ARTICLE in PRESS YEXCR-06597; No

DTD 5 ARTICLE IN PRESS YEXCR-06597; No. of pages: 12; 4C: 6

Experimental Cell Research xx (2005) xxx–xxx www.elsevier.com/locate/yexcr

NF45/ILF2 tissue expression, promoter analysis, and interleukin-2 transactivating functionB

Guohua Zhao, Lingfang Shi, Daoming Qiu, Hong Hu, Peter N. KaoT

Division of Pulmonary and Critical Care Medicine, Stanford University Medical Center, 300 Pasteur Drive, Stanford, CA 94305-5236, USA

Received 5 May 2004, revised version received 20 December 2004

Abstract

NF45/ILF2 associates with NF90/ILF3 in the nucleus and regulates IL-2 gene transcription at the antigen receptor response element (ARRE)/NF-AT DNA target sequence (P.N. Kao, L. Chen, G. Brock, J. Ng, A.J. Smith, B. Corthe´sy, J. Biol. Chem. 269 (1994) 20691– 20699). NF45 is widely expressed in normal tissues, especially testis, brain, and kidney, with a predominantly nuclear distribution. NF45 mRNA expression is increased in lymphoma and leukemia cell lines. The human and murine NF45 proteins differ only by substitution of valine by isoleucine at amino acid 142. Fluorescence in situ hybridization localized the human NF45 gene to chromosome 1q21.3, and mouse NF45 gene to chromosome 3F1. Promoter analysis of 2.5 kB of the murine NF45 gene reveals that significant activation is conferred by factors, possible including NF-Y, that bind to the CCAAT-box sequence. The function of human NF45 in regulating IL-2 gene expression was characterized in Jurkat T-cells stably transfected with plasmids directing expression of NF45 cDNA in sense or antisense orientations. NF45 sense expression increased IL-2 luciferase reporter gene activity 120-fold, and IL-2 protein expression 2-fold compared to control cells. NF45 is a highly conserved, regulated transcriptional activator, and one target gene is IL-2. D 2005 Elsevier Inc. All rights reserved.

Keywords: Transcriptional activator; RNA-binding protein; Nuclear factor of activated T-cells; Antigen receptor response element

Introduction serve essential roles in development of lymphocytic immunity through their contributions to double-stranded NF45/ILF2 and NF90/ILF3 contribute to RNA gene DNA break repair and antibody and T-cell receptor diversity regulation at the levels of transcription, splicing, export, and [4–8]. The 110-kDa variant of NF90, termed NF110, translation. These proteins were isolated as principal contains a C-terminal RGG domain, and is a target for components of a Jurkat T-cell nuclear DNA-binding arginine methylation by protein arginine methyl transferase complex with affinity for the purine-rich antigen receptor 1 [9]. response element (ARRE)/NF-AT target DNA sequence NF45 and NF90 interact with DNA [1,2,10,11] and RNA in the IL-2 promoter. [1,2]. NF45 and NF90 stabilize [10,12–16]. NF90 contains 2 double-stranded RNA-binding the association between the Ku70, Ku80 lupus antoanti- domains and is thus related to other proteins that regulate gens, and the DNA-dependent protein kinase catalytic transcription (RNA helicase A; [17]), RNA editing (ADAR subunit, DNA-PKcs [3]. Ku70, Ku80, and DNA-PKcs each [18,19]), and translation (PKR [20]), and a zinc-finger nucleic acid binding motif, DZF. NF45 contains an N-terminal arginine- and glycine-rich domain at positions 3–22, and a

B zinc-finger DZF domain homologous to NF90, at positions The nucleotide sequences for the human and murine NF45 genes have 104–338. been deposited in the GenBank database under GenBank Accession Numbers, human (AY099265), and murine (AF458249). NF45 and NF90 contribute to gene regulation at multiple T Corresponding author. Fax: +1 650 725 5489. levels. Transcriptional enhancement and repression have E-mail address: [email protected] (P.N. Kao). both been demonstrated for NF90 and NF110, depending on

2 G. Zhao et al. / Experimental Cell Research xx (2005) xxx–xxx the promoter context [16,21,22]. Cotransfection of NF45 in Experimental methods these studies demonstrated augmented transcriptional activation. Posttranscriptional message stabilization represents RNA and protein expression analysis an important level of regulation, in particular for cytokines such as IL-2 and IL-8. IL-2 mRNA is stabilized in activated Multiple tissue Northern blots (Clontech) were hybri- T-cells through specific interactions between NF90 and AU- dized sequentially with a 32P-labeled human NF45 probe rich sequences in the IL-2 3VUTR [23]. Furthermore, NF90/ (1046 bp of coding sequence), followed by a probe for ILF3 regulated the translocation of IL-2 mRNA from the glyceraldehyde-3-phosphate dehydrogenase (Clontech) for nucleus to the cytoplasm. The regulated export of IL-2 the human blot and for beta-actin (660 bp) for the mouse mRNA involves interactions of NF90/ILF3 with the nuclear blot, according to the manufacturer’s instructions [33]. karophyrin, exportin 5, and Ran GTPase [24]. NF90 and Intensities were quantitated by phosphorimaging (Cyclone, NF45 have also been identified as components of the Packard), and the normalized expression of NF45 was spliceosome [25,26] and NF90 has been demonstrated determined for each tissue. The expression of NF45/ILF2 to contribute to RNA splicing [15]. A role for NF90 and in human tissues and cell lines was also determined using NF45 in regulating translation was implied by the recovery Genechip 3.2 (Affymetrix, Santa Clara), and the results of these proteins in the ribosomal salt wash, as well as are presented with the permission of the corresponding the physical association with the double-stranded RNA- author (http://expression.gnf.org) [34]. For Western blot activated protein kinase, PKR, known to regulate transla- analysis, extracted proteins (40 Ag) were fractionated and tional initiation [13–15]. Furthermore, NF90 and NF45 detected with rabbit anti-NF45 serum which was affinity- copurified with translational elongation initiation factor 2 purified against recombinant NF45 protein using a alpha, beta, and gamma subunits [3]. Specific translational HiTrapk NHS-activated column (Amersham Bioscience) inhibition of acid beta-glucosidase and selected other liver [1]. mRNAs was mediated by translational control protein 80, which is identical to NF90/ILF3 [27]. Immunohistochemistry The highest levels of expression of NF45 and NF90 occur in the testes. NF45/ILF2 was shown to be regulated Normal adult male and female C57Bl/6 mice were by meiosis and to be associated with transcriptionally active sacrificed, and formalin-fixed, paraffin-embedded tissues chromatin [28]. Lopez-Fernandez et al. analyzed testis were sectioned. The sections were deparaffinized, rehy- development and demonstrated expression of NF45/ILF2 drated, and microwaved for 10 min in 0.01 M citrate buffer. and NF90/ILF3 in pachytene spermatocytes that had The endogenous peroxidase was blocked using 3% H2O2 completed meiosis. In adult testis, there was strong nuclear (5 min at RT). The sections were blocked with 5% normal expression of NF45/ILF2, except in the area of the XY donkey serum (Jackson Immunoresearch Lab) for 10 min at bivalent, which is transcriptionally silent. In addition to RT, and then incubated with primary antibody, rabbit anti- potential roles in regulating transcription, NF45 may NF45 antisera, generated, and affinity-purified against associate with RNAs in ribonucleoprotein complexes that recombinant NF45 protein (1:1500 dilution, 30 min at regulate delayed translation of mRNAs [29,30]. 378C). Detection was achieved using Biotin-SP-conjugated NF90 and NF45 represent host cellular factors that can donkey anti-rabbit IgG (1:400 dilution, Jackson Immuno- interact specifically with viral RNAs, including HIV TAR, research) followed by peroxidase-conjugated streptavidin adenovirus VA2, and hepatitis B virus RNA [12,31]. NF45 IgG (1:400 dilution, Jackson) and development with and NF90 bound to hepatitis B virus epsilon RNA and diaminobenzidine (Research Genetics). For a negative facilitated protein priming of the hepatitis B virus polyme- control, the slides were incubated with PBS instead of the rase. Behrens and coworkers demonstrated that binding of primary antibody. NF90 and NF45 to the 5Vand 3Vregions of bovine diarrheal virus RNA (a relative of human hepatitis C) mediated a Genomic sequence analysis of murine and human NF45 circular conformation of the viral genome that contributed to viral replication and translation [32]. A mouse genomic library prepared in bacterial artificial Our aim is to understand the function of NF45 (BAC) chromosome plasmids was screened using a full- in regulating gene expression. Towards this goal, we have length human cDNA for NF45, at Incyte Genomics. characterized the tissue expression and subcellular dis- Subclones of pBleoBAC11 were prepared by restriction tribution of NF45. We compare the genomic structures using HindIII, EcoRI, BamHI, and PstI enzymes, cloned of the murine and human NF45/ILF2 genes, and we into pBluescript II KS+ (Stragene), and positive clones characterize the CCAAT-box DNA sequence in the murine identified by Southern analysis using a human NF45 cDNA NF45 promoter that regulates basal transcription of NF45. were sequenced on both strands using an ABI prism big Functionally, we demonstrate that stable expression of dye terminator kit (Protein and Nucleic Acid Facility, NF45 augments T-cell transcription and expression of Stanford University). The DNA sequences were assembled IL-2. using MacVector and AssemblyLIGN software (Kodak). ARTICLE IN PRESS

G. Zhao et al. / Experimental Cell Research xx (2005) xxx–xxx 3

Human genomic P1 clones selected by hybridization with UTR. The sequences of the oligonucleotides used as PCR the hNF45 cDNA were purchased from Incyte Genomics. primers to amplify the regulatory regions are available on The complete human NF45 genomic sequence was request. determined by assembling DNA sequence information from subclones of clone P1-17080 in pBluescript with Cell culture, transfections, and promoter analyses sequences from PCR amplifications of human genomic DNA using primers based upon the murine intron–exon Murine CRL-2053 cells (murine SV-40 transformed junction sequences and cloned into pCRII (Invitrogen). For spermatogonia cells, ATCC) were maintained in 100-mm genomic PCR, we used Takara LA Taq polymerase (Takara Petri dishes at 378C in Dulbecco’s modified Eagle medium Bio, Inc, Shiga, Japan). with 10% fetal bovine serum. Generally, 3 Â 107 cells at 80–90% confluence were transfected in 4 electroporations Rapid amplification of cDNA Ends (RACE) each using 3 Ag forward or reverse firefly luciferase reporter plasmid together with 1 Ag elongation factor 1 Mouse testis and brain Marathon-Ready cDNA were alpha-Renilla luciferase normalizing plasmid (BTX-600, purchased from Clontech (Palo Alto, CA). The specific pri- 250 V 500 AF in 800 Al plain DMEM media). Cells from mers used for 5VRACE were (1) CATGCCGGATGGCTGC- each electroporation were divided into 6-well plates and TAAGG, (2)TCACTCCTGAGTCTCCATGC, for 3VRACE whole cell extracts were analyzed after 24 h for firefly and (1) TGCCCTGGGGAACAAAGTCG, (2) GGACACGCC- Renilla luciferase activities (Promega Dual Luciferase GGCCAGACGTTTC. AP1 primer from the kit was used for Assay). The specific transcriptional activation for each both 5Vand 3VRACE. PCR products were cloned to TOPATA condition is presented as the firefly luciferase activity divided vector (Invitrogen, Carlsbad, CA) and sequenced. by the Renilla luciferase activity. The data represent the means and standard deviations from at least 3 independent Chromosomal localization by fluorescence in situ experiments. hybridization Human Jurkat T-cells (clone E6-1) were maintained in media RPMI 1640 containing 10% fetal bovine serum Genomic DNA clones containing NF45, P1-17080 and penicillin/streptomycin, and were transfected by (human) or BAC-17025 (mouse) were labeled at Incyte electroporation. Genomics with digoxigenin dUTP by nick translation. Labeled probes (each larger than 100 kB in size) that Establishment of Jurkat T-cell populations that stably contained the wild-type NF45 gene were combined with express NF45 cDNA in sense (NF45F) or antisense sheared human or mouse DNA and hybridized to normal (NF45R) orientations metaphase chromosomes derived from PHA-stimulated human peripheral blood lymphocytes or mouse embryo We generated a eukaryotic expression vector, pEF ires fibroblast cells in a solution containing 50% formamide, neo, in which the elongation factor 1a promoter [35] drives 10% dextran sulfate, and 2 Â SSC. The specific hybrid- bicistronic expression of our gene of interest, followed by ization signal was detected by through the use of anti- an internal ribosomal entry sequence (ires) and the neo- digoxigenin antibody coupled to fluorescein, followed by mycin resistance gene (gift from G. Nolan lab, Stanford nuclear counterstaining with 4V,6-diamidino-2-phenylindole University). Jurkat T-cells were transfected by electro- (DAPI). Initial experiments showed that the labeled human poration [1] either with Control vector pEF ires neo, pEF NF45 genomic probe hybridized specifically to the proximal NF45F ires neo (sense NF45 cDNA), or pEF NF45R ires long arm of a group A chromosome believed to be neo (antisense NF45 cDNA). Jurkat T-cells that stably Chromosome 1, and the labeled murine NF45 genomic express the pEF ires neo constructs were selected using probe hybridized specifically to the middle region of a large G418 (1.5 mg/ml). sized chromosome believed to be Chromosome 3 on the basis of size, morphology, banding pattern. Double-labeling Nuclear extract preparation and electrophoretic mobility experiments were performed next using chromosome- shift assays specific probes together with the NF45 genomic clones to confirm the localization of the NF45 genes. Nuclear extracts of CRL-1053 spermatogonia cells were prepared using ammonium sulfate, as described [1]. Electro- NF45 promoter deletion constructs phoretic mobility shift assays (EMSA) of specific CCAAT- box DNA-binding activity were performed by incubating NF45 promoter deletion luciferase reporter constructs 10 Ag of spermatogonia cell nuclear proteins for 30 min at were generated to analyze regulatory sequences within 2390 258Cin20Al of binding buffer C (25 mM HEPES—pH 7.6, bp of 5V flanking sequence of the murine NF45 gene. All 0.1 mM EDTA, 10% glycerol, 50 mM KCl, 0.05 mM DTT) constructs inserted the firefly luciferase gene at the site of containing 1–2 Ag of poly (dI–dC) and 2.5 pg of 32P-labeled the start ATG codon, and therefore included 90 nt of 5V oligonucleotide probe (approximately 1 Â 105 cpm). The ARTICLE IN PRESS

4 G. Zhao et al. / Experimental Cell Research xx (2005) xxx–xxx wild-type CCAAT-box sequence with an adjacent hepato- neurons (Fig. 3C). The testes showed strong nuclear cyte nuclear factor-1 binding site from the murine NF45 staining of spermatocytes and spermatids, but mature promoter is GCGTTAACCAATAAACGCGCGGGACG- sperm no longer showed NF45 immunoreactivity (Fig. GAGT. The specific mutation analyzed in construct 7F- 3D). Approximately half of liver hepatocytes showed mut/À62 altered only the CCAAT-box to CtAgT. The probe nuclear staining for NF45 (Fig. 3E). In the kidney, there was labeled using Klenow DNA polymerase (New England was strong NF45 expression in the nuclei of tubular Biolabs) and [a-32P] dCTP (Amersham). Protein–DNA epithelial cells, but staining within the glomeruli was complexes were resolved from free probe using 4% limited to the nuclei of mesangial cells (Fig. 3F). In the nondenaturing polyacrylamide gels in 0.5 Â Tris–Borate lung, we observed NF45-staining in the nuclei of half of EDTA (pH 8.3), and visualized by fluorography. Supershift the bronchial epithelial cells (Fig. 3G). The pancreas studies were performed by preincubating nuclear proteins revealed prominent nuclear and cytoplasmic staining with 2 Al of purified polyclonal antibody (CBF-A Santa confined to islet beta cells, and no staining in the exocrine Cruz sc-8986, HNF-1 sc-13045) for 30 min at RT, followed gland (Fig. 3H). Cardiomyocytes showed expression of by addition of probe and poly (dI–dC) and incubation for an NF45 in the nuclei, and moderate reactivity in the additional 30 min before electrophoresis. cytoplasm (Fig. 3I). Skeletal muscles showed no expression of NF45 in the nuclei and moderate cytoplasmic staining Data and statistical analysis (data not shown). Together, these results establish that the predominant site of expression of NF45 is in the nucleus Significance of the differences between the experimental with the greatest tissue expression observed in testes, brain, conditions were determined by paired two-sample Student’s and kidney. t test (Microsoft EXCEL). Genomic structure of human and murine NF45

Results We determined the complete sequences of the human (GenBank AY099265) and murine NF45 genes (GenBank Tissue expression of NF45 RNA and protein AF458249), and each spans 14 exons. The intron–exon boundaries of the human and murine NF45 genes match the NF45 mRNA is present in all human tissues characte- GT-AG rule for splice donor and acceptor sequences (Tables rized by Northern analysis (Fig. 1A). Analysis of NF45/ 1 and 2). At the nucleic acid level, the protein-coding exons ILF2 gene expression in human tissues and cell lines are highly conserved across species (data not shown). The determined using Genechip 2.3 (Affymetrix, Santa Clara amino acid sequences predicted from the human and murine CA) is presented with permission (Fig. 1B). The genechip NF45 cDNAs are identical, with the exception of a single analysis reveals greatest NF45 RNA expression (3-fold conservative substitution of I for V at position 142 of the above median) in lymphoma and leukemia transformed cell murine sequence (Fig. 4). The primary sequence analysis lines. shows the presence of an amino-terminal RGG-rich single- Murine tissues analyzed by Northern hybridization stranded RNA binding domain, and a DZF zinc-finger revealed highest normalized expression of NF45 mRNA nucleic acid binding domain that is shared with NF90/ILF3 in the testes, followed by heart, liver, kidney, and brain (Fig. and other double-stranded RNA-binding proteins involved 2A). Two hybridization bands for NF45 were present at 1.7 in gene regulation (Fig. 4). The NF45 protein sequence also and 2.1 kb. We used RACE (rapid amplification of cDNA reveals a highly acidic C-terminal Lys-C peptide, ends), to amplify two different NF45 cDNAs from murine KEGEEEEENTEEPPQGEEEESMETQE (Fig. 4). We con- brain mRNA, of sizes 1657 and 2064 bp. Sequence analysis firmed the presence of this C-terminal Lys-C peptide in revealed that these alternative NF45 transcripts differed only recombinant NF45 protein by HPLC purification, mass- in the length of their 3VUTRs. spectroscopy, and N-terminal sequence analysis (data not We analyzed NF45 protein expression by Western shown). immunoblotting using NF45 affinity-purified antisera, and demonstrated greatest NF45 protein expression in testes, Chromosomal localization of human and murine NF45 kidney, and brain. A single immunoreactive band with an genes apparent molecular weight of 45 kDa was present in these tissue extracts (Fig. 2B). Fluorescence in situ hybridization (FISH) performed at We used the NF45 affinity-purified antisera for immu- Genome Systems localized the human NF45 gene (P1 nohistochemical localization of NF45 in murine tissues clone 17080, human) to Chromosome 1q21.3 (Fig. 5A), (Fig. 3). In the brain, NF45 was present in the nuclei of and this is consistent with a prior localization of the NF45 hippocampal neurons (Fig. 3A), in the nuclei and cyto- gene to chromosome 1 [36]. The murine genomic NF45 plasm of cortical neurons (Fig. 3B), and in the nuclei and clone (BAC clone 17025) was located by FISH at cytoplasm of cerebellar Purkinje cells but not in granular Chromosome 3F.1 (Fig. 5B) [37]. The mouse–human ARTICLE IN PRESS

G. Zhao et al. / Experimental Cell Research xx (2005) xxx–xxx 5

Fig. 1. NF45 RNA expression in human tissues and cell lines. (A) Northern analysis of multiple human tissues. The relative expression of NF45/GAPDH is shown below each tissue hybridization. (B) Expression of NF45/ILF2 in multiple human tissues and cell lines determined using Genechip 3.2 (Affymetrix). Further description of the human samples is available at http://expression.gnf.org/human_annot.html.

homology maps demonstrate that these regions show using the program MAT inspector (http://www.genomatix. conserved synteny. Our analysis of the human genome de; Genomatix, Muchen, Germany). The 5Vflanking region sequence revealed the presence of two NF45/ILF2 pseu- lacks a proximal TATA box but contains a well-conserved dogenes, lacking introns, present on present on Chromo- cellular and viral CCAAT-box sequence at position À54 nt some 3 (greater than 88% identity) and Chromosome 14 from the transcription start site (Fig. 6A). We generated a set (greater than 86% identity). These pseudogenes were not of nested NF45 promoter deletion constructs coupled to detected by FISH because the 100-kB genomic probe that firefly luciferase reporter gene, and used these to analyze the contains the wild-type NF45 gene has flanking sequences function of 2.4 kB of regulatory sequences upstream of the unique to Chromosome 1. transcription start site (Fig. 6B). The firefly luciferase gene is inserted in place of the start ATG of NF45, and thus every Promoter analysis of murine NF45 gene construct contains 90 nt of 5V UTR. We chose murine spermatogonia cells for this analysis because the highest We analyzed the murine NF45 genomic 5V flanking basal expression of NF45 mRNA and protein is in the testes sequence for regulatory transcription factor binding sites (Figs. 2, 3D). The NF45 promoter-luciferase reporters were ARTICLE IN PRESS

6 G. Zhao et al. / Experimental Cell Research xx (2005) xxx–xxx

transiently transfected into murine spermatogonia cells, together with a normalizing gene in which the elongation factor 1-alpha promoter directed expression of Renilla luciferase (Fig. 6C). The result that 7F/À62 has much greater transcriptional activation than 8F/+4 (23-fold increase in transcriptional activation over empty vector) indicates that a potent transcriptional activator acts within this region (Figs. 6A, C). The presence of additional upstream sequences through 3F/À1238 showed no significant differences in transcriptional activation compared to 7F/À62, although longer constructs through 1F/À2390 showed a trend towards transcriptional repression. In reverse orientation, the promoter constructs showed less than 10– 20% the activity observed in forward orientation (data not shown). The most likely transcription factor binding site within 7F/À62 is the CCAAT-box sequence present at À54 nt (Fig. 6A). To confirm the importance of this CCAAT-box sequence in basal NF45 transcription in spermatogonia cells, we tested that activity of a mutant 7F-mut/À62 reporter in which the core CCAAT sequence is changed to Fig. 2. NF45 RNA and protein expression in murine tissues. (A) Northern CtAgT. Mutation of the CCAAT-box served to decrease analysis of multiple murine tissues. The relative expression of NF45/beta- transcriptional activation more than 4-fold (Figs. 6B, C, 7F- actin is shown below each tissue hybridization. (B) Western immunoblot of mut/À62 vs. 7F/À62). These functional and mutational NF45 protein expression. results strongly implicate the CCAAT-box sequence in

Fig. 3. NF45 protein expression in murine tissue sections. Affinity-purified anti-NF45 sera was used to characterize tissue expression and subcellular localization. NF45 was present in the nuclei of hippocampal neurons (A), in the nucleus and cytoplasm of cortical neurons (B), and in the nucleus and cytoplasm of cerebellar Purkinje cells but not in granular neurons (C). Testes showed strong NF45 nuclear staining of spermatocytes and spermatids, but mature sperm were negative (D). Approximately half of liver hepatocytes showed nuclear staining for NF45 (E). The kidney showed strong NF45 immunoreactivity in the nucleus of tubular epithelial cells, but staining within the glomeruli was limited to the nucleus of mesangial cells (F). The lung showed NF45-staining in the nucleus of half of the bronchial epithelial cells (G). The pancreas revealed prominent nuclear and cytoplasmic staining confined to islet beta cells, and no staining in the exocrine gland (H). Cardiomyocytes showed expression of NF45 in the nucleus, and faint reactivity in the cytoplasm (I). ARTICLE IN PRESS

G. Zhao et al. / Experimental Cell Research xx (2005) xxx–xxx 7

Table 1 Intron/exon boundary sequences of hNF45 Exon Nucleotide Amino acid 5V-Splice donor 3V-Splice acceptor 1 1–45 1–22 GGCACG ...... CATGAGgtaagt 2 730–789 23–222 ttctagGGGTGA ...... AGGAGGgtgagt 3 1082–1124 223–36 ttttagGTTCAG ...... TATTTGgtgagt 4 2405–2509 37–71 gtttagTGTGAA ...... GAACAGgtatgt 5 2885–2962 72–97 tttcagGCATCT ...... GAAGTGgtgagt 6 3306–3408 98–1321 aactagCAAATT ...... CAACGTgtgagt 7 5238–5303 1322–1541 aattagTGGAAG ...... CTGAAGgtttgc 8 5629–5746 1542–193 tttcagTTTTAA ...... TTGTTAgttctt 9 6492–6570 194–2201 ttttagTGGATA ...... GTCCACgtgagt 10 6836–6923 2202–249 tttcagAGTTAA ...... CTACTAgtaagt 11 7686–7747 250–2702 tttcagGGCCAT ...... ATACAGgtacag 12 7829–7943 2703–309 ttctagGCGCTG ...... CAGCAGgtattg 13 8167–8257 310–3381 cttcagGACATG ...... CCAGCTgtgagt 14 8406–8924 3382–390 gcctagATCTTG ...... CTAGTA Numerical superscripts indicate where exons begin or end with the second or third base of a codon. Coding sequence is in uppercase and intron sequence in lowercase, with consensus splice motifs in bold. Translation initiation is at nucleotide 41. The open reading frame ends at nucleotide 8564. regulation of basal transcription of the murine NF45 HNF-1 antisera caused no supershift at all (Fig. 6D, lane 5 promoter. vs. 1). As only a portion of the CCAAT-binding complex In order to determine which transcription factors bind to supershifted with the CBF-A/NF-Y antisera, we infer that the CCAAT-box sequence in the proximal NF45 promoter, other nuclear proteins in spermatogonia cells also contrib- we performed electrophoretic mobility shift assays using ute to the specific NF45 CCAAT-box DNA-binding spermatogonia cell nuclear extracts and a specifically activity. labeled DNA probe that contains the CCAAT-box sequence and the adjacent hepatocyte nuclear factor-1 Functional analysis of NF45 regulation of IL-2 gene binding site (Figs. 6A, D). We demonstrated specific expression CCAAT-box DNA-binding activity that is completely inhibited by competition with a wild-type unlabeled We originally identified NF45 as a potential regulator of oligonucleotide, but not by a mutant oligonucleotide that IL-2 gene expression [1], and therefore we characterized the changes the core binding sequence from CCAAT to effects of stable expression of NF45 sense and antisense CtAgT (Fig. 6D, lanes 2, 3 vs. 1). We next tested specific coding cDNAs on Jurkat T-cell regulation of IL-2 tran- antisera directed against potential CCAAT-box binding scription and endogenous IL-2 gene expression. Previously, proteins CBF-A/NF-Y or HNF-1a for their ability to we demonstrated autoregulation of NF45 and NF90 supershift the specific complex. The CBF-A/NF-Y antisera expression in Jurkat T-cells transiently transfected with caused a partial supershift (Fig. 6D lane 4 vs. 1), while the histidine-tagged expression plasmids for NF45 and NF90

Table 2 Intron/exon boundary sequences of mNF45 Exon Nucleotide Amino acid 5V-Splice donor 3V-Splice acceptor 1 7339–7433 1–22 ttgttgGGACAC ...... CATGAGgtaagt 2 8193–8252 23–222 ttttagGGGTGA ...... TGGAGGgtgagt 3 8508–8550 223–36 tttcagGTTCAG ...... TATTTGgtgagt 4 11,792–11,896 37–71 ttctagTGTGAA ...... GAGCAGgtatg 5 12,181–12,258 72–97 tttcagGCTTCC ...... GAAGTGgtgagt 6 12,552–12,654 98–1321 caacagCAAATT ...... CAACATgtaagt 7 13,965–14,030 1322–1541 ttctagTGGAAG ...... CAGAAGgtttga 8 15,639–15,755 1542–1931 ttttagTTTTGA ...... TCCATTgtaagt 9 16,875–16,953 1932–2192 tttcagTGGACA ...... GTCCACgtgagt 10 17,370–17,457 2193–248 attcagAGTTAA ...... CTACTTgtaagt 11 18,036–18,097 249–2692 ttccagGGGCAC ...... TTACAGgtataa 12 18,168–18,282 2693–307 tttcagGCGCTG ...... CAACAGgtatta 13 18,412–18,502 308–3381 cttcagGATATG ...... CCAGCTgtaagt 14 18,643–19,563 3382–390 ttctagATCTTG ...... AAATAA Numerical superscripts indicate where exons begin or end with the second or third base of a codon. Coding sequence is in uppercase and intron sequence in lowercase, with consensus splice motifs in bold. Translation initiation is at nucleotide 7429. The open reading frame ends at nucleotide 18800. ARTICLE IN PRESS

8 G. Zhao et al. / Experimental Cell Research xx (2005) xxx–xxx

Fig. 4. NF45 protein sequence. Predicted amino acid sequence of human NF45. The murine NF45 sequence is identical except for substitution of I for V at amino acid 142 (marked by *). Underlines indicate the RGG-rich RNA binding motif (amino acids 2–22), and the DZF zinc-finger nucleic acid binding domain that is homologous to NF90/ILF3 (amino acids 104–338).

[1]. Here, we show that transgenic Jurkat T-cells that We used the transgenic Jurkat T-cells that stably express express NF45 cDNA in reverse or forward orientations NF45 cDNA in forward (NF45F) or reverse orientations show modest decreases or increases in the level of cellular (NF45R), and to study IL-2 promoter regulation (Figs. 7B, NF45 protein compared to Control cells transfected with C) and endogenous IL-2 gene expression (Figs. 7D, E). We empty vector (Fig. 7A). compared transcriptional regulation of the IL-2 promoter in the NF45F, NF45R ,and Control T-cells, and present the results on a semilog plot to accommodate the wide dynamic range of the results (Figs. 7B, C). The unstimulated NF45F T-cells showed a 90-fold increase in the IL-2 reporter activity compared to Control cells (Fig. 7B, row 2 vs. 1). The stimulated NF45F cells showed activation to 28,393-fold above the level in resting Control cells, and this represented 123-fold greater activation than in stimulated Control cells (Fig. 7B, row 5 vs. 4). Similarly, the NF45F cells showed activation of the 3xARRE/NF-AT reporter to 23,418-fold the level in resting Control cells, and this represented a 114-fold greater activation than in stimulated Control cells (Fig. 7C, row 5 vs. 4). These substantial transactivations were specific for the 3xARRE/NF-AT and IL-2-luciferase reporters, as we observed no significant changes in the raw expression of the EF-1a Renilla luciferase reporter between nonstimulated and stimulated Control, NF45F, or NF45R cells. The NF45R cells showed decreases in the activation of the IL- 2-and 3xARRE/NF-AT luciferase reporters, compared to NF45F and Control cells (Fig. 7A, B, rows 6 vs. 5, 4). We have observed similar specific increases in IL-2-and NF-AT/ ARRE-luciferase reporter gene activation in three separately generated transgenic T-cell lines (data not shown). Taken together, these results support a role for NF45 in inducing Fig. 5. FISH double-labeling experiments localize human NF45 at specific, regulated transcriptional activation of the IL-2 Chromosome 1q21 and murine NF45 at Chromosome 3F1. (A) Double- promoter, acting through the ARRE/NF-AT DNA sequence. labeling performed with a probe specific for band 1q44 demonstrated that We next compared expression of the endogenous IL-2 human clone P1-17080 is located at the position immediately adjacent to the heterochromatic–euchromatic boundary on the long arm of chromo- gene, and showed that stimulated NF45F cells produced some 1q21. White arrow NF45 genomic probe, red arrow human Ch. 1 significantly more IL-2 protein and mRNA than Control or specific probe. (B) Double-labeling performed with a probe specific for the NF45R cells (Figs. 6D, E). However, the approximately 2- centromeric region of mouse chromosome 3 demonstrated that murine fold increase in IL-2 mRNA and protein expression that we clone BAC-17025 is located at a position which is 49% of the distance from observed in the NF45F cells is substantially lower than the the heterochromatic–euchromatic boundary to the telomere of chromosome 3F1. White arrow NF45 genomic probe, red arrow murine Ch. 3 specific transcriptional enhancement of the IL-2 reporter gene of probe. (For interpretation of the references to colour in this figure legend, approximately 120-fold. These results demonstrate a role for the reader is referred to the web version of this article.) NF45 in transactivating the IL-2 promoter and regulating ARTICLE IN PRESS

G. Zhao et al. / Experimental Cell Research xx (2005) xxx–xxx 9

Fig. 6. Murine NF45 promoter is regulated by a specific CCAAT-box transcription factor. (A) Predicted transcription factor binding sites (using MAT inspector) in the 5Vflanking region of the murine NF45 gene. The transcription start site is identified as +1, and the translation start ATG codon is shown. (B) Schematic of the NF45 promoter deletion constructs. (C) Activity of NF45 promoter deletion constructs transiently transfected in CRL-2053 murine spermatogonia cells, together with normalized EF-1a Renilla luciferase. (D) Specific DNA-binding activity in CRL-2053 spermatogonia cells involves CCAAT-box binding factor (CBF-A), NF-Y. endogenous IL-2 gene expression in T-cells, but underscore upregulation of NF45 expression may contribute to the the need for further investigations. transformed malignant phenotype, especially in leukemias and lymphomas. NF45 is expressed predominantly in the nucleus of cells Discussion in diverse murine tissues. NF45/ILF2 was shown to be associated with transcriptionally active chromatin [28]. The NF45 is widely expressed in human and murine tissues. presence of a highly acidic C-terminal domain in NF45, The ubiquitous expression of NF45 is consistent with a combined with the association of NF45/ILF2 with other postulated role in gene regulation at the levels of tran- nuclear proteins known to interact with nucleic acids, scription and RNA splicing [15,25,26]. The gene array suggests a role for nuclear NF45 as a transcriptional analysis revealed increased expression of NF45 in trans- activator [1,2,10,12–16,38]. formed lymphoma, leukemia, and hepatocellular carci- We determined the complete genomic structures of the noma cell lines. These results suggest that aberrant human and murine NF45 genes. The high level of ARTICLE IN PRESS

10 G. Zhao et al. / Experimental Cell Research xx (2005) xxx–xxx conservation at the nucleotide level throughout each of the and 14. Expression of a pseudogene was recently demon- 14 exons, and the complete conservation at the amino acid strated to regulate the mRNA-stability of the homologous level with the exception of a single conservative substitu- coding gene, and bolsters the functional significance of tion, suggest an important role for NF45. Fluorescent in situ noncoding RNAs in regulating gene expression [39]. hybridization localized the human NF45/ILF2 gene to Further investigations that involve targeted disruption of Chromosome 1q21 and the murine NF45/ILF2 gene to the murine NF45 gene will address the question of whether Chromosome 3F1. The chromosomal regions surrounding NF45 is an essential gene. NF45/ILF2 demonstrate conserved human–murine synteny. Our analysis of the murine NF45 promoter revealed a We discovered the presence of two pseudogenes (lacking critical CCAAT-box at À54 bp from the transcription start introns) of NF45 in the human genome, on Chromosomes 3 site that confers significant transcriptional activation on a heterologous luciferase reporter gene transfected into murine spermagonia cells. When we mutated two bases in the CCAAT-box to CtAgT, we abolished specific DNA binding activity, and substantially diminished CCAAT-box reporter gene activity. Numerous nuclear proteins are capable of binding to and regulating CCAAT-box transcription, and our EMSA-supershift results indicate that the CCAAT-box binding factor, CBF subunit alpha, also known as Nuclear Factor Y (NF-Y), contributes partially to DNA binding at the NF45 promoter. By EMSA-supershift assays, we found no evidence for binding of the alternate CCAAT- box DNA-binding factor, hepatocyte nuclear factor 1. NF-Y has recently been demonstrated to cooperate with Upstream Binding Factors 1 and 2 in the regulation of homeobox gene B4 and hematopoiesis [40]. Our functional analysis of NF45 focused on the regulation of IL-2 gene expression in Jurkat T-cells because this system is extensively studied biochemically [23].We show that transgenic Jurkat/NF45F T-cells that stably overexpress NF45 sense cDNA demonstrated a 120-fold specific increase in IL-2 promoter-and NF-AT/ARRE- luciferase activity following T-cell activation. Appropriate regulation of IL-2 promoter and gene expression by T-cell activation signals was preserved in the transgenic Jurkat T- cells. Although we demonstrated 120-fold enhancement of IL-2 reporter gene activation in the transgenic NF45F cells, we observed an enhancement of endogenous IL-2 gene expression of 2-fold in the NF45F versus the Control cells. One important potential explanation for this discrepancy is

Fig. 7. Stable expression of NF45 sense cDNA in Jurkat T-cells enhances IL-2 transcriptional activation and gene expression. (A) Cellular expression of NF45 protein in whole cell extracts of Control, NF45F, and NF45F transgenic Jurkat T-cells by Western immunoblotting. (B) Semilog plot of IL-2 luciferase activation in Control, NF45F, and NF45R. (C) Semilog plot of purine-box/NF-AT-luciferase activation in Control, NF45F, and NF45R Jurkat T-cells. Jurkat T-cells. The data represent the means F standard deviations from 4 independent experiments. Statistically significant differences in luciferase activities in NF45F and NF45R compared to Control Jurkat T-cells are indicated (*P b 0.05, **P b 0.005). (D) IL-2 protein secretion by Control, NF45F, and NF45R Jurkat T-cells. (E) Northern analysis of IL-2 mRNA expression by Control, NF45F, and NF45R T-cells. Control, NF45F, and NF45R Jurkat T-cells were either nonstimulated (NS) or stimulated for 6 h, then cell supernatants were assayed for secreted IL-2 by ELISA, and total cellular RNA was analyzed for IL-2 mRNA expression by Northern hybridization [33]. The measurements of secreted IL-2 are the means F standard deviations from 4 independent experiments; statistically significant differences in IL-2 secretion in NF45F and NF45R compared to Control Jurkat T-cells are shown (TP b 0.05). ARTICLE IN PRESS

G. Zhao et al. / Experimental Cell Research xx (2005) xxx–xxx 11 that transiently-transfected luciferase reporter genes are Acknowledgments episomal and therefore cannot report on the conformational changes in chromatin structure at the endogenous IL-2 gene This work was supported by NIH grants R01-AI39624 locus during T-cell activation [41]. Thus, while an increase and R01-HL62588 to PNK. G.Z. was the recipient of the in NF45/ILF2 protein potently enhanced transcriptional Ho-Ho-Li Fellowship and a Dean’s Postdoctoral Fellowship activation of an episomal IL-2 luciferase reporter construct, from Stanford University. it may be insufficient to alter chromatin conformation and enhance expression of the endogenous IL-2 gene. Another References potential explanation is that IL-2 gene expression is regulated at multiple levels beyond transcriptional activa- [1] P.N. Kao, L. Chen, G. Brock, J. Ng, J. Kenny, A.J. Smith, B. tion, such as posttranscriptional IL-2 mRNA stability and Corthesy, Cloning and expression of cyclosporin A- and FK506- nuclear to cytoplasmic RNA export, through interactions sensitive nuclear factor of activated T-cells: NF45 and NF90, J. Biol. with the partner of NF45, NF90/ILF3 [23]. Posttranscrip- Chem. 269 (1994) 20691–20699. [2] B. Corthesy, P.N. Kao, Purification by DNA affinity chromatography tional regulation of IL-2 gene expression may diminish the of two polypeptides that contact the NF-AT DNA binding site in the effects of transcriptional enhancement in the NF45F trans- interleukin 2 promoter, J. Biol. Chem. 269 (1994) 20682–20690. genic cells. We propose that our results establish that NF45 [3] N.S.Y. Ting, P.N. Kao, D.W. Chan, L.G. Lintott, S.P. Lees-Miller, contributes to selective and potent transcriptional activation DNA-dependent protein kinase interacts with antigen receptor of the IL-2 promoter, and suggest that NF45 contributes to response element binding proteins NF90 and NF45, J. Biol. Chem. 273 (1998) 2136–2145. regulation of the endogenous IL-2 gene. [4] S.P. Lees-Miller, The DNA-dependent protein kinase, DNA-PK: 10 Reichman et al. demonstrated that NF90 and NF45 years and no ends in sight, Biochem. Cell Biol. 74 (1996) 503–512. expression constructs conferred gene-specific transcriptional [5] A. Nussenzweig, C. Chen, V. da Costa Soares, M. Sanchez, K. Sokol, activation and repression in transiently transfected human M.C. Nussenzweig, G.C. Li, Requirement for Ku80 in growth and 293-T kidney cells. NF90 conferred 3-fold specific tran- immunoglobulin V(D)J recombination, Nature 382 (1996) 551–555. [6] C. Jhappan, H.r. Morse, R.D. Fleischmann, M.M. Gottesman, G. scriptional activation upon a CMV promoter driving Merlino, DNA-PKcs: a T-cell tumour suppressor encoded at the expression of Renilla luciferase, and this was enhanced mouse scid locus, Nat. Genet. 17 (1997) 483–486. another 2-fold by cotransfection with NF45 [16]. Differences [7] C. Zhu, M.A. Bogue, D.S. Lim, P. Hasty, D.B. Roth, Ku86-deficient between Reichman’s and our work are in the reporter genes mice exhibit severe combined immunodeficiency and defective (CMV vs. IL-2 promoter), the cell types (293 vs. Jurkat), the processing of V(D)J recombination intermediates, Cell 86 (1996) 379–389. transfections of the NF45 expression vectors (transient vs. [8] Y. Gu, K.J. Seidl, G.A. Rathbun, C. Zhu, J.P. Manis, N. van der Stoep, stable transfections), and in our use of PMA + ionomycin L. Davidson, H.L. Cheng, J.M. Sekiguchi, K. Frank, P. Stanhope- stimulation to activate gene expression in Jurkat T-cells. Baker, M.S. Schlissel, D.B. Roth, F.W. Alt, Growth retardation and Taken together, these differences in experimental method- leaky SCID phenotype of Ku70-deficient mice, Immunity 7 (1997) ology may account for the 120-fold induction of IL-2 653–665. [9] J. Tang, P.N. Kao, H.R. Herschman, Protein-arginine methyltransfer- luciferase that we demonstrated in NF45F versus Control ase I, the predominant protein-arginine methyltransferase in cells, cells compared to the approximately 3- to 6-fold induction of interacts with and is regulated by interleukin enhancer-binding factor CMV-luciferase described by Reichman et al. Our results 3, J. Biol. Chem. 275 (2000) 19866–19876. establish an important function for NF45 as a potent [10] M. Satoh, V.M. Shaheen, P.N. Kao, T. Okano, M. Shaw, H. Yoshida, transcriptional activator (N100-fold specific activation) of H.B. Richards, W.H. Reeves, Autoantibodies define a family of proteins with conserved double-stranded RNA-binding domains as the IL-2 promoter acting through ARRE/NF-AT target well as DNA binding activity [In Process Citation], J. Biol. Chem. 274 sequences in activated T-cells. (1999) 34598–34604. What other genes are regulated by NF45/ILF2 and NF90/ [11] J. Brzostowski, C. Robinson, R. Orford, S. Elgar, G. Scarlett, T. ILF3? Are target genes, such as IL-2, regulated at multiple Peterkin, M. Malartre, G. Kneale, M. Wormington, M. Guille, RNA- levels by NF45 and NF90, such as transcription, RNA dependent cytoplasmic anchoring of a transcription factor subunit during Xenopus development, EMBO J. 19 (2000) 3683–3693. splicing, export or stability, and translation? Maniatis and [12] H.J. Liao, R. Kobayashi, M.B. Mathews, Activities of adenovirus Reed describe the existence of gene expression factories in virus-associated RNAs: purification and characterization of RNA which there is extensive coupling between transcription, binding proteins, Proc. Natl. Acad. Sci. U. S. A. 95 (1998) pre-mRNA splicing, and mRNA export [42]. Several 8514–8519. transcriptional coactivators capable of interacting with both [13] J.O. Langland, P.N. Kao, B.L. Jacobs, Nuclear factor-90 of activated T-cells: a double-stranded RNA-binding protein and substrate for the DNA and RNA have been shown to couple transcriptional double-stranded RNA-dependent protein kinase, PKR, Biochemistry elongation to RNA splicing [42]. NF45 and NF90, shown to 38 (1999) 6361–6368. regulate transcription (this work and [16]), and to contribute [14] R.C. Patel, D.J. Vestal, Z. Xu, S. Bandyopadhyay, W. Guo, S.M. to RNA splicing [15,25], likely represent new examples of Erme, B.R. Williams, G.C. Sen, DRBP76, a double-stranded RNA- highly coupled gene expression regulators. Further studies, binding nuclear protein, is phosphorylated by the interferon-induced protein kinase, PKR, J. Biol. Chem. 274 (1999) 20432–20437. including targeted disruptions of the NF45 and NF90 genes, [15] L.R. Saunders, D.J. Perkins, S. Balachandran, R. Michaels, R. Ford, will help to elucidate the multifaceted contributions of these A. Mayeda, G.N. Barber, Characterization of two evolutionarily proteins to gene regulation. conserved, alternatively spliced nuclear phosphoproteins, NFAR-1 ARTICLE IN PRESS

12 G. Zhao et al. / Experimental Cell Research xx (2005) xxx–xxx

and -2, that function in mRNA processing and interact with the [29] D. Curtis, R. Lehmann, P.D. Zamore, Translational regulation in double-stranded RNA-dependent protein kinase, PKR, J. Biol. Chem. development, Cell 81 (1995) 171–178. 276 (2001) 32300–32312. [30] F. Meric, A.M. Searfoss, M. Wormington, A.P. Wolffe, Masking and [16] T.W. Reichman, L.C. Muniz, M.B. Mathews, The RNA binding unmasking maternal mRNA. The role of polyadenylation, tran- protein nuclear factor 90 functions as both a positive and negative scription, splicing, and nuclear history, J. Biol. Chem. 271 (1996) regulator of gene expression in mammalian cells, Mol. Cell. Biol. 22 30804–30810. (2002) 343–356. [31] H.J. Shin, S.S. Kim, Y.H. Cho, S.G. Lee, H.M. Rho, Host cell proteins [17] C.G. Lee, V. da Costa Soares, C. Newberger, K. Manova, E. Lacy, J. binding to the encapsidation signal epsilon in hepatitis B virus RNA, Hurwitz, RNA helicase A is essential for normal gastrulation, Proc. Arch. Virol. 147 (2002) 471–491. Natl. Acad. Sci. U. S. A. 95 (1998) 13709–13713. [32] O. Isken, C.W. Grassmann, R.T. Sarisky, M. Kann, S. Zhang, F. [18] Q. Wang, M. Miyakoda, W. Yang, J. Khillan, D.L. Stachura, M.J. Grosse, P.N. Kao, S.E. Behrens, Members of the NF90/NFAR protein Weiss, K. Nishikura, Stress-induced apoptosis associated with null group are involved in the life cycle of a positive-strand RNA virus, mutation of ADAR1 RNA editing deaminase gene, J. Biol. Chem. 279 EMBO J. 22 (2003) 5655–5665. (2004) 4952–4961. [33] Y. Aoki, D. Qiu, A. Uyei, P.N. Kao, Human airway epithelial [19] M. Higuchi, S. Maas, F.N. Single, J. Hartner, A. Rozov, N. Burnashev, cells express interleukin-2 in vitro, Am. J. Physiol. 272 (1997) D. Feldmeyer, R. Sprengel, P.H. Seeburg, Point mutation in an AMPA L272–L284. receptor gene rescues lethality in mice deficient in the RNA-editing [34] A.I. Su, M.P. Cooke, K.A. Ching, Y. Hakak, J.R. Walker, T. Wiltshire, enzyme ADAR2, Nature 406 (2000) 78–81. A.P. Orth, R.G. Vega, L.M. Sapinoso, A. Moqrich, A. Patapoutian, [20] D. Baltzis, S. Li, A.E. Koromilas, Functional characterization of pkr G.M. Hampton, P.G. Schultz, J.B. Hogenesch, Large-scale analysis of gene products expressed in cells from mice with a targeted deletion of the human and mouse transcriptomes, Proc. Natl. Acad. Sci. U. S. A. the N terminus or C terminus domain of PKR, J. Biol. Chem. 277 99 (2002) 4465–4470. (2002) 38364–38372. [35] T. Uetsuki, A. Naito, S. Nagata, Y. Kaziro, Isolation and character- [21] T.W. Reichman, M.B. Mathews, RNA binding and intramolecular ization of the human chromosomal gene for polypeptide chain interactions modulate the regulation of gene expression by nuclear elongation factor-1 alpha, J. Biol. Chem. 264 (1989) 5791–5798. factor 110, RNA 9 (2003) 543–554. [36] P. Marcoulatos, G. Koussidis, Z. Mamuris, V. Velissariou, N.C. [22] T.W. Reichman, A.M. Parrott, I. Fierro-Monti, D.J. Caron, P.N. Kao, Vamvakopoulos, Mapping interleukin enhancer binding factor 2 gene C.G. Lee, H. Li, M.B. Mathews, Selective regulation of gene (ILF2) to human chromosome 1 (1q11–qter and 1p11–p12) by expression by nuclear factor 110, a member of the NF90 family of polymerase chain reaction amplification of human–rodent somatic double-stranded RNA-binding proteins, J. Mol. Biol. 332 (2003) cell hybrid DNA templates, J. Interferon Cytokine Res. 16 (1996) 85–98. 1035–1038. [23] J. Shim, H. Lim, J.R. Yates, M. Karin, Nuclear export of NF90 is [37] P.M. Kroisel, P.A. Ioannou, P.J. de Jong, PCR probes for chromosome required for interleukin-2 mRNA stabilization, Mol. Cell 10 (2002) in situ hybridization of large-insert bacterial recombinants, Cytogenet. 1331–1344. Cell Genet. 65 (1994) 97–100. [24] C. Gwizdek, B. Ossareh-Nazari, A.M. Brownawell, A. Doglio, E. [38] Y. Aoki, G. Zhao, D. Qiu, L. Shi, P.N. Kao, CsA-sensitive purine-box Bertrand, I.G. Macara, C. Dargemont, Exportin-5 mediates nuclear transcriptional regulator in bronchial epithelial cells contains NF45, export of minihelix-containing RNAs, J. Biol. Chem. 278 (2003) NF90, and Ku, Am. J. Physiol. 275 (1998) L1164–L1172. 5505–5508. [39] S. Hirotsune, N. Yoshida, A. Chen, L. Garrett, F. Sugiyama, S. [25] Z. Zhou, L.J. Licklider, S.P. Gygi, R. Reed, Comprehensive proteomic Takahashi, K. Yagami, A. Wynshaw-Boris, A. Yoshiki, An expressed analysis of the human spliceosome, Nature 419 (2002) 182–185. pseudogene regulates the messenger-RNA stability of its homologous [26] A. Scherl, Y. Coute, C. Deon, A. Calle, K. Kindbeiter, J.C. Sanchez, coding gene, Nature 423 (2003) 91–96. A. Greco, D. Hochstrasser, J.J. Diaz, Functional proteomic analysis of [40] J. Zhu, D.M. Giannola, Y. Zhang, A.J. Rivera, S.G. Emerson, NF-Y human nucleolus, Mol. Biol. Cell 13 (2002) 4100–4109. cooperates with USF1/2 to induce the hematopoietic expression of [27] Y.H. Xu, G.A. Grabowski, Molecular cloning and characterization of HOXB4, Blood 102 (2003) 2420–2427. a translational inhibitory protein that binds to coding sequences of [41] E.V. Rothenberg, S.B. Ward, A dynamic assembly of diverse human acid beta-glucosidase and other mRNAs, Mol. Genet. Metab. transcription factors integrates activation and cell-type information 68 (1999) 441–454. for interleukin 2 gene regulation, Proc. Natl. Acad. Sci. U. S. A. 93 [28] L.A. Lopez-Fernandez, M. Parraga, J. del Mazo, Ilf2 is regulated (1996) 9358–9365. during meiosis and associated to transcriptionally active chromatin, [42] T. Maniatis, R. Reed, An extensive network of coupling among gene Mech. Dev. 111 (2002) 153–157. expression machines, Nature 416 (2002) 499–506.