and well suited to phenotypic drug screening. The research presented highlights the utility of phenotypic drug screening in identifying effective therapeutic options for children suffering from severe VEOIBD.

Not only has the incidence and prevalence of IBD in children grown disproportionately, but the reach of the disease has extended internationally to parts of the world previously unaffected. The findings of this research may benefit those with VEOIBD and the expanding IBD population. The research presented intertwines translational research with drug discovery, cell biology, zebrafish models, and personalized medicine for pediatric patients with rare diseases.

Hypothesis and specific aims

I hypothesize that TTC7A-deficiency results in compromised cellular survival and aberrant intestinal phenotypes; thus, therapies targeting anti-apoptotic pathways for both in vitro and in vivo models may improve intestinal fitness.

The overall research goal is to identify compounds that can rescue aberrant phenotypes induced by TTC7A-deficiency via high-throughput drug screening. The research has focused on the following aims:

1. Identifying and characterizing phenotypes related to TTC7A-deficiency in cell-based models.

2. Identifying and characterizing intestinal phenotypes in ttc7a-mutant zebrafish.

3. Establishing a high-throughput drug screen related to a TTC7A-phenotype. Identifying hit compounds that can rescue the screening phenotype.

4. Validating candidate drugs in cell-based and zebrafish models.

Because little data on TTC7A are available, identifying drugs with known targets may provide some insight into TTC7A’s functions in the cell and in VEOIBD.

Chapter 2 Materials and Methods 2 2.1 Cell lines

TTC7A knockout (TTC7A-KO) HAP1 (human haploid) cells were engineered by Horizon Discovery (Cambridge, UK) using CRISPR-Cas9 genome editing. Horizon Discovery Sanger sequenced the cell line and confirmed a 1 base pair insertion (c. 1564_1565insT) in exon 9 of TTC7A leading to an early stop codon (p. L399LfsX132). Cells were resequenced by extracting RNA from WT and TTC7A-KO lysates, reverse transcribing RNA to cDNA, amplifing a 421 base pair region of interest using cDNA primers surrounding the insertion, running the sample on a gel to confirm the size of region, and then Sanger sequencing. Forward primer: CGGAAACCTCACCTCTATGAAG Reverse primer: CAAAGTGCTCTGCTTCCTCTA. TTC7A protein loss was confirmed via western blotting using an anti-TTC7A antibody (Origene TA812302 mab, USA). HEK293T cells overexpressing WT-TTC7A-FLAG were used as a positive control. Although the antibody works for western blot detection, upwards of 100μg of protein was loaded and the resultant band intensity was generally weak.

HeLa cell lines stably overexpressing WT TTC7A and E71K-mutations were made previously by the Muise lab.5 The E71K mutants have a missense nonsynonymous variant in exon 2, which resulted in a glutamic acid to lysine substitution at amino acid 71. The mutation was very rare (1 heterozygous variant of 6503 healthy individuals- NHLBI) and highly deleterious (polyphen score of 0.99) as it was in a conserved alpha helix region. Patient 1 from Avitzur et al. was compound heterozygous for E71K and a truncation mutation, and 13 patients were homozygous for E71K in Lemoine et al.7 These HeLa cells were previously validated via sequencing and immunoblotting in the Muise Lab.

52 53

2.2 Cell culture and drug treatment

HAP1 cells were cultured with Iscove’s modified Dulbecco medium (IMDM, Gibco, USA) and supplemented with 1% penicillin and streptomycin (penstrep) (100IU/ml) and 10% (vol/vol) fetal bovine serum (FBS). Cells were maintained at densities below 75% and passaged every 2-3 days. HeLa cells were cultured in Dulbecco’s Modified Eagle medium (Wisent Inc, Canada) (1% Penstrep, 10% FBS) and passaged every 4 days.

Unless otherwise stated, cells and zebrafish were treated with the following drug concentrations: DMSO (0.5%vol/vol), Cyanocobalamin (CYANO-10μM) (Selleckchem, USA), Leflunomide (LEF-4μM) (Selleckchem, USA), Tiaprofenic acid (TIA-4μM) (Prestwick Chemical Library, USA), Fenbufen (FEN-10μM) (Selleckchem, USA) Fasudil (FAS-5μM) (Selleckchem, USA), Y27632 (10μM) (Selleckchem, USA), and 4-PBA (5mM) (Sigma, USA). Fasudil and Y27632 are RhoA Kinase-inhibitors (ROCK) and were not hits in the drug screen but served as controls for ROCK-inhibition when assessing candidate drugs.

2.3 Microscopy

For live cell imaging, cells were seeded at low density onto 8-well chamber slides (ibdi, Germany) with 200 μl of medium. Cells were given 24hrs to adhere before addition of DMSO or drugs. Cells were treated with DMSO or drugs for 24hrs and imaged with a Quorum Spinning Disk Confocal at various objective magnifications. Colony size formation was assessed after a 48hr-drug treatment and images were taken at various objective magnifications. Volocity Software’s line tool was used to measure six of the largest continuous colonies per condition.

2.4 Fluorescent cell staining

For morphology assessment, cells were cultured as described above in chamber slides and live- stained with nuclear stain Hoechst 33342 (ThermoFisher, Canada). Hoechst stock solution was diluted 1:2000 with phosphate buffered saline (PBS) (Wisent Inc, Canada) and incubated with cells for 5 minutes away from light followed by 3 washes with PBS. Samples were excited with a UV laser (350/461) and imaged with a spinning disk confocal at 40x objective magnification.

Filamentous actin (F-actin) structures were assessed via phalloidin staining. Cells were seeded at low density on cover slips coated with poly-D-lysine (Sigma, USA), cultured and treated as described above, fixed in methanol-free 4% PFA (Sigma, Canada), permeabilized with 0.1% Triton X-100, stained with ActinGreen 488 Ready Probes Reagent according to manufacturer’s protocol (Invitrogen R37110, Canada) and DAPI (1:2000), and mounted onto slides with Dako mounting medium (Agilent, USA). The slides were imaged at 40x objective magnification with a spinning disk confocal, 495/518 green channel and 350/461 UV channel were used. For each condition, five images were acquired, and the number of F-actin processes were tabulated for each condition.

2.5 Flow cytometry

Adherent and suspended HAP1 cells were stained using the Annexin V-FITC Apoptosis Detection Kit with Propidium iodide (PI) (Biolegend) as per the manufacturer’s protocol. Approximately 1 million cells were collected, washed twice in flow buffer, and resuspended in 100 μl binding buffer. The cell suspension was added to flow tubes, then 5μl of Annexin V-FITC and 10 μl of PI were added, samples were incubated and protected from light for 10 minutes. Sample fluorescence was acquired with a BD LSRFortessa™ (BD Biosciences) using FACSDiva™ software and analysed with FlowJo® v.10.4.2 software. Live cells had no Annexin V/PI, while necrotic cells had both Annexin V/PI staining (where dead cells were used as a

55 control for both Annexin V/PI staining). Apoptotic cells had Annexin V-FITC with no PI staining.

2.6 Viability assay

Cells were seeded (10 000 cells/well) into 96-well white walled/clear bottom plates and allowed to adhere for 24hrs prior to any DMSO or drug treatment. Cells were treated with DMSO or drugs and viability (number of cells) was assessed either by the addition of Calcein acetoxymethyl (AM) (Invitrogen, USA) (1μl Calcein AM/125μl medium) or a Realtime-Glo MT viability assay, according to manufacturer’s protocol (Promega, USA). Calcein AM viability reads were obtained with a fluorescent plate reader, 495/515nm excitation/emission. Realtime- Glo MT viability reads were obtained with a luminescence plate reader.

2.7 Adhesion assay

Cells were pre-treated with DMSO or drugs as described above, counted with a Countess cell counter, and 20,000 cells were seeded equally across all conditions on collagen I coated 96-well plates (PerkinElmer, USA). Cells were allowed to adhere for 2hrs and then agitated with 3 PBS washes to remove non-adherent cells. Calcein AM was then added to each well (1μl Calcein AM/125 μl medium), and mean fluorescence was measured as a metric for the number of viable cells remaining before and after agitation.

2.8 Western blot

Western blotting was completed as per standard protocols. For AKT experiments, cells were treated with DMSO or drugs for 1 and 3 hrs and stimulated with 10% FBS for 5 minutes prior to lysing. Cells were cultured in 10-cm dishes until ready for cell lysing. All lysing steps were completed on ice to reduce any biochemical changes related to stress, and protein denaturation/degradation. Cells were washed with ice cold PBS and lysed with 1% Triton X-100, 1nmM sodium orthovanadate (inhibits tyrosine phosphatases), 1 mM sodium fluoride (inhibits serine/threonine phosphatases), 1 mM PMSF (inhibits serine/cysteine proteases) and 1x P2714 (protease inhibitor cocktail inhibitor, Sigma-Aldrich). Briefly, protein lysate concentrations were quantified with a standard Bradford assay protocol. Samples were reconstituted with 20% 5x Laemmli buffer (8% sodium dodecyl sulfate for protein denaturation, 20% 2-mercaptoenthanol to reduce disulfide bonds, 40% glycerol to increase density, 0.008% bromophenol blue in 0.125 M Tris-HCl (pH 6.8), to create a trackable and anionic mixture) and heated to 95°C for 5 minutes. Equal amounts of protein were loaded on MINI-PROTEAM TGX Precast Gels, 4-20% (BioRad, USA). Electrophoresis was performed with a BioRad electrophoretic device and run for 35 min. Proteins in gel were transferred onto nitrocellulose membranes (GE Healthcare)(Bio- Rad) with a Trans-Blot (BioRad) transfer machine. The membranes were then blocked in a 5% skim milk solution (Carnation non-fat milk powder and 1x PBS with Tween 20 (PBST) to reduce nonspecific interactions) for 1 hour at room temperature. Membranes were then incubated overnight in primary antibodies (1:1000 with 5% skim milk), washed 3x for 5 min with PBST, and then incubated with secondary antibodies for 1 hour at room temperature. Primary antibodies included: anti-Caspase 3 Rabbit (Cell Signaling, USA), anti-p-AKT (S473) Rabbit (Cell Signaling, USA), anti-p-AKT (T308) Rabbit mab (Cell Signaling, USA), anti-AKT Rabbit (Cell Signaling, USA), anti-P-Ezrin (T567)/Radixin (T564), Moesin (T558) Rabbit (Cell Signaling, USA), anti-XIAP (D2Z8W) Rabbit mab (Cell Signaling, USA), and anti-TTC7A Mouse mab (Origene, USA). Membranes were then washed 3x for 5 min each with PBST and incubated with Clarity Western ECL solution (Bio-Rad). Images were developed using a Li-COR Odyssey FC Imaging System and analyzed with Image Studio Software (Li-COR Biosciences).

2.9 Caspase activity assay

Caspases 3 and 7 activities were evaluated with the Caspase-Glo 3/7 Assay System (Promega) according to manufacturer’s protocol. Briefly, active Caspases 3 and 7 cleave a luciferase substrate and the exogenously introduced luciferase enzyme produces a luminescence signal proportional to the relative apoptosis levels in the sample. HAP1 WT and TTC7A-KO cells were cultured for 24 hours and then treated for 24 hours with DMSO (or treatment of interest) in 96- well white-sided/clear bottom microtiter plates (Costar). A multichannel pipette was used to dispense 1μl of Calcein AM (see viability assay) to each well, and then plates were read on a Molecular Devices SpectraMax Gemini EM Fluorescence Plate Reader. The plate was then multiplexed for the apoptosis assay by the addition of 80μl of the Caspase-Glo 3/7 reagent to each well, plates were shaken for 30 seconds at 400 rpm, incubated for 1 hour, and read on a Molecular Devices Spectramax Luminometer with 5 second integration times. Caspase readouts were provided in relative light/luminescence units (RLUs) and were normalized to cell viability (Calcein AM RFUs). The following equation was used as a multiplier for raw Caspase RLU values so that they could be normalized to cell viability: 1-[(viability of treated (RFU)-viability of control (RFU))/viability of control (RFU)]. If 2 wells had similar Caspase readouts, yet different viabilities, then the equation normalized Caspase values by accounting for differences in cell viabilities. For example, if the result of the equation was >1, then raw Caspase values would be increased upon normalization. A scenario for this might be 2 wells having the same Caspase value, yet one well had very low viability RFUs. The equation will yield a value >1 and the Caspase activity for that given well will be greater given that there were fewer cells present. 16 replicates produced a Z’-factor score of 0.54. Statistical significance was determined using a one-way ANOVA. Z’-factor was calculated as described in Zhang et al. 1999, Z’-factor= 1-

(3σpc+3σnc)/|μpc-μnc|where “pc” is the positive control value, “nc” is the negative control value, omega is the standard deviation and mu is the average.117 Z’-factor is a well-established metric to assess the quality of a high-throughput screen, where values >0.5 indicate a very good assay, values between 0 and 0.5 are acceptable, and values <0 indicate that the screen would be unable to identify hits.117

2.10 High-throughput drug screen

Low passage (<20) HAP1 WT and TTC7A-KO cells were seeded with the Biomek FX (Beckman) liquid handler robot into 96-well white walled/clear bottom plates (Costar) at 10 000 cells/well in 125μl IMDM/10% FBS/1% penstrep (Gibco). Columns 1 and 12 contained positive WT and negative (TTC7A-KO) vehicle treated (DMSO) controls. Cells were given 24-hours to adhere before the addition of DMSO and/or compounds. Columns 2-11 contained TTC7A-KO cells screened with compounds from the Prestwick, TOCRIS, and LOPAC drug libraries at 8μM, 8μM, and 5μM concentrations, respectively. Source plates from all libraries contained compounds dissolved in DMSO, which were added to the assay plates using the Mutimek (Beckman) pinning robot. The plates were incubated for another 24-hours at 37°C, followed by the addition of 1μl/well of Calcein AM (BioLegend) by the tipless MultiDrop Combi (Thermo). After Calcein AM addition, fluorescent readings were taken with the Cytation (Biotek) plate reader, Caspase-Glo 3/7 (Promega) reagents were added with the tipless MultiDrop Combi (Thermo) (80μl/well), shaken for 30 seconds at 400rpm, incubated away from light for 1 hour at room temperature, and then read by the Cytation (Biotek). The readouts for viability and apoptosis were relative fluorescent units (RFU) and relative light units (RLU), respectively. The hit rate was 0.4% and mean Z’-factor scores were 0.34 for Prestwick, 0.55 for LOPAC, and 0.59 for TOCRIS. Z’-factor was calculated as described in Zhang et al. 1999, Z-factor= 1- 117 (3σs+3σc)/|μs-μc|, where “s” is the sample value and “c” is the negative control. Mean Caspase activity of WT and TTC7A-KO cells was plotted, and compounds that reduced Caspase activity below 3 standard deviations of the positive WT control (hit threshold=μpositive control - 3σ), providing a confidence limit of 99.73%, were selected as hits. Hits were cross-referenced to the internal viability control fluorescent reads (Calcein AM), which were multiplexed with the Caspase 3/7 (RLU) assay. Comparison to the internal viability controls identified false positives by ensuring that lower Caspase RLUs corresponded to high viability reads, and that low RLUs were not an artifact of total cell annihilation via compound toxicity. For further hit validation of

Caspase 3/7 inhibition and IC50 determination, concentration-response assays were performed using compound concentrations serially diluted from 40 to 0.04 μM. Concentration-response curves and IC50 values were generated with Graphpad software.

2.11 Zebrafish ttc7a-/- model

All protocols and procedures involving zebrafish were performed in accordance with Canadian Council on Animal Care (CCAC) guidelines. Mutant ttc7a strains were generated by the Zebrafish Core Facility at Sickkids’ Peter Gilgan Centre for Research and Learning using CRISPR/Cas9 mutagenesis following previously described protocols.129 Briefly, a single- stranded guide RNA targeting exon 14 (5’GAGCTCTGCAGTCACTACGC 3’) was designed using CHOPCHOP and injected into 1 cell-stage AB embryos.130 Fish were screened for mutations using high-resolution melt (HRM) analysis with the following primers: Forward 5’ CATGTCTGCCATGACTCACTGT 3’; Reverse 5’AACCTAGTTCGCAAGCACACAT3 3’4. The following primers were used for sequence confirmation of mutant profiles: Forward 5’ CAGGCCTCTGATGGTAAGCC 3’; Reverse 5’ AGGACACAAAGACAGAAGCGAA 3’.

Zebrafish were maintained in accordance with CCAC guidelines. Fish were housed, maintained and bred at the Zebrafish Core Facility. The zebrafish work was done in strict accordance with conditions to avoid animal suffering. In order keep the fish transparent, larvae used for imaging or histological analysis were treated with 0.003% 1-phenyl-2-thiourea (PTU) in system water after 1 dpf.

2.12 Peristalsis assays

Peristalsis assays were adapted from Shi et al. 2014 and performed in larvae at 7 dpf.131 Larvae were produced by in-crossed F1 heterozygotes, WT, or homozygous fish genotype-confirmed for the exon 14 1-base pair deletion. Embryos were treated with PTU to inhibit pigment formation. At 6 dpf, larvae were treated with 2’,7’-Dichrolodihydrofluorescein diacetate (DCFH-DA) (Sigma, Canada), a fluorescent probe that labels the intestinal lumen, for 24hrs. At 7 dpf, fish were washed 3 times for 5 minutes with fish water, anaesthetized with tricaine, and embedded in 1% low melt agarose (Sigma, Canada) on chamber slides that were topped-up with fish water.

Gut motility function was visualized with green fluorescence (495/518nm) and DIC channels using a spinning disk confocal (Quorum) at 4x objective magnification with 3 z-stacks across depths of <10μm (kept at a minimum for speed). Still frames were captured from 8-minute analysis of peristaltic activity. All zebrafish were genotype-verified by either HRM analysis or Sanger sequencing.

2.13 Histology

Zebrafish were treated with candidate drugs from 3.5 to 7 dpf and fixed at 7dpf with buffered zinc formalin, to preserve sample morphology. After fixation, samples were submitted to Toronto General Hospital’s Pathology unit for wax embedding, slicing along the sagittal plane and staining with H&E. Slides were imaged at 40x with the 3DHistech Panoramic 250 Flash II Slide Scanner at PGCRLs imaging facility. Zebrafish histology, from the intestinal bulb to the anus, was scored for openness of the luminal space, overall mucosal architecture, integrity of the simple columnar polarized monolayer of intestinal epithelial cells, and signs of apoptosis. Initial assessment of histological features was done in consultation with pathologists, Drs. Cornelia Theoni and Iram Siddiqui.

2.14 Statistical analysis

Data are presented as mean ±SD, and experimental and technical replicates are indicated in figure legends, with a minimum of three experimental replicates performed for most experiments. Statistical significance between groups was indicated in figure legends and calculated by GraphPad Prism software version 6.0 (GraphPad, San Diego, CA) as a two-tailed 1-way or 2-way ANOVA, or unpaired Student’s t-test. Statistical significance was established at P values <0.05.

Chapter 3 Results

3 3.1 Confirmation of a novel TTC7A-knockout cell line

The TTC7A knockout (TTC7A-KO) model was commercially engineered from a HAP1 cell line by Horizon Discovery (Cambridge, UK) using CRISPR-Cas9 genome editing. HAP1 cells are a human haploid cell line that is fibroblast-like and derived from chronic myeloid leukemia cells.132 Horizon Discovery validated the cell line at the genome level via Sanger sequencing. The TTC7A-KO cells were revalidated with Sanger sequencing confirming a 1 base pair insertion (c. 1564_1565insT) in exon 9 of TTC7A leading to a synonymous mutation, causing a frameshift, and early stop codon (p. L399LfsX132) (Figure 9A). Western blotting also confirmed the loss of TTC7A at the protein level. HEK293T cells overexpressing WT-TTC7A-FLAG was used as a positive control in the blot (Figure 9B).

Figure 9. Confirming the HAP1 TTC7A-KO cell line

A Sequence confirmation of 1 base pair insertion (c. 1564_1565insT) in exon 9 of TTC7A causing a frameshift and early stop codon (p. L399LfsX132). B Western blot for endogenous TTC7A in HAP1 WT and TTC7A-KO cells. HEK293T cells transiently overexpressing WT- TTC7A-FLAG was used as the positive control. (n=3)

3.2 TTC7A-KO cells exhibit phenotypes associated with apoptosis

IEC apoptosis as well as apoptotic enterocolitis were pathophysiologic features shared among TTC7A-deficient patients.5,8,9 Likewise, HAP1 TTC7A-KO cells displayed several phenotypes related to apoptosis. In culture, TTC7A-KO cells formed small clustered colonies of cells, whereas WT cells typically formed larger expansive colonies (Figures 10A and 10B). Live-cell imaging showed that TTC7A-KO cells had aberrant morphology compared to WT cells, including active membrane blebbing as seen in the still-frame in Figure 10C. WT cells displayed increased spreading, while TTC7A-KO cells were rounded with multiple plasma membrane blebs and protrusions, features usually associated with cells in the early stages of apoptosis. 133- 135

To further explore the nature of the aberrant morphology in TTC7A-KO cells, Phalloidin staining revealed that TTC7A-KO cells had an abundance of filopodia-like processes composed of Filamentous Actin (F-actin) (Figure 11A). Interestingly, when WT cells were treated with proinflammatory cytokines IFN/TNF (also serving as apoptotic stimuli), the F-actin organization became similar in the WT and untreated TTC7A-KO cells. Cytoskeletal changes can be associated with changes in ROCK activity.78 Since previous studies implicated increased ROCK activity in TTC7A-associated IEC loss of polarity, TTC7A-KO cells were treated with ROCK-inhibitors, Fasudil and Y27632 (Figure 11B). The abnormal F-actin structures in the TTC7A-KO cells failed to form with ROCK-inhibition via Y27632 treatment.

Flow cytometry with Annexin V-FITC staining and counterstaining with propidium iodide showed that TTC7A-KO cells had increased Annexin V staining, suggesting that cells were in the early stages of apoptosis (Figure 12). Furthermore, TTC7A-KO cells displayed reduced cell viability over a 48-hour period compared to WT cells (Figure 13A). Western blot analysis confirmed that TTC7A-KO cells express baseline cleaved Caspase 3 and had an increased susceptibility for Caspase-dependent apoptosis when treated with IFN/TNF (Figure 13B). Cumulatively, these data suggests that HAP1 TTC7A-KO cells are more apoptotic relative to WT cells.

Figure 10. Cell morphology of WT and TTC7A-KO cells with DIC microscopy

A HAP1 WT and TTC7A-KO cells at confluency, 2.5x magnification objective. (scale bar 100μm) B WT cells formed large colonies, while KO cells formed small clustered colonies. Cells at 4x objective magnification. Dashed-bars highlight differences in colony sizes formed after 48hrs of growth. (scale bar 190μm). C Cells at 63x objective magnification. Blebs and filopodia-like processes indicated by arrow and arrowhead, respectively. (scale bar 10μm) (n=3)

Figure 11. Phalloidin staining of WT and TTC7A-KO cells

A Phalloidin staining of HAP1 WT and TTC7A-KO shows the F-actin cytoskeleton (green) and DAPI staining indicates nuclei (blue). Images were taken with a spinning disk confocal, objective magnification 40x. Bottom panels were treated with IFN and TNF for 48 hours. White arrows indicate filopodia-like processes. (n=3). B Cells were stained with Phalloidin and DAPI after Fasudil 5 μM or Y27632 10 μM treatment for 24 hours. 40x objective magnification. (Scale bar 22 μm)

Figure 12. Increased Annexin V-FITC staining in TTC7A-KO cells

A Gated plot for Annexin V-FITC/Propidium iodide (PI) flow cytometry of WT and TTC7A-KO cells showed that there was a 1.5-fold increase in the Annexin V-FITC stained population in TTC7A-KO cells. Flow data analysed using Facsdiva. B Comparison of the Annexin V-FITC staining in the TTC7A-KO cells relative to the WT cells from flow cytometry experiments. Data are presented as the mean ±SD. Statistical significance was determined using an unpaired Students t-test. **p≤0.01 (n=3)

Figure 13. Reduced cell viability and increased cleaved Caspase 3 in TTC7A-KO cells

A Cell viability assay over 48 hours, RLU= relative light/luminescence units. Statistical significance was determined using a 2-way ANOVA **p<0.01, ***p<0.001 (n=3, 3 replicates each) B Western blot analysis of untreated and IFN//TNF-treated (48 hours) WT and TTC7A- KO cells (n=3).

3.3 ttc7a-mutant zebrafish display aberrant intestinal phenotypes

Given that mice with Ttc7a mutations did not phenocopy the intestinal defects seen in humans87 and that previous studies reported zebrafish as an appropriate model system for IBD,96 we tested whether ttc7a-mutant zebrafish display aberrant intestinal features in-line with the defects presenting in patients. In vivo experiments were performed with ttc7a-mutant zebrafish having an 11-base pair deletion in exon 14 (c.1710_1721del), and previously made with CRISPR-Cas9 genome editing (Figure 14A). The 11-base pair deletion was predicted to result in a frameshift mutation at the protein level causing an early stop codon (p. T548LfsX41) (Figure 14B).

Viability analyses over a three-month period showed no evidence that the ttc7a mutants had reduced survival. However, they did display abnormal intestinal phenotypes. Peristalsis assays utilized real-time in vivo imaging of the GI tract, allowing for evaluation of gut architecture and contractile motility. Live-labeling of the intestinal luminal space was achieved via a water soluble non-fluorescent stain, 2’,7’-Dichlorodihydrofluorescein diacetate (DCFH- DA), which then becomes oxidized to a fluorescent compound once ingested by the zebrafish.40 Still-frames from the peristalsis footage are shown in Figure 15A. The presence or lack thereof distinct villi structures and normal intestinal architecture could be appreciated with the light transmission (DIC) channel, while the delineation of the luminal space was distinctly informed by the fluorescent channel. Control fish, ttc7a+/-, displayed large intestinal luminal spaces (Figures 15B and 15C) with discernable villi in the intestinal bulb and coordinated peristaltic contractions from the anterior to posterior regions of the gut. Mutant ttc7a-/- fish showed various intestinal abnormalities, as shown in exemplar images i-iii in Figure 15A. Insults to the global intestinal architecture in ttc7a-/- fish included; stricturing points in the intestinal bulb resulting in bottlenecked contractions, severely narrow luminal spaces where peristalsis was also reduced, and obstruction-like masses in the intestinal bulb resulting in uncoordinated gut motility. In sum, the ttc7a -mutant fish had reduced luminal spaces (Figure 15B and 15C) with associated motility defects, presenting as either dramatically reduced or uncoordinated gut motility (Figure 15D).

Histological samples for control and mutant zebrafish are provided in Figure 16. Slices were taken along the sagittal plane so that the entire length of the gut could be scored for openness of the luminal space, overall mucosal architecture, integrity of polarized epithelial monolayers, and signs of apoptosis. ttc7a -/- zebrafish showed the following intestinal aberrations: stratification and crowding of IEC, blunted villi, breaches in the intestinal mucosal layer, and strictured regions along the intestinal tract. IEC polarity ensures that cells remain in a single layer where nuclei are arranged basolaterally. Stratification occurs when epithelial cells are arranged on top of one another in layers, or cells appear to be layered because nuclei are not aligned, in the case of pseudostratified epithelia. Therefore, stratification or pseudostratification suggests abnormal IEC integrity.

Figure 14. DNA and protein sequences for ttc7a-mutant zebrafish

A DNA sequence showing the 11 base pair deletion in exon 14 (c.1710_1721del). B Protein alignment sequence showing frameshift at threonine 548 (black arrow) leading to a stop codon (red arrow) 41 amino acids away (p. T548LfsX41).

(Only a point of reference for the size of fish at 7dpf, and not representative of the fish in figures)

Figure 15. Phenotypes associated with ttc7a-mutant zebrafish

(Labeling note: in zebrafish figures ttc7a +/- = TTC7A+/- and ttc7a-/- =TTC7A-/-)

A Intestinal lumen staining of control (ttc7a +/-) and TTC7A-mutant (ttc7a -/-) zebrafish 7 days post fertilization (dpf). Images are still-frames from peristalsis assays, intestinal lumens are marked by green fluorescent stain (DCFH-DA). ttc7a +/- fish have discernable villi (black arrow) and large continuous intestinal bulbs (double-headed white arrow). Representative ttc7a-mutant intestinal phenotypes are in panels i-iii; (i) stricturing point (white arrow heads) (ii) continuously narrow intestinal lumen (iii) obstruction interrupting intestinal bulb (white arrow) (Scale bar 100 μm) B Measurements of intestinal lumen volume; a complementary analysis for phenotypes observed in the peristalsis assay. The volume (μm3) of fluorescence in the luminal space across z-stacks from the peristalsis data was analyzed using Volocity software. Statistical significance was determined using an unpaired students t-test, ***p=0.0009 (n=20) C Intestinal bulb lengths; a complementary analysis for phenotypes observed in the peristalsis assay. The lengths (μm) of intestinal bulbs were measured using Volocity’s line tool. Statistical significance was determined using a 1-way ANOVA, ****p<0.0001 (n=20) D ttc7a -mutant phenotype summary from peristalsis assays. Motility defect refers to either reduced or uncoordinated peristalsis. Data are presented as the mean ±SD, and statistical significance was determined using a 2-way ANOVA, *p<0.05 (n=50 total for each group, across 3 experimental clutches).

(Only a point of reference, not representative of fish in figures)

Figure 16. Zebrafish intestinal histology

Histology from ttc7a +/- and ttc7a -/- zebrafish fixed at 7dpf and stained with H&E. A ttc7a +/- zebrafish displayed open luminal spaces with discernible villi projections (grey arrowhead), clefts (black arrowhead), monolayer epithelial integrity (double-ended arrow), and mature goblet cells (black arrow) with large vesicles. B ttc7a -/- zebrafish displayed narrowing in the intestinal lumen, stratified epithelial (double asterisk), signs of apoptosis (single asterisk), and goblet cells (black arrow) with numerous small vesicles. Entire gut magnified at 10x and insets marked by solid and dashed lines at 40x (ttc7a +/- n=14, ttc7a -/- n=11) (Scale bar 100 μm, inset scale bar 50 μm)

3.4 Phenotypic drug screen model

TTC7A-KO cells consistently showed increased activation of apoptosis, with and without IFN/TNF stimuli. The apoptotic phenotype was appealing for a screen because it is a strong reproducible feature observed in TTC7A-deficient patients.5-9 Therefore, the drug screen was designed to identify compounds that could rescue the apoptotic phenotype via the Caspase-Glo 3/7 (Promega) luciferase-based assay. Briefly, active Caspases 3 and 7 in the sample would cleave a DEVD-luciferase substrate, so that the luminescence signal was proportional to the number of cells with irreversibly activated apoptotic pathways.136 The Caspase-Glo 3/7 assay was performed in 96-well plates and produced a Z’-factor score of 0.54, suggesting that the assay could confidently identify hits via high-throughput screening (Figure 17A).117 A Z’-factor greater than zero indicates that the means of the positive and negative controls, as well as their standard deviations, do not overlap, making it possible to identify hits on a large scale screen. A workflow schematic for the drug screen is provided in Figure 17B. Notably, each assay plate in the screen was multiplexed for both viability and Caspase 3/7 readouts. The viability readout served as an internal control to eliminate false positives and ensure that low Caspase 3/7 readouts were not a result of compound toxicity and/or total cell annihilation.

Hits identified with wells having caspase activities (3-standard deviations) below that of the positive control

Figure 17. Phenotypic drug screening model and workflow

A High-throughput apoptosis phenotype assay. Caspase 3/7 luciferase assay, performed in a 96- well plate, Z’-factor score was 0.54, data are presented as the mean ±SD, and statistical significance was determined using a 1-way ANOVA, ****p<0.0001 (n=3, 16 replicates) B Drug screen workflow schematic. HAP1 cells were seeded in 96-well white walled/clear bottom plates at 10 000 cells/well in 125 μl IMDM. Columns 1 and 12 contained positive (WT) and negative (TTC7A-KO) controls. Cells were given 24 hours to adhere before the addition of DMSO and/or drugs. Columns 2-11 contained TTC7A-KO cells to be screened with test compounds at 8 μM concentrations. The plate was incubated for another 24 hours, followed by the addition of Calcein AM, an internal control cell viability, and fluorescence readings were taken. Caspase- Glo 3/7 reagents were added (80 μl/well), plates were shaken for 30 seconds, incubated for 1 hour, and read by a luminometer. Calcein AM and Caspase readouts were relative fluorescent units (RFU) and relative luminescence/light units (RLU), respectively. Since Caspase 3/7 readings were higher in the negative control (TTC7A-KO), compared with the positive control (WT), the hit threshold was calculated as three standard deviations (σ) below the mean (μ) of the positive control (hit threshold=μpositive control (RLU) - 3σ). Hits were cross-referenced to the internal viability fluorescent reads (Calcein AM) to reduce false positives.

3.5 Identification of small molecules that could rescue the apoptotic phenotype in TTC7A-KO cells

Drug screening was performed using 3 libraries containing FDA-approved compounds as well as other compounds with known biological targets. The Prestwick Chemical Library (PCL) contained 1120 compounds, many of which were FDA-approved drugs, as well as other compounds that were biologically active with known human pharmacokinetic and safety data.48 The LOPAC (Sigma) library contained 1280 compounds, both marketed and candidate drugs, with over 50% of the compounds targeted to G protein-coupled receptors (GPCR). Lastly, the TOCRIScreen library contained 1360 compounds, which encompassed both approved and biologically active drugs with a diverse range of targets including GPCRs, ion channels, kinases, enzymes, and nuclear receptors/transporters. 112

Altogether 3760 compounds were screened, and 16 hit compounds were identified, resulting in a 0.4% hit rate (Figure 18A). Compounds that reduced Caspase activity below 3 standard deviations of the positive control (WT Caspase 3/7 activity), providing a confidence limit of 99.73%, were selected as hits. Nonsteroidal anti-inflammatory drugs (NSAIDs) as well as Metabotropic Glutamate Receptor Subtype 5 (mGluR5) antagonists were the most well- represented classes of hit compounds. Relative inhibition of Caspase activity among hit compounds were compared in Figure 18B. All hits were validated with concentration-response curves in the TTC7A-KO cells, and additionally, in a HeLa cell line that stably expressed TTC7A-mutations (E71K and A832T) found in our previously reported patients (Table 4).

The top compound was Leflunomide and it effectively reduced Caspase 3/7 activity by

96% (relative to DMSO control), with a half-maximal inhibitory (IC50) concentration of approximately 1.2 μM (Figure 19). Leflunomide was the most promising candidate for repurposing since it is a Disease Modifying Anti-Rheumatic Drug (DMARD) that is currently used to treat Juvenile Rheumatoid Arthritis and has been shown to be effective in moderate to severe IBD.137-139 Cyanocobalamin, the synthetic form of Vitamin 12, was another hit compound previously shown to be effective in IBD.140 An annotated list of all hit compounds identified in the screen is found in Table 5.

Figure 18. Drug classification families and relative Caspase-inhibition of hit compounds

A Drug classification families of hit compounds. 3760 compounds were screened from the Prestwick, LOPAC, and TOCRIS drug libraries. 16 hit compounds were identified, resulting in a 0.4% hit rate. Hit compounds were distributed across 10 drug classification families: 5 NSAIDs, 3 mGluR5 antagonists, and 1 from each of the other classes listed. B Comparison of hit compounds’ inhibition of Caspase 3/7 activity in TTC7A-KO cells. Rescue of Caspase 3/7 activity was calculated by the percentage of decrease in luminescence signal compared to DMSO TTC7A-KO control. Bars with black borders represent FDA-approved drugs. Bar colours correspond to drug classification families in Figure 18A.

Table 4: IC50 values of hit compounds in 3 different TTC7A-mutant cell lines

Figure 19. Concentration-response curves for Leflunomide

Concentration-response curves for TTC7A-KO HAP1 cells (IC50=1.1uM) and HeLa cells with

E71K (IC50=1.2uM) and A832T (IC50=1.3uM) TTC7A overexpressed mutations. Serial dilutions starting from 40 μM were used.

Table 5: Summary of hit compounds that were able to rescue the apoptotic phenotype

Molecular Weight Decrease in caspase 3/7 Compound Name Structure Formula Structure IC 50 (μM) Compound description (g/mol) activity

F Arava, immunosuppressive O F F modifying anti rheumatic drug Leflunomide*** N C12H9F3N2O2 270.2 1.1 96% Disease Modifying Anti N CH O 3 Rheumatic Drug (DMARD) - Pyrimidine synthesis inhibitor

O CH3 S Tiaprofenic acid COOH C14H12O3S 260.3 2.5 87% NSAID, arthritic pain

N N Fungicide, vascular disrupting Tiabendazole C10H7N3S 201.3 11 60% S N agent

O H N NH2 2 O NH Chiral 2 H C CH3 3 O O H3C H N N 2 N N H C + O 3 Co H N N CH H2N 3 CH Cyanocobalamin 3 C63H88CoN14O14P 1355 11 64% Synthetic form of B12 CH3 CH3 O NH N O 2 CH H C OH 3 3 CH O O O 3 P O O N OH N

O OH NSAID, arthritis, increases P- Flurbiprofen** C15H13FO2 244.2 39 31% Akt in rats (Sun B et al 2011) CH3 F

O NSAID, increase survival of CH 3 motor neuron proteins, Indoprofen N C17H15NO3 281.3 6.1 73% O muscular atrophies. HO Withdrawn.

O Lederfen, NSAID, propionic OH acid derivatives class, Fenbufen O C16H14O3 254.3 30 56% withdrawn due to liver toxicity in 2010

OMe Flavone from black locust used HO O to treat arthritis. inhibition of Acacetin C16H12O5 284.3 N/A 47% recombinant human OH O monoamine oxidases (MAO- A/B)

Prevents apoptosis in K562 Resveratrol** C14H12O3 228.3 4.9 45% cells by inhibiting lipoxygenase and cyclooxygenase activity

Soluble guanylyl cyclase Isoliquiritigenin C15H12O4 256.3 9.7 89% activator and aldose reductase inhibitor

Vanilloid antagonist.Potent, SB-366791 C16H14NO2Cl 287.7 7.6 58% selective, competitive vanilloid receptor-1 (VR1) antagonist.

Selective and noncompetitive antagonist of mGlu5 SIB 1893 C14H13N 195.3 9.1 58% metabotropic glutamate receptor, positive allosteric modulator at mGlu4

Highly selective mGlu5 SIB 1757** C12H11N3O 213.2 18 50% metabotropic glutamate receptor antagonist

C15H12NO3• Non-steroidal anti- Ketorolac tris salt 376.4 156 48% C4H12NO3 inflammatory (NSAID) drug

Glutamate antagonist. Highly selective, non-competitive MPEP hydrochloride** C14H11N.HCl 229.7 6.3 33% mGluR5 (GCPR) metabotropic glutamate receptor antagonist.

p53 inhibitor. Also aryl Pifithrin-α hydrobromide C16H18N2OS.HBr 367.3 8.3 31% hydrocarbon receptor agonist

** hit in 2 screens, *** hit in 3 screens, grey boxes are FDA-approved drugs

3.6 Hit compounds rescue concomitant phenotypes related to TTC7A-deficiency

Since drug repurposing was the endpoint of our screen, candidate drug selection from the 16 hit compounds was based on class diversity and FDA-approved status. Therefore, the 16 hit compounds were narrowed down to 4 candidate drugs (Cyanocobalamin, Leflunomide, Tiaprofenic acid, and Fenbufen) for orthogonal validation in the concomitant TTC7A- phenotypes shown in Figures 11-13. Since it was previously suggested that TTC7A-deficiency is associated with increased ROCK-activity, small molecule ROCK-inhibitors, Fasudil and Y27632, were also investigated to assess changes in ROCK-associated pathways.

As all the candidate drugs reduced TTC7A-KO Caspase activity in the initial screen, it was not surprising that TTC7A-KO cell morphology improved after drug treatment (Figure 20A). TTC7A-KO cells exhibited filopodia-like protrusions and rounded plasma membranes, which made the cells appear smaller in size due to a lack of spreading. TTC7A-KO cells treated with candidate drugs appeared to be less round and more spread-out on the plate, increasing the apparent cell sizes. Changes in cell morphology and spreading were further evaluated with agitation-experiments that exposed differences in cell-adhesion (Figure 20B). Since TTC7A-KO cells displayed more rounding, it was not surprising that there were significant differences in cell-adhesion between the WT and TTC7A-KO cells. Cyanocobalamin, Tiaprofenic acid, Fenbufen, and Fasudil treatments improved TTC7A-KO cell-adhesion relative to the vehicle control. Furthermore, colony size formation, a proxy for both cell-adhesion and viability, was increased in TTC7A-KO cells after Cyanocobalamin, Leflunomide, Tiaprofenic acid, Fasudil, and Y27632 drug treatments (Figure 20C).

In Figure 21A, Phalloidin staining showed that Fenbufen (as well as the ROCK-inhibitors in Figure 11B) were able to rescue the abnormal F-actin organization in the TTC7A-KO cells. The number of F-actin protrusions was significantly increased in the TTC7A-KO cells; however, these processes were reduced with Fenbufen treatment (Figure 21B).

Candidate drug treatments generally improved viability of TTC7A-KO cells (Figure 22A), complementing the observed increases in colony sizes. In an attempt to understand how Leflunomide increases cell viability, western blot analysis in Figure 22B showed that WT cells had strong expression of both phosphorylated (active) forms of AKT (p-AKT Thr308 and Ser473), a crucial survival kinase, whereas TTC7A-KO cells showed weak expression of these proteins. TTC7A-KO cell treatment with Leflunomide increased expression of both forms of p- AKT. Treatment with a phosphatidylinositol 3-kinase (PI3K)-inhibitor, an upstream regulator of AKT, eliminated p-AKT expression in both WT and TTC7A-KO Leflunomide-treated cells. These data suggest that the increases in TTC7A-KO cell viability (after Leflunomide treatment) may be related to increases in AKT activation.

The relationship between AKT, X-linked inhibitor of apoptosis (XIAP), and cleaved Caspase 3 were investigated in Figure 22C. Immunoblotting revealed that WT cells have discernable Thr308 p-AKT and XIAP protein bands, and lack baseline cleaved Caspase 3 activity. When the WT cells were treated with an apoptotic inducer, PI3K-inhibitor (LY294002), we observed a loss of p-AKT/XIAP and increased cleaved Caspase 3 protein levels. Interestingly, TTC7A-KO cells showed a similar protein pattern compared to the PI3K-inhibited WT cells, with low p-AKT and XIAP, and increased cleaved Caspase 3, suggesting that the apoptotic phenotype observed in TTC7A-deficiency may be partly mediated by AKT. Leflunomide treatment increased p-AKT and XIAP protein levels and reduced cleaved Caspase 3 in TTC7A-KO cells. The changes in p-AKT, XIAP and cleaved Caspase 3 protein levels resulting from Leflunomide treatment suggested that TTC7A-KO cells underwent a shift from an overall apoptotic phenotype to a survival phenotype.

Figure 20. Orthogonal validation of candidate drugs in TTC7A-KO cell line

A Cell morphology from DIC microscopy. Hoechst staining (in blue) was used to distinguish nuclei and single cells. Unless otherwise stated, drug concentrations were, DMSO (0.5%vol/vol), Cyanocobalamin (CYANO-10 μM), Leflunomide (LEF-4 μM), Tiaprofenic acid (TIA-4 μM), Fenbufen (FEN-10 μM), Fasudil (FAS- 5 μM), Y27632 (10 μM). Fasudil and Y27632 served as positive controls for comparison to candidate drugs. Overall, cells that were rounding-up (in contrast to well-adhered and flattened) had membranes that were more easily discernable, and visible as a distinctly delineated membrane (black arrows). Notable features included: rounded cells (black arrows), apoptotic membrane protrusions (black arrowhead), filopodia-like process (white arrow), cell fragmentation and blebbing (white arrowhead), and cell-spreading (double- headed arrows). Objective magnification 40x (n=3, 3 replicates per condition) (Scale bar 22 μm) B Adhesion differences between WT, TTC7A-KO, and drug-treated TTC7A-KO cells. Data are presented as the mean ±SD, and statistical significance was relative to KO/DMSO control and determined using a 1-way ANOVA, ****p<0.0001, **p<0.01 (n=3, 4 replicates per condition). C Changes in colony size formation between WT, TTC7A-KO, and drug-treated TTC7A-KO cells. Colonies were measured with Volocity’s line tool after 48-hour drug treatment. Plotted values represent individual cell colonies, error bars presented as mean ±SD, and statistical significance was relative to KO/DMSO control and determined using a 1-way ANOVA, ****p<0.0001, ***p<0.001, **p<0.01 (n=3, 6 replicates per condition)

2 0

s e

s *** ***

s 1 5

r p

1 0

a -

F 5

# 0

F O O O IA N S S N E E L /T M M A / /F Y O /D D O O / C K K T O / K W K O K

Figure 21. Phalloidin staining after drug treatment

A and B Phalloidin staining in green indicates F-actin structures and DAPI in blue are stained nuclei. Cells were imaged at 40x objective magnification. (Scale bar 22 μm). For single cells, the number of F-actin processes were counted and presented in the graph. Data are presented as the mean ±SD, and statistical significance was relative to KO/DMSO control and determined using a 1-way ANOVA, ***p<0.001 (n=3, 5 replicates per condition). Drug abbreviations same as previous figure.

Figure 22. TTC7A-KO cell viability after drug treatment

A Viability assay, after 48-hour drug treatment. The number of viable cells was measured by fluorescence from Calcein AM at 1, 24 and 48-hour timepoints. At the 48-hour timepoint, statistical significance relative to KO/DMSO control was present for WT (***p<0.001), KO/TIA (*p<0.05), KO/FAS (**p<0.01), statistical significance determined using 1-way ANOVA (n=3, 4 replicates per condition). B and C AKT western blots. Western blot for HAP1 WT and TTC7A-KO cells treated with DMSO, Leflunomide (8 μM), or LY294002 (50 μM) for 3 hours. B Leflunomide increases both Thr308 and Ser473 p-AKT expression relative to DMSO control in TTC7A-KO cells, while total AKT levels remain unchanged. C Leflunomide treatment increases both p-AKT and XIAP relative to DMSO control in TTC7A-KO cells, while cleaved Caspase 3 levels are correspondingly reduced. (n=3)

3.7 Abnormal ROCK-activity is unlikely to drive apoptosis

Previous studies suggested that abnormal ROCK-activity may cause the IEC defects associated with TTC7A-deficiency.6 Constitutive ROCK-activity in TTC7A-deficient human cells causes activation of the Ezrin/Radixin/Moesin (ERM) family of proteins via phosphorylation (p-ERM) and loss of focal adhesions. 6,133 It is possible that poor focal adhesions may drive apoptosis via anoikis, a specific form of apoptosis resulting from the lifting of adherent cells .141,142 Morphological differences and increases in apoptosis were associated with the poor adhesion phenotype observed in TTC7A-KO cells (relative to WT) as seen in Figure 23A. Poor adhesion did not appear to be driving the apoptotic phenotype in TTC7A-KO cells since they were apoptotic even before lifting, while relative Caspase 3/7 activity levels were similar between WT and TTC7A-KO cells that were floating (Figure 23B). Consistent with previous studies, the blot in Figure 23C shows that p-ERM, a downstream marker for ROCK activity, was more abundant in TTC7A-KO cells compared with WT protein levels. However, Leflunomide treatment did not reduce p-ERM levels in TTC7A-KO cells to WT levels (Figure 23C and 23D). These data suggest that Leflunomide treatment does not rescue apoptosis by reducing ROCK-activity, and that the increased in ROCK-activity may not be driving the apoptotic phenotype.

p-ERM levels

Figure 23. ROCK activity and the apoptotic phenotype in TTC7A-KO cells

A Adhesion assay using Calcein AM and Collagen I coated 96-well plates. TTC7A-KO cells have impaired adhesion after agitation, relative to WT cells. Statistical significance was determined using a Students t-test, **p<0.002, (6 replicates, n=3) B Apoptosis likely precedes cell lifting in TTC7A-KO cells. Floating and adherent cells were isolated, counted and plated in equal amounts for both WT and TTC7-KO cells. Caspase 3/7 activity was measured in floating cells and adherent cells and analyzed relative to the WT control. Statistical significance was determined using a 2-way ANOVA, ****p<0.0001 (n=3) C and D Western blot for p-ERM. WT and TTC7A-KO cells were treated with DMSO or Leflunomide 8 μM (Lef) for 3 hours. The blot and densitometric analysis show that p-ERM is significantly increased in both DMSO and Leflunomide treated TTC7A-KO cells, relative to WT cells. Statistical significance was determined using a 1-way ANOVA, *p<0.05 (n=2).

3.8 Candidate drugs improve ttc7a-mutant zebrafish intestinal phenotypes

The reduced intestinal motility and narrow lumen phenotypes displayed by ttc7a-mutant zebrafish were improved with candidate drug treatments, for the dose and timepoint tested in the peristalsis assays (Figure 24A). Leflunomide treatment resulted in the most significant improvement in motility, while Fasudil did not significantly change the proportion of fish with motility defects compared to the DMSO-treated ttc7a-mutant fish. Intestinal luminal volumes were measured as a complimentary metric for the narrow lumen phenotype (Figure 24B). Except for Fenbufen, all the candidate drugs and Fasudil increased luminal volume in ttc7a-mutant zebrafish, suggesting an improvement in the intestinal stricturing phenotype.

Given that significant proportions of ttc7a-mutant fish (relative to WT fish) displayed the reduced motility and narrow gut phenotypes (Figure 15D), and that DMSO at 0.5% vol/vol is routinely used in fish143, resources (i.e., time, animals, and compounds) for orthogonal drug validation in zebrafish were mainly directed toward ttc7a-mutant fish, instead of WT fish. Consequently, very few WT fish were treated with candidate drugs in the peristalsis assays, primarily due to the time sensitive nature of these real-time live assays. Furthermore, preliminary data (obtained by Lucie Zhu) suggested that lethal doses for candidate drugs (in WT fish) were at least an order of magnitude (mM range) greater than the concentrations used in these validation experiments (μM range). For example, Leflunomide’s lethal dose was 10 mM (for a 24 hr period) across 5 experiments/clutches, while a lethal dose for Cyanocobalamin was predicted to be >10 mM. The exact lethal dose could not be determined due to limiting stock concentration (10 mM). Given that the concentrations tested here were in the μM range, these findings suggest that WT fish would not display serious toxicity effects from candidate drug treatments. Additionally, WT zebrafish were treated with candidate drugs for histology experiments, and for the number of fish sampled, there was no evidence to suggest that GI features were adversely affected.

As a point of reference, histology samples for ttc7a+/- and ttc7a-/- DMSO controls are provided in Figure 25. Intestinal integrity was qualitatively evaluated with the following criteria:

97 large and open intestinal bulb, rounded or blunted villi, presence of a discernable epithelial monolayer, IEC integrity (well polarized, no pseudostratification/stratification and no crowding), and presence of mature goblet cells with large secretory vesicles. In some cases, signs of fragmented apoptotic nuclei were obvious in histology; however, this feature was not consistently discernable and was only noted in Figure 25 as an example.

Histology for ttc7a -/- zebrafish treated with drugs of interest is shown in Figure 26A. Histological improvements were observed after Tiaprofenic acid, Leflunomide, and Cyanocobalamin treatments, resulting in open luminal spaces with discernible villi projections resembling ttc7a +/- gut morphology (previously shown in Figure 16). Monolayers with simple columnar IECs were observed in Leflunomide treated ttc7a -/-. Conversely, there appeared to be little improvement in IEC integrity related to the crowding and stratification appearance in ttc7a -/- fish treated with Cyanocobalamin and Fenbufen. ttc7a -/- zebrafish treated with candidate drugs appeared to have overall normal goblet cell morphology with large-single vesicles, similar to ttc7a +/- fish. Previous studies suggested that chaperone drug, 4-phenylbutyrate (4-PBA, Ucyclyd Pharma), and ROCK-inhibitors (Fasudil and Y27632) may be effective in improving defects related to TTC7A-deficiency, and histology showed that mutant fish treated with 4-PBA seemed to have improvements in all intestinal features (Figure 26B).

Gut atresia was common among patients with TTC7A-deficiency. Similarly, a narrow gut phenotype was the most striking abnormality in the ttc7a-mutant fish. From the histological data, Figure 26C summarizes the incidence of the narrow gut phenotype in drug-treated mutant fish. Note that small numbers of histology samples for ttc7a+/- drug treated-fish were obtained (CYANO n=2, LEF n=12, TIA n= 2, FEN n=1, Y27632 n=0/NA, FAS n=1, 4-PBA n=0/NA) and none of them displayed the narrow gut phenotype. Small numbers were due to the technically challenging nature of obtaining fish histology with a continuous stretch of the GI tract. For example, approximately 1/10 fish processed for histology yielded slices with complete GI tracts (intestinal bulb to anus). Since Leflunomide was the most effective inhibitor of apoptosis, larger sample sizes were obtained for ttc7a+/- and ttc7a-/- fish treated with Leflunomide. Figure 26D shows that ttc7a-mutants treated with Leflunomide had significantly reduced populations with narrow intestinal lumens, relative to DMSO-treated ttc7a-/- zebrafish.

A Z e b ra fis h in te s tin a l-lu m in a l v o lu m e

)

(

3 7 n 1 0 0 6 .0 1 0 m 

o ** 

i D M S O *

(

a e

l 8 0 C Y A N O * u

m ** p * u L E F l 7 o 4 .0 1 0

n s o  p

v n s 6 0 T IA

*** l h

s i

** F E N n

f i

a 4 0 m r *** F A S 2 .0 1 0 7

u 

z -

2 0 -

/ -

* * * * * A

0% 0% 0% 0% 0% 7

A C

7 0 0

C T

T m o tility d e fe c t n a r r o w lu m e n O O F A N S E I A T S N E L T F M A F D Y C

Figure 24. Candidate drugs improve ttc7a-mutant zebrafish phenotypes

A Phenotype summary obtained from peristalsis assays after drug treatment. Unless otherwise stated, fish were treated from 3.5 to 7 dpf with the following drug concentrations: DMSO (0.5%vol/vol), Cyanocobalamin (CYANO-10 μM), Leflunomide (LEF-4 μM), Tiaprofenic acid (TIA-4 μM), and Fenbufen (FEN-10 μM). Data are presented as the mean ±SD, statistical significance was relative to TTC7A -/- DMSO control, and determined using a 2-way ANOVA, *p<0.05, **p<0.01, ***p<0.001 (DMSO n=18, CYANO n=21, LEF n=21, TIA n=17, FEN n=18, FAS n=13 for each group across 3 experimental clutches). Grubbs’ outlier test (Graphpad Software) was used to reject single outliers (p<0.05) from each of the drug groups for the narrow lumen phenotype, resulting in 0% of the ttc7a -/- population exhibiting the narrow lumen phenotype for the timepoint and concentration tested. Power analysis (for qualitative endpoints) was determined to be 17 fish, suggesting that an appropriate sample size was evaluated here (except for the Fasudil group) in order to make predictions about the effects of the candidate drugs on ttc7a-mutant phenotypes. B Intestinal lumen volume measurements for ttc7a -/- zebrafish after drug treatment. Plotted values represent individual fish luminal volumes, and error bars are presented as mean ±SD. Volumes were calculated using Volocity Software, statistical significance was relative to TTC7A -/- DMSO control, and determined using a 1-way ANOVA, *p<0.05, **p<0.01.

100

Figure 25. Zebrafish histology with schematics indicating features of interest

Zebrafish were treated with DMSO from 3.5 to 7 dpf, fixed at 7dpf, and stained with H&E. ttc7a+/- zebrafish displayed open luminal spaces with large intestinal bulbs. Villi appeared rounded and projected into the lumen and a clear epithelial monolayer was discernable in the intestinal bulb, indicated by adjacent nuclei positioning. Mature goblet cells with large-single secretory vesicles were evident. ttc7a-mutant zebrafish displayed narrowing along the entire length of the intestinal lumen. The intestinal epithelia appeared thicker and villi were blunted with less rounded protrusions into the luminal space. IECs in the intestinal bulb appeared pseudostratified and crowded, as the nucleus from one cell seemed to overlap with the nucleus of the adjacent cell. There were more goblet cells with numerous small secretory vesicles and more IECs with fragmented nuclei, suggesting increased apoptosis (*). IB=intestinal bulb, PI=Posterior intestine, P=pseudostratified IEC, S= stratified IEC (TTC7A +/- n=49, TTC7A -/- n=36). Entire gut magnified at 10x and inset at 40x. (Scale bar 100 μm, inset scale bar 50 μm)

101

102

)

C %

( D

s 8 0 n + / -

e T T C 7A D M S O (n = 4 9 )

m u

l D M S O (n = 3 6 ) 6 0

w C Y A N O (n = 1 0 ) o

r r L E F (n = 2 6 )

a 4 0 n

T IA (n = 1 3 )

h t i F E N (n = 1 3 )

w 2 0

n F A S (n = 1 3 )

o i

t Y 2 7 6 3 2 (n = 4 )

a l

u 0 4 -P B A (n = 4 ) p ) ) ) ) ) ) ) ) ) 0 3 3 4 4 o 9 6 6 3 4 3 1 2 1 1 1 = =

P ======n n n n n ( ( n n ( (n ( n ( ( ( ( 2 A F S 3 O O O IA N 6 B N E E A P S S L T F 7 - M M A F 2 4 Y Y /- D D + C

A - /- 7 T T C 7 A C T T

103

Figure 26. Zebrafish histology after drug treatments

A and B Histology from ttc7a-mutant zebrafish treated with drugs from 3.5 to 7 dpf, fixed at 7dpf, and stained with H&E. Samples were qualitatively evaluated for large and open intestinal bulbs, rounded villi, epithelial monolayer, IEC integrity (no crowding or stratification), and the presence of mature goblet cells. Objective magnification 10x. (Scale bar 100 μm) C Summary of fish with the narrow lumen phenotype. TTC7A +/- (DMSO n=49) TTC7A -/- (DMSO n= 36, CYANO n=10, LEF n=26, TIA n= 13, FEN n=13, Y27632 n=4, FAS n=13, 4-PBA n=4). For candidate drug evaluation (CYANO, LEF, TIA and FEN), sample sizes were acquired from a minimum of 3 experimental clutches. For FAS and Y27632/4-PBA treatments, sample sizes were acquired from 2 and 1 experimental clutches, respectively. D Summary of the narrow gut phenotype simplified for DMSO and LEF treated fish (TTC7A+/- and TTC7A-/-). TTC7A +/- (DMSO n=49, LEF n=12), TTC7A -/- (DMSO n= 36, LEF n=26). Statistical significance was determined using a 2-way ANOVA, ****p<0.0001.

104

Chapter 4 Discussion

Considering the critical and unmet need for drugs to treat TTC7A-deficiency, our goal was to identify therapies that would be effective in resolving intestinal defects contributing to the disease. With the use of a human TTC7A-KO cell line and mutant zebrafish, we have identified several phenotypes related to TTC7A-deficiency, while simultaneously establishing a novel cellular and animal model system for studying TTC7A-deficiency. Given that TTC7A-patients had presented with apoptotic enterocolitis or signs of apoptosis in their intestinal epithelium, we performed a phenotypic high-throughput drug screen to identify compounds that could ameliorate the apoptotic phenotype. We selected candidate drugs having class diversity, known safety profiles, and repurposing potential and validated them in concomitant TTC7A-KO cell phenotypes as well as in our zebrafish model. Leflunomide, an FDA-approved DMARD, previously used for chronic inflammatory diseases including Juvenile Rheumatoid Arthritis, is our lead compound. Leflunomide inhibited Caspase 3 activation, increased survival-signaling in TTC7A-KO cells and rescued the intestinal defects in our zebrafish model. Through the development of various model systems and a phenotypic drug screen, we have identified a potential novel therapeutic for children suffering with TTC7A-deficiency (as summarized in Figure 27).

105

Figure 27. Project summary

Patients with TTC7A-deficiency motivated the identification of aberrant phenotypes in cell- based and zebrafish models with TTC7A-mutations. A range of phenotypes, with similarities to patient disease features, were identified and characterized. The cell-based human TTC7A-KO model displayed altered morphology, adhesion, F-actin organization, reduced viability, and increased apoptosis. The ttc7a-mutant zebrafish model exhibited abnormal gut motility and aberrant intestinal architecture. A phenotypic drug screen was developed, compounds that rescued the apoptotic phenotype were selected as hits and cross-validated in orthogonal phenotypes. Leflunomide was identified as the most promising lead compound. Changes in the AKT signaling pathway were revealed after Leflunomide treatment, suggesting that the AKT survival pathway may be altered in TTC7A-deficiency.

106

4.1 Drug screen

Using a novel TTC7A-KO cell line, we demonstrated the utility of phenotypic and repurposing drug screening. Since phenotypic drug screening is target-agnostic, a major challenge is lead compound validation and target ascertainment.110 To address the validation challenge, the identification of a range of mutant phenotypes related to TTC7A-dysfunction allowed us to cross-validate our candidate drugs in multiple experimental systems. The most widely recognized mechanism of action for Leflunomide is its role as a pyrimidine synthesis inhibitor. The active metabolite of Leflunomide (A77 1726) binds to and blocks the hydrophobic tunnel formed by α-helical domains leading to the active site of dihydroorotate dehydrogenase, an enzyme involved in the de novo synthesis of pyrimidines.144 A lack of de novo pyrimidines results in less DNA/RNA synthesis, necessary for T-cell proliferation; thus, halting T-cells in the G1 stage of the cell cycle.145 Therefore, Leflunomide’s immunomodulating function reduces inflammatory responses from T-cell activation contributing Rheumatoid Arthritis, a disease that shares some immunopathogenicity with IBD (i.e., overactive T-cells and increased TNFα signaling).138

Leflunomide, also known as Arava® (Sanofi Aventis) or N-(4-trifluoromethylphenyl)-5- methylisoxazole-4-carbo-xamide, is considered a hydrophobic small-molecule drug (270.2 g/mol) and is administered in tablet form, where 10, 20, and 100mg tablet doses are available.146 Specific dosing depends on a patient’s weight; for example, patients weighing less than 20 kg receive 100 mg for the first day and then 10 mg for maintenance on the following days.139 Leflunomide is absorbed in the GI tract, its bioavailability ranges from 83-86%, and it is excreted in urine and feces.146 At 36 days after a single dose, Leflunomide is still detectable in urine and feces, indicating that it has a long clearance time.146 In a randomized trial comparing Leflunomide to methotrexate, the gold standard in Juvenile Rheumatoid Arthritis, both therapies were considered to cause high rates of clinical improvement, where the percentage improvement index of both drugs were similar at 44% and 53%, respectively.139 The most common adverse effects in patients aged 3 to 17 years included higher aminotransferase levels (indicative of liver toxicity), GI side effects (nausea, pain, diarrhea, gastritis), headaches, rash, hair-loss, and nose- throat symptoms.40,138,139

107

Previous reports indicate that Leflunomide may be effective in treating IBD, specifically for maintenance therapy in moderate to severe CD.40,138 Studies evaluating Leflunomide as a therapy for CD were driven by a “significant proportion” of adult patients who were unresponsive or had serious adverse effects to gold standard maintenance immunosuppressive therapies.137,138 Leflunomide was able to improve GI-disease manifestations in both the small bowel and colon and allowed patients to reduce steroid use. Patients still required concomitant 5- ASA, antibiotic, and biologic therapies with Leflunomide.137 The efficacy of DMARDs are typically evaluated over several months to a year, but given the severity of disease in TTC7A- patients, shorter evaluation periods may be required. Another Phase I clinical trial for Leflunomide used to treat CD, evaluated improvement at 16-weeks. The remission rate was 42% within the 16-week period and beyond that, the remission rate increased to 71%.138 In these patients, there was also a significant decrease in the number who required steroids; however, 16/24 patients dropped out of the study over a one-year course due to lack or efficacy or adverse effects. Concomitant use of 5-ASA and/or biologics were provided as potential reasons for the elevated adverse effects; however, no statistical evidence was provided to support this hypothesis.138 Ultimately, more studies are required to understand the efficacy and safety of Leflunomide in IBD treatment.

Besides Leflunomide, there were other promising candidate drugs. While Tiaprofenic acid was able to rescue many TTC7A-related phenotypes, its repurposing for VEOIBD should be approached with caution since it is typically not prescribed for children and NSAIDs are associated with gastric ulcers and bleeding.147 Cyanocobalamin, the synthetic form of Vitamin B12, was able to improve several TTC7A-deficient phenotypes in our model systems. Although Cyanocobalamin was less effective in rescuing the apoptotic phenotype compared with Leflunomide, its relatively safe clinical profile makes it an appealing therapeutic to use in maintenance programs or in combination with Leflunomide. Additionally, case reports showed that when standard IBD therapies failed, high-dose Vitamin B12 supplementation resulted in excellent responses in patients with perianal suppurative (pus) disorders.140 These patients had no measurable Vitamin B12 deficiency and it was hypothesized that Vitamin B12 may have an immunomodulatory role in reducing TNFα levels.140 Interestingly, three of 16 hits were Metabotropic Glutamate Receptor Subtype 5 (mGluR5) antagonists, where mGluR5 is a type of GPCR linked to the inositol trisphosphate/DAG pathway.148 The hits belonging to the mGluR5

108 antagonists class were not FDA-approved drugs, nor were they suitable for repurposing; thus, they were not further validated, as our overall goal was to satisfy the need for effective and expedited TTC7A-treatment. Nevertheless, previous research has shown mGluR5 antagonists to be important in the GI tract by improving epithelial barrier function.148 Our drug screen identified a diverse range of biologically active compounds and illuminated several potential pathways implicated in TTC7A-deficiency. Further exploration of mGluR5 antagonists for instance, will be an interesting future direction in TTC7A and VEOIBD research and may lead to the development of novel drug targets.

4.2 TTC7A phenotypes

Phenotype complexity and heterogeneity in rare diseases represent challenges in drug discovery. Through unknown mechanisms, TTC7A-dysfunction is thought to disrupt homeostasis in the intestinal and immune system. The range of insults reported in patients have included various combinations of the following; lymphocytopenia, immunodeficiency, hypogammaglobulinemia, autoimmunity, severe combined immunodeficiency, thymus hypoplasia, secretory diarrhea, enterocolitis, alopecia, intestinal mucosal sloughing, detachment of surface epithelia, villous atrophy, loss of intestinal architecture, intestinal friability, multiple intestinal atresias, apoptotic enterocolitis, and crypt apoptosis.5-9 The first genotype/phenotype correlative study was from Lien and colleagues, and their findings suggested that TTC7A-patients with immunodeficiency and homozygous mutations in TPR-domains resulted in worse outcomes.8 Because TTC7A- defects associated with immune function may be improved by HSCT, our research was focused on therapeutic options able to recover the epithelial defects.

On the cellular level, altered morphology, poor adhesion, reduced viability and increased apoptosis were abnormal phenotypic features shared between TTC7A-KO cells and IECs in TTC7A-patients.5-9 In patients, we saw that both adhesion and apoptotic phenotypes existed, and confoundingly, each of these defects are capable of driving the other. Bigorgne et al. showed that TTC7A-mutations lead to the upregulation of ROCK activity, and it has been established that constitutive ROCK activity can lead to cell rounding and lifting.6,141,142 ROCK activity increases

109 p-MLC, which facilitates actomyosin ring contraction, resulting in the cytoskeleton pulling away from the plasma membrane, promoting rounding and bleb formation.142 Furthermore, increased ROCK activity is also associated with polymerization of Actin fibers and phosphorylation of ERM proteins, which link Actin filaments to the membrane to form F-actin protrusions.141 We have demonstrated that TTC7A-KO cells have increased rounding, blebbing (Figure 10C), lifting (Figure 23A), and F-actin (Figure 11A), all of which were abrogated with ROCK inhibition (Figure 11B and 20). An unaddressed question in TTC7A-research was whether constitutive ROCK activity drives the apoptotic phenotype. Anoikis is a mechanism by which ROCK activity could drive apoptosis. When adherent cells detach from their basal surfaces, anoikis, a specific form of apoptosis, may be triggered due to the loss of cell adhesion.133 Thus, in TTC7A-KO cells, it was possible that the abnormal adhesion phenotypes could drive apoptosis.

TTC7A-deficient cells displayed increased apoptosis, activated via the Caspase cascade, and culminating in the activation of effector Caspases 3 and 7 (as shown in Figures 13B and 17A).76 Once active, Caspases cleave various proteins including ROCK, which permanently exposes its kinase domain from the autoinhibitory folded state.141 Caspase cleavage results in constitutive ROCK-activity, causing rounding, blebbing and lifting, morphological features typically associated with apoptosis.133-135

Since TTC7A-KO cells displayed both adhesion and apoptotic phenotypes, it was unclear whether Caspase 3/7 activation occurred before or after cell lifting. Our data showed that cells were apoptotic even before lifting, suggesting that the apoptotic phenotype was not driven by anoikis (Figure 23B). Interestingly, the ROCK-inhibitor Fasudil, which was in our drug screen, did not rescue the apoptotic phenotype to the hit threshold. Approaching the question from another direction, rescuing apoptosis did not appear to alter protein activity downstream of the ROCK pathway. Figure 23C showed that p-ERM protein levels were unaffected by Leflunomide. These findings do not exclude the existence of an adhesion defect independent of the apoptotic pathway. Instead, these data suggest that TTC7A likely affects multiple intracellular pathways. For example, Leflunomide was effective in rescuing apoptosis but not F- actin protrusions (Figure 21), whereas the ROCK-inhibitor (Y27632) was effective in improving the F-actin phenotype but did not rescue the apoptosis.

110

Since the phenotypes associated with constitutive ROCK activity did not appear to be driving cell death, there existed no other pathway explicitly linking apoptosis and TTC7A. The drug screen conducted by Smith and colleagues confirmed several of the hits identified here as Caspase inhibitors, and their data suggested that some hits worked by physically obstructing the catalytic cysteine domain of Caspase 3.149 The results shown here suggests that Leflunomide may be doing more than physically obstructing the Caspase catalytic domain because changes in AKT activation were observed, an enzyme upstream of Caspase 3 (Figure 22B). Through western blot analysis, we identified alterations in the AKT-survival pathway in TTC7A-KO cells that were improved with Leflunomide treatment. These findings corroborate with research from Leger et al. who showed that low dose Leflunomide (10 μM) activated PI3K/AKT signaling in HEL and K562 leukemia cells.150

AKT is a crucial survival kinase and its activation prevents apoptosis, promotes proliferation and protein expression, and regulates cell metabolism.151-153 Because decreased viability (Figure 22A), and increased apoptosis were conspicuous phenotypes here, it seemed relevant to explore the effects of Leflunomide on AKT signaling in a TTC7A-deficient model. A proposed model linking TTC7A to AKT and Caspase 3 is presented in Figure 28. TTC7A and PI4KIIIα mediate PI4P synthesis at the plasma membrane, which contribute to pools of PIP- 5,75,80-82 substrates for PI3K. Binding to PI(3,4,5)P3 is a prerequisite for AKT activation, necessary for further downstream pro-survival signaling via XIAP.152 In TTC7A-deficient scenarios, western blot analysis showed that there was a lack of activated AKT, and cellular homeostasis seemed to be driven toward apoptosis given the presence of cleaved Caspase 3 (Figure 22C). After a 3-hour treatment, Leflunomide seemed to increase both threonine 308 and serine 473 p- AKT levels, while total AKT remained relatively unchanged (Figure 22B). We have demonstrated that Leflunomide treatment not only decreased Caspase 3 activation, but also resulted in increased expression of p-AKT and XIAP. XIAP is an important downstream effector of the PI3K/AKT pathway and is a direct inhibitor of Caspases via its polyubiquitination function of Caspases 3, 7, and 9, signaling their proteasomal degradation.154 Furthermore, deficiencies in XIAP are linked with the onset of IBD, making it an IBD-susceptible locus.63 Given that poor PI4KIIIα trafficking to the plasma membrane has been shown to reduce plasma membrane PI4P levels, we have proposed a model linking TTC7A to p-AKT signaling and overall cell survival. While Leflunomide’s precise target and mechanism of action remain

111

unknown, we demonstrated that Leflunomide was involved in activation of AKT, providing a potential rationale for the improved cell viability and reduced apoptosis in TTC7A-KO cells.

A B

112

Figure 28. Suggested model linking TTC7A-deficiency and apoptosis

The data presented in Figures 22B and 22C as well as data from previous studies (as cited below) provide the rationale for the following model. A TTC7A competent scenario: TTC7A is involved in trafficking PI4KIIIα to the plasma membrane where PI4KIIIα phosphorylates PI lipids to 5 create PI4Ps. PI4Ps may then serve as substrates for PIP5Ks to make PI(4,5)P2. Activated PI3K 82 then phosphorylates PI(4,5)P2 to create PI(3,4,5)P3. The pleckstrin homology (PH) domain of 152 AKT allows for its recruitment to the tightly regulated plasma membrane PI(3,4,5)P3. Upon localization to the plasma membrane, AKT undergoes a conformational change related to the position of its PH domain that allows phosphorylation of threonine 308 and serine 473 by PDK1 and mTORC2 complex, respectively (omitted for simplicity).152 Activated AKT (p-AKT) is a major regulator of cell survival with many targets. For example, activated AKT phosphorylates XIAP, where it can then avoid degradation, and polyubiquitylate procaspases 3,7, and 9 for proteasomal degradation.154 Additionally, NF-kβ activation by AKT is another way XIAP expression is increased via transcription. AKT is also involved in the inhibition of Bcl-2 associated death promoter (BAD), a proapoptotic protein.152 B TTC7A-deficiency scenario: PI4P levels have been shown to be reduced in TTC7A-mutant models, suggesting that PI4KIIIα trafficking to (or kinase activity at) the plasma membrane is compromised.5,80 Although reduced, PI4Ps are not absent from the plasma membrane,5 likely due to compensatory mechanisms (i.e. PIP kinases/phosphatases, TTC7B, secretory membrane fusions)5,80. Nevertheless, the apoptotic phenotype (suggested by the presence of cleaved Caspase 3) suggests that potential compensatory PIP synthesis80,82 does not effectively change p-AKT levels (and downstream XIAP levels) in TTC7A-KO cells. C TTC7A-deficiency + Leflunomide scenario: When TTC7A- KO cells are treated with Leflunomide, p-AKT and XIAP levels are increased, while the cleaved Caspase 3 levels are decreased, suggesting a shift toward a survival phenotype. It has yet to be established how Leflunomide mediates p-AKT activation.

113

Apoptosis is linked to TTC7A-deficiency disease pathology because it is a feature typically affecting patient IECs. Elevated IEC apoptosis can disrupt epithelial barriers, allowing translocation of bacteria and antigens into the lamina propria, leading to inflammation and tissue destruction.46,83 Pathologically, IEC apoptosis is also associated with Necrotizing Enterocolitis (NEC) and Acute Graft Versus Host Disease (GVHD), a complication of allogenic HSCT.68,155,156 Intestinal GVHD is a destructive histopathological condition where symptoms include diarrhea, abdominal cramping, nausea, poor absorption, intestinal mucosal sloughing and fibrosis.68 Similarly, the intestinal environment of several TTC7A-patients has been described as strikingly reminiscent of GVHD.5,9 In a mouse model with acute and lethal GVHD, Leflunomide was not only effective in preventing the disease, but also effective when used as a therapy to recover established GVHD.157 Furthermore, Jilling and colleagues found that elevated apoptosis preceded histological damage in mice with NEC, and pan-caspase inhibitors reduced the histological damage, suggesting that apoptosis alone had an underlying role in the mucosal injury.155 Given that IEC apoptosis is a common feature in GVHD and NEC, targeting apoptosis may moderate the damaging histological features seen in TTC7A patients. Taken together, the shift from apoptosis to a survival phenotype seen in TTC7A-KO cells may reduce the cumulative disease burden of TTC7A-deficiency. Therefore, these data suggests that Leflunomide may promote IEC fitness by inhibiting apoptotic mechanisms, which could potentially improve overall intestinal health by maintaining epithelial barrier function.

4.3 Zebrafish model

Strikingly, Cyanocobalamin, Tiaprofenic acid, and Leflunomide treatments reduced the proportion of mutant fish with motility defects. Through peristalsis assays, we studied gut function and morphology and found that ttc7a-mutant fish displayed dramatically reduced or uncoordinated peristalsis, establishing defective gut motility as a feature associated with TTC7A- deficiency. Previous research showed that intestinal inflammation can result in bowel-wall thickening, and that impaired peristalsis is a secondary effect of the pathogenesis associated with chronic intestinal inflammation.29,158 Impaired gut motility is well documented in IBD and,

114 counterintuitively, reduced bowel contraction contributes to the accelerated transit-time associated with diarrhea. 29,158 Furthermore, in clinical settings, gut motility can be monitored via diagnostic imaging in CD and UC patients to assess disease severity. 29,158 Taken together, the evaluation of gut motility is a reasonable and practical measure to assess the severity of gut- dysfunction in zebrafish, although the underlying pathophysiology remains unknown.

In previously established IBD zebrafish models, the fish have decreased gut peristalsis, loss of villi, and dramatic increases in mucin-positive goblet cells.96 Intriguingly, no intestinal narrowing was associated with previous IBD zebrafish models, suggesting that the strictured-gut phenotype may be a feature specifically caused by TTC7A-deficiency. Thakur and colleagues developed a zebrafish model (cdipt hi559) lacking phosphoinositide (PI) synthesis. cdipt hi559 fish have disease manifestations related to IBD, including aberrant villi and IEC integrity, loss of intestinal architecture, increased IEC apoptosis, and small gut sizes.159 Given that TTC7A- deficiency results in decreased PI4P synthesis at the plasma membrane, and the cdipt hi559 fish similarly have profound PI deficiencies, the phenotypes from cdipt hi559 fish provide a precedence for linking PI deficiency with IBD. Like cdipt hi559 fish, ttc7a-mutant zebrafish display overall narrowing and/or stricturing of the intestinal luminal space (Figures 15, 16, and 25). In some cases, the intestinal motility defect occurred concomitantly with the narrowing phenotype, where irregular contractions were localized at the stricture site, spatially correlating the epithelium and motility defects in ttc7a-mutant fish.

Overall, zebrafish histology samples show that ttc7a-mutants had a combination of the following intestinal defects: stratification and crowding of IEC, blunted villi, and narrowing or strictured regions along the intestinal tract. The intestinal defects in the zebrafish histology were in line with patient pathohistological findings, establishing ttc7a-mutant fish as a model phenocopying patient features, similar to cdipthi559 fish. Given that TTC7A-deficiency is associated with reduced plasma membrane PI4P levels, these findings suggest that PI homeostasis could be an important target for improving IEC integrity and intestinal architecture.

We show that 4-sodium phenylbutyric acid (4-PBA), a drug that resolves the pathohistological features in the cdipthi559 fish,159 is also able to improve the intestinal phenotypes in ttc7a-mutant fish (Figure 26B). Thakur et al. showed that a lack of de novo PI

115 synthesis in IECs results in endoplasmic reticulum (ER) stress due to increased expression of ER-stress factors (Hspa5 and Xbp1).159 It is hypothesized that the IBD-like disease features in cdipt hi559 fish were resolved by 4-PBA because it is a chemical chaperone drug known to reduce ER-stress associated with autophagy and the unfolded protein response.159,160 Interestingly, 4- PBA was in our TOCRIS screen and did not rescue the apoptotic phenotype in the TTC7A-KO cells, once more suggesting that multiple pathways may be affected by TTC7A-dysfunction. Furthermore, antibiotics (ampicillin, kanamycin, penicillin, and streptomycin) and anti- inflammatory (5-ASA and prednisolone) drugs on their own did not ameliorate intestinal disease features in the cdipt hi559 fish. Conversely, Leflunomide, having dual anti-inflammatory and anti- apoptotic roles, is effective improving intestinal morphology and function. As a future direction, it would be interesting to evaluate intestinal disease features of cdipt hi559 fish after Leflunomide treatment.

4.4 Concluding remarks

Drug discovery has become increasingly less efficient over the last 2 decades. As genetic approaches strengthen, rare monogenic diseases are continually being identified, with only a handful of effective therapies available to the 350-million affected individuals. In the case of most rare diseases, an incomplete understanding of the pathobiology often necessitates a phenotypic or target-agnostic drug discovery approach. The need for therapies targeted to rare diseases is becoming so dire that several countries have passed Orphan drug legislation to provide financial incentives to accelerated drug development programs. Recently, phenotypic drug screening is more successful in identifying first in class therapies and tapping into the hidden potential of already approved drugs further expediting the drug discovery process. Considering that TTC7A-deficiency is a rare and often fatal disease, the most promising and efficient approach for identifying potential therapies is a phenotypic drug screen aimed at drug repurposing.

116

In conclusion, we established cell and zebrafish model systems to recapitulate patient disease features and developed a phenotypic drug screen. Our approach expedited the identification Leflunomide, a previously unidentified potential therapeutic for children suffering with TTC7A-deficiency. The critical need for therapies motivated us to exploit the full potential of an existing drug such as Leflunomide, which has the advantage of a known safety profile in children. Although we did not identify the precise target of Leflunomide, changes in the AKT survival pathway provided some indication of how Leflunomide may improve cellular fitness in TTC7A-deficient cells. Patients in palliative care may potentially have the option to use Leflunomide in expedited clinical trials on the grounds of compassionate care. Additionally, a precision medicine-based approach would be to evaluate the response of TTC7A patient-derived organoids with Leflunomide.

Understanding the underlying processes involved in the pathobiology of TTC7A- deficiency is the ultimate goal. Specifically, elucidating the roles of PIPs in TTC7A-disease has not been explored thoroughly. For example, understanding localization differences in PI4P plasma membrane pools and quantitatively determining PI4P levels in TTC7A IECs could help to identify actionable disease-causing targets. Developing real-time in vivo zebrafish monitoring assays to study PI4Ps, intestinal barrier function, and IEC apoptosis would help us to understand how these factors contribute to TTC7A-disease pathology. Resolving the specific structure of TTC7A in complex with PI4KIIIα could also help us to understand how mutations alter PI4KIIIα trafficking and function. There is also the possibility that TTC7A may be involved in unidentified or undetectable pathways. Future investigation of the other hits with known targets may provide further insight into TTC7A’s intracellular activities, while the hits without FDA- approved statuses may represent promising candidates for drugs targeted to epithelial defects in IBD.

Drugs capable of rescuing TTC7A-deficiency could increase patient prognosis and uncover the functional pathways contributing to VEOIBD. More than 10,200 Canadians are diagnosed with IBD yearly, creating an estimated economic burden of over $2.8 billion.1 This study may lead to the identification novel VEOIBD therapies that could translate to the broader IBD population.

References

1 Bray, J. et al. The Challenges of Living with Inflammatory Bowel Disease: Summary of a Summit on Patient and Healthcare Provider Perspectives. Can J Gastroenterol Hepatol 2016, 9430942, doi:10.1155/2016/9430942 (2016).

2 Kammermeier, J. et al. Stem cell transplantation for tetratricopeptide repeat domain 7A deficiency: long-term follow-up. Blood 128, 1306-1308, doi:10.1182/blood-2016-01- 696385 (2016).

3 Moran, C. J., Klein, C., Muise, A. M. & Snapper, S. B. Very early-onset inflammatory bowel disease: gaining insight through focused discovery. Inflamm Bowel Dis 21, 1166- 1175, doi:10.1097/MIB.0000000000000329 (2015).

4 Uhlig, H. H. et al. The diagnostic approach to monogenic very early onset inflammatory bowel disease. Gastroenterology 147, 990-1007.e1003, doi:10.1053/j.gastro.2014.07.023 (2014).

5 Avitzur, Y. et al. Mutations in tetratricopeptide repeat domain 7A result in a severe form of very early onset inflammatory bowel disease. Gastroenterology 146, 1028-1039, doi:10.1053/j.gastro.2014.01.015 (2014).

6 Bigorgne, A. E. et al. TTC7A mutations disrupt intestinal epithelial apicobasal polarity. J Clin Invest 124, 328-337, doi:10.1172/JCI71471 (2014).

7 Lemoine, R. et al. Immune deficiency-related enteropathy-lymphocytopenia-alopecia syndrome results from tetratricopeptide repeat domain 7A deficiency. J Allergy Clin Immunol 134, 1354-1364 e1356, doi:10.1016/j.jaci.2014.07.019 (2014).

8 Lien, R. et al. Novel Mutations of the Tetratricopeptide Repeat Domain 7A Gene and Phenotype/Genotype Comparison. Front Immunol 8, 1066, doi:10.3389/fimmu.2017.01066 (2017).

9 Woutsas et al. - 2015 - Hypomorphic mutation in TTC7A causes combined immunodeficiency with mild structural intestinal defects.pdf.

10 Fullerton, B. S., Velazco, C. S., Hong, C. R., Carey, A. N. & Jaksic, T. High Rates of Positive Severe Combined Immunodeficiency Screening Among Newborns with Severe Intestinal Failure. JPEN J Parenter Enteral Nutr 42, 239-246, doi:10.1002/jpen.1013 (2018).

11 Neves, J. F. et al. Missense mutation of TTC7A mimicking tricho-hepato-enteric (SD/THE) syndrome in a patient with very-early onset inflammatory bowel disease. Eur J Med Genet 61, 185-188, doi:10.1016/j.ejmg.2017.11.014 (2018).

117 118

12 Samuels, M. E. et al. Exome sequencing identifies mutations in the gene TTC7A in French-Canadian cases with hereditary multiple intestinal atresia. J Med Genet 50, 324- 329, doi:10.1136/jmedgenet-2012-101483 (2013).

13 Peloquin, J. M., Goel, G., Villablanca, E. J. & Xavier, R. J. Mechanisms of Pediatric Inflammatory Bowel Disease. Annu Rev Immunol 34, 31-64, doi:10.1146/annurev- immunol-032414-112151 (2016).

14 Langkamp-Henken, B., Glezer, J. A. & Kudsk, K. A. Immunologic structure and function of the gastrointestinal tract. Nutrition in clinical practice : official publication of the American Society for Parenteral and Enteral Nutrition 7, 100-108, doi:10.1177/0115426592007003100 (1992).

15 Allaire, J. M. et al. The Intestinal Epithelium: Central Coordinator of Mucosal Immunity. Trends Immunol, doi:10.1016/j.it.2018.04.002 (2018).

16 El Aidy, S., van den Bogert, B. & Kleerebezem, M. The small intestine microbiota, nutritional modulation and relevance for health. Current opinion in biotechnology 32, 14- 20, doi:10.1016/j.copbio.2014.09.005 (2015).

17 Peterson, R. T., Link, B. A., Dowling, J. E. & Schreiber, S. L. Small molecule developmental screens reveal the logic and timing of vertebrate development. Proc. Natl. Acad. Sci. U. S. A. 97, 12965–9 (2000).

18 Thiagarajah, J. R. et al. Advances in Evaluation of Chronic Diarrhea in Infants. Gastroenterology 154, 2045-2059 e2046, doi:10.1053/j.gastro.2018.03.067 (2018).

19 Basu, J. & Bertram, T. A. Regenerative medicine of the gastrointestinal tract. Toxicologic pathology 42, 82-90, doi:10.1177/0192623313512431 (2014).

20 Powell, D. W., Pinchuk, I. V., Saada, J. I., Chen, X. & Mifflin, R. C. Mesenchymal cells of the intestinal lamina propria. Annual review of physiology 73, 213-237, doi:10.1146/annurev.physiol.70.113006.100646 (2011).

21 Peterson, L. W. & Artis, D. Intestinal epithelial cells: regulators of barrier function and immune homeostasis. Nature reviews. Immunology 14, 141-153, doi:10.1038/nri3608 (2014).

22 Ouwerkerk, J. P., de Vos, W. M. & Belzer, C. Glycobiome: bacteria and mucus at the epithelial interface. Best practice & research. Clinical gastroenterology 27, 25-38, doi:10.1016/j.bpg.2013.03.001 (2013).

23 Pelaseyed, T. et al. The mucus and mucins of the goblet cells and enterocytes provide the first defense line of the gastrointestinal tract and interact with the immune system. Immunological reviews 260, 8-20, doi:10.1111/imr.12182 (2014).

24 Haegebarth, A. & Clevers, H. Wnt signaling, lgr5, and stem cells in the intestine and skin. The American journal of pathology 174, 715-721, doi:10.2353/ajpath.2009.080758 (2009).

119

25 Camilleri, M., Madsen, K., Spiller, R., Greenwood-Van Meerveld, B. & Verne, G. N. Intestinal barrier function in health and gastrointestinal disease. Neurogastroenterology and motility : the official journal of the European Gastrointestinal Motility Society 24, 503-512, doi:10.1111/j.1365-2982.2012.01921.x (2012).

26 Wittkopf, N., Neurath, M. F. & Becker, C. Immune-epithelial crosstalk at the intestinal surface. Journal of gastroenterology 49, 375-387, doi:10.1007/s00535-013-0929-4 (2014).

27 Mittal, R. K. Regulation and dysregulation of esophageal peristalsis by the integrated function of circular and longitudinal muscle layers in health and disease. Am J Physiol Gastrointest Liver Physiol 311, G431-443, doi:10.1152/ajpgi.00182.2016 (2016).

28 Vighi, G., Marcucci, F., Sensi, L., Di Cara, G. & Frati, F. Allergy and the gastrointestinal system. Clin Exp Immunol 153 Suppl 1, 3-6, doi:10.1111/j.1365-2249.2008.03713.x (2008).

29 Ohama, T., Hori, M. & Ozaki, H. Mechanism of abnormal intestinal motility in inflammatory bowel disease: how smooth muscle contraction is reduced? J. Smooth Muscle Res 43, 43–54 (2007).30 Bassotti, G. et al. Gastrointestinal motility disorders in inflammatory bowel diseases. World J Gastroenterol 20, 37-44, doi:10.3748/wjg.v20.i1.37 (2014).

31 Zhang, Y. Z. & Li, Y. Y. Inflammatory bowel disease: pathogenesis. World J Gastroenterol 20, 91-99, doi:10.3748/wjg.v20.i1.91 (2014).

32 de Vos, W. M. Fame and future of faecal transplantations--developing next-generation therapies with synthetic microbiomes. Microbial biotechnology 6, 316-325, doi:10.1111/1751-7915.12047 (2013).

33 Human Microbiome Project Consortium. Structure, function and diversity of the healthy human microbiome. Nature 486, 207–214 (2012).

34 Kiesler, P., Fuss, I. J. & Strober, W. Experimental Models of Inflammatory Bowel Diseases. Cell Mol Gastroenterol Hepatol 1, 154-170, doi:10.1016/j.jcmgh.2015.01.006 (2015).

35 HISTOLOGY DIAGRAMS: Special histology- specific points. Available at: http://myhistologydiagrams.blogspot.com/2016/02/special-histology-specific-points.html. (Accessed: 5th August 2018)

36 Gallo, J., Raska, M., Kriegova, E. & Goodman, S. B. Inflammation and its resolution and the musculoskeletal system. Journal of Orthopaedic Translation 10, 52-67, doi:https://doi.org/10.1016/j.jot.2017.05.007 (2017).

37 Uhlig, H. H. & Powrie, F. Translating Immunology into Therapeutic Concepts for Inflammatory Bowel Disease. Annu Rev Immunol 36, 755-781, doi:10.1146/annurev- immunol-042617-053055 (2018).

120

38 Rieder, F. & Fiocchi, C. Intestinal fibrosis in inflammatory bowel disease - Current knowledge and future perspectives. J Crohns Colitis 2, 279-290, doi:10.1016/j.crohns.2008.05.009 (2008).

39 Abraham, C. & Cho, J. H. Inflammatory bowel disease. The New England journal of medicine 361, 2066-2078, doi:10.1056/NEJMra0804647 (2009).

40 Gardlik, A. W. In vivo reprogramming in inflammatory bowel disease. Gene Therapy 20, 1111, doi:doi:10.1038/gt.2013.43 (2013).

41 Coskun, M., Department of Gastroenterology, M. S. H. H. U. o. C. D. & [email protected]. Intestinal Epithelium in Inflammatory Bowel Disease. Frontiers in Medicine 1, doi:10.3389/fmed.2014.00024 (2014).

42 Garg, M., Lubel, J. S., Sparrow, M. P., Holt, S. G. & Gibson, P. R. Review article: vitamin D and inflammatory bowel disease--established concepts and future directions. Alimentary pharmacology & therapeutics 36, 324-344, doi:10.1111/j.1365- 2036.2012.05181.x (2012).

43 Goodhand, J. R. et al. Do antidepressants influence the disease course in inflammatory bowel disease? A retrospective case-matched observational study. Inflamm Bowel Dis 18, 1232-1239, doi:10.1002/ibd.21846 (2012).

44 Camara, R. J., Schoepfer, A. M., Pittet, V., Begre, S. & von Kanel, R. Mood and nonmood components of perceived stress and exacerbation of Crohn's disease. Inflamm Bowel Dis 17, 2358-2365, doi:10.1002/ibd.21623 (2011).

45 Playford, R. J. et al. The epidermal growth factor receptor (EGF-R) is present on the basolateral, but not the apical, surface of enterocytes in the human gastrointestinal tract. Gut 39, 262-266 (1996).

46 Schnoor, M. Inflammatory Mediators Contributing to Intestinal Epithelial Cell Apoptosis and Barrier Disruption in IBD. Journal of Clinical & Cellular Immunology 01, doi:10.4172/2155-9899.S3-003 (2012).

47 Larmonier, C. B., Shehab, K. W., Ghishan, F. K. & Kiela, P. R. T Lymphocyte Dynamics in Inflammatory Bowel Diseases: Role of the Microbiome. BioMed research international 2015, 504638, doi:10.1155/2015/504638 (2015).

48 Mowat, C. et al. Guidelines for the management of inflammatory bowel disease in adults. Gut 60, 571-607, doi:10.1136/gut.2010.224154 (2011).

49 Hwang, J. M. & Varma, M. G. Surgery for inflammatory bowel disease. World Journal of Gastroenterology 14, doi:10.3748/wjg.14.2678 (2008).

50 Seekatz, A. M. & Young, V. B. Clostridium difficile and the microbiota. J Clin Invest 124, 4182-4189, doi:10.1172/jci72336 (2014).

121

51 Sharara, A. I. When to Start Immunomodulators in Inflammatory Bowel Disease? Digestive diseases (Basel, Switzerland) 34, 125-131, doi:10.1159/000443127 (2016).

52 Zenlea, T. & Peppercorn, M. A. Immunosuppressive therapies for inflammatory bowel disease. World J Gastroenterol 20, 3146-3152, doi:10.3748/wjg.v20.i12.3146 (2014).

53 Derkx, B. et al. Tumour-necrosis-factor antibody treatment in Crohn's disease. Lancet (London, England) 342, 173-174 (1993).

54 Moss, A. C. Optimizing the use of biological therapy in patients with inflammatory bowel disease. Gastroenterology report 3, 63-68, doi:10.1093/gastro/gou087 (2015).

55 Eser, A., Primas, C. & Reinisch, W. Drug monitoring of biologics in inflammatory bowel disease. Current opinion in gastroenterology 29, 391-396, doi:10.1097/MOG.0b013e328361f7f6 (2013).

56 Yang, L. S., Alex, G. & Catto-Smith, A. G. The use of biologic agents in pediatric inflammatory bowel disease. Current opinion in pediatrics 24, 609-614, doi:10.1097/MOP.0b013e3283574154 (2012).

57 Greenstein, A. J., Barth, J. A., Sachar, D. B. & Aufses, A. H., Jr. Free colonic perforation without dilatation in ulcerative colitis. American journal of surgery 152, 272-275 (1986).

58 Bernell, O., Lapidus, A. & Hellers, G. Risk factors for surgery and postoperative recurrence in Crohn's disease. Annals of surgery 231, 38-45 (2000).

59 Lopez, J. & Grinspan, A. Fecal Microbiota Transplantation for Inflammatory Bowel Disease. Gastroenterol. Hepatol. (N. Y). 12, 374–9 (2016).

60 Data and Statistics. Available at: https://www.cdc.gov/ibd/data-statistics.htm. (Accessed: 5th August 2018)

61 Benchimol, E. I. et al. Epidemiology of pediatric inflammatory bowel disease: a systematic review of international trends. Inflamm Bowel Dis 17, 423-439, doi:10.1002/ibd.21349 (2011).

62 Crowley, E. et al. A13 WHOLE EXOME SEQUENCING OF OVER 1000 PEDIATRIC IBD PATIENTS FROM A SINGLE CENTRE IDENTIFIES MONOGENIC FORMS OF IBD. Journal of the Canadian Association of Gastroenterology 1, 21-21, doi:10.1093/jcag/gwy009.013 (2018).

63 Uhlig, H. H. & Muise, A. M. Clinical Genomics in Inflammatory Bowel Disease. Trends Genet 33, 629-641, doi:10.1016/j.tig.2017.06.008 (2017).

64 Salo-Mullen, E. E. et al. Contiguous gene deletion of chromosome 2p16.3-p21 as a cause of Lynch syndrome. Fam Cancer 17, 71-77, doi:10.1007/s10689-017-0006-x (2018).

122

65 Scriver, C. R. Human genetics: lessons from Quebec populations. Annual review of genomics and human genetics 2, 69-101, doi:10.1146/annurev.genom.2.1.69 (2001).

66 Duran, N. E. & Hommes, D. W. Stem cell-based therapies in inflammatory bowel disease: promises and pitfalls. Therap Adv Gastroenterol 9, 533-547, doi:10.1177/1756283X16642190 (2016).

67 Farge, D. et al. Autologous hematopoietic stem cell transplantation for autoimmune diseases: an observational study on 12 years' experience from the European Group for Blood and Marrow Transplantation Working Party on Autoimmune Diseases. Haematologica 95, 284-292, doi:10.3324/haematol.2009.013458 (2010).

68 Akpek, G. et al. Gastrointestinal involvement in chronic graft-versus-host disease: a clinicopathologic study. Biol Blood Marrow Transplant 9, 46-51, doi:10.1053/bbmt.2003.49999 (2003).

69 TTC7A tetratricopeptide repeat domain 7A [Homo sapiens (human)] - Gene - NCBI, https://www.ncbi.nlm.nih.gov/pubmed/ (2018).

70 Gene: TTC7A (ENSG00000068724) - Paralogues - Homo sapiens - Ensembl genome browser 92, http://useast.ensembl.org/Homo_sapiens/Gene/Compara_Paralog?db=core (2018).

71 TTC7B - Tetratricopeptide repeat protein 7B - Homo sapiens (Human) - TTC7B gene & protein, https://www.uniprot.org/uniprot/Q86TV6 (2018).

72 Tissue expression of TTC7A - Summary - The Human Protein Atlas, https://www.proteinatlas.org/ENSG00000068724-TTC7A/tissue> (2018).

73 Zeytuni, N. & Zarivach, R. Structural and functional discussion of the tetra-trico-peptide repeat, a protein interaction module. Structure 20, 397-405, doi:10.1016/j.str.2012.01.006 (2012).

74 Blatch, G. L. & Lassle, M. The tetratricopeptide repeat: a structural motif mediating protein-protein interactions. BioEssays : news and reviews in molecular, cellular and developmental biology 21, 932-939, doi:10.1002/(sici)1521- 1878(199911)21:11<932::Aid-bies5>3.0.Co;2-n (1999).

75 Baskin, J. M. et al. The leukodystrophy protein FAM126A (hyccin) regulates PtdIns(4)P synthesis at the plasma membrane. Nat Cell Biol 18, 132-138, doi:10.1038/ncb3271 (2016).

76 Elmore, S. Apoptosis: a review of programmed cell death. Toxicol. Pathol. 35, 495–516 (2007).

77 Tang, V. et al. Loss of a Candidate Biliary Atresia Susceptibility Gene, add3a, Causes Biliary Developmental Defects in Zebrafish. J. Pediatr. Gastroenterol. Nutr. 63, 524–530 (2016).

123

78 Amano, M., Nakayama, M. & Kaibuchi, K. Rho-kinase/ROCK: A key regulator of the cytoskeleton and cell polarity. Cytoskeleton (Hoboken) 67, 545-554, doi:10.1002/cm.20472 (2010).

79 Citalan-Madrid, A. F. et al. Cortactin deficiency causes increased RhoA/ROCK1- dependent actomyosin contractility, intestinal epithelial barrier dysfunction, and disproportionately severe DSS-induced colitis. Mucosal Immunol 10, 1237-1247, doi:10.1038/mi.2016.136 (2017).

80 Chung, J., Nakatsu, F., Baskin, J. M. & De Camilli, P. Plasticity of PI4KIIIalpha interactions at the plasma membrane. EMBO Rep 16, 312-320, doi:10.15252/embr.201439151 (2015).

81 Lees, J. A. et al. Architecture of the human PI4KIIIalpha lipid kinase complex. Proc Natl Acad Sci U S A 114, 13720-13725, doi:10.1073/pnas.1718471115 (2017).

82 Tan, J. & Brill, J. A. Cinderella story: PI4P goes from precursor to key signaling molecule. Crit Rev Biochem Mol Biol 49, 33-58, doi:10.3109/10409238.2013.853024 (2014).

83 Schulzke, J. D. et al. Disrupted barrier function through epithelial cell apoptosis. Ann N Y Acad Sci 1072, 288-299, doi:10.1196/annals.1326.027 (2006).

84 Ito, R. et al. Interferon-gamma is causatively involved in experimental inflammatory bowel disease in mice. Clin Exp Immunol 146, 330-338, doi:10.1111/j.1365- 2249.2006.03214.x (2006).

85 Hermiston, M. L. & Gordon, J. I. Inflammatory bowel disease and adenomas in mice expressing a dominant negative N-cadherin. Science (New York, N.Y.) 270, 1203-1207 (1995).

86 Yamamoto, S. & Ma, X. Role of Nod2 in the development of Crohn's disease. Microbes Infect 11, 912-918, doi:10.1016/j.micinf.2009.06.005 (2009).

87 Helms, C. et al. The Tetratricopeptide Repeat Domain 7 Gene Is Mutated in Flaky Skin Mice: A Model for Psoriasis, Autoimmunity, and Anemia.

88 Fiorino, G. & Omodei, P. D. Psoriasis and Inflammatory Bowel Disease: Two Sides of the Same Coin? J Crohns Colitis 9, 697-698, doi:10.1093/ecco-jcc/jjv110 (2015).

89 Parisi, R. et al. Global epidemiology of psoriasis: a systematic review of incidence and prevalence. J Invest Dermatol 133, 377-385, doi:10.1038/jid.2012.339 (2013).

90 Ali, S., Champagne, D. L., Spaink, H. P. & Richardson, M. K. Zebrafish embryos and larvae: a new generation of disease models and drug screens. Birth Defects Res C Embryo Today 93, 115-133, doi:10.1002/bdrc.20206 (2011).

124

91 Ng, A. N. et al. Formation of the digestive system in zebrafish: III. Intestinal epithelium morphogenesis. Dev Biol 286, 114-135, doi:10.1016/j.ydbio.2005.07.013 (2005).

92 Brugman, S. The zebrafish as a model to study intestinal inflammation. Dev Comp Immunol 64, 82-92, doi:10.1016/j.dci.2016.02.020 (2016).

93 Gordon, J. F. R., Buck, S. S. & Jeffrey, I. Gnotobiotic zebrafish reveal evolutionarily conserved responses to the gut microbiota. doi:10.1073/pnas.0400706101 (2004).

94 Trede, N. S., Langenau, D. M., Traver, D., Look, A. T. & Zon, L. I. The use of zebrafish to understand immunity. Immunity 20, 367-379 (2004).

95 Oehlers, S. H. et al. Expression of zebrafish cxcl8 (interleukin-8) and its receptors during development and in response to immune stimulation. Dev Comp Immunol 34, 352-359, doi:10.1016/j.dci.2009.11.007 (2010).

96 Fleming, A., Jankowski, J. & Goldsmith, P. In vivo analysis of gut function and disease changes in a zebrafish larvae model of inflammatory bowel disease: a feasibility study. Inflamm Bowel Dis 16, 1162-1172, doi:10.1002/ibd.21200 (2010).

97 Oehlers, S. H., Flores, M. V., Hall, C. J., Crosier, K. E. & Crosier, P. S. Retinoic acid suppresses intestinal mucus production and exacerbates experimental enterocolitis. Dis Model Mech 5, 457-467, doi:10.1242/dmm.009365 (2012).

98 Halim, D. Congenital Diseases of the Intestine, Erasmus University Medical Center, Netherlands (2016).

99 Sukardi, H., Chng, H. T., Chan, E. C. Y., Gong, Z. & Lam, S. H. Zebrafish for drug toxicity screening: bridging the in vitro cell-based models and in vivo mammalian models. Expert Opin. Drug Metab. Toxicol. 7, 579–589 (2011).

100 MacRae, C. A. & Peterson, R. T. Zebrafish as tools for drug discovery. Nat Rev Drug Discov 14, 721-731, doi:10.1038/nrd4627 (2015).

101 Yin, X. et al. Engineering Stem Cell Organoids. Cell Stem Cell 18, 25-38, doi:10.1016/j.stem.2015.12.005 (2016).

102 Clevers, H. Modeling Development and Disease with Organoids. Cell 165, 1586-1597, doi:10.1016/j.cell.2016.05.082 (2016).

103 Date, S. & Sato, T. Mini-gut organoids: reconstitution of the stem cell niche. Annu Rev Cell Dev Biol 31, 269-289, doi:10.1146/annurev-cellbio-100814-125218 (2015).

104 Peters et al. Single Lgr5 stem cells build crypt–villus structures. Nature 459, 262, doi:doi:10.1038/nature07935 (2009).

105 In, J. G. et al. Human mini-guts: new insights into intestinal physiology and host- pathogen interactions. Nature reviews. Gastroenterology & hepatology 13, 633-642, doi:10.1038/nrgastro.2016.142 (2016).

125

106 Koo, B. K. & Clevers, H. Stem cells marked by the R-spondin receptor LGR5. Gastroenterology 147, 289-302, doi:10.1053/j.gastro.2014.05.007 (2014).

107 Moffat, J. G., Vincent, F., Lee, J. A., Eder, J. & Prunotto, M. Opportunities and challenges in phenotypic drug discovery: an industry perspective. Nat Rev Drug Discov 16, 531-543, doi:10.1038/nrd.2017.111 (2017).

108 Hill, D. R., Huang, S., Tsai, Y.-H., Spence, J. R. & Young, V. B. Real-time Measurement of Epithelial Barrier Permeability in Human Intestinal Organoids. J. Vis. Exp. (2017). doi:10.3791/56960

109 Spence, J. L. L. et al. Persistence and Toxin Production by Clostridium difficile within Human Intestinal Organoids Result in Disruption of Epithelial Paracellular Barrier Function. doi:10.1128/IAI.02561-14 (2015).

110 Warrington, J. W. S., Alex, B., Helen, B. & Brian. Diagnosing the decline in pharmaceutical R&D efficiency. Nature Reviews Drug Discovery 11, 191, doi:doi:10.1038/nrd3681 (2012).

111 Scannell, J. W., Blanckley, A., Boldon, H. & Warrington, B. Diagnosing the decline in pharmaceutical R&D efficiency. Nat. Rev. Drug Discov. 11, 191–200 (2012).

112 Dandapani, S., Rosse, G., Southall, N., Salvino, J. M. & Thomas, C. J. Selecting, Acquiring, and Using Small Molecule Libraries for High-Throughput Screening. Curr Protoc Chem Biol 4, 177-191, doi:10.1002/9780470559277.ch110252 (2012).

113 Hughes, J. P., Rees, S., Kalindjian, S. B. & Philpott, K. L. Principles of early drug discovery. Br J Pharmacol 162, 1239-1249, doi:10.1111/j.1476-5381.2010.01127.x (2011).

114 Zheng, W., Thorne, N. & McKew, J. C. Phenotypic screens as a renewed approach for drug discovery. Drug Discov Today 18, 1067-1073, doi:10.1016/j.drudis.2013.07.001 (2013).

115 Kosinski, P., Sarzynska-Nowacka, U., Fiolna, M. & Wielgos, M. The practical use of acetylsalicylic acid in the era of the ASPRE trial. Update and literature review. Ginekologia polska 89, 107-111, doi:10.5603/GP.a2018.0018 (2018).

116 Vincent, F. et al. Developing predictive assays: the phenotypic screening "rule of 3". Science translational medicine 7, 293ps215, doi:10.1126/scitranslmed.aab1201 (2015).

117 Zhang, J. H., Chung, T. D. & Oldenburg, K. R. A Simple Statistical Parameter for Use in Evaluation and Validation of High Throughput Screening Assays. J Biomol Screen 4, 67- 73, doi:10.1177/108705719900400206 (1999).

118 Lipinski, C. A. Drug-like properties and the causes of poor solubility and poor permeability. Journal of pharmacological and toxicological methods 44, 235-249 (2000).

126

119 FDA Commissioner. The Drug Development Process - Step 3: Clinical Research, https://www.fda.gov/ForPatients/Approvals/Drugs/ucm405622.htm (2018).

120 Tsuyuki, K., Yano, K., Watanabe, N., Aruga, A. & Yamato, M. Compassionate use of drugs and medical devices in the United States, the European Union and Japan. Regenerative Therapy 4, 18-26, doi:https://doi.org/10.1016/j.reth.2015.11.002 (2016).

121 Górski, J. B., Hans-Jörg, E. & Andrzej. Ethics review in compassionate use. BMC Medicine 15, 136, doi:doi:10.1186/s12916-017-0910-9 (2017).

122 Nosengo, N. Can you teach old drugs new tricks? Nature 534, 314-316, doi:10.1038/534314a (2016).

123 Breckenridge, A. & Jacob, R. Overcoming the legal and regulatory barriers to drug repurposing. Nat Rev Drug Discov, doi:10.1038/nrd.2018.92 (2018).

124 Griggs, R. C. et al. Clinical research for rare disease: opportunities, challenges, and solutions. Mol Genet Metab 96, 20-26, doi:10.1016/j.ymgme.2008.10.003 (2009).

125 Klimova, B., Storek, M., Valis, M. & Kuca, K. Global View on Rare Diseases: A Mini Review. Current medicinal chemistry 24, 3153-3158, doi:10.2174/0929867324666170511111803 (2017).

126 Bhattacharya, I., Manukyan, Z., Chan, P., Harnisch, L. & Heatherington, A. Making Every Subject Count: A Case Study of Drug Development Path for Medication in a Pediatric Rare Disease. Clinical pharmacology and therapeutics 100, 330-332, doi:10.1002/cpt.417 (2016).

127 Sun, W., Zheng, W. & Simeonov, A. Drug discovery and development for rare genetic disorders. American journal of medical genetics. Part A 173, 2307-2322, doi:10.1002/ajmg.a.38326 (2017).

128 FDA Commissioner. In Brief - FDA In Brief: FDA recommends new, more efficient approach to drug development for rare pediatric diseases, https://www.fda.gov/newsevents/newsroom/fdainbrief/ucm587862.htm (2018).

129 Varshney, G. K. et al. High-throughput gene targeting and phenotyping in zebrafish using CRISPR/Cas9. Genome Res. 25, 1030–42 (2015).

130 Labun, K., Montague, T. G., Gagnon, J. A., Thyme, S. B. & Valen, E. CHOPCHOP v2: a web tool for the next generation of CRISPR genome engineering. Nucleic acids research 44, W272-276, doi:10.1093/nar/gkw398 (2016).

131 Shi, Y. et al. Acetylcholine serves as a derepressor in Loperamide-induced Opioid- Induced Bowel Dysfunction (OIBD) in zebrafish. Sci Rep 4, 5602, doi:10.1038/srep05602 (2014).

127

132 Essletzbichler, P. et al. Megabase-scale deletion using CRISPR/Cas9 to generate a fully haploid human cell line. Genome Res 24, 2059-2065, doi:10.1101/gr.177220.114 (2014).

133 Chen, G., Hou, Z., Gulbranson, D. R. & Thomson, J. A. Actin-myosin contractility is responsible for the reduced viability of dissociated human embryonic stem cells. Cell Stem Cell 7, 240-248, doi:10.1016/j.stem.2010.06.017 (2010).

134 Subauste, M. C. et al. Rho family proteins modulate rapid apoptosis induced by cytotoxic T lymphocytes and Fas. J. Biol. Chem. 275, 9725–33 (2000).

135 Huot, J. et al. SAPK2/p38-dependent F-Actin Reorganization Regulates Early Membrane Blebbing during Stress-induced Apoptosis. The Journal of Cell Biology 143, 1361-1373, doi:10.1083/jcb.143.5.1361 (1998).

136 Payne, A. M. et al. Caspase activation as a versatile assay platform for detection of cytotoxic bacterial toxins. J Clin Microbiol 51, 2970-2976, doi:10.1128/JCM.01161-13 (2013).

137 Prajapati, D. N. et al. Leflunomide treatment of Crohn's disease patients intolerant to standard immunomodulator therapy. Journal of clinical gastroenterology 37, 125-128 (2003).

138 Holtmann, M. H., Gerts, A. L., Weinman, A., Galle, P. R. & Neurath, M. F. Treatment of Crohn's disease with leflunomide as second-line immunosuppression : a phase 1 open- label trial on efficacy, tolerability and safety. Digestive diseases and sciences 53, 1025- 1032, doi:10.1007/s10620-007-9953-710.1007/s10620-007-9953-7. Epub 2007 Oct 13. (2008).

139 Silverman, E. et al. Leflunomide or methotrexate for juvenile rheumatoid arthritis. The New England journal of medicine 352, 1655-1666, doi:10.1056/NEJMoa041810 (2005).

140 Mortimore, M. & Florin, T. H. A role for B(1)(2) in inflammatory bowel disease patients with suppurative dermatoses? An experience with high dose vitamin B(1)(2) therapy. J Crohns Colitis 4, 466-470, doi:10.1016/j.crohns.2010.02.007 (2010).

141 Tonges, L., Koch, J. C., Bahr, M. & Lingor, P. ROCKing Regeneration: Rho Kinase Inhibition as Molecular Target for Neurorestoration. Front Mol Neurosci 4, 39, doi:10.3389/fnmol.2011.00039 (2011).

142 Bhadriraju, K. et al. Activation of ROCK by RhoA is regulated by cell adhesion, shape, and cytoskeletal tension. Exp. Cell Res. 313, 3616–3623 (2007).

143 Maes, J. et al. Evaluation of 14 Organic Solvents and Carriers for Screening Applications in Zebrafish Embryos and Larvae. PLoS One 7, e43850 (2012).

128

144 Liu, S., Neidhardt, E. A., Grossman, T. H., Ocain, T. & Clardy, J. Structures of human dihydroorotate dehydrogenase in complex with antiproliferative agents. Structure 8, 25- 33 (2000).

145 Breedveld, F. & Dayer, J. Leflunomide: mode of action in the treatment of rheumatoid arthritis. Ann Rheum Dis 59, 841-849, doi:10.1136/ard.59.11.84110.1136/ard.59.11.841. (2000).

146 Rozman, B. Clinical pharmacokinetics of leflunomide. Clinical pharmacokinetics 41, 421-430, doi:10.2165/00003088-200241060-00003 (2002).

147 Autret-Leca, E., Bensouda-Grimaldi, L., Maurage, C. & Jonville-Bera, A. P. Upper gastrointestinal complications associated with NSAIDs in children. Therapie 62, 173- 176, doi:10.2515/therapie:2007032 (2007).

148 Ferrigno, A. et al. Localization and role of metabotropic glutamate receptors subtype 5 in the gastrointestinal tract. World J Gastroenterol 23, 4500-4507, doi:10.3748/wjg.v23.i25.4500 (2017).

149 Smith, C. E. et al. Non-steroidal Anti-inflammatory Drugs Are Caspase Inhibitors. Cell Chem Biol 24, 281-292, doi:10.1016/j.chembiol.2017.02.003 (2017).

150 Leger, D. Y., Liagre, B. & Beneytout, J. L. Low dose leflunomide activates PI3K/Akt signalling in erythroleukemia cells and reduces apoptosis induced by anticancer agents. Apoptosis 11, 1747-1760, doi:10.1007/s10495-006-9439-7 (2006).

151 Leary, A., Auclin, E., Pautier, P. & Lhomme, C. in Ovarian Cancer - A Clinical and Translational Update Ch. Chapter 13, (2013).

152 Manning, B. D. & Toker, A. AKT/PKB Signaling: Navigating the Network. Cell 169, 381-405, doi:10.1016/j.cell.2017.04.001 (2017).

153 Zhang, H. M. et al. Akt kinase activation blocks apoptosis in intestinal epithelial cells by inhibiting caspase-3 after polyamine depletion. J Biol Chem 279, 22539-22547, doi:10.1074/jbc.M314337200 (2004).

154 Abkhezr, M., Keramati, A. R., Ostad, S. N., Davoodi, J. & Ghahremani, M. H. The time course of Akt and ERK activation on XIAP expression in HEK 293 cell line. Mol Biol Rep 37, 2037-2042, doi:10.1007/s11033-009-9658-4 (2010).

155 Jilling, T., Lu, J., Jackson, M. & Caplan, M. S. Intestinal epithelial apoptosis initiates gross bowel necrosis in an experimental rat model of neonatal necrotizing enterocolitis. Pediatr Res 55, 622-629, doi:10.1203/01.PDR.0000113463.70435.74 (2004).

156 Shidham, V. B. et al. Colon biopsies for evaluation of acute graft-versus-host disease (A- GVHD) in allogeneic bone marrow transplant patients. BMC Gastroenterol. 3, 5 (2003).

129

157 Mrowka, C., Thoenes, G. H., Langer, K. H. & Bartlett, R. R. Prevention of the acute graft- versus-host disease (GVHD) in rats by the immunomodulating drug leflunomide. Ann. Hematol. 68, 195–199 (1994).

158 Kilcoyne, A., Kaplan, J. L. & Gee, M. S. Inflammatory bowel disease imaging: Current practice and future directions. World J Gastroenterol 22, 917-932, doi:10.3748/wjg.v22.i3.917 (2016).

159 Thakur, P. C., Davison, J. M., Stuckenholz, C., Lu, L. & Bahary, N. Dysregulated phosphatidylinositol signaling promotes endoplasmic-reticulum-stress-mediated intestinal mucosal injury and inflammation in zebrafish. Dis Model Mech 7, 93-106, doi:10.1242/dmm.012864 (2014).

160 Kim, D. S. et al. The regulatory mechanism of 4-phenylbutyric acid against ER stress- induced autophagy in human gingival fibroblasts. Archives of pharmacal research 35, 1269-1278, doi:10.1007/s12272-012-0718-2 (2012).

130

Appendices

Uncropped western blots. a Caspase blot from Figure 13B b AKT, XIAP, and Caspase blot Figure 22C. c p-AKT T308 and S473 blot from Figure 22B. d p-ERM blot from Figure 22C e TTC7A blot from Figure 9B

The following introductory figures were obtained from the publications below:

Figure 1 adapted and reprinted from:

Special histology- specific points, (2018).

Figure 2 adapted and reprinted from:

Gardlik, A. W. In vivo reprogramming in inflammatory bowel disease. Gene Therapy 20, 1111, doi:doi:10.1038/gt.2013.43 (2013).

Figure 3 adapted and reprinted from:

Coskun, M., Department of Gastroenterology, M. S. H. H. U. o. C. D. & [email protected]. Intestinal Epithelium in Inflammatory Bowel Disease. Frontiers in Medicine 1, doi:10.3389/fmed.2014.00024 (2014).

Tables 1-3 adapted from:

Lien, R. et al. Novel Mutations of the Tetratricopeptide Repeat Domain 7A Gene and Phenotype/Genotype Comparison. Front Immunol 8, 1066, doi:10.3389/fimmu.2017.01066 (2017).

131 132

Figure 4 adapted and reprinted from:

Avitzur, Y. et al. Mutations in tetratricopeptide repeat domain 7A result in a severe form of very early onset inflammatory bowel disease. Gastroenterology 146, 1028-1039, doi:10.1053/j.gastro.2014.01.015 (2014).

Baskin, J. M. et al. The leukodystrophy protein FAM126A (hyccin) regulates PtdIns(4)P synthesis at the plasma membrane. Nat Cell Biol 18, 132-138, doi:10.1038/ncb3271 (2016).

Figure 5 adapted and reprinted from:

Bigorgne, A. E. et al. TTC7A mutations disrupt intestinal epithelial apicobasal polarity. J Clin Invest 124, 328-337, doi:10.1172/JCI71471 (2014).

Figure 6 adapted and reprinted with permission from:

Figure 7 adapted and reprinted with permission from:

Lees, J. A. et al. Architecture of the human PI4KIIIalpha lipid kinase complex. Proc Natl Acad Sci U S A 114, 13720-13725, doi:10.1073/pnas.1718471115 (2017).

Figure 8 adapted and reprinted from:

Ng, A. N. et al. Formation of the digestive system in zebrafish: III. Intestinal epithelium morphogenesis. Dev Biol 286, 114-135, doi:10.1016/j.ydbio.2005.07.013 (2005).