1 Université Paris 5

Home , DYNLT3, FANCL, JADE1, PIGC, Proglucagon, UBE2B

UNIVERSITÉ PARIS 5 - RENE DESCARTES FACULTE DE MEDECINE

ECOLE DOCTORALE GC2ID Génetique, Cellules, Immunologie, Infectiologie, Développement

ANNÉE 2014

DOCTORAL DISSERTATION to obtain the grade of

DOCTEUR EN SCIENCE DE LʼUNIVERSITE PARIS DESCARTES

Discipline: Molecular and Cellular Biology

PRESENTED AND DEFENDED BY ALEJANDRO CONDE PEREZ

Novel implications of β-catenin in melanocyte homeostasis and melanomagenesis

1ST OF JULY, 2014

Thesis Director : LIONEL LARUE

Dr. Herve ENSLEN Jury President Dr. Robert BALLOTTI Referee Dr. Lidia KOS Referee Prof. Dorothy BENNETT Examiner Dr. Christophe LAMAZE Examiner Dr. Lionel LARUE Thesis Director

This thesis is dedicated to an incredible human being. I cannot express such gratitude on paper, there aren’t enough words in the English language which I could write that come remotely close to describing how much I want to thank you, but I can only hope that these few words become immortalized in time and that this may somehow have some justice. You sacrificed so much for me so that I would never know what it felt like to suffer as much as you did. For all of the effort, the double jobs, the late nights, the hard times, you were always there, when I needed it the most, and education was paramount. I am so proud to say that I am your son and that hard work pays off. Desde pequeño siempre me enseñastes de marcar la diferencia, y gracias a ti soy la persona que soy hoy por hoy. Te quiero mucho, y que to dolo el mundo lo sepa.

Gracias mami.

ACKNOWLEDGEMENTS

Firstly, I would like to thank all of the members of the jury, Dr. Herve Enslen for accepting to be jury president. Dr. Lidia Kos and Dr. Robert Balloti for being referee and taking the time to scrupulously review my thesis. Pro. Dorothy Bennett and Dr. Christophe Lamaze for accepting to partake in my defense as examiners and last but not least Dr. Lionel Larue for allowing me to embark on this adventure. Thank you all very much. I sincerely thank all of the lab members, past and present, for all of their help and advice throughout my time here. I can say without a doubt that without their encouragement and support these last almost four years would have been very difficult. I like to share my gratitude with you all and thank you for not only representing an important chapter for my future but also in my personal life. I have had the pleasure to work with the best group of people anybody can ask for and I will cherish all of the moments until I become senile and no longer can remember them. Even though, I really could not have done it without all of your help, I cannot go without thanking personally a set of individuals that have been instrumental to me. I start of with you honeybunny!!! Honestly man, I have learned a great deal from you and I appreciate all of the solid advice, not only scientific but also personally, that you gave me. There is no more five o’clock beer time but I hope that one day we can find each other on the 18th hole, ein brosit. To Jacky, I have never met someone so passionate about science and so dedicated to it. Thank you for all of the stimulating conversations and advice; it has been a pleasure sharing a wall division with you. To Gwen, I cannot write something and not include you. I am immensely thank you for all of your patience with me from the beginning and I know that sometimes I asked for a lot of help and you always were able to help me with a smile. To Delphine and Valerie, I regard you both as surrogate lab mothers who I could always count on when I needed someone to talk. Thank you. To Dr. Domingues, I do owe you, I think out of all of the people I owe you the most thanks for bringing with you the most important thing that I leave with. Finally, to those that are gone but not forgotten, Irina, thanks for all of the lively discussions and the beer. Iri, I will never forget what you did for me when I was in need, I will always remember, thanks. I know that the lab is much numerous than the people which I can hope to mention, but know that each and every one has been an integral part in this journey of mine and for that I thank you all from the bottom of my heart, thanks Audrey, Laura, Roselyne, Madeleine, Leslie, Juliette, Laura, Zackie, Franck the wonderful people of the second floor of the 110 building. With so many people to thank I am sure to have forgotten some and for that I apologize in advance, thank you. The last few lines of this paper I like to dedicate it to the most wonderful woman I know. Thank you for being just you, for the support and care. For waking up every morning and not only preparing yourself for your day but also making sure that Im not a mess. Regardless of what has occurred I am the happiest man on the planet knowing that I have you by my side. Thank you, I love you.

Contents

TABLE OF ILLUSTRATIONS ...... 6 LIST OF ABREVIATIONS ...... 7 RESUME ...... 10 ABSTRACT ...... 11 INTRODUCTION ...... 12 I. Skin ...... 14 A. Melanocytes ...... 15 1. Melanin biogenesis ...... 17 2. Melanosome biogenesis ...... 18 a) Melanosome transport ...... 20 II. Melanoma ...... 22 A. General clinical information ...... 23 B. Risk factors ...... 24 C. Melanoma types ...... 25 1. Cumulative sun-induced and other types of melanoma ...... 25 a) Lentigo Maligna Melanoma ...... 25 b) Acral Lentiginous Melanoma ...... 25 c) Spitzoid melanoma ...... 25 d) Uveal Melanoma ...... 26 2. Non cumulative sun-induced melanoma ...... 26 a) Nodular melanoma ...... 26 b) Superficial Spreading melanoma ...... 26 D. Melanoma Initiation ...... 27 1. Proliferation ...... 27 2. Immortalization ...... 28 a) Senescence ...... 28 b) Senescence bypass ...... 29 E. Progression ...... 32 F. Melanoma heterogeneity ...... 33 G. Therapies ...... 36 1. Standard of care treatment ...... 36 2. Radiotherapy ...... 36 3. Immunotherapy ...... 37 4. Braf inhibitors ...... 37 a) Vemurafenib ...... 38

b) Dabrafenib ...... 38 5. MEK inhibitors ...... 39 6. Kit inhibitors ...... 39 7. Nras inhibitors ...... 40 8. Drawbacks of single molecule therapies ...... 40 9. Combinatorial therapies ...... 41 H. Mouse melanoma models ...... 41 III. Caveola ...... 42 A. Caveolins ...... 44 B. Caveolin-1 in melanoma ...... 45 IV. Non-coding Genome ...... 46 A. Non-coding RNAs ...... Error! Bookmark not defined. B. miRNA ...... Error! Bookmark not defined. A. miRNA in melanoma ...... 49 1. miR-203 and miR-199a-5p ...... 50 a) miR-203 ...... 50 b) miR-199a-5p ...... 51 THESIS PROJECT ...... 52 A. Effect β-catenin on melanosome trafficking and distribution ...... 52 B. The role β-catenin/Caveolin-1 axis in melanomagenesis in mouse and humans 52 RESULTS ...... 53 A. Effect β-catenin on melanosome trafficking and distribution...... 54 B. Part B. The role β-catenin/Caveolin-1 axis in melanomagenesis in mouse and humans...... 54 DISCUSSION AND PERSPECTIVES ...... 61 A. Effect β-catenin on melanosome trafficking and distribution ...... 61 B. The role β-catenin/Caveolin-1 axis in melanomagenesis in mouse and humans 63 BIBLIOGRAPHY ...... 66 APPENDICES ...... 82

TABLE OF ILLUSTRATIONS

Figure 1. Schematic representation of the skin structure...... 14 Figure 2. Migratory pathway of neural crest cells and derivatives...... 17 Figure 3. Melanin synthesis pathway and the involvement of melanogenic enzymes...... 18 Figure 4. Melanosome maturation and segregation...... 19 Figure 5. Molecular and morphologic representation of melanosomes...... 20 Figure 6. Simplified schematic representation of microtubule associated melanosome movement...... 21 Figure 7. ABCDE rule of melanoma...... 24 Figure 8. Simplified PTEN associated pathways...... 31 Figure 9. Schematic representation of melanoma initiation and progression. 33 Figure 10. Melanoma cancer stem cell models of growth and progression. .. 35 Figure 11. Overall survival of melanoma patients treated with Vemurafenib. 38 Figure 12. Spontaneous energy of curvature of lipids...... 43 Figure 13. Electron-micrograph of elongated dome-shaped Caveola...... 44 Figure 14. Primary sequence and schematic illustration of caveolin-1...... 45 Figure 15. The fraction of non-protein-coding DNA and megabases of protein-coding sequence (CDS) per haploid genome across species...... 48 Figure 16. miRNA processing...... 49

LIST OF ABREVIATIONS

α-MSH α-Melanocyte Stimulating Hormone β-gal β-galactosidase β-Trcp β-Transducin repeat containing protein ACTH Adenocorticotrophic Hormone AJCC American Joint Committee on Cancer AKT Thymoma viral proto-oncogene 1 ALDOC Aldolase C ALK Anaplastic lymphoma receptor tyrosine kinase ALM Acral lentiginous melanoma APC Adenomatous Polyposis Coli APC Anaphase Promoting Complex ARM Armadillo ASF1A Anti-silencing function 1A histone chaperone ASIP Agouti Signalling Protein ATG5 Autophagy related 5 ATP Adenosine Triphosphate BCL2 B-cell leukemia/lymphoma 2 bp Base pairs BRAF v-raf murine sarcoma viral oncogene homolog B1 cAMP Cyclic adenosine monophosphate CAV1 Caveolin-1 CDK Cyclin-dependant Kinase CDKN2A Cyclin-dependent Kinase Inhibitor 2A ceRNA Competitive endogenous RNA CNEPC Centromere Protein C ChIP Chromatin Immunoprecipitation CK1 Casein Kinase 1 CREB cAMP Responsive Element Binding CRH Corticotropin Releasing Hormone CtBP C-terminal Binding Protein Dct Dopachrome Tautomérase DGCR8 DiGeorge Syndrome Critical Region DKK Dickkopf DMSO Dimethylsulfoxide DNA Deoxyribonucleic acid DSB Double Strand Breaks Dsh Dishevelled dsRNA Double-stranded RNA DYNLT3 Dynein, light chain, Tctext-type-3 EDN Endothelin EDNRB Endothelin Receptor B E2F1 E2F transcrption factor 1 EGF Epidermal Growth Factor EMSA Electronic Mobility Shift Assay EMT Epithelial-Mesenchyme Transition ERK Extracellular Signal-regulated Kinase

ES Embryonic Stem FACS Fluorescence-activated Cell Sorting FGF Fibroblast Growth Factor FOXD3 Forkhead box D3 Fz Frizzled FZR1 Fizzy/Cell Division Cycle 20 Related 1 GADD45 Growth Arrest and DNA-Damage-Inducible Protein GFP Green Fluorescent Protein GNA11 Guanine nucleotide binding protein (G protein), alpha 11 (Gq class) GNAQ Guanine nucleotide binding protein (G protein), q polypeptide GSK3 Glycogen Synthase Kinase 3 GST Glutathione S-transferase GUV Giant Unilamenar Vesicles Hes1 Hairy and Enhance of Split 1 HF Hair Follicles HGF Hepatocyte Growth Factor HIRA Histone cell cycle regulator HLA Human Leukocyte Antigen HLH Helix-Loop-Helix HNF Hydrazinium Nitroformate kb Kilobase KIT v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog MAP1LC3A Microtubule-associated protein 1 light chain 3 alpha LAMP1 Lysosomal-associated membrane protein 1 LEF Lymphoïd enhancer factor LMM Lentigo maligna melanoma LRO Lysosome related organelles LRP LDL receptor-related protein LZ Leucine Zipper MAPK Mitogen Activated Kinase-like Protein MC Melanocytes MC1R Melanocortin Receptor 1 MCC Merkel Cell Carcinomas MDM MDM oncogene, E3 ubiquitin protein ligase MEK 1/2 Mitogen Activated Protein Kinase Kinase 1/2 MHC Myosin Heavy Chain miRNA MicroRNA MITF Microphtalmia-associated Transcription Factor mTOR Mechanistic Target of Rapamycin MRE miRNA Recognition Element mRNA Messenger RNA MSC Melanocyte Stem Cell Myc Myelocytomatosis Oncogene NC Neural Crest NCC Neural Crest Cell NES Nuclear Export Signal NF1 Neurofibromin 1 NGF Nerve Growth Factor NLS Nuclear Localization Signal NM Nodular melanoma

NTRK1 Neurotrophic tyrosine kinase receptor type 1 NRAS Neuroblastoma RAS viral (v-ras) oncogene homolog OA1 Ocular albinism 1 OCA Oculocutaneous albinism OIS Oncogene Induce Senescence OS Overall Survival PAX3 Paired box 3 PDGFRβ Platelet-derived growth factor receptor beta pEMT pseudo Epithelium-to-Mesenchyme Transition PI3K Phosphatidylinositol-3-Kinase PKA Protein Kinase A pMET pseudo Mesenchyme-to-Epithelium Transition POU3F2 POU class 3 homeobox 2 pri-miRNA Primary miRNA RAD51 RAD51 recombinase RB1 Retininoblastoma 1 RET Ret proto-oncogene RGP Radial Growth Phase RISC RNA-Induced Silencing Complex RNA Ribonucleic acid ROS Reactive Oxygen Species ROS1 c-ros oncogene 1 receptor tyrosine kinase RTK Receptor Tyrosine Kinases SC Stem Cells SCF Stem Cell Factor SCLC Small Cell Lung Cancers SCP Schwann Cell Precursor SAHF Senescence associated heterochromatin foci siRNA Small Interfering RNA SNAI1 Snail family zinc finger 1 SNAl2 Snail family zinc finger 2 SOX Sry-like HMG box containing gene SUMO-1 Small Ubiquitin-Related Modifier 1 SSM Superficial spreading melanoma TBP TATA-binding Protein TBX T-box protein TCF Transcription factor 7-like 2 (T-cell specific, HMG box) TFIIB Transcription Factor II B TYR Tyrosinase TYRP1 Tyrosinase-related protein 1 TWIST Twist family bHLH transcription factor UTR Untranslated Region UM Uveal melanoma UV Ultra-Violet VGP Vertical Growth Phase WNT Wingless-related MMTV Integration site WT Wild-Type ZEB Zinc finger E-box binding homoebox

RESUME

L’homéostasie des mélanocytes est d'une importance primordiale dans la prévention de la transformation maligne. Les mélanocytes transformés conduisent souvent à un type particulièrement agressif de cancer de la peau, le mélanome, qui est souvent réfractaire au traitement. Plusieurs processus clés impliquant MAPK, PI3K, et les cascades de signalisation WNT, ont été identifiés comme indispensables pour la transition des mélanocytes cellules de mélanome. L'objectif de cette thèse était de décrire le rôle de la signalisation WNT / β -caténine dans la régulation de l'équilibre homéostatique dans la mélanogénèse et sa fonction tout aussi importante dans melanomagénèse.

Nous avons identifié un rôle inconnu de la β -caténine dans la production de mélanine. Nous avons démontré que l’activation de la β – caténine avait un impact sur les niveaux d’expression de gènes mélanosomaux clés et que. De plus, nous avons observé que cela n’avait pas simplement un effet sur la production des mélanosomes, mais aussi sur leur migration intracellulaire. Par ailleurs, nous avons été en mesure d'associer cette production dysfonctionnelle avec un phénotype de l'hypopigmentation, observée chez les souris transgéniques qui contiennent de la β -caténine transcriptionnellement active. L’ensemble de ces résultats replacerait ainsi la β-caténine au centre de l’homéostasie mélanocytaire.

Enfin, nous avons évalué la conséquence de la perturbation de la signalisation PI3K, par l'intermédiaire de la perte de suppresseur de tumeur PTEN, et par l’activation concomitante de NRAS, l’effecteur des MAPK. Nos résultats démontrent de façon concluante que les mutations NRAS et la perte de PTEN, dans les mélanocytes, peuvent effectivement induire et maintenir la formation de mélanomes. Nous avons également démontré que ce processus est modulé par une boucle de rétro-contrôle positif impliquant la translocation de la membrane des complexes β-catenin/Caveolin-1 et la répression de microARN. Cette partie du travail peut fournir plus de détails sur la complexité de la régulation de la transcription par la β-caténine et que celle-ci ne régule pas seulement l’expression des gènes mais aussi celle ce microARN, au moins dans le mélanome.

ABSTRACT

Melanocyte homeostasis is of paramount importance in preventing malignant transformation. The transformed melanocytes often lead to a particularly aggressive type of skin cancer, melanoma, which is often unresponsive to therapy. Several key processes, involving the MAPK, PI3K, and WNT signaling cascades, have been identified as indispensable for the transition from melanocyte to melanoma cells. The goal of this PhD thesis was to describe the role of WNT/β-catenin signaling in regulating homeostatic balance in melanogenesis and its equally important function in melanomagenesis.

Firstly, we identified an unknown role of β-catenin in melanin production. We demonstrate that β-catenin activation impacts the expression levels of key melanosomal related genes. Additionally, we observed that this effect was not restricted to just melanosome production but also intracellular migration. Moreover, we were able to associate the dysfunctional production with a hypopigmentation phenotype, observed in mice that transgenically contain transcriptionally active β- catenin. Altogether, these findings would place β-catenin again in the center of melanocyte homeostatsis.

Lastly, we evaluated the consequence of disrupting PI3K signaling, via loss of the tumor suppressor PTEN, and concomitant activation of the MAPK effector NRAS. Our results conclusively demonstrate that NRAS mutation and loss of PTEN, in melanocytes, can effectively induce and maintain melanoma tumor formation. We could also demonstrate that this process is driven by a positive auto regulatory loop involving β-catenin/Caveolin-1 membrane translocation and repression of microRNAs. This part of the work may provide further details of the complex level of β-catenin transcriptional regulation and that transcription may not be solely gene dependent, at least in melanoma.

INTRODUCTION

I. Skin

The skin forms the largest organ in the human body. It is highly dynamic and mosaic in nature. It serves as the body’s first protective barrier preventing water loss and thermo-regulating core body temperature. The skin consists of three main layers: the epidermis, dermis, and the hypodermis (Figure 1).

Figure 1. Schematic representation of the skin structure. All the three main layers of the skin, the epidermis, dermis and the hypodermis, form part of the skin. From http://www.scarformula.com/skin.php.

The epidermis is the outermost layer of the skin, enacting as the body's physical barrier to pathogens, and is characterized as a stratified squamous epithelium of varying thickness. It houses several principal cell types; the epithelial keratinocytes, the antigen presenting immune cells Langerhans, the somatosensory

Merkel cells, and the pigment producing melanocytes. Ultimately, the epidermis shields the body from a wide range of stresses including but not limited to radiation, pathogens, and physical perturbations. Beneath the epidermis lays the vascularized dermis. The dermis is composed of mainly fibroblasts, macrophages, and adipocytes. It contains several important specialized structures which includes the hair follicle as well as apocrine and sebaceous glands juxtaposed to the hair follicle. There is also a complex extracellular matrix composed of collagen, elastin, and reticular fibers, mostly orthogonally oriented to the skin, providing the elastic nature of the skin. Additionally, the dermis is innervated with mechanosensing nerve fibers which are capable of relaying mechanical stress and temperature information to the brain. For example, the Meissner's and Vater-Pacini corpuscles transmit touch and pressure. The deepest layer of the skin, the hypodermis, is specialized in energy conservation, accounting for mostly adipocytes. It functions as a temperature regulator by inducing beta acid oxidation to increase heat output, in the case of low external temperature. It is also highly innervated with nerve fibers and contains substantial vascularization. My thesis work focuses on studying aspects of melanocyte homeostasis, such as melanosome migration, and mechanisms related to transformation.

A. Melanocytes Melanocytes are specialized skin cells that play an important role in regulating skin tone levels and decreasing the sensitivity to the effects of electromagnetic radiation by increasing the production of the photo-protectant melanin. Melanocytes reside within the epidermal-dermal junction in humans, mostly found in the hair follicle in rodents, and through multiple dendritic extensions establish multiple connections with the surrounding keratinocytes. Regulation of pigmentation levels in epidermal melanocytes comes from an indirect response to DNA damage via UV radiation to the surrounding keratinocyte population and subsequent activation of several signal transduction pathways. A complex relationship exists between melanocytes and the surrounding environment which tightly controls the pigmentation production of pheomelanin and eumelanin. De novo synthesized pigment can be transferred to the peripheral keratinocytes, providing protection from

UV. Additionally, melanocytes are instrumental in providing and maintaining body color. Melanocytes arise from the progenitors of neural crest cells (NCC). Neural crest cells specify into a plethora of different cell lineages including but not limited to peripheral neurons, neuroendocrine cells, and craniofacial mesenchyme. Cells originate from the dorsal aspect of the primitive neural tube and migrate substantially to the periphery changing plasticity until arriving at the respective cellular niche. Spatial and temporal cues from the surrounding microenvironment, through a carefully orchestrated transcriptional regulation, delineate the specification program that is innate to each cell lineage. During embryonic development there is an initial wave of melanoblast, melanocyte precursors, migration starting at around embryonic day 10.5 (E10.5-12.5). Melanocyte precursors migrate dorso-laterally from the trunk neural crest to the basal layer of the epidermis where they settle into their niche and differentiate into the melanin producing melanocytes (Fitzpatrick et al., 1979; Le Douarin et al., 1982; Luciani et al., 2011). More recently, it has been demonstrated that upon neural tube dissemination, a subpopulation of neural crest cells that undergo a more dorsal-ventral migratory trajectory acquire neuronal, glial, or endoneural fibroblast lineage specific characteristics (Figure 2). Additionally, this dorsal- ventral route of migration, leads to the terminal differentiation and establishment of skin melanocytes via bi-potential Schwann cell precursors (SCP) (Adameyko et al., 2009). Differential regulation of key regulatory factors along the migratory path results in the commitment of the migrating neural crest to the melanocytic lineage. These include PAX3, SOX 10, WNT signaling pathway, EDNRB, KIT and KIT ligand, and MITF (Baynash et al., 1994; Chabot et al., 1988; Copeland et al., 1990; Dorsky et al., 2000; Hodgkinson et al., 1993; Hosoda et al., 1994; Ikeya et al., 1997; Pingault et al., 1998; Potterf et al., 2000; Southard-Smith et al., 1998; Watanabe et al., 1998).

After settlement and subsequent differentiation in the basal epidermis, these melanocytes function in the aforementioned protection from Ultraviolet (UV) radiation, specifically from UVB and UVA radiation.

Figure 2. Migratory pathway of neural crest cells and derivatives. The main cell types of NCCs migrating in the ventral migratory pathway include sensory, sympathetic and SCPs. SCPs are the cellular source for Schwann cells, melanocytes and endoneural fibroblasts. SC, spinal cord; DM, dermamyotome; NCCs, neural crest derived cell types. From (Ernfors, 2010)

1. Melanin biogenesis A key feature of melanocytes is the ability to actively produce melanin. Melanin is a naturally occurring pigment from derived from the amino acid Tyrosine. Melanin comes in two flavors, light-brown pheomelanin and dark eumelanin (Figure 3). Several enzymes are involved in the synthesis of melanin. Tyrosinase (Tyr) hydroxylates L-Tyrosine producing L-DOPA. This reaction intermediate is then oxidized by Tyr into L-Dopaqinone. Dopachrome tautomerase (Dct) or Tyrosinase related protein 2 (Trp2), performs a keto-enol tautomerisation reacton, resulting in 5,6-Dihydroxindole-2-carboxylic acid. The final reactions in the synthesis involve Tyrosinase related protein 1 (Tyrp1) and Tyrosinase, which result in the final production of eumelanin (Figure 3). The newly synthesized melanin is transported from melanocytes to the surrounding keratinocytes in specialized Lysosome Related Organelles (LRO), melanosomes.

Figure 3. Melanin synthesis pathway and the involvement of melanogenic enzymes. Initial melanin synthesis is catalyzed by tyrosinase and is then divided into eumelanogenesis or pheomelanogenesis. The other melanogenic enzymes, that is, l-3,4-dihydroxyphenylalanine (DOPA) chrome tautomerase (DCT) and tyrosinase-related protein 1 (TYRP1), are involved in eumelanogenesis, and no specific enzymes have been found that are involved in pheomelanogenesis so far. From (Ando et al., 2007)

2. Melanosome biogenesis Melanin is contained in specialized vesicles called melanosomes, which can be transported to the surrounding environment (i.e. keratinocytes) to provide protection (Delevoye et al., 2011; Orlow, 1995; Raposo and Marks, 2007). The process of melanin synthesis requires a carefully orchestrated chain of events that begin with melanosomes, emanating from early endosomes shuttling and/or de novo products trans-Golgi network, being “primed” with the formation of premelanosome protein (PMEL) fibrils (Figure 4). PMEL encoded by PMEL gene located in the 12q13-14q region, is a melanocyte specific type I transmembrane glycoprotein which generates the internal matrix fibers necessary for melanin deposition. As such, it defines the transition between Stage I and Stage II melanosomes. This is a key requirement for proper melanosome synthesis, as defects or lack in PMEL results in retained Stage I and Stage II melanosomes. The enzymatic machinery that is required for the synthesis of melanin is actively enriched in Stage III and Stage IV melanosomes.

Figure 4. Melanosome maturation and segregation. Represented are maturation stages of endosomes (left) and melanosomes (right) from early endosomes (top) and their putative derivation by maturation from earlier compartments (red arrows). Protein contents of melanosomes as described in the text are indicated in italics to the right. Early endosomes (top) form by coalescence of membranes derived by internalization from the plasma membrane and by input from the secretory pathway. They consist of tubular domains and vacuolar domains; within the vacuolar domains, internal vesicles begin to form by invagination of the limiting membrane in regions rich in bilayered clathrin- and Hrs-containing coats (black arrows). The vacuolar domains mature into late endosomal multivesicular bodies (MVB) as in other cell types by exchange with other compartments via tubular connections. Lumenal contents of late endosomes are degraded upon fusion with lysosomes. In pigment cells, the vacuolar domains of early endosomes also correspond to stage I melanosomes but are distinguished from vacuolar early endosomes of other cells by the presence of fibrils emanating from the internal vesicles as indicated. These fibrils elongate and assemble into sheets in stage II melanosomes. Delivery of contents to stage II melanosomes by vesicular traffic (not shown) or by tubular intermediates from early endosomes (as shown) results in the deposition of melanins on the fibrils in stage III melanosomes. Continued melanin deposition masks internal structure in stage IV melanosomes. From (Sitaram and Marks, 2012).

Tyrosinase, the enzyme responsible for initiating melanin synthesis by catalyzing the conversion of tyrosine to DOPA and subsequent oxidation of DOPA to DOPA- quinone, is enriched in late stage melanosomes. Similarly, TYRP1 is enriched in late stage melanosomes and is responsible for catalyzing late steps in the cascade. Additionally, TYRP1 modulates tyrosinase levels, as they are known to form a complex and mutations in TYRP1 targets the complex for degradation as well as accelerates the degradation of tyrosinase (Kobayashi et al., 1998; Toyofuku et al.,

2001). Dopachrome tautomerase is predominantly found in late stage melanosomes (Figure 5).

Figure 5. Molecular and morphologic representation of melanosomes. From (Valencia et al., 2012).

a) Melanosome transport Before being transferred to keratinocytes, mature pigmented melanosomes are first transported to the peripheral area of the cell by long-range, bidirectional, microtubule-dependent movements and are then transferred to actin filaments. The latter of which relies on unidirectional, local movement at the cell periphery. The molecular mechanism associated with the movement on actin filaments is well documented and depends on Rab27A-melanophilin-myosin Va (Hume and Seabra, 2011). The centripetal and centrifugal movements of the melanosomes are associated with dyneins and kinesins, respectively. Dynein motors are macromolecular structures comprised of several subunits which are activated by binding to dynactin. Heavy, intermediate, and light chains, all of which once assembled can transport cargo to different areas. There are two main subclasses of

dynein motors axonemal and cytoplasmic. The heavy chains comprise the globular domain which physically interacts with microtubules to generate forward motion. This process is regulated by a continuous hydrolysis of GTP into GDP. The intermediate chains anchor the globular domain to the light chains and serve as “stalks” allowing for the generation of maximum torque from the point of fulcrum, the light chains. The light chains serve as the docking platform for the type of cargo the motor carriers. Dynein motors also associate with RILP (Rab interacting lysosomal protein), which is essential to link Rab proteins with melanosome, on Rab27 null melanocytes and Melanoregulin to drive retrograde transport (Figure 6) (Ohbayashi et al., 2012).

Figure 6. Simplified schematic representation of microtubule associated melanosome movement. Melanosome bi-directional movement along microtubule tracks (MT) towards the plasma membrane (anterograde transport) using primarily kinesin motors and towards the nucleus (retrograde transport) using mainly dynein motors associated with RILP and melanoregulin. Asterisks denotes such transport in Rab27 null melanocytes (Ohbayashi et al., 2012).

Kinesin are a large superfamily of motors generally classified as orienting centrifugal trafficking or anterograde motion of organelles. Kinesins contain a motor domain linked by sequences specific for each cargo and oligomerization. In order to generate forward motion, kinesin utilize the energy from ATP hydrolysis much in the same manner as dyneins. There are three major families of kinesins, kinesin-1, kinesin-2, and kinesin-3, however as of date there are 14 kinesin families identified. They have been shown to function as heterotetrameric, homodimeric, monomeric,

and dimeric motors depending on the family studied (Reviewed by (Verhey et al., 2011). Melanosome trafficking is directly implicated in the maturation process. For instance, it has been demonstrated that the Hermansky-Pudlak syndrome (HPS) associated protein complex 3 (AP-3) which is known to be involved in vesicular transport, can direct the trafficking of tyrosinase from early endosomes to melanosomes, as HPS 2 patients show a mislocalization of tryrosinase in endosomes (Theos et al., 2005). Interestingly however, as discussed in Raposo C. & Marks M 2007, evidence exists for an AP-3 independent pathway of another mature melanosome protein, TYRP1. The adaptor complex 1 (AP-1), which binds both TYRP1 and tyrosinase in vitro, exists as independent populations of AP-1 and AP-3 coated endosomal buds and serve as intermediates in the trafficking of tyrosinase and TYRP1 (Raposo and Marks, 2007). Modifications in melanosome localization can be due to a default in the biogenesis of the melanosomes impacting later on melanosome transport or/and a transport defect of the melanosomes as such. The anomalous melanosome transport may affect the microtubule bidirectional movement and/or the actin unidirectional movement and/or a deficiency of melanosome secretion. One part of my thesis project is centered around the regulation of melanosomal trafficking in relation to the transcriptional activity of β-catenin.

II. Melanoma

Melanocyte maintenance and survival is controlled by a complex web of feedback mechanisms that involve many regulatory peptides, some of which include the aforementioned MITF and downstream effector molecules of the WNT/β-catenin, KIT signaling pathways. De-regulation in these signaling cascades leads to the transformation of melanocytes into ultimately malignant melanoma. Melanoma is the most dangerous type of skin of cancer because of its high aggressiveness, propensity to metastasize, and resistance to therapeutic treatments after surgery (Larue et al., 2009). The incidence of melanoma, especially in Western culture, has risen sharply since the early 1960s. United States alone, and according to the World Health Organization approximately 48,000 melanoma related deaths occur every year worldwide (Robin

et al., 2006). The National Cancer Institute 2012 projections estimated in the USA alone, 76,250 new cases and 9,180 deaths in the Hispanic population (Siegel et al., 2012a; Siegel et al., 2012b). Although the majority of melanoma cases are cured after surgical excision of the primary tumor, metastases occur frequently, and the metastatic form of the disease is highly resistant to all current forms of therapy and has a poor prognosis with a median survival time of 6 months. 5-year patient survival is less than 10% once the disease metastasizes to distal organs. Reasons for its high metastatic potential and resistance to treatment remain elusive. Melanoma has become an increasing health hazard to many individuals and has prompted an urgent need to devise better treatment strategies to combat the disease. Cutaneous malignant melanoma is a complex disease with a multifaceted etiology originating from mutated melanocytes. The incidence of melanoma is rising steadily in western populations and the number of cases worldwide has doubled in the past 20 years (Gray-Schopfer et al., 2006). It is characterized on a histological level as a multistep process which evolves through distinct stages: 1) common acquired nevi and dysplastic nevi, 2) radial growth phase (RGP) melanoma, 3) vertical growth phase (VGP) melanoma, and 4) metastatic melanoma (Clark et al., 1969). In a simplified way of thinking, each of these stages may be associated with specific cellular mechanisms. The first stage can be associated with proliferation followed by senescence, the second stage with immortalization, the third stage with pseudo epithelial-mesenchymal transition (pEMT) and the last stage with migration- intravasation-extravasation-metastasis formation. Customarily, benign tumors remain un-proliferative and non-invasive at or before RGP. However, genomic instability often leads to a bypass of the senescence barrier and a phenotypic switch from proliferative to invasive. This is accompanied, during the later stages of the disease, by colonization of distal organs, predominately lung, liver and brain. Metastatic melanoma ultimately becomes highly resistant to all current forms of therapy.

A. General clinical information The most basic mode of early detection/identification, within the first stage, utilizes the ABCDE guideline system (Friedman et al., 1985): Asymmetry; Border irregularity; Color; Diameter; Evolution (Figure 7). This approach is widely acknowledged to be insufficient and misleading, as irregularity and heterogeneity 23

varies within samples and not all relevant growths are necessarily identified (Aldridge et al., 2011; Salerni et al., 2011). Accurate diagnosis often requires a skin biopsy, which still remains the quickest method of detection (Rigel et al., 2010). The Breslow index is a prognostic factor for melanoma based on measuring the depth of tumor (Shenenberger, 2012). Deep infiltration into the dermis is often associated with sentinel lymph node metastasis. Generally, melanomas that do not evolve further in the staging system can often be excised surgically without further complications. Therefore, monitoring the Breslow thickness in patients through time can be informative: higher values of the index are positively correlated with poor prognosis and can be used as an indicator for surgical removal.

B. Risk factors There are several generally accepted key risk factors that contribute to melanoma. Extensive experimental evidence suggests that Solar Ultraviolet Radiation (UV) is one of the most important risk factors for developing skin cancers, specifically melanoma. skin phototypes, or the homogenous level of skin pigmentation, is also a risk factor. People with lighter skin phototypes are the most at risk of developing melanoma (Osterlind et al., 1988). The presence of a large number of nevi or congenital nevi is also a risk factor (Grulich et al., 1996). Lastly, familial history of melanoma and germline aberrations in susceptibility genes such as CDKN2A, MC1R, CDK4 and the low penetrance gene IL-10 (Bennett, 2003) (Alonso et al., 2005) (Howell et al., 2001).

Figure 7. ABCDE rule of melanoma. From http://www.webmd.com/melanoma-skin-cancer/abcds-of-melanoma-skin-cancer

C. Melanoma types 1. Cumulative sun-induced and other types of melanoma a) Lentigo Maligna Melanoma Lentigo maligna melanoma (LMM) typically develops on the chronically sun- exposed skin of the head and neck (Clark et al., 1969). Precursor lesions are termed lentigo maligna and commonly appear as irregular brownish pigmented macular lesions that persist for years. The incidence increases with age and generally peaks at between 70 and 80 years of age (Situm et al., 2010).

b) Acral Lentiginous Melanoma Acral lentiginous melanoma (ALM) is the rarest type of melanoma (~1% of malignant melanomas for the Australian population) and occurs at the same frequency in people of different phototypes (Boniol et al., 2006). It has a worse prognosis than the other types of melanoma (Swan and Hudson, 2003) (Bellows et al., 2001; Bradford et al., 2009). Dermatological signs include dark, irregular macules, papules or nodules on the feet and, less commonly, the hands. Subungual occurrence in the fingers is uncommon, and is reported in 1–13% of all cases of ALM (Miranda et al., 2012). Histologically, ALM is characterized by asymmetric, poorly circumscribed proliferation of continuous single melanocytes at the dermal– epidermal junction (Piliang, 2011). Additionally, comparative genome hybridization analysis showed that chromosomal amplifications in regions 5p15, 5p13, 12q13–22 and 16q21–22 are more frequently associated with ALM and may drive tumor formation (Bastian et al., 2000a).

c) Spitzoid melanoma Spitzoid melanomas are more commonly occurring in young children and young adults, typically less than 18 years old, which tend to be proliferative and be associated with high rate of sentinel lymph node metastasis. Perplexingly, in one study patients remain progression-free after 3 year follow up (Busam et al., 2009). Most lesions present themselves as intradermal, with large epitheliod melanocytes. Driving oncogenic alterations of Spitzoid melanoma include mutations in HRAS, BRAF, and most recently increased amounts of rearrangements resulting in fusion kinases of ROS1, ALK, RET, NTRK1, BRAF in 39% of spitzoid melanoma (Bastian et al., 2000b) (Wiesner et al., 2014) (Wiesner et al., 2012).

d) Uveal Melanoma Lastly, Uveal melanoma (UM) is characterized by lesions occurring in the choroid, ciliary body, or the irirs. Mutations in the alpha subunit of the G proteins GNA11 and GNAQ, account for more than 80%. Each subtype displays different histo-pathological features, diagnostic criteria and overall survival rates. Additionally, loss-of-function mutations in the deubiquitinase BAP1 are found in approximately 49% of Uveal melanoma (Harbour et al., 2010). Moreover, monosomy of chromosome 3 and amplifications in 8q correlate with poor prognosis (Sisley et al., 1997).

2. Non cumulative sun-induced melanoma a) Nodular melanoma Nodular melanoma (NM) is the second most common subtype, and is described in 15% of melanoma cases (Chang et al., 1998). It is vertically invasive and generally has a higher propensity to metastasize. Lesions manifest themselves as symmetrical nodules with colors ranging from blue, to brown, pink and grey (for review, see (Moloney and Menzies, 2011)).

b) Superficial Spreading melanoma Superficial spreading melanoma (SSM) accounts for approximately 40–70% of all cases of melanoma (Boniol et al., 2006; McPherson et al., 2006) (Saxe et al., 1998; Tournillac et al., 1999). The most common locations are the legs of women and the backs of men, and they occur most commonly between 30 and 50 years of age. Many are barely raised from the surrounding skin and vary in color. Such melanomas evolve over 1–5 years and can be readily caught at an early stage if they are detected and surgically removed. It has been suggested that lesions demonstrating greater than 2 mm thickness should be excised with a safety margin of 2 cm (Testori A 2009). Part of my thesis work concentrates on elucidating mechanisms of melanocyte transformation in mouse melanoma models closely resembling human superficial spreading melanoma.

D. Melanoma Initiation 1. Proliferation The transformation of melanocytes leads to malignant melanoma. It can be divided into two cellular processes; proliferation and immortalization. Hyper- activation of the MAPK pathway is a defining hallmark. Both epigenetic and genetic alterations contribute to the etiology of melanoma. This includes genes corresponding to WNT/β-catenin (β-catenin and APC), MAPK (BRAF and NRAS) and PI3K (PTEN and AKT3) signaling, cell adhesion (ITGB3, ITGAV and CDH1) and cell cycle control (CDKN2A or INK4A–ARF, MYC, RB1 and TP53) (Delmas et al., 2007; Hayward, 2003; Tsao et al., 2000). During the initial stage of melanomagenesis, abnormal melanocytic growth is observed in the form of nevi (moles). The cause of this abnormal proliferation is probably uncontrolled cell division and/or delayed senescence. In melanocytes, the MAPK (RAS/RAF/MEK/ERK) pathway is activated by growth factors, including SCF, HGF and FGF, resulting in ERK activation and thus proliferation (Halaban, 1996; Larue and Beermann, 2007). BRAF is a serine/threonine specific protein kinase that is part of the RAS/RAF/MEK/ERK signaling cascade. It is involved in cell division, differentiation, and other cellular processes (Dhomen et al., 2009). Somatic gain-of-function mutations are present in 50% of human melanomas (Davies et al., 2002; Dhomen et al., 2009; Garnett and Marais, 2004). An amino acid substitution, from Valine to Glutamic acid at position 600 (V600E) constitutes (90%) of mutations found in melanoma, resulting in constitutive cell signaling, growth factor independent proliferation, and transformation of immortalized melanocytes (Hingorani et al., 2003; Hoeflich et al., 2006; Karasarides et al., 2004; Wan et al., 2004; Wellbrock et al., 2004). BRAF mutations are more common on patients that are younger at diagnosis; with a majority of tumors being superficial spreading and arising from non-chronically exposed skin such as the trunk (Long et al., 2011). Similarly, oncogenic mutations in the RAS family, (NRAS, KRAS, and HRAS) more specifically NRAS are common in melanoma. RAS proteins are low molecular weight small GTPase directly upstream of RAF protein kinases, that function as molecular switches relying signals from membrane receptors. Much like BRAF, NRAS signaling is involved in proliferation, cell growth, and division. The most common mutation in NRAS associated with an oncogenic phenotype in melanoma is an amino acid change at position 61 from

Glutamine to Lysine and to a lesser extent Glutamine to Arginine, rendering the protein constitutively active. Gain of function NRAS mutations are found in approximately 20% of human melanoma samples (Goel et al., 2006).

2. Immortalization a) Senescence Senescence, from Latin "senescence" meaning "to grow old", is a natural phenomenon that results in the arrest of cell division. Hayflick limit is defined as the lifetime limit of diploid cells, or replicative senescence (Hayflick and Moorhead, 1961). This is a consequence of telomeric shortening, which protect chromosomes from deterioration or fusion, by telomere attrition (Harley et al., 1990). As telomeres reach a critical minimal length a DNA damage response is often observed. The result of which is a transient arrest in proliferation to allow for repairs. Other hallmarks of senescent cells include flatten cell morphology and the increased expression of Senescence-associated β-Galactosidase (Kurz et al., 2000). If the damage exceeds a certain threshold then cells can undergo either apoptosis or senescence. Senescence may also be achieved by telomere independent mechanisms. Additionally, increased heterochromatin formation is often considered as a mark of senescence. Senescence associated heterochromatin foci (SAHF), which are characterized by H3 Lys9 methylation, are frequently observable in senescent cells. Through a mechanism involving HIRA/ASF1A translocation to PML bodies, cells regulate chromatin packing and engage in cell growth arrest (Adams, 2007; Adams, 2009). This is confirmed through RNAi experiments were depletion of ASF1A results in acute bypass of the senescence program (Zhang et al., 2005). More recently, the idea that autophagy and senescence have a common cellular link has been suggested. In one study co-localization of MAP1LC3A (LC3) and LAMP1 demonstrated autophagosome and lysosome fusion and correlated with LC3-II expression (Patschan et al., 2008). Additionally, in a recent review from Liu and colleagues, they highlight the nature of autophagy in the regulation of OIS. Using a large cohort of primary human melanoma and nevi, they concluded that the autophagy marker ATG5 is lowly express in primary melanoma compared to nevi and that ATG5 overexpression in cells resulted in a decrease of proliferation. This

along with other data led them to reiterate the importance of autophagy in OIS (Liu et al., 2014).

b) Senescence bypass Senescence bypass results in unobstructed continued cellular proliferation indicative of malignant transformation and “proper” melanoma initiation. There are many effectors of the senescence response and the mechanisms of regulation are yet to be fully described. In melanoma oncogenes such as BRAF (or NRAS) are themselves incapable of transforming primary cells, or can do so only poorly, as they cause oncogene-induced senescence (OIS) (Ackermann et al., 2005; Chin et al., 1999; Gray-Schopfer et al., 2006; Michaloglou et al., 2005). This is largely attributed to a non-physiological activation of critical regulatory pathways (i.e. MAPK) which triggers stress response leading to G1 arrest. Generally, once senescence occurs as measured by senescence associated β-galactosidase and other senescence associated markers, nevi do not progress towards malignancy. Further increase in mutational load and/or alteration of gene expression ultimately leads to overwriting of the senescence program and uncontrolled proliferation. A large body of evidence places the MDM2/p53 and the E2F/p16/RB1 pathways at the center of such phenomenon. Interestingly, this effect is independent of telomere length, as it has been observed extensively in murine cells which naturally express telomerase. In human and mouse melanocytes, the lack of p53 would not be the dominant factor inducing melanocyte bypass of senescence. Alterations in the p53 pathway are more commonly associated with melanoma progression (Ha et al., 2008). As a caveat however, it cannot be excluded that dysregulation of the p53 pathway is not involved in melanomagenesis, even though mutational load is low in early melanoma. Interestingly, it has been reported recently that MDM4, but not MDM2, would be involved in melanoma initiation in a mouse model (Gembarska et al., 2012). On the contrary, p16INK4A, PTEN, and β-catenin have been thoroughly studied as it relates to melanomagenesis in mice. Deletion, mutation and silencing of p16INK4A are the main molecular processes associated with the bypass of senescence in melanoma. In accordance, it has been shown that p16INK4A can be silenced by repression through the β-catenin–TCF7L2 complex (Delmas et al., 2007) or by methylation of its promoter. Understanding how oncogenic cells overcome this senescence barrier to hyper-proliferate is one of the

keys to improving our knowledge of melanoma initiation. Thus most of the focus of my thesis centers on the possible interplay of these proteins and their combinatorial importance in melanoma formation. p16INK4A is encoded by the CDKN2A gene. It is a product of alternative reading frame within the gene that also gives rise to a structurally unrelated protein ARF. p16INK4A gene product negatively regulates the cyclin-dependent kinase 4 (CDK4) and thus has important functionality in G1 cell-cycle control. Deletion or mutations in p16INK4A is associated with bypass of the senescence barrier. For instance, loss of the CDKN2A locus (9p21.3) is found in about 60% of cutaneous melanomas and to a lesser extent other promoter methylation and sequence variations also exist. Most of the described mutations affect the reading frame of p16 and not p14. Moreover, germ-line mutations in CDKN2A range from 20-40%, and constitute as a risk factor for developing melanoma. Patients with CDKN2A mutations also demonstrate greater number and larger nevus than the wild-type counterparts (Bishop et al., 2000). PTEN negatively regulates the action of PI3K/AKT signaling through the dephosphorylation of phosphatidylinositol (3,4,5)-triphosphate (PIP3) (Figure 8). This regulation is essential for modulating important cellular processes, including but not limited to, cell growth, cell survival, and proliferation. However, there has been increasing amount of evidence demonstrating PTEN PI3K/AKT independent functions. In this regard, several studies have demonstrated that PTEN localization is not strictly restricted to the plasma membrane and can localize to the nucleus. For instance, PTEN has been shown to promote the formation of the anaphase promoting complex, APC/FZR1 in the nucleus, thus inducing the transition from metaphase to anaphase in mouse embryonic fibroblasts (Song et al., 2011). PTEN nuclear functions also consist of maintaining chromatin stability by interacting with the kinetochore component CENP-C as well as regulating Rad51 recombinase and Double Strand Breaks (DSB) (Shen et al., 2007). Additionally, PTEN mRNA itself alters the delicate fine balance of mRNA expression by serving as a miRNA “sponge”, sequestering miRNA from their respective targets. As such, PTEN mRNA is characterized as a competitive endogenous RNA (ceRNA) that uses novel miRNA Recognition Elements (MRE) as sponges for miRNA (Tay et al., 2011). This notion has been further expanded in a BRAFV619E (the mouse equivalent of the human BRAFV600E) “Sleeping Beauty” mouse model where ZEB2 functions as a miRNA

sponge and that abrogation of ZEB2 results in a decreased expression of PTEN and cooperates with BRAFV600E to induce melanomagenesis (Karreth et al., 2011). PTEN mutational inactivation and/or deletion is observed in 5 to 20% of uncultured primary and metastatic melanomas (Goel et al., 2006; Whiteman et al., 2002a; Wu et al., 2003; Zhou et al., 2000b)(Goel et al., 2006; Whiteman et al., 2002b; Wu et al., 2003; Zhou et al., 2000a) as well as 30 to 40% of melanoma cell lines (Guldberg et al., 1997; Tsao et al., 1998; Wu et al., 2003). Additionally, loss of phosphatase and tensin homologue PTEN has been demonstrated to orchestrate in part, disease progression. CGH analysis revealed frequent loss of PTEN in melanoma (Bastian et al., 2003).

Figure 8. Simplified PTEN associated pathways. Mutations are depicted as point mutations (*) or deletions (Δ). (Conde-Perez and Larue, 2012)

Through the regulation of PI3K/AKT pathway, PTEN can modulate the intracellular levels of β-catenin. β-catenin another important factor that controls melanocyte development and homeostasis shown to be mutated in approximately 3% of melanomas (Demunter et al., 2002; Pollock and Hayward, 2002). It can reside at focal adhesion junctions in a complex with cadherins, where it plays a role in cell- cell adhesion. Activation of the Wnt signaling pathway inhibits GSK-3β, which subsequently prevents the phosphorylation of β-catenin and results in its translocation to the nucleus where it interacts with LEF/TCF factors to regulate the expression of target genes (Delmas V., 2007). It has been shown to directly influence melanocyte differentiation by inducing M-MITF (Takeda K et al.,

2000)(Gallagher et al., 2012). Constitutively active β-catenin mutations that resemble the activated form from Wnt signaling have been shown to be found in numerous cancers, including melanoma (Giles RH., 2003). . In addition, nuclear translocation of β-catenin is observed in approximately 30% of melanoma samples while genetic aberrations contribute to approximately 5% of uncultured malignant melanoma cases (Rimm et al., 1999) (COSMIC database)Mouse models show that stabilized β- catenin promotes immortalization of melanocytes by repressing the expression of the tumor suppressor gene p16Ink4a (Delmas V., 2007). Additionally, stabilized β-Catenin promotes accelerated melanomagenesis in transgenic mice (Damsky et al 2011).

E. Progression Melanoma progression is often associated histo-pathologically as increase in vertical displacement of lesions with increased angiogenesis, dissemination of single or groups of melanoma cells from the main tumor mass, and distal organ reestablishment. This tightly controlled process is driven by a slew of different cell autonomous and cell non-autonomous factors. Activation of several signaling pathways, specifically the aforementioned MAPK, WNT, and PI3K signaling cascades, results in epithelial to mesenchymal transition (EMT), for epithelial cells and pseudo-epithelial to mesenchymal transition for melanocytes, at the primary site and pseudo-mesenchymal to epithelial transition (pMET) at the metastatic sites (Figure 9) (Dissanayake et al., 2007; Wehbe et al., 2012)}(Li et al., 2001; Lin et al., 2010). A hallmark of pEMT is the loss of cell-to-cell junctions via extinction of E- cadherin (Larue and Bellacosa, 2005). This in turn facilitates cellular diffusion from the primary tumor mass and subsequent vascular infiltration. SNAIl, ZEB, and TWIST are critical for the EMT process (Peinado et al., 2007). In melanoma downregulation of E-cadherin expression is often associated with up-regulation of SNAl1 and SNAl2 as well as mesenchymal marker Vimentin and N-cadherin (Kim et al., 2013; Peppicelli et al., 2014). Contrarily, pMET is associated with a decrease in N- cadherin, SNAl, and Vimentin expression while increasing E-cadherin (Pal et al., 2014)

Figure 9. Schematic representation of melanoma initiation and progression. Melanomagenesis is composed of two main processes: melanoma initiation and progression. During melanoma initiation, proteins of the MAP kinase pathway (BRAF, NRAS, HRAS, KRAS and NF1) are involved in proliferation, and proteins of the PI3K (PTEN) and WNT (β-catenin) pathways, and p16INK4A are involved in the bypass of senescence. Melanoma progression is the combination of invasion and metastasis. At the cellular level, melanoma invasion results from a combination of several mechanisms: a pseudoepithelial–mesenchymal transition, a loss of cell-to-cell adhesion, a loss of cell–matrix adhesion, matrix degradation, and chemo-attraction/repulsion and migration. RGP, radial growth phase; VGP, vertical growth phase; met, metastasis. Kc, keratinocyte; Mc, melanocyte; and BM, basement membrane.From (Conde-Perez and Larue, 2012).

F. Melanoma heterogeneity Increased resistance to treatment, often observed in malignant melanoma, can be attributed to one of the hallmarks of this disease; heterogeneity. The complexity in melanomagenesis and evolution are highlighted by the numerous distinct components that contribute to the disease (such as KIT, RET, HGF, PI3K, PTEN, BRAF, NRAS, p16, APC and MITF), evident by its defining patient heterogeneity as well as intra-tumor heterogeneity. For instance, selective pressure from BRAFV600E treatment reveals de novo mutations in NRAS, specifically a C>T transition which results in the amino acid change Q61K. Additionally, modifications in the RAS inhibitor, NF1, have been described in melanoma. Los of heterozyosity (LOH) is observed in 10% of melanoma patients (Gomez et al., 1996; Krauthammer et al., 2012) activating RAS/MAPK signaling and mutations in NF1 have also been associated with Vemurafenib resistance (Maertens et al., 2013).

Not only is there clear evidence for intra-tumor heterogeneity but also there is inter-tumor heterogeneity within patients themselves, adding to the complexity of melanoma treatment. Deciphering the differential gene expression pattern within single tumor mass is currently at the epicenter of melanoma treatment strategy. For instance, it has been shown that melanoma cells within a given tumor can have different levels of expression and even exclusivity, as in the case for MITF and POU3F2 (BRN2), at different locations in the tumor driving diverse phenotypic populations (Goodall et al., 2008). This results in a scenario were targetable treatment may only reach a certain population of cells while inducing a selective advantage to the remaining cells that do not respond to the treatment. As such, this inevitably gives rise to treatment resistance and possible disease progression. However, one group successfully managed to circumvent this by taking advantage of the fact that MITF induces Tyrosinase. Using a two-hit approach homogenized MITF expression using Methotrexate (MTX) followed by treatment with 3-O-(3,4,5- trimethoxybenzoyl)-(-)-epicatechin (TMECG) a Tyrosinase pro-drug which induced efficient cellular apoptosis (Saez-Ayala et al., 2013). One argument that arises from this discrepant expression pattern, which is currently under debate, is the true nature of tumors and from what cells do they develop from. Ideally all melanocytes have the intrinsic capacity to become transformed and give rise to melanoma. It can be interpreted that this unlikely as the BRAFV600E mutation in nevi is often found in juxtaposed melanoma with additional mutations evident of disease evolution (Tschandl et al., 2013); thus limiting the cells that can obtain transformative potential. Although, as of date the melanoma forming cell has not been isolated, it is believed that cells that maintain a stem like behavior (i.e. can self-renew and differentiate) or are quiescent termed the “melanoma stem cell” are the ones that can potentially give rise to melanoma (Fang et al., 2005).

Hierarchical Stochastic

Figure 10. Melanoma cancer stem cell models of growth and progression. In the hierarchical model, there is a defined subset of cells that are able to self-renew and to give rise to daughter cells. This quality is unidirectional, and if this subset of cells, or the stem cell pool, is depleted, the tissue will be unable to replenish itself. In the stochastic model, all the cells in theory have some ability to behave as a stem cell in terms of self-renewal and multipotential. Extrinsic factors, such as extracellular proteins, growth factors, and other cell types, regulate the cell in terms of decisions for maintenance, differentiation, or cellular death. (Adapted from (Lang et al., 2013))

In light of this, two current model of understanding have been proposed, the Hierarchical and the Stochastic model (Figure 10). In the hierarchical model, only a sub-population of cells within the tumor is able to self-renew and give rise to daughter cells through asymmetrical division. This delineates the boundary between tumor initiating cells and tumor supporting cells. As a result, disease progression is constrained to only the cells which can maintain a certain level of “genetic plasticity” (Klein et al., 2007; Monzani et al., 2007; Topczewska et al., 2006). It can be postulated that upon selective stress tumor supporting cells may themselves become subjected to increased mutational burden and consequently more aggressive, independently of the evolution of the tumor initiating cells. Contrarily to the stochastic model, were it is assumed that all cells have the same capacity for tumorogenicity and this is directed by their interaction with the underlying micro-environment. However, both models alone fail to fully discern the causal role of melanoma and its intrinsic heterogeneity. For instance, the hierarchical model fails to explain

the diverse array of gene expression within tumors and limits the evolution to the maintenance of a stem cell pull. This does not correlate with the fact that melanoma latency can vary from patient to patient and that if this model is true then all melanomas that arose from a driver mutation should evolve in the same manner. In the stochastic model, the assumption that all cells can give rise to a melanoma, although it would explain the high level of heterogeneity, as not one cell is limited to evolve through one mechanism. All together it is not difficult to conceive that melanoma arises from a combination of the two models, where cells can switch states upon specific micro- environmental cues and which drives tumor evolution (Hoek and Goding, 2010).

G. Therapies

1. Standard of care treatment There has been a recent shift in the standard treatment option for melanoma. Although surgical resection still remains the most effective form of treatment, it is often prolonged to the point where it is no longer a viable option for patients. Traditionally once diagnosed, standard treatment of care is associated with administration of the alkylating agent Dacarbazine, which unfortunately has very poor efficiency and the overall survival of patients is not dramatically increased. In addition, recombinant interluken-2 and interferon immunotherapy is widely used in the treatment of melanoma due to its capacity to actively engage the immune system (Carrel et al., 1985; Gambacorti-Passerini et al., 1988; Hersey et al., 1987; Margolin et al., 1989; Tyring et al., 1984). Unfortunately, the response rate is relatively low and the level of secondary side effects, ranging from hepatic and renal dysfunctions to cardiac anomalies, outweigh the benefits (Creagan et al., 1984a; Creagan et al., 1984b; Dutcher et al., 1991; Kruit et al., 1991; Stoter et al., 1991). However, with the introduction of small molecule patient targeted therapies, a slew of more potent and efficient family of drugs show more promise. Currently there are 373 open studies worldwide, which are in the process of recruiting, according to clinicaltrials.gov.

2. Radiotherapy Radiation therapy, as a mode of action, essentially induces double strand breaks in DNA resulting in cellular death. Current treatment specification for radiotherapy in melanoma is 5 times 1.8-2.5 Gy doses weekly. It is occasionally used

36 after surgery in patients who do not respond well to systemic treatment to control the local recurrence rate. However, there is no clear consensus on the dose related effects. Thus radiotherapy is not considered first line of treatment and its recommended usage is as adjuvant to surgery if proper safety margins can be achieved and in distal organ metastasis were no other treatment is viable (reviewed in (Forschner et al., 2013)).

3. Immunotherapy General therapeutic approach to melanoma has been greatly evolving recently due to the introduction of small molecule therapies and immunotherapy. Immunotherapy has recently shown greater promise than prior attempts with interluken-2 and interferon therapies, with agents such as anti-PDL1 (BMS-936559), anti-PD1 (Lambrolizumab), and anti-CTLA4 (Ipilimumab) antibodies (Brahmer et al., 2012; Hamid et al., 2013a; Jang and Atkins, 2013). For instance, the treatment with anti-PD1 antibody in one study resulted in a 52% response rate, but only using the highest administered dose at 10mg/kg every two weeks, which was highly associated with adverse secondary effects (Hamid et al., 2013a; Hamid et al., 2013b). Additionally, in a separate phase I trial, treatment with anti-PD-1 monoclonal antibody, resulted in 28% response rate (Topalian et al., 2012). Ipilimumab, a monoclonal antibody that blocks CTLA4, in one phase III randomized single agent study median overall survival increased 3.7 months compared to gp100 vaccination with response rates of 11% (Hodi et al., 2010). Furthermore, phase III trial of Ipilimumab as an adjuvant to Dacarbazine therapy resulted in a significant prolongation of OS (11.2 vs 9.1 months) compared to Dacarbizine plus placebo (Robert et al., 2011). However, any treatment benefit was not observed prior to 12 weeks as the progression-free survival curves overlapped between both groups. Although, Ipilimumab treatment has relatively long response duration, it has low response rates and is associated with immune-related adverse effects.

4. Braf inhibitors Recent advances in understanding the complex cellular and molecular events in melanomagenesis, has resulted in a new class of small molecule drugs targeting members of the MAPK signaling pathway, including the BRAFV600E mutation. First and second-generation BRAFV600E inhibitors, Vemurafenib and Dabrafenib

respectively, demonstrate great promise in the clinics as potent inhibitors of the kinase domain of mutant BRAF.

a) Vemurafenib In a phase III randomized trial Vemurafenib treatment increased Over Survival (OS) by 20% at 6 months, compared to dacarbazine, as well as progression free survival (5.3 vs 1.6 months) as a single agent treatment (Figure 11) (Chapman et al., 2011). Additionally, in a phase I does-escalating trial, Vemurafenib treatment resulted in overall tumor shrinkage in 81% of patients (Flaherty et al., 2010). Moreover, phase II trial of 132 patients containing mutant BRAF resulted in a confirmed overall response in 53% of patients, with 6% obtaining a complete response. This translated to a median progression free survival of 6.8 months, with a median overall survival of 15.9 months (Sosman et al., 2012).

Figure 11. Overall survival of melanoma patients treated with Vemurafenib. From (Chapman et al., 2011).

b) Dabrafenib Second generation specific BRAF V600E inhibitor, Dabrafenib, is a reversible ATP-competative inhibitor with similar pharmacodynamics to Vemurafenib (Falchook et al., 2012). In a phase II study of 76 patients with advanced melanoma, a confirmed response was noted in 59% of patients with a median progression free survival of 6.3 months (Ascierto et al., 2013). Additionally, in a phase III trial of 250 previously untreated stage IV or un-resectable stage III BRAF mutant melanoma, Dabrafenib treatment increased median progression free survival from 2.7 to 5.1

38 months, compared to Dacarbazine alone. Furthermore, objective responses were noted in 50% of patients who received Dabrafenib (Hauschild et al., 2012). However, patients often relapse due to secondary adaptive resistance via hyperactivation of MAPK downstream targets such as MEK and more recently through activation of PI3K signaling via loss of the tumor suppressor PTEN and nuclear accumulation of downstream WNT signaling effector, CTNNB1 (Johannessen et al., 2010; Wagle et al., 2011) (Damsky et al., 2011; Dankort et al., 2009). Evidence, suggests that targeting exclusively BRAFV600E is simply not sufficient enough to prevent disease progression.

5. MEK inhibitors Targeting effectors of MAPK, such as MEK have also resulted in appreciable effects in patients. Trametinib is a small molecule selective inhibitor of MEK1 and MEK2. In a phase III open-labeled trial, 322 patients with metastatic mutant BRAF melanoma with no prior history of BRAF treatment were treated with Tramatinib or chemotherapy (Dacarbazine or Paclitaxel). Median progression free survival was determined to be 4.8 months in the Trametinib group compared to 1.5 months in the chemotherapy group. Additionally, OS at 6 months was increased 14% in patients who received Tramatinib, and 22% had obtained an objective response compared 8% in the chemotherapy group at the primary endpoint (Flaherty et al., 2012b) Dabrafenib and trametinib treatment showed infrequent toxic effects at the dose- limiting 150mg of dabrafenib and 2mg of trametinib (Flaherty et al., 2012a). Additionally, clinical trials using another MEK inhibitor, Selumetinib (AZD6244) has just been completed to determine its efficacy (NCT00866177).

6. Kit inhibitors KIT is a tryrosine/kinase transmembrane receptor indispensable for melanocyte development. Genomic studies have found either oncogenic mutations or foal amplifications in KIT. Some therapeutic approaches have included the use of KIT inhibitor (Imatinib) for patients that carry mutations or amplification in KIT, but remains limited in the case of melanoma (Hodi et al., 2013). Notwithstanding, one phase II study using Imatinib in patients with KIT, mutated or amplified in metastatic melanoma, resulted in a median progression free survival of 3.5 months with an overall 1 year survival of 51% (Nikolaou et al., 2012).

7. Nras inhibitors There are few studies characterizing the involvement of NRAS mutations in- conjunction with other signalization pathways in melanoma. NRAS is found mutated in approximately 20% of human melanoma patients. Additionally, NRAS is mutated in approximately 80% in giant congenital nevi (Bauer et al., 2007). Recent evidence highlights the importance of NRAS mutations and the aggressiveness of human melanoma (Devitt et al., 2011). All efforts to develop an effective NRAS inhibitor have yielded unsuccessful results to date. Unlike, BRAFV600E Vemurafenib or Dabrafenib, there is no current form of treatment of melanomas that bear the NRAS mutation. To date the most researched possible therapeutic treatment for RAS mutations have been farnesyl transferase inhibitors, which prevent post-translation farnesylation and perturbs RAS membrane attachment. Unfortunately, no relevant clinical activity was achieved using these inhibitors. Identifying potential putative therapeutic targets responsive to NRAS modulation would be greatly beneficial.

8. Drawbacks of single molecule therapies For all of the potential benefits of the current preferred single agent treatments, there are also considerable drawbacks. For instance, Vemurafenib and Dabrafenib therapy are only effective against tumors that present the V600E mutation. This leaves approximately 40-50% of patients who do not qualify for the treatment. Additionally, clinical evidence of tumor resistance becomes manifested at a median 5-7 months after commencing treatment. Moreover, the most notable adverse effect in patients treated with Vemurafenib is the development of RAS mutated Cutaneous Squamous-cell Carcinomas (SCC) (Su et al., 2012). This has been since described as a result of tumor-acquired resistance via paradoxical reactivation of MEK/ERK signaling. Furthermore, secondary mutations in MEK, have been detected in patients who progressed during inhibitor treatment (Nazarian et al., 2010; Wagle et al., 2011). Cross-pathway oncogenic activation has also been shown to confer resistance to treatment, in the case of PDGFRβ and PI3K/AKT/mTOR signaling (Shi et al., 2011; Villanueva et al., 2010) and reviewed in (Sullivan and Flaherty, 2013). In the case for immunotherapy the effects on OS and progression- free survival are only modest at best. This presents a treatment scenario in where the combination of targeted therapy with immunotherapy could feasibly maintain the

high response rate from the small molecule inhibitor as well as achieve longer response duration.

9. Combinatorial therapies Recently, there has been a shift in preferred treatment strategies. It suffices it to say that single molecule therapy alone is insufficient. Even though the optimal dosage and treatment period requires some fine tuning, it is perhaps of interest to combine not only single molecule treatments but also immunotherapies tailored to patients. Indeed, one study showed that the combination of Dabrafenib and Trametinib resulted in positive tumor response in 17% of patients who demonstrated prior resistance to Vemurafenib (Infantate et al., 2011). Moreover, in a separate trial patients who were given doses of Dabrafenib and Trametinib responded better than with the single agent Dabrafenib treatment (76% vs 54%), with a median progression free survival of 9.4 vs 5.8 months (Flaherty et al., 2012a). Similarly, in a phase I study the combination of Vemurafenib and GDC-0973 (Cobimetinib), a selective inhibitor of MEK, demonstrated tumor reduction in all patients (Gonzalez et al., 2012). A phase III randomized, double-blind trial of previously untreated, unresectable or metastatic BRAF mutant melanoma, is currently recruiting (NCT01689519). In addition, treatment with mTOR inhibitors may circumvent the observed resistance by PI3K/AKT activation seen after Vemurafenib treatment. Effectively, a combinatorial strategy currently presents the most promising mode of treatment. Further investigation into the dosing, efficacy, and toxicity effects should be performed.

H. Mouse melanoma models Melanoma mouse models have served as indispensable tools for better understanding the key regulatory events that lead to melanoma formation. With the advancement of genetic manipulation techniques, mouse melanoma models have become more disease relevant and facilitated drug discovery/screening and treatment refinement. During the last 30 years extensive research has been focused on generating a compatible mouse model for human melanoma. With a variety of different gene modifications and specific control of expression, essential amount of knowledge in

the understanding of melanoma has been gained from the mouse (nicely reviewed in (Larue and Beermann, 2007)). For instance, a BrafV600E conditional mouse model developed by Marais R. group, accurately phenocopied histologically and molecularly oligomelanotic malignant melanoma (Dhomen et al., 2009). Even though approximately, 50% of the mutant mice developed these lesions at 12 months, after crossing to a p16INK4a null background the latency period dropped to 7 months. Contrarily, Bosenberg's group observed that the BrafV600E conditional mice developed melanocytic hyperplasia, which did not progress to melanoma over a 15-20 month interval. However, upon concomitant deletion of the tumor suppressor PTEN mice developed invasive melanoma with 100% draining into regional lymph nodes (Dankort et al., 2009). These studies provide circumstantial evidence that mouse genomics although advanced, the perfect mouse model for melanoma does not exist. Other similar studies have focused on describing the transformative potential of the RAS genes. For instance, a conditional KRASV12G driven melanoma model resulted in the increase of melanoma appearance and decrease of tumor-free survival (Milagre et al., 2010). Additionally, HRASV12G ; Pten+/-; INK4a/Arf-/- mice develop more invasive melanomas with a much shorter latency period compared to HRASV12G ; INK4a/Arf-/- (Nogueira et al., 2010). Interestingly, the observable mutational rate for the human HRAS and KRAS are approximately 1 and 2% respectively, which puts in to question the relevance of these mouse models for the human disease (Milagre et al., 2010). Contrarily, to the observed rate of mutation in human melanoma for HRAS and KRAS, NRAS mutations have been determined to exist in approximately 20% of melanoma patients (reviewed in (Fedorenko et al., 2013)). NrasQ61K mice develop melanoma with a high latency and low penetrance. However, NRASQ61K ; INK4a-/- develop epidermally invasive metastatic melanoma within 6 months (Ackermann et al., 2005).

III. Caveola

Caveola have been initially described as small membranous invaginations as seen through electron microscopy. Caveola serve as “membrane reservoirs” that cells can utilize to directly increase surface area without increasing volume, when

upon increased membrane tension. These reservoirs can be often found in special short-lived cholesterol rich lipid microdomains (lipid rafts) enriched in sphingolipids. The energy of spontaneous curvature is a direct intrinsic property of lipids and depends on fatty acid chain and the polar head group (Figure 12).

Figure 12. Spontaneous energy of curvature of lipids. Js is the spontaneous energy of curvature. Reports have demonstrated that steady state lipid segmentation exits at the plasma membrane, which ultimately leads to phase-separation and lipid microdomain formation. This is most certainly true in Giant Unilamenar Vesicles (GUV) containing different lipid species and holds true in eukaryotic plasma membrane. These microdomains display distinct physical properties and are known to be heavily crowded and enriched in transmembrane receptors, channels, cytoskeletal anchorage proteins, and GPi-anchored proteins. Caveolins have been described to be recruited and assist in membrane deformation by lowering the spontaneous energy of membrane curvature through inner leaflet insertion and inducing negative membrane curvature. Membrane insertion and oligomerization, results in the typical 50-100nm in diameter invaginations seen in electron microscopy (Figure 13). Additionally, Caveola have been described as integral components associated with Clatherin independent endocytosis. Recently, there has been increasing evidence exemplifying the role of mechanosensing and transduction under mechanical forces of Caveolin-1 and β- catenin in modulating cellular plasticity (Goetz et al., 2011; Gortazar et al., 2013; Joshi et al., 2012; Sinha et al., 2011). Thus it is of interest to further explore this relationship in order to devise new possible therapeutic strategies. Part of my thesis work deals with characterizing the Caveolin-1/β-catenin circuitry.

Figure 13. Electron-micrograph of elongated dome-shaped Caveola. An electron micrograph of small (65 nm) flask-shaped pits called caveolae in the plasma membrane of a human fibroblast. Adapted from (Parton, 2001).

A. Caveolins There are three members of the Caveolin family; Caveoli-1,Caveolin-2, and Caveolin-3. Although they all share sequence homology, studies have revealed that the expression pattern is not the same. For instance, Caveolin-1 and 2 are generally ubiquitously expressed in most cell types while Caveolin-3 expression is mainly restricted to muscle tissue. Caveolin-1 is the most prominently expressed form. Structurally, they are approximately 22-24kd in size and are characterized by cholesterol recognition/interaction amino acid consensus (CRAC) motif, Oligomerization domain, and a N-terminal Caveolin Scaffolding Domain (CSD) facilitating protein-protein interactions (Figure 14). Caveolin-1 and 2 share the most sequence homology and redundancy. However, most interestingly only Caveoli-1 has been implicated in a wide range of malignancies including, breast cancer, melanoma, prostate, and lung cancer (reviewed in (Senetta et al., 2013)).

Figure 14. Primary sequence and schematic illustration of caveolin-1. Key domains are indicated: the CSD in blue, containing the cholesterol-binding CRAC motif and the residues required for binding of protein partners (underlined). Bold residues indicate sites U−13C,15N-labeled in one or more peptides (From (Hoop et al., 2012)).

B. Caveolin-1 in melanoma The role of Caveolin-1 in melanoma is highly debated. For instance, Caveolin- 1 overexpression in WM983A human melanoma cells results in increased migration, invasion and colony formation in soft agar (Felicetti et al., 2009). Contrarily in a different study, Cav1 KO mice promote the growth of intradermally injected B16F10 cells. Furthermore, co-cultures with Cav1 KO fibroblasts and B16F10 results in an increased growth of the melanoma cells through a paracrine sustained activation of ShhN (Capozza et al., 2012). Alluding to the complexity in function, Cav1 overexpression in B16F10 cells have impaired tumor forming capabilities upon subcutaneous injection. Perplexingly, B16F10 cells had also increased lung metastatic formations after intravenous injection (Lobos-Gonzalez et al., 2014; Lobos-Gonzalez et al., 2013). In a landmark study, authors determined that mechanical remodeling of the microenvironment depending on Cav1 expression results in a phenotypic switch between highly invasive and non-invasive. This is driven by the bifurcation of signaling of Rac1 and Rho (Goetz et al., 2011). Succeeding studies expanded this notion further and demonstrated that overexpression of Cav1 in B16F10 cells promotes migration and focal adhesion turnover through increased Cav1 phosphorylation at Tyr-14 and Rac1 activation 45

(Urra et al., 2012). More recently, it has proposed that Caveolin-1 expression promotes cell migration and invasion through the recruitment of Rab5 and activation of Rac1 in B16F10 murine melanoma cells (Diaz et al., 2014). It is evident that the role of Caveolin-1 in melanoma is highly contextually dependent and varies from study. Furthermore, it seems that most of the in vitro classification has been done on the same cell type, murine B16F10 cells, which may not correspond to the most physiological setting. There a few human studies in which the role of Caveolin-1 has been assessed and little conclusion can be drawn. In example, loss of Cav1 in stromal cells from human melanoma samples correlates with poor survival (Wu et al., 2011). While in a different study, higher levels of Cav1 positive exosomes were identified in melanoma patients that correlated with disease progression (Logozzi et al., 2009).

IV. Non-coding Genome

Organismal complexity was thought to be determined by genome size and of number of protein coding genes. However, this leads to interesting paradoxes in where in nature phylogenetic studies do not hold up to this criteria as there is no correlation between protein-coding gene content and level of organismal complexity. For example, coding genes only account for approximately 2% of DNA content in humans, which leaves the vast majority as non-coding. Interestingly, the ratio of non- coding/coding positively correlates with increasing order of phylogenetic complexity. The importance of the non-coding genome, in terms of organismal regulation, has been relatively ignored and only in recent years more efforts have been placed on deciphering its exact role.

A. Non-coding RNAs Non-coding RNAs have been a topic of interest in the last several years for their potential to regulate gene expression at different levels. There are several classes of non-coding RNAs, all which exert different functions mostly dependent on size and secondary structure. For instance, the most well-known non-coding RNAs are tRNA (transfer RNA) and rRNA (ribosomal RNA). There are also the long non-coding RNA and long intergenic non-coding RNA (lncRNA and lincRNA) which are generally

greater than 200 nucleotides. Their functions include epigenetic regulation through gene silencing (i.e. XIST lnRNA is responsible for chromosome X inactivation). A different class of non-coding RNA, piRNA, or Piwi-interacting, Dicer-independent, RNA which are typically ∼ 26-30nt, which have been associated with regulating germline elements. They tend not contain defined secondary structure. Small nucleolar RNA (snoRNA) also correspond to a different class of non-conding RNA. They tend to be between 10-20nt long and generally target secondary modifications to other RNAs (i.e. methylation, pseudouridylation). Endogenous small interfering RNA (Endo-siRNA) are ∼ 21-22nt in length and form from endogenous sources and incorporate them into dsRNA complexes much similarly as siRNA, all reviewed in (Taft et al., 2010).

B. miRNA miRNA genes are encoded within the genome and can exist as either intergeneic (between coding genes) or intrageneic (within genes). They can be found at genomic clusters or as single genes and are involved in a wide range of cellular functions (i.e. differentiation, apoptosis). They can inhibit protein synthesis by either repressing translation and/or destabilizing/degrading mRNA. This is achieved through complementary binding of a 6-8nt stretch termed "seed sequence" in the miRNA to its target mRNA. The regulation of miRNA genes is still not fully understood, but it is well accepted that genes can be under the control of their own promoter or be co-transcribed with the coding gene in which they reside, as is often the case for intragenic miRNA. miRNA processing involves the initial cleavage of the pri-miRNA by a microprocessor complex containing the RNaseIII Drosha and the double-stranded RNA binding protein DGCR8 after RNA polymerase II or III transcription. The resulting 60-70nt pre-miRNA is then exported from the nucleus via Exportin-5 to be further processed via the RNaseIII endonuclease, Dicer. Then the ∼ 22nt single strand mature miRNA is incorporated in the RNA-induced silencing complex (RISC) containing Argonaute and able to regulate gene expression. Gene repression is often associated with the complementary sequence recognition at the 3' UTR of respective targets. However, now evidence exists that this binding is not strictly confined to the 3' UTR of mRNA and binding has been observed in the 5' UTR as well as the coding sequence (CDS) (Hausser et al., 2013; Liu et al., 2013).

Degree of evolution

Figure 15. The fraction of non-protein-coding DNA and megabases of protein-coding sequence (CDS) per haploid genome across species. A: The ratio of the total bases of non-protein-coding to the total bases of genomic DNA per sequenced genome across phyla (i.e. the percent ncDNA). The four largest prokaryote genomes and two well-known bacterial species are depicted in black. Single-celled organisms are shown in gray, organisms known to be both single and multicellular depending on lifecycle are light blue, basal multicellular organisms are blue, plants are green, nematodes are purple, arthropods are orange, chordates are yellow, and vertebrates are red. Species names are listed below section B of the figure. B:The amount (in megabases) of CDS per genome for species ranked by fraction of non-protein-coding DNA. A description of the calculation methods and references for each genome can be obtained upon request. Adapted from (Taft et al., 2007)

C. miRNA in melanoma The field of miRNA research in melanoma has been considerably rising. Several high throughput sequencing studies have divulged key functions of miRNA in melanoma. For example, the tumor suppressor PTEN mRNA is a target of the miR-106b-25 cluster, 181a, 21, and 200b among others, which

Figure 16. miRNA processing. This canonical maturation includes the production of the primary miRNA transcript (pri- miRNA) by RNA polymerase II or III and cleavage of the pri-miRNA by the microprocessor complex Drosha–DGCR8 (Pasha) in the nucleus. The resulting precursor hairpin, the pre- miRNA, is exported from the nucleus by Exportin-5–Ran-GTP. In the cytoplasm, the RNase Dicer in complex with the double-stranded RNA-binding protein TRBP cleaves the pre-miRNA hairpin to its mature length. The functional strand of the mature miRNA is loaded together with Argonaute (Ago2) proteins into the RNA-induced silencing complex (RISC), where it guides RISC to silence target mRNAs through mRNA cleavage, translational repression or deadenylation, whereas the passenger strand (black) is degraded. In this review we discuss the many branches, crossroads and detours in miRNA processing that lead to the conclusion that many different ways exist to generate a mature miRNA.(From (Winter et al., 2009))

are found to be up-regulated in melanoma (Karreth et al., 2011; Poliseno et al., 2010; Satzger et al., 2012; Yang et al., 2011). Additionally, miR-211 expression is regulated by MITF-M, and correlates with decrease invasive capabilities. Furthermore, it has been shown to target several receptor tyrosine kinases such as cKit and TGFβR2. Moreover, it was demonstrated as a regulator of POU3F2, as a result displaying a myriad of melanocyte/melanoma associated functions. Thus, it can be interpreted that miR-211 may serve as a prime candidate for a melanoma specific miRNA. Other miRNA have been shown to be up-regulated in melanoma and are associated with pro-survival. For instance, miR-148 was demonstrated to regulate MITF-M expression levels in MeWO melanoma cells (Haflidadottir et al., 2010). Moreover, miR-182 also targets MITF-M and FOXO3 and their expression is inversely correlated in human melanoma samples (Segura et al., 2009). miR-221 was demonstrated to target the TRK receptor, cKIT, decreasing colony forming potential and increasing proliferation (Felicetti et al., 2008; Igoucheva and Alexeev, 2009). More recently there has been a steady shift from studying the effects of single miRNA genes on cellular processes to determining aberrant functional miRNA signatures in cancers that may regulate several cellular mechanisms as a prognostic tool (reviewed in (Kunz, 2013)). miRNA clusters have been shown to drive tumorigenicity as well as better overall survival (Segura et al., 2010; Streicher et al., 2012). miRNA play an indispensable role in cellular homeostasis and malignancy. Thus further understanding of the biological roles these non-coding RNAs perform is invaluable to current research.

1. miR-203 and miR-199a-5p Currently, there still few known about the role of miR-203 and miR- 199a in melanoma; although increasing evidence suggests that they regulate key factors.

a) miR-203 Recently, miR-203 was shown to induce senescence by targeting E2F3 in MeWo melanoma cells (Noguchi et al., 2012). This was observed by an increased amount of senescence associated β-Galactosidase staining upon

miR-203 overexpression. Additionally, loss of miR-203 expression from 30 human primary melanoma compared to nevi significantly correlated with melanoma progression (Kozubek et al., 2013; Xu et al., 2012). Moreover, loss miR-203, as determined by in situ hybridization from human melanoma patients, at the invasive front correlated with increased tumor thickness and disease progression (van Kempen et al., 2012). These results place miR-203 as a potential important tumor suppressor miRNA in melanoma.

b) miR-199a-5p miR-199a has been identified to target oncogene c-MET and impair melanoma cell motility (Migliore et al., 2008). However, in a different study it was determined that miR-199a expression is a negative regulator of melanoma invasion and metastasis through the down-regulation of ApoE (Pencheva et al., 2012). Thus the role of miR-199a is yet to be fully elucidated in melanoma. Subsequently, miR-203 and miR-199a-5p have been demonstrated to target Caveolin-1 in breast and pancreatic cancer and in lung fibroblasts (Lino Cardenas et al., 2013; Miao et al., 2014; Orom et al., 2012). Thus the second part of my thesis work consists of elucidating the complex regulatory mechanisms of melanomagenesis through the interplay of β-catenin/Caveolin- 1 and the regulation of such axis by PTEN.

THESIS PROJECT

A. Effect β-catenin on melanosome trafficking and distribution

Melanosomes are indispensable internal structures for melanocytes. They serve as the repository of the photo-protective melanin responsible for the proper transport and transfer to surrounding cells. Preliminary studies from mouse melanocytes, established from transgenic mice containing a transcriptionally active form of β-catenin, demonstrated a peculiar localization of mature melanosomes at the cellular periphery. Interestingly, no such observation has been previously described. Given the importance of β-catenin in melanocyte homeostasis, we decided to investigate the implications of such phenomenon in vitro.

B. The role β-catenin/Caveolin-1 axis in melanomagenesis in mouse and humans Melanoma is the most aggressive type of skin cancer. Although it is not the most prevalent, it accounts for the most skin cancer related deaths. Current therapeutic approaches, although much improved, still fail to significantly increase survival once the disease has metastasized. Therefore it is paramount to gain full insight into the mechanisms which drive the disease.

The PI3K and MAPK pathways have important roles in melanomagenesis. PTEN expression is frequently altered in melanoma, but the role of PTEN is yet not fully understood. We found concomitant NRAS mutation and loss of PTEN in human melanoma biopsies and cell lines. Additionally, transgenic mice expressing an NRAS mutated form specifically in melanocytes developed melanoma. The specific inactivation of PTEN in melanocyte on such background induced dramatically the melanoma initiation by reducing the latency period of melanoma occurrence, increased radically the penetrance and lung metastasis formation. This prompted us to further investigate the role of active MAPK and PI3K signaling in melanoma initiation.

RESULTS

PRESENTATION OF RESULTS

The two major areas of research focus during my PhD consist of assessing the role of β-catenin in melanosome dynamics and to elucidate the interplay of β-catenin transcriptional regulation under constitutive NRAS activation and loss of PTEN.

A. Effect β-catenin on melanosome trafficking and distribution. The first part of the thesis is focused on evaluating of the importance of β- catenin gene regulation of melanosome trafficking in in vitro melanocytes. These results are presented as an article (Article 1), were I signed as co-first author.

β-catenin regulates melanosome trafficking through repression of Dynlt3. Alejandro Conde-Perez, Florian Rambow, Baptiste Hochet, Sylvie Coscoy, Francois Amblard, & Lionel Larue.

B. Part B. The role β-catenin/Caveolin-1 axis in melanomagenesis in mouse and humans. The second part of the thesis focuses on the molecular and physiological importance of β-catenin/Caveolin-1 signaling in tumorigenesis. These results are presented as an article (Article 2), were I signed as co-first author.

A Novel Caveolin-Dependent and PI3K/AKT-Independent Role of PTEN in β-Catenin Transcriptional Activity. Alejandro Conde-Perez, Gwendoline Gros, Christine Longvert, Malin Pedersen, Valérie Petit, Zackie Aktary, Amaya Viros, Florian Rambow, Boris C. Bastian, Andrew D. Campbell, Sophie Colombo, Isabel Puig, Alfonso Bellacosa, Owen Sansom, Richard Marais, Leon C.L.T. Van Kempen, & Lionel Larue.

Part A. Effect β-catenin on melanosome trafficking and distribution

These results are presented as an article (Article 1), were I signed as co-first author.

β-catenin regulates melanosome trafficking through repression of Dynlt3. Alejandro Conde-Perez, Florian Rambow, Baptiste Hochet, Sylvie Coscoy, Francois Amblard, & Lionel Larue.

ARTICLE 1

β-catenin regulates melanosome trafficking through repression of Dynlt3

β-catenin regulates melanosome trafficking through repression of

Dynlt3

Alejandro Conde-Perez1-4, Florian Rambow1-4, Baptiste Hochet1-4, Sylvie

Coscoy5, Francois Amblard5, & Lionel Larue1-4#

#Address correspondence to Lionel LARUE e-mail: [email protected] - Tel: (33) 1 69 86 71 07 - Fax: (33) 1 69 86 71 09 Institut Curie – Bat 110 - 91405, Orsay Cedex, France

Key words :

Running title :

ABSTRACT

The role of β-catenin in melanosome dynamics is largely unknown. Here we report that β-catenin actively regulates melanosome transport without affecting cytoskeletal constituents. Using mouse cell cultures established from transcriptionally active β-catenin transgenic mice (bcat*), we demonstrate an

altered melanosome distribution at the cell periphery. Counterintuitively,

quantification of trajectories through live microscopy, revealed enhanced

melanosome motility in mutant cells. Using integrative transcriptomics, we

identify a dynein light chain (Dynlt3) as a putative target of β-catenin.

Cytoplasmic dynein light chains (DLC) are involved in the plus to minus microtubule associated vesicular transport of various organelles. We showed that knockdown of Dynlt3 in wild-type murine melanocytes mimics the peripheral accumulation of melanosomes in observed in bcat* cells. Lastly, we confirmed that Dynlt3 is bona fide target of β-catenin. All together, our results

enlighten a novel function for β-cat in melanosome trafficking through the regulation of Dynlt3.

INTRODUCTION

Before being transferred to keratinocytes, mature pigmented melanosomes are first transported to the peripheral area of the cell by long-range, bidirectional, microtubule-dependent movements and are then transferred to actin filaments. The latter of which relies on unidirectional, local movement at the cell periphery. The molecular mechanism associated with the movement on actin filaments is well documented and depends on Rab27A-melanophilin- myosin Va (Hume and Seabra, 2011). In contrast, the bidirectional movement

of the melanosomes on microtubules is poorly known. It has been suggested recently that Rab1A facilitates long-range anterograde melanosome transport

(Ishida et al., 2012). Additionally, retrograde transport might be regulated by

Melanoregulin through its association to the dynein-dynactin motor complex

(Ohbayashi et al., 2012).

Cytoplasmic Dynein motors are macromolecular structures comprised of several subunits which are activated by binding to dynactin (Burkhardt et al., 1997). Heavy, intermediate, and light chains, all of which once assembled can transport cargo to different areas (King, 2003). The heavy chains comprise the globular domain which physically interacts with microtubules to generate forward motion. This process is regulated by a continuous hydrolysis of ATP into ADP (Mocz and Gibbons, 2001). The intermediate chains anchor the globular domain to the light chains and serve as “stalks” allowing for the generation of maximum torque from the point of fulcrum, the light chains.

Dynein light chains, from the Tctex family, act as non-catalytic accessory components and can direct microtubule trafficking from the plasma membrane to the nucleus and have been studied as an alternative to gene delivery

(Favaro et al., 2014; Toledo et al., 2013).

β-catenin is an important factor that controls melanocyte development and homeostasis. It can reside at focal adhesion junctions in a complex with cadherins, where it plays a role in cell-cell adhesion (Orsulic et al., 1999). β- catenin also interacts in the nucleus with co-transcriptional regulators Lef/Tcf factors modulating gene expression. It has been shown to directly influence melanocyte differentiation by inducing M-MITF expression (Takeda et al.,

2000). However, nothing is known about the function of β-catenin in regulating

melanosome dynamics.

We directly investigated the possible role of β-catenin in a melanosome centric manner. Using several in vitro cellular models we demonstrated that β- catenin transcriptional activity directly affects melanosome trafficking by modulating Dynein light chain (Dynlt3) levels subsequently resulting in perinuclear exclusion of melanosomes. Thus we provide first hand evidence for a regulatory function of β-catenin in melanosome trafficking.

RESULTS

Nuclear β-catenin overexpressing melanocytes display atypical melanosome distribution

We previously demonstrated that mutant expressing nuclear β-catenin melanocytes (bcat*) have impaired cellular motility early on during embryogenesis, as well as the resulting melanocytes (Gallagher et al., 2013).

However, the overall status of melanosomes was not fully characterized. We reasoned that subtle melanosome abnormalities remain undetected since through rough analysis have never been carried out. In this regard, using high magnification bright field microscopy, we observed an abnormal distribution pattern of melanosomes in bcat* melanocytes compared to wild-type (Figure

1A). Bcat* cells appeared to have an increased melanosome density at the periphery as opposed to a more perinuclear, as delineated by DAPI staining, concentration in the wild-type cells, (Figure 1B). In order to exclude that the observed differences in melanosome localization is due to reduced melanosome numbers, we counted the number of melanosomes from 20 wild- type and 15 bcat* mutant cells using the ImageJ Analyze Particle feature. No observable difference was found in the distribution of total melanosome numbers. We proceeded to quantify the number of melanosomes within a

15um diameter centered on the nucleus and corresponding to microtubule enriched region. We observed a significant reduction in the melanosomes near the perinuclear area in bcat* mutant cells compared to wild-type (Figure

1D).

β-catenin regulates abnormal melanosome distribution independently of cytoskeletal organization

Initial observations suggested that β-catenin perhaps may be associated with melanosome distribution. To this end we decided to modulate the levels of beta-catenin in wild-type as well as in bcat* mutants melanocytes. In this respect, we overexpressed a transcriptionally active form of β-catenin which lacks the proteosomal targeting exon 3 altogether, in wild-type cells.

Interestingly, β-catenin overexpression resulted in the exclusion of melanosomes within the perinuclear area as determined by a 15µm diameter

(Figure 2A). These results accurately mimic the abnormal phenotypic melanosome distribution in the bcat* melanocytes. Moreover, we performed the reverse experiment wherein by we downregulated β-catenin expression in bcat* mutant cells. Consistent with our prior observations, β-catenin knockdown results in complete restoration of proper melanosome distribution

(Figure 2B). In order to exclude that the bcat* mutant phenotype is due to impaired microtubules or actin filaments formation; we performed immunofluorescence for alpha-tubulin and FITC conjugated phalloidin.

Surprisingly, we did not observe any disturbance in either cytoskeletal organization (Figure 2C,D). Bcat* melanocytes much like wild-type melanocytes display peripheral concentration of actin filaments and are able to form actin stress fibers (Figure 2C). Furthermore, the tubulin cytoskeletal system appear unaffected in bcat* melanocytes (Figure 2D).

Bcat* melanosomes exhibit enhanced motility

All together, the aforementioned results imply that β-catenin regulates

melanosome distribution irrespective of cytoskeletal organization. We

wondered whether this aberrant distribution of melanosomes was a result of

dysfunctional motility. To this end, using time-lapse live microscopy we

followed the trajectory of melanosomes in wild-type and bcat* melanocytes.

Bright field movies were constructed by capturing frames every half a second

for an interval of 300 s (Figure 3A,B). Direct observation of melanosome

movements revealed that generally motion is composed of variable and

intermittent migration, with high level of pauses followed by short bursts of

movements, as previously reported (Lopes et al., 2007; Palmisano et al.,

2008). Perplexingly however, bcat* melanosomes displayed enhanced motility when compared with wild-type melanosomes. On average, bcat* melanosomes traveled longer distances than in wild type melanocytes (Figure

3C). Additionally, the average distance and velocity were also observed to significantly increase (Figure 3D,E). The amount of times were successive frames recorded no difference in motion can be interpreted as the amount of pausing each melanosome undertakes throughout the duration of the movie, which can be accurately quantified. Interestingly, bcat* melanosomes generally paused less frequently than wild-type melanosomes (Figure 3F). In fact, approximately 63% of melanosomes tracked in wild-type cells registered movement in only 20% of the entire movie compared to 32% for bcat* melanosomes (Figure 3G). Furthermore, pausing distribution profile of melanosomes from wild-type and bcat* melanocytes binned in three

increasing categories 0-40%, 40-80%, and ≥80% demonstrate that most of

the bcat* melansomes actively move more than wild-type melanosomes.

β-catenin affects key vesicle trafficking genes

The lack of microtubule and actin filament disruption and increased melanosome motility in bcat* melanocytes, suggests that β-catenin regulates key elements of the transport of melanosomes. In this regard, using a supervised approach, we examined the expression of 67 genes known regulate Lysosomal Related Organelles (LRO), including melanosomes, functions such as transport, maturation, biogenesis, and elimination (Table 1).

Mouse Affymatrix expression arrays were used to determine mRNA levels.

Ratio of expression between bcat* and wild-type melanocytes from all of the

67 genes results in two distinct groups, upergulated and downregulated as determined by a cutoff of 1.5 and 0.5 (Figure 4A). Several upregulated genes include members of the myosin family, Myo6 and MyoVa. Amongst, the downregulated genes several are associated with vesicle trafficking Dnaic1

(DNAI1 human homolog), Dynlt3, and Muted (Zhang et al., 2002). Using the same cutoff criteria we integrated miRNA expression with the expression profiles of the 67 genes using Partek Genomic Suite miRNA integration feature. We identified 10 potential miRNA inversely correlated with 5 of mRNA. Interestingly, miR-125b-5p emerged as a potential regulator for Dynlt3 and Rad3D.

Knockdown of Dynlt3 in wild-type melanocytes phenocopies melanosome distribution in bcat* melanocytes

Dynlt3 is a member of the Tctex-type 3 family of Dynein motor light chain implicated in retrograde transport (Schneider et al., 2011). Given that we observed an exclusion of melanosomes in the perinuclear area with increased concentration at the periphery and enhanced motility in bcat* melanocytes irrespective of cytoskeletal components, we wondered whether these effects can be recapitulated by modulating the levels of Dynlt3. To this end, we transiently reduced the levels of Dynlt3 in wild-type melanocytes. Surprisingly, bright field microscopy revealed that knockdown of Dynlt3 phenocopied the exclusion of melanosomes from the perinuclear area observed in bcat* melanocytes (Figure 5A). Moreover, quantification of melanosomes within the perinuclear area resulted in a significant decrease in the number of melanosomes with knockdown of Dynlt3 compared to scrambled control

(Figure 5B). Surprisingly, total number of melansomes, from 20 wild-type and

25 bcat* melanocytes, after knockdown of Dynlt3 was less than control

(Figure 5C). However, total melanin remain unchanged after knockdown

(Figure 5D,E). We validated the efficacy of silencing via real-time PCR and observed approximately a 55% knockdown (Figure 5F).

β-catenin and miR-125b-5p inhibit Dynlt3 levels

Lastly, we considered that nuclear β-catenin may in fact transcriptionally repress the expression of Dynlt3 resulting in increased melanosome motility and density at the periphery of the cells. To this extent, we predicted putative transcription factor binding sites in the 1.7kb proximal promoter of the mouse

Dynlt3 gene using TRANFAC (BIOIBASE) prediction algorithm (Figure 6A).

We identified 3 putative Lef1/Tcf7l2 and 1 putative Lef1 site. We proceeded to determine whether modulating the levels of β-catenin would have any effect on Dynlt3 expression. As expected, siRNA mediated silencing of β-catenin in bcat* melanocytes increases the mRNA and protein levels of Dynlt3 (Figure

6B,C). Additionally, overexpression of transcriptionally active β-catenin in wild-type melanocytes results in significant decrease of Dynlt3 protein levels

(Figure 6D). In light of the fact that that miR-125b-5p is upregulated in bcat* melanocytes compared to wild-type and Dynlt3 is a predicted target, we wondered whether miR-125-5p can also regulate Dynlt3 in vitro. We thus localized the putative binding region of miR-125b-5p to the 3’ UTR of Dynlt3

(position 1164-1170) (Figure 6E). Subsequently, overexpression of miR-125b-

5p mimics in bcat* melanocytes does not have an effect on the mRNA levels of Dynlt3 (Figure 6F). Surprisingly however, protein levels of Dynlt3 are drastically reduced upon over expression of miR-125b-5p mimics (Figure 6G).

These results suggest that miR-125b-5p acts as a translational inhibitor in liaison with β-catenin, direct transcriptional regulation, to suppress the levels of Dynlt3.

DISCUSSION

β-catenin has an indispensable role in melanocyte homeostasis. A plethora of

melanocyte functions have been attributed to β-catenin activity, ranging from

melanocyte differentiation to pigmentation and melanocyte dendricity

(Enshell-Seijffers et al., 2010; Hari et al., 2012; Ikeya et al., 1997; Kim et al.,

2010; Yamada et al., 2013). However, there is few if any evidence suggesting

that β-catenin can directly influence melanosome dynamics. Our data formally identifies a novel role of β-catenin in meleanosme trafficking.

Firstly, we observed an impaired spatial distribution melanosomes in melanocytes cells isolated from transgenic mice carrying a transcriptionally active form of β-catenin. This phenomenon is not caused by disruption of the underlying microtubule or actin filament networks.

Throughout the study we became aware of the similarity in phenotype of the bcat* melanocytes to the OA1 (Ocular albinism 1/G-protein coupled receptor 143) melanocytes. Oa1 null melanocytes display perturbed melanosme distribution, with peripheral accumulation, as well as the occurrence of macromelanosomes (Palmisano et al., 2008). However, we did not identify a clear indication which would suggest that our mutant cell melanosome phenotype was a result of Oa1 dysregulation. Be that as it may, we cannot fully exclude that Oa1 may play a role in our observed phenotype.

Using a supervised approached, mRNA levels of known components of

Lysosomal Related Organels (LRO) including melanosome homeostasis, we identified several mRNAs which were dysregulated in mutant cells compared to wild-type. Amongst others, a component of the dynein motor macromolecular structure, Dynlt3 (dynein, light chain, Tctex-type 3), was

found downregulated in mutant cells. Interestingly, not only is Dynlt3 implicated in plus to minus as part of the Dynein motor complex, it functions as the interface between the cargo and the motor. As such, we were able to demonstrate through siRNA mediated knockdown, that Dynlt3 downregulation is sufficient to recapitulate the observed perinuclear exclusion of melanosomes in the bcat* melanocytes.

Lastly, we demonstrate that β-catenin can actively regulate the levels of Dynlt3. We identified several putative transcription factor binding sites in the proximal promoter region of the mouse Dynl3. Consistently, we were able to demonstrate reversible regulation of Dynlt3 mRNA and protein upon β-

catenin modulation. Additionally, we observed a multi-layered regulation of

Dynlt3 through miR-125b-5p translational inhibition, suggesting a tightly

controlled inhibitory loop. Ultimately, these results expand on the role of β- catenin in melanocyte function and identify a novel protein required for proper melanosome intra-cellular trafficking.

MATERIAL AND METHODS

Cell culture Mouse primary melanocyte cell lines were established as previously

described (Berlin et al., 2012; Delmas et al., 2007). Melanocyte cell lines were

grown in F12 media (GIBCO, #), supplemented with 10% FBS (GIBCO,

#10270-106), 1% Penicillin-Streptomycin (GIBCO, #15140), 1% L-Glutamine

(GIBCO, #25030), and 100nM TPA (Sigma # P1585-1MG).

Western blotting Whole cell lysate was prepared from melanocyte cell lines using RIPA buffer.

Membranes were probed with antibodies against Dynlt3 (Sigma, hpa003938),

β-catenin (Abcam, #ab-6302), GFP (Abcam), and β-actin (Sigma, #A5441).

Immunofluorescence microscopy Primary murine melanocytes were grown on 18mm glass cover slips prior

immunofluorescence analysis. Cells were fixed in 4%PFA for 20 min at RT

followed by permeabilization with 0.2% v/v PBS/Triton X-100 for 5 min at RT.

Then, cells were washed twice with PBS and blocked with 1% BSA (w/v),

10% FBS in PBS for 20 min at RT. Cells were then incubated with primary

antibody for anti-αTubulin (Sigma T9026), or FITC conjugated phalloidin

(Sigma P-5282) at 4°C overnight. Alexa 555 anti-rabbit (Sigma) or Alexa 488

anti-mouse (Sigma) were used accordingly as secondary antibody, and

incubated for 1h at RT in the dark. Cells were counterstained with 0.5µg/µL

DAPI to visualize the nucleus.

Live microscopy Cells were seeded in 24-well glass plates (MatTek Corporation #P24G-1.5-

13-F) and were imaged using a Leica in a humidified atmosphere of 37°C and 5% CO2, under the control of the Metamorph® software using 100X OIL

immersion objective. Approximately, 10 melanosome trajectories were

followed per cell from 7-8 cells per genotype from two independent

experiments. Images were acquired using a Leica DMI 6000 B microscope

equipped with a Evolve (Photometric Technology) camera at ½ second

intervals for a duration of ≈ 6 minutes resulting in a total of 601 frames.

Melanosome tracking Trajectories were manually followed using the Manual Tracking plugin for

ImageJ developed by F. Cordelières (http://rsbweb.nih.gov/ij/plugins/track/t

rack.html). Each melanosome path was taken at random from each genotype.

siRNA knockdown siRNA targeting mouse β-catenin (35) and Dynlt3 were purchased from

Dharmacon as a SMART pool mix of 4 sequences a. β-catenin: 5'-GAA CGC

AGC AGC AGU UUG U-3', 5'-CAG CUG GCC UGG UUU GAU A-3', 5'- GCA

AGU AGC UGA UAU UGA C-3', 5'- GAU CUU AGC UUA UGG CAA U-3'. si scrambled, with no known human targets, was purchased from Invitrogen as a mix. Briefly, cells were transfected with 100pmol siβ-catenin or si Scrambled

(siScr)

semi-quantitative Real-time PCR Total RNA was extracted from cells using miRNeasy kit from Qiagen (217004) according to manufactures suggestions. Reverse transcription reactions were performed with 250-500 ng of total RNA and M-MLV reverse transcriptase

(Invitrogen), according to the manufacturer’s instructions. The cDNA

generated was then subjected to quantitative real-time PCR for the analysis of

gene expression using ABI 7900HT. Oligonulceotides used for sqRT-PCR

were as follows; β-catenin Fwd 5’ CGTGGACAATGGCTACTCAA 3’ Rv 5’

TGT CAG CTC AGG AAT TGC AC 3’, Dynlt3 Fwd 5’ GCG ATG AGG TTG

GCT TCA ATG CTG 3’ Rv 5’ CAC TGC ACA GGT CAC AAT GTA CTT G 3’,

Gapdh Fwd 5’ ACC CAG AAG ACT GTG GAT GG 3’ Rv 5’ CAC ATT GGG

GGT AGG AAC AC 3’.

Transfections All cells were transfected using Magnetofectamine (OZ Biosciences)

according to the manufactures recommendations. miR-125b-5p expression

was induced using miRIDIANTM 125b-5p mimic and appropriate control.

Plasmid transfections were as follows; briefly cells were plated on either 6 or

12 well plates and allowed a minimum of 24h to recover. Cells were either

transfected with 750ng of control CMV::GFP (#1084), CMV::βcatΔexon3-GFP

(#775), 50µM mimic control, or mimic miR-125b-5p. The mRNA and protein

content were collected at approximately 48h post-transfection for analysis.

Statistical analysis Statistical significance was determined using Graphpad Prism software. Real-

time experiments were performed at least 3 times with statistical significance

determined using Mann-Whitney, *, **, ***,**** signify p < .05, p < .01, p <

.001, p < .0001 respectively.

Melanosome quantification Melanosome quantification was performed using ImageJ Analyze Particle

feature. Size was maintained at 0-infinity µm^2 and circularity at 0-1. Average

melanosome size was determined to be 13 ± 8 pixels. Areas with larger or smaller than the range were adequately adjusted based on our predetermined size range. All images were adjusted equally before the analysis. To exclude melanosmes nearby the nuclear region, a circle of 15µm was designated as an arbitrary region of separation.

Acknowledgements

ACP was supported by a fellowship from Institut Curie. We are grateful to the

Rimbaud family for its donation to our laboratory. This work was supported by the Ligue Nationale Contre le Cancer (Equipe labellisée) and INCa.

REFERENCES

Berlin, I., Denat, L., Steunou, A. L., Puig, I., Champeval, D., Colombo, S., Roberts, K., Bonvin, E., Bourgeois, Y., Davidson, I., et al. (2012). Phosphorylation of BRN2 modulates its interaction with the Pax3 promoter to control melanocyte migration and proliferation. Molecular and cellular biology 32, 1237‐47. Burkhardt, J. K., Echeverri, C. J., Nilsson, T., and Vallee, R. B. (1997). Overexpression of the dynamitin (p50) subunit of the dynactin complex disrupts dynein‐dependent maintenance of membrane organelle distribution. The Journal of cell biology 139, 469‐84. Delmas, V., Beermann, F., Martinozzi, S., Carreira, S., Ackermann, J., Kumasaka, M., Denat, L., Goodall, J., Luciani, F., Viros, A., et al. (2007). Beta‐catenin induces immortalization of melanocytes by suppressing p16INK4a expression and cooperates with N‐Ras in melanoma development. Genes & development 21, 2923‐35. Enshell‐Seijffers, D., Lindon, C., Wu, E., Taketo, M. M., and Morgan, B. A. (2010). Beta‐catenin activity in the dermal papilla of the hair follicle regulates pigment‐type switching. Proceedings of the National Academy of Sciences of the United States of America 107, 21564‐9. Favaro, M. T., De Toledo, M. A., Alves, R. F., Santos, C. A., Beloti, L. L., Janissen, R., De La Torre, L. G., Souza, A. P., and Azzoni, A. R. (2014). Development of a non‐viral gene delivery vector based on the dynein light chain Rp3 and the TAT peptide. Journal of biotechnology 173, 10‐8. Gallagher, S. J., Rambow, F., Kumasaka, M., Champeval, D., Bellacosa, A., Delmas, V., and Larue, L. (2013). Beta‐catenin inhibits melanocyte migration but induces melanoma metastasis. Oncogene 32, 2230‐8. Hari, L., Miescher, I., Shakhova, O., Suter, U., Chin, L., Taketo, M., Richardson, W. D., Kessaris, N., and Sommer, L. (2012). Temporal control of neural crest lineage generation by Wnt/beta‐catenin signaling. Development 139, 2107‐17. Hume, A. N., and Seabra, M. C. (2011). Melanosomes on the move: a model to understand organelle dynamics. Biochemical Society transactions 39, 1191‐6. Ikeya, M., Lee, S. M., Johnson, J. E., Mcmahon, A. P., and Takada, S. (1997). Wnt signalling required for expansion of neural crest and CNS progenitors. Nature 389, 966‐70. Ishida, M., Ohbayashi, N., Maruta, Y., Ebata, Y., and Fukuda, M. (2012). Functional involvement of Rab1A in microtubule‐dependent anterograde melanosome transport in melanocytes. Journal of cell science 125, 5177‐87. Kim, J. H., Sohn, K. C., Choi, T. Y., Kim, M. Y., Ando, H., Choi, S. J., Kim, S., Lee, Y. H., Lee, J. H., Kim, C. D., et al. (2010). Beta‐catenin regulates melanocyte dendricity through the modulation of PKCzeta and PKCdelta. Pigment cell & melanoma research 23, 385‐93. King, S. M. (2003). Organization and regulation of the dynein microtubule motor. Cell biology international 27, 213‐5.

Lopes, V. S., Ramalho, J. S., Owen, D. M., Karl, M. O., Strauss, O., Futter, C. E., and Seabra, M. C. (2007). The ternary Rab27a‐Myrip‐Myosin VIIa complex regulates melanosome motility in the retinal pigment epithelium. Traffic 8, 486‐99. Mocz, G., and Gibbons, I. R. (2001). Model for the motor component of dynein heavy chain based on homology to the AAA family of oligomeric ATPases. Structure 9, 93‐103. Ohbayashi, N., Maruta, Y., Ishida, M., and Fukuda, M. (2012). Melanoregulin regulates retrograde melanosome transport through interaction with the RILP‐p150Glued complex in melanocytes. Journal of cell science 125, 1508‐18. Orsulic, S., Huber, O., Aberle, H., Arnold, S., and Kemler, R. (1999). E‐ cadherin binding prevents beta‐catenin nuclear localization and beta‐catenin/LEF‐1‐mediated transactivation. Journal of cell science 112 ( Pt 8), 1237‐45. Palmisano, I., Bagnato, P., Palmigiano, A., Innamorati, G., Rotondo, G., Altimare, D., Venturi, C., Sviderskaya, E. V., Piccirillo, R., Coppola, M., et al. (2008). The ocular albinism type 1 protein, an intracellular G protein‐coupled receptor, regulates melanosome transport in pigment cells. Human molecular genetics 17, 3487‐501. Schneider, M. A., Spoden, G. A., Florin, L., and Lambert, C. (2011). Identification of the dynein light chains required for human papillomavirus infection. Cellular microbiology 13, 32‐46. Takeda, K., Yasumoto, K., Takada, R., Takada, S., Watanabe, K., Udono, T., Saito, H., Takahashi, K., and Shibahara, S. (2000). Induction of melanocyte‐specific microphthalmia‐associated transcription factor by Wnt‐3a. The Journal of biological chemistry 275, 14013‐6. Toledo, M. A., Favaro, M. T., Alves, R. F., Santos, C. A., Beloti, L. L., Crucello, A., Santiago, A. S., Mendes, J. S., Horta, M. A., Aparicio, R., et al. (2013). Characterization of the human dynein light chain Rp3 and its use as a non‐viral gene delivery vector. Applied microbiology and biotechnology. Yamada, T., Hasegawa, S., Inoue, Y., Date, Y., Yamamoto, N., Mizutani, H., Nakata, S., Matsunaga, K., and Akamatsu, H. (2013). Wnt/beta‐ catenin and kit signaling sequentially regulate melanocyte stem cell differentiation in UVB‐induced epidermal pigmentation. The Journal of investigative dermatology 133, 2753‐62. Zhang, Q., Li, W., Novak, E. K., Karim, A., Mishra, V. S., Kingsmore, S. F., Roe, B. A., Suzuki, T., and Swank, R. T. (2002). The gene for the muted (mu) mouse, a model for Hermansky‐Pudlak syndrome, defines a novel protein which regulates vesicle trafficking. Human molecular genetics 11, 697‐706.

FIGURE LEGENDS

Figure 1. Melanosomes are mislocalized towards the peripheral area in bcat* cells. (A) Representative Wild-type and bcat* mutant melanocytes under bright field microscopy displaying melanosomes as visibly dark points.

Increased magnification of melanosomes in upper right square. (B) Bright field microscopy demonstrating the perinuclear exclusion of melanosomes in the bcat* mutant melanocytes and increased density at the peripheral regions.

DAPI counter stained was used to delineate the nucleus (merge). The merge demonstrates decreased overlap between the nucleus and melanosomes

(pseudocolored in green for visual clarity) in bcat* mutant cells. (C) Total number of melanosomes as counted by using Image J Analyze Particles feature (see Material and Methods). There is no significant difference in total melanosome content in bcat* melanocytes compared to wild-type. (D) Percent of melanosomes in 15µm diameter circle containing the nucleus (see Material and Methods) in wild-type and bcat* melanocytes. Box plot (max and min wiskers) demonstrating significant difference in melansomes contained within

15µm diameter circle around the perinuclear area in wild-type and bcat* melanocytes. Results represent the mean ± SD of pooled data from 2-3 independent experiment. Significant difference was determined by Mann-

Whitney test; ns signifies p > .05 and *** signifies p < .001. Scale bar = 10µm.

Figure 2. β-catenin affects melanosome distribution without disruption of cytoskeletal components. (A) Bright field microscopy of wild-type cells transiently overexpressing a nuclear targeted form of β-catenin (CMV::βcat-

GFP). Melanosome exclusion from the perinuclear area (arrowhead) as

determined by a 15µm diameter circle in wild-type cells transfected with β-

catenin compared to non-transfected cells. Β-catenin overexpression as

determined by GFP fluorescence. (B) Bright field microscopy of siRNA

mediated knockdown of β-catenin (si βcat) in mutant bcat* cells and scrambled control (si Scr). Knockdown of β-catenin results in complete rescue of the peripheral localization defect. (C) Representative melanosome

distribution, as visualized by bright field microscopy, in relation to actin

filaments via immunofluorescence with FITC conjugated anti-phalloidin, in

wild-type and bcat* mutant melanocytes. Circles indicate perinuclear area as

previously defined. (D) Similarly, melanosome distribution, determined by

bright field microscopy, in conjunction to microtubule organization, indirectly

visualized using alpha-tubulin antibody. Cells were counterstained with DAPI

to visualize the nucleus (merge). Scale bar = 10µm.

Figure 3. Melanosomes in bcat* mutant melanocytes display enhance

motility. (A,B) Bright field image stills from time-lapse video microscopy from

representative wild-type and bcat* melanocytes during an interval of 300

seconds. Rectangular box constitutes trajectory from a representative

melanosome track, green (WT) blue (bcat*). Arrowhead indicate melanosome

position at corresponding time intervals. (C,D) Total and average distance

calculated using Image J Manual tracking plugin (see Material and Methods)

in µm from both wild-type and bcat* melanocytes. (E) Average melanosome velocity from both wild-type and bcat* melanocytes in µm/sec. Melanosomes migrate faster and longer in bcat* melanocytes compared to wild-type. (F)

Histogram of the percent of melanosomes static, calculated as the ratio of number of frames with no motion registered/total number of frames during the entirety of trajectory. (G,H) Histograms depicting the percentage of

melanosomes “stopped”, classified as melanosomes that have more than

80% of the frames register no motion, as well as the overall distribution (H).

The large majority of the melanosomes in bcat* melanocytes pause less compared to wild-type melanosomes. Trajectories were pooled from 2 independent experiments in which 70 bcat* melanosomes and 74 wild-type melanosomes were followed. Melanosomes were randomly selected to be followed by live microscopy from different regions of the cell associated with microtubule migration. Statistical significance was determined by Mann-

Whitney test; **** signifies p < .0001.

Figure 4. mRNA and miRNA expression profiles in bcat* and wild-type melanocytes. (A) Ratio of expression between wild-type and bcat* melanocytes from Affymatrix mRNA transcriptomic analysis from 67 genes associated with melasosomes and other lysosomal related organelles (LRO).

(B) miRNA integration using PARTEK Genomic Suite targeting the 67 mRNA through sequence conservation (Targescan 6.0) with 1.5 and 0.5 expression cutoff.

Figure 5. Dynlt3 downregulation in wild-type cells mimics bcat* melanosome atypical distribution. (A) Bright field microscopy of wild-type cells treated with scrambled siRNA (si Scr) or siRNA targeting the Dynein light chain motor

Dynlt3 (si Dynlt3). Melanosome (pseudocolored in green) distribution is affected upon deletion of Dynlt3. Exclusion of melanosomes from the perinuclear area, delineated by DAPI staining (merge), evident in si Dynlt3 treated wild-type melanocytes. (B) Percent of melanosomes in 15µm diameter circle containing the nucleus (see Material and Methods) in si Scr and si

Dynlt3 treated wild-type melanocytes. Box plot (max and min wiskers)

showing significant difference in melansomes contained within 15µm diameter

circle around the perinuclear area, in si Scr compared to si Dynlt3 treated

cells (C) Total number of melanosomes as counted by using Image J Analyze

Particles feature (see Material and Methods). Significant reduction in the total

amount of melanosomes was noted in si Dynlt3 treated wild-type cells

compared to si Scr. (D) Photomicrograph of melanin pelleted from siRNA

treated wild-type cells 48h post-transfection. (E) Total melanin quantification

of si Scr and si Dynlt3 treated wild-type cells. No significant difference in total

melanin content was observed. (F) Real-time PCR for the expression of

Dynlt3 in wild-type melanocytes after siRNA mediated silencing using siRNA

targeting Dynlt3 (si Dynlt3) and scrambled control (si Scr). Results were

pooled from 2 independent experiments. Statistical significance was

determined by Mann-Whitney test; ns signifies p > .05, * signifies p < .05, **

signifies p < .01, *** signifies p < .001.

Figure 6. β-catenin negatively regulates Dynlt3 expression in a direct and indirect manner. (A) Transcription factor binding prediction using TRNAFAC on the proximal promoter of mouse Dynlt3. Three putative Lef1/Tcf7l2 binding sites and one Lef1 were predicted in the promoter sequence of the mouse

Dynlt3 gene. (B) Significant upregulation of mRNA expression levels of Dynlt3 after siRNA downregulation of β-catenin in bcat* melanocytes. (C) Western blot analysis of whole cell lysates from bcat* melanocytes treated with si Scr or si β-cat showing increased Dynlt3 protein expression. (D) Dynlt3 protein levels post-transfection with CMV::GFP or CMV::βcat-GFP in wild-type melanocytes. Significant reduction of Dynlt3 is observed in wild-type

melanocytes overexpressing βcat-GFP. (E) Putative miR-125b-5p binding, with a 7mer seed sequence, in the 3’ UTR of Dynlt3 mRNA as predicted by the sequence conservation miRNA prediction algorithm Targetscan. (F) mRNA expression levels of Dynlt3 after overexpression with miR-125b-5p mimics in bat* melanocytes. No significant difference was observed at the mRNA level when compared with control. (G) Western blot analysis of whole cell lysates from bcat* cells overexpressing miR-125b-5p mimics and blotted for Dynlt3. Experiments were performed a minimal of 3 independent times.

Statistical significance was determined by Mann-Whitney test; ns signifies p >

.05, *** signifies p < .001.

A wild-type bcat*

B bright field DAPI merge (green false colored)

wild-type

bcat*

CDns

8000 40 ***

6000 30

4000 20 μm diameter

2000 10 Percent of melanosomes within 15

Total number of melanosomes Total 0 0 wild-type bcat* wild-type bcat* n = 20 n = 15 n = 19 n = 14

Figure 1 ABnon-transfected CMV::βcat-GFP Bright field

si Scr GFP

si βcat C bright field phalloidin merge

wild-type

bcat*

D bright field alpha-tubulin merge

wild-type

bcat* Figure 2 A

wild-type

B t = 0 s t = 60 s t = 120 s t = 180 s t = 240 s t = 300 s

bcat*

t = 0 s t = 60 s t = 120 s t = 180 s t = 240 s t = 300 s

CDETotal distance Average distance Average velocity

0.4 150 **** **** 0.5 **** 0.3 0.4 100 0.3 m m μ μ 0.2 m/sec

μ 0.2 50 0.1 0.1 0 0.0 0.0 wild-type bcat* wild-type bcat* wild-type bcat*

FGH% static during trajectory % of melanosomes that are Distribution of percent pausing 80% of the time stopped **** 100 100 80 0-40 40-80 80 80 60 > 80 60 60 40 percent percent percent 40 40 20 20 20

0 0 0 wild-type bcat* wild-type bcat* wild-type bcat*

Figure 3 B A 0. 0. 1. 1. 2. 2. 3. 0 5 0 5 0 5 0

MYO6 D2ERTD391E LYST MYO5A BLOC1S1 SLC45A2 RABGGTA BLOC1S2 HPS5 OCA2 HPS3 KIF13A MLANA RAB38 BLOC1S3 TRAPPC6A FIG4 RAB32 STX17 VPS33A GPNMB MLPH HPS4 DCT

Figure 4 GPR143 TYRP1 BACE2 Ratio ofexpression

VPS39 (bcat* vswild-type) RAB27A AP3D1 VPS18 AP3B1 AP1S3 SI AP1M2 F2RL1 VAC14 KIF5B VPS33B VPS11 HPS6 CNO VPS41 ATG7 PLDN KIF3B AP1S2 RAB11B VPS16 SNAPIN TYR RILP AP3M1 DTNBP1 TSG101 AP1S1 MREG HPS1 DCTN1 KIF3A AP3S1 DNAIC1 DYNLT3 FHIT MUTED RAB31 RAB3D Si Dynlt3 Si scr A B Percent of melanosomes within 15μm diameter 10 20 30 40 0 9n= 22 n =19 si Scr *** si Dynlt3 C

Total number of melanosomes 200 400 600 800 0 0 0 0 0 0n= 25 n =20 si Scr ** si Dynlt3 E D Dynlt3 mRNA in wild-type F melanocytes

0.0 0.5 1.0 1.5 2.0 pg melanin/μg total protein 0 2 4 6 8 si scr melanin quantication si Scr si Scr Figure 5 ns si dynlt3 * si Dynlt3 si Dynlt3 A Chr. X A1.1 Tcf7l2 Tcf7l2 Tcf7l2 TSS Lef1 Lef1 Lef1 Lef1

Dynlt3 exon 1 exon 2 -1463 -1309 -1132 -962

BD3 *** Wild-type 2 GFP βcat-GFP 130kda mRNA in bcat* 1 β-cat 100kda

Dynlt3 melanocytes 0 130kda si Scr si βcat GFP bcat* 35kda C si Scr si βcat β-cat 15kda Dynlt3 Dynlt3

β-actin β-actin 40kda

E Mouse Dynlt3 3’ -UTR 5' . . . CAGGUUAUCUAAUAUCUCAGGG C . . . 1164-1170 Mir-125b-5p 3' AGUGUCCAAUUUCCCA----GAGUCCC U FG 2.0 mimic mimic c 1.5 ns 125b-5p 1.0 Dynlt3

mRNA in mRNA 0.5

0.0 β-actin Dynlt3 bcat* melanocytes mimic c mimic 125b-5p

Figure 6 Gene Gene Product Human Mouse Stage Disease Model TYR TYR OCA1 Albino Maturation OCA2 OCA2/P OCA2 Pink eye Maturation dilution TYRP1 TYRP-1 OCA3 Brown Maturation SLC45A2 SLC45A2/MATP OCA4 Underwhite Maturation DCT DCT/TRP-2 Salty Maturation PMEL PMEL/Pmel17/Silver/gp100 Silver Maturation GPR143 GPR143/OA1 OA1 Oa1 Biogenesis MLANA MART1/melan-a Melan-a Maturation AP3B1 AP-3β3a subunit HPS2 Pearl Transport AP3D1 AP3 δ subunit Mocha Transport AP3M1 AP-3 µ3a subunit Transport AP3S1 AP-3 σ3a subunit Transport BLOC1S5 Muted Muted Transport BLOC1S4 Cappuccino HPS1 Cappuccino Transport DTNBP1 Dysbindin HPS7 Sandy Maturation BLOC1S3 BLOS3 HPS8 Reduced Biogenesis pigmentation PLDN Pallidin HPS9 Pallid Maturation BLOC1S1 BLOS1 Transport BLOC1S2 BLOS2 Transport SNAPIN Snapin Transport HPS1 HPS1 HPS1 Pale ear Biogenesis HPS3 HPS3 HPS3 Cocoa Biogenesis HPS4 HPS4 HPS4 Light ear Biogenesis HPS5 HPS5 HPS5 Ruby-eye 2 Biogenesis HPS6 HPS6 HPS6 Ruby-eye Biogenesis VPS11 VPS11 Transport VPS16 VPS16 Transport VPS18 VPS18 Transport VPS33A VPS33A Buff Maturation VPS39 VPS39/Vam6 Transport VPS41 VPS41 Transport VPS33B VPS33B ARCS1 Maturation C14ORF133 VIPAR/VPS16B ARCS2 Transport RABGGTA Α Subunit of Rab Gunmetal Biogenesis geranylgeranyl transferase II LYST LYST CHS Beige Transport MYO5A Myosin VA GS1 Dilute Transport RAB27A RAB27A GS2 Ashen Transport MLPH Melanophilin GS3 Leaden Transport STX17 Syntaxin 17 Elimitation TRAPPC6A TRAPPC6A Mhyp Transport VAC14 VAC14/ARPIKFYVE Inglis Transport (infantile gliosis) FIG4 Fig/SAC3 CMT4J Pale tremor Maturation AP1S1 AP-1 σ1 subunit Transport AP1S2 AP-1 σ2 subunit Transport AP1S3 AP-1 σ3 subunit Transport AP1M2 AP-1 µ2 subunit Transport ATG7 Autophagy related 7 Elimination ATG13 Autophagy related 13 Elimination BACE2 Bace2/ASP1 Biogenesis CD63 Cd63 Biogenesis DCTN1 Dynactin 1 Transport F2RL1 F2RL1 Transfer GPNMB GPNMB Transfer KIF13A KIF13A Maturation/ Transport KIF3A KIF3A Transport KIF3B KIF3B Transport KIF5B KIF5B Transport MREG Melanoregulin Transfer RAB32 RAB32 Biogenesis RAB11B RAB11B Transfer RAB38 RAB38 chocolate Biogenesis RILP RILP Transport SLC24A5 OCA6 Maturation TSG101 TSG101/VPS23 Maturation MYO6 Myosin VI Biogenesis DYNLT3 DYNLT3 Transport RAB3D RAB3D Elimination

Table 1 Part B. The role β-catenin/Caveolin-1 axis in melanomagenesis in mouse and humans.

These results are presented as an article (Article 2), were I signed as co-first author.

ARTICLE 2

A Novel Caveolin-Dependent and PI3K/AKT- Independent Role of PTEN in β-Catenin Transcriptional Activity

A Novel Caveolin-Dependent and PI3K/AKT-Independent Role of PTEN

in β-Catenin Transcriptional Activity

Alejandro Conde-Perez1-4*, Gwendoline Gros1-4*, Christine Longvert1-4, Malin Pedersen5, Valérie Petit1-4, Zackie Aktary1-4, Amaya Viros6, Florian Rambow1-4, Boris C. Bastian7, Andrew D. Campbell8, Sophie Colombo1-4, Isabel Puig1-4, Alfonso Bellacosa9, Owen Sansom8, Richard Marais6, Leon C.L.T. Van Kempen10-12, & Lionel Larue1-4# 1 Institut Curie, Normal and Pathological Development of Melanocytes, 91405, Orsay, France 2 CNRS, UMR3347 Bat. 110, 91405, Orsay Cedex, France. 3 INSERM U1021 4 Equipe labellisée – Ligue Nationale contre le Cancer 5 Targeted Therapy Team, The Institute of Cancer Research, 237 Fulham Road, SW3 6JB, London, United Kingdom 6 Molecular Oncology Group, Cancer Research UK Manchester Institute, The University of Manchester, Wilmslow Road, M20 4BX, Manchester, United Kingdom. 7 Departments of Dermatology and Pathology and UCSF Helen Diller Family Comprehensive Cancer Center, University of California San Francisco, San Francisco. 8 The Beatson Institute for Cancer Research, Glasgow G61 1BD, UK 9 Fox Chase Cancer Center, Philadelphia, PA 19111, USA 10 Department of Pathology, Radboud University Nijmegen Medical Centre. Nijmegen, The Netherlands 11 Jewish General Hospital, Lady Davis Institute for Medical Research, Montreal, Quebec, Canada. 12 Department of Pathology, McGill University, Montreal, Quebec, Canada

#Address correspondence to Lionel LARUE e-mail: [email protected] - Tel: (33) 1 69 86 71 07 - Fax: (33) 1 69 86 71 09 Institut Curie – Bat 110 - 91405, Orsay Cedex, France

* These authors contributed equally to the work

Key words : PTEN, β-catenin, caveolin, NRAS, human melanoma, transgenic mice, melanoma initiation, senescence

Running title : PTEN and caveolin in β-catenin transactivation

Conflict of interest : The authors declare that they have no conflict of interest

1 Conde et al SUMMARY

Loss of the tumor suppressor PTEN is frequently observed in human melanoma, follows MAPK activation, suppresses senescence and mediates metastatic behavior.

How PTEN loss mediates these effects is unknown. Here we show that surprisingly loss of PTEN in epithelial and melanocytic cell lines induces the nuclear localization and transcriptional activation of β-catenin in a PI3K-AKT-GSK3β-independent fashion. Rather absence of PTEN leads to Caveolin-1 (CAV1)-dependent β-catenin- dependent senescence bypass in vitro and in an NRAS mouse melanoma model, and induces efficient metastasis formation by provoking E-cadherin internalization.

Significantly, the CAV1-β-catenin axis is underpinned by a feedback loop in which β- catenin represses transcription of miR-199a-5p and miR-203, which suppress the levels of CAV1 mRNA in melanoma cells. These data reveal a novel mechanism by which loss of PTEN increases CAV1-mediated dissociation of β-catenin from membranous E-cadherin to promote senescence bypass and metastasis.

2 Conde et al

HIGHLIGHTS

- loss of PTEN induces βcatenin nuclear localization in a PI3K-GSK3-independent fashion

- absence of PTEN leads to Caveolin1-dependent β-catenin-dependent senescence bypass

- lack of PTEN induces efficient metastasis formation by provoking CDH1 internalization

- a feedback loop of β-catenin occurs on CAV1 after repression of miR-199a and miR-203

SIGNIFICANCE

Loss of PTEN is a common feature of many cancers where is promotes metastasis and senescence bypass in animal models. Here we reveal the molecular mechanism underlying the tumor-promoting function of PTEN loss that operates by promoting

CAV1-dependent nuclear localization of β-catenin.

3 Conde et al INTRODUCTION

Melanomagenesis is a multistep process including initiation and progression.

Mutant BRAF- and NRAS-driven MAPK signaling promotes proliferation of melanocytes, but this is effectively blunted by the induction of cellular growth arrest known as oncogene-induced senescence (OIS) 1, 2, 3. The cell cycle inhibitor p16INK4A is critical for this process and its expression is induced by the histone demethylase

JMJD3 4. OIS is bypassed in melanoma via loss of the p16INK4A gene or suppression of its transcription by nuclear β-catenin 5, 6.

Hemizygous PTEN loss is frequent in various cancers. Mutational inactivation and/or deletion of PTEN is found in about 20% of uncultured primary and metastatic melanomas 7, 8, 9, 10 and in 30-40% of melanoma cell lines 9. In melanoma tissue, loss of PTEN protein expression has been observed in approximately 15% of the cases 7,

11, but hemizygous gene loss occurring more frequently, 34% 7. PTEN loss in nevi is rare, 2 out of 39 12, suggesting that PTEN aberrations in melanocytes are unlikely to contribute to their uncontrolled proliferation. In Dct::Cre mice, the inactivation of both

PTEN alleles does not lead to a difference in the number of nevi 13. Altogether, it is unlikely that altered PTEN expression directly stimulates abnormal proliferation of melanocytes, but the exact contribution of PTEN to melanoma development and progression remains poorly understood.

Epigenetic inactivation or loss of PTEN may occur at different stages of melanomagenesis, but remains controversial for its role in senescence. On one hand, the acute loss of PTEN and APC/FZR1 induces senescence in mouse primary fibroblasts 14. However, the inactivation of PTEN failed to induce a robust growth arrest in human IMR90 fibroblasts 15. Moreover, in human BRAFV600E-mutated

4 Conde et al melanocytes, reducing PTEN expression was sufficient to bypass senescence 16. In mice, the induction of a BRAF mutation after birth induces nevi formation and melanomas arise harboring deletion of p16INK4A or PTEN 1, 17. These in vivo results suggest that the lack of PTEN, similar to p16INK4A loss 5, contributes to the bypass of senescence.

PTEN has different functions depending on its subcellular localization 18. At the membrane it can dephosphorylate phosphatidylinositol (3,4,5)-triphosphate (PIP3), thereby regulating AKT phosphorylation and activity. Among other functions, cytoplasmic PTEN has been shown to interact with caveolin-1 (CAV1), a major endocytic protein in mammals 19. Such PTEN-CAV1 interaction could implicate this phosphastase in cell signaling, other than the canonical PI3K-AKT-GSK3β axis.

In this study, we uncovered a signaling mechanism by which PTEN affects nuclear localization and transcriptional activity of β-catenin through a reciprocal interplay with CAV1. We discovered that the lack of PTEN, through CAV1, induces β- catenin transactivation leading to the repression of p16INK4A. The co-occurrence of

NRASG183T mutation and PTEN loss was detected in a fraction of human melanoma biopsies, suggesting non-epistatic and potentially synergistic pathogenetic mechanisms. Indeed, in a mouse melanoma model, hemizygous PTEN loss synergized with NRAS mutation and led to bypass of senescence. Thus, we have identified a novel CAV1 dependent pathway by which PTEN affects β-catenin activity and mediates melanomagenesis.

5 Conde et al RESULTS

PTEN affects β-catenin nuclear localization in a PI3K- and GSK3β-independent fashion

To explore the possibility that PTEN induces re-localization of β-catenin from the plasma membrane to the nucleus, we transiently re-expressed PTEN in human

PTENnull human cells (Hs944T) (Figure 1A-D). In non-transfected cells, β-catenin was localized in the nucleus. Upon PTEN expression, the level of β-catenin in the nucleus was significantly diminished. Conversely, siRNA-mediated PTEN knockdown in

PTENwt human cells, as shown by western blot analysis (Figure 1E), resulted in translocation of β-catenin into the nucleus (Figure 1F-I). These results mimic the observation from murine melanocytes lacking PTEN (Figure 1J), which exhibit strong nuclear β-catenin localization (Figure 1K-L). These results suggest that PTEN affects subcellular localization of β-catenin in both transformed and non-transformed cells.

One possible explanation for the relationship between PTEN loss and nuclear β- catenin localization is that the latter is a consequence of activation of the PI3K-AKT axis and inhibition of GSK3β. Thus, we evaluated the PI3K-AKT-GSK3β axis in relationship to the level of pThr41-Ser45 β-catenin to explain its nuclear localization

(Figure 1M). Re-expression of PTEN affected the activity of downstream effectors of

PI3K, as indicated by the reduction of pAKT (Ser473) and pGSK3β (Ser9), but did not affect the level of total AKT and GSK3β. Even though the level of pThr41/Ser45

β-catenin was similar, upon PTEN re-expression the total amount of β-catenin was slightly reduced, and the quantity of transcriptionally active form of pβ-catenin

(Ser675) was decreased, explaining the lower β-catenin nuclear staining. This

6 Conde et al indicated that the observed strong changes in β-catenin localization could not be explained by minor molecular changes, if any, in the destruction complex that targets

β-catenin for degradation. These results were confirmed upon pharmacological inhibition of PI3K or GSK3β, using LY294002 and LiCl treatment, respectively, in cells that were transfected or not with PTEN: the decrease of pSer675 β-catenin by

PTEN transfection was observed even in the presence of these compounds.

LY294002 treatment efficacy was demonstrated by a decrease in pAKT (Ser473) and pGSK3β (Ser9) levels. Positive controls for LiCl treatment included lack of modification of the level of pAKT Ser473 in the presence of LiCl (certainly due to the resultant of two effects, the dephosphorylation of AKT by PTEN and the induction of phosphorylation of AKT by LiCl 20) and induction of pGSK3β (Ser9) irrespective of the presence of PTEN. Altogether, these results suggest that, in the absence of PTEN, pathways other than PI3K-AKT and GSK3β are involved in the nuclear localization of

β-catenin and the accumulation of active pSer675 β-catenin.

PTEN inhibits the caveolin-1/β-catenin immunocomplex

According to Ingenuity pathway analysis, PTEN and β-catenin share 63 interactors

(Figure 2A), including caveolin-1, AKT, PDGFR, EGR1, ERBB2, AF2, HDAC3, EZH2, and different FOXO proteins (Table S1). Among them, caveolin-1 is found in the sub- membrane area and in the cytoplasm, and it was already suggested that CAV1 might be a positive regulator of β-catenin in human gastric cancer cells 21. Caveolin-1

(CAV1) scaffolding domain (CSD) interacts with either PTEN or β-catenin 19, 22. Thus, we hypothesized that PTEN and β-catenin could compete for CAV1, subsequently affecting different signaling outcomes. We first verified that CAV1 and β-catenin are

7 Conde et al able to immuno-complex in a reciprocal manner in ROSI cell line (Figure 2B).

We then confirmed that CAV1 co-immunoprecipitates with PTEN and/or β-catenin after performing a GST-β-catenin pull-down on Hs944T cells expressing exogenous

PTEN (Figure 2C). Co-immunoprecipitation experiments in Hs944T cells expressing exogenous PTEN reveals that re-expression of PTEN significantly abrogates β- catenin/CAV1 interactions (Figure 2D).

At low confluency, β-catenin was mainly localized in the cytoplasm of Hs944T cells

(Figure 2E-H). Upon over-expression of CAV1, which showed perinuclear localization, immunofluorescence analysis revealed strong nuclear β-catenin staining.

Treatment of the cells with LY294002 did not affect the level of β-catenin in the cytoplasm or in the nucleus when overexpressing CAV1, confirming that PI3K pathway is not involved in this nuclear translocation (Figure S1).

In murine epithelial CSG cells, expressing PTEN, CAV1 and β-catenin, the latter is found at cell-cell contacts, in the cytoplasm and in the nucleus once the cells form small islets. In these conditions, the reduction of PTEN leads to a nuclear localization of β-catenin, and the reduction of CAV1 leads to a recruitment of β-catenin at the cell-cell contacts (Figure 2I-Q). Similar experiments were performed with murine pancreatic epithelial cells expressing PTEN (KPC1) or not (KCPTEN2). The reduction of PTEN and CAV1 in KPC1 cells was demonstrated by western blot analysis (Figure S2A). Concurrently, decreased amount of PTEN led to nuclear localization of β-catenin, whereas the diminution of CAV1 resulted in an accumulation at the cell-cell contacts of β-catenin. As expected, β-catenin is mainly nuclear in

KCPTEN2 cells (Figure S2B). Re-expression of PTEN in KCPTEN2 cells led to an accumulation of β-catenin at cell-cell contacts. The overexpression of CAV1 in

KCPTEN2 cells did not affect the localization β-catenin. The absence of response of

8 Conde et al β-catenin is certainly due to the high level of CAV1 in KCPTEN2 cells. Thus, it appears that PTEN is sufficient to disrupt the interaction between β-catenin and

CAV1, and to decrease the level of nuclear β-catenin.

CAV1 regulates the transcriptional activity of β-catenin.

We first assessed whether CAV1 expression affects the transcriptional activity of β- catenin, using the “TOP-FOP” flash reporter assay and cell lines lacking PTEN, either mutated for NRAS (NRASQ61K) or BRAF (BRAFV600E). TOP flash activity is induced in both cell lines in the presence of CAV1 (or β-catenin as positive control) (Figure

3A,B). Conversely, the TOP flash activity is reduced once CAV1 or β-catenin are downregulated (Figure 3C,D). The transcriptional activity of MITF-M, the master gene of the melanocyte lineage and a known β-catenin transcriptional target, was induced in the presence of these two proteins (Figure 3E). The level of another β-catenin mRNA target, CMYC, was either induced or repressed after overexpressing or repressing, respectively, the level of CAV1 (Figure 3F,G). β-catenin can also act as a co-transcriptional repressor for p16INK4A. Similar experiments revealed that overexpression/repression of CAV1 inhibited/activated the transcriptional activity of p16INK4A and reduced/induced the steady state level of p16 mRNA, respectively

(Figure 3H-K). In conclusion, CAV1 acts on the transcriptional activity of exogenous

(TOP) and endogenous (MITF, MYC, p16INK4A) β-catenin targets in an NRAS- or

BRAF-independent context. Finally, in agreement with our in vitro data, histomolecular analysis of human melanoma biopsies revealed that some tumors are

PTEN-negative, CAV1-positive and P16-negative (Figure 3L).

9 Conde et al NRASQ61K and the lack of PTEN cooperate during melanoma initiation

The oncogenic form of NRAS (NRASQ61K/R) and the lack of PTEN are found in about

20% and 30% of human melanoma, respectively, and it has generally been assumed that they are mutually exclusive 10. We found that NRAS mutation and the loss of

PTEN may coexist in human melanoma. A series of 105 human melanoma samples was analyzed by comparative genomic hybridization for PTEN loss and for the presence or absence of point mutations affecting NRAS. NRASG183T mutation, resulting in an amino-acid change Q61K, was found in 16 samples (15%), of which two also showed homozygous PTEN loss (Figure S3). A second independent series of 101 human melanoma samples was analyzed for NRASG183T mutation and PTEN protein expression. Allele-specific PCR and DNA sequencing revealed that 14 samples harbored NRASG183T mutation. Immunohistochemistry analysis showed that

39 samples were negative for PTEN; three of these also contained the NRASG183T mutation (Figure 4A). A large series of human melanoma cell lines were tested for their NRAS and PTEN status; all combinations exist. As examples, Lyse and Rosi cells express PTEN whereas Hs944T and SK29 cells do not; Lyse and Hs944T cells carry NRASG183T mutation while Rosi and SK29 cells are wild-type for NRAS (Figure

S4). In conclusion, the presence of NRAS mutation and PTEN loss is not mutually exclusive in melanoma, and the occurrence of these two mutations in the same melanoma suggests that they can independently and synergistically contribute to melanomagenesis.

A mouse melanoma model for these two mutations was generated. Tyr::NRASQ61K mice were crossed with Tyr::Cre mice and PTENf/+ mice. We produced the following mice: Tyr::Cre/°;PTENf/+ (henceforth ΔPTEN), Tyr::NRASQ61K/°;Tyr::Cre/° (NRAS)

10 Conde et al and Tyr::NRASQ61K/°;Tyr::Cre/°;PTENf/+ (NRAS-ΔPTEN). None of the ΔPTEN mice developed melanoma during two years of follow up observation (Figure 4B). Half of

NRAS mice spontaneously developed melanomas with a latency period of 71±16 weeks. NRAS-ΔPTEN mice spontaneously developed melanomas, with a higher penetrance (86%) and a shorter latency (27±13 weeks) than the NRAS mice. Most melanomas appeared in the hairy part of the skin for both genotypes (Figure S5A,B &

Table S2). The tumors consisted of irregularly pigmented cells with diverse sizes, large nucleoli and positive S100 immunostaining (Figure S5C-H). Similar results were obtained with another mouse melanoma model in which the NRAS mutation is slightly different (NRASG12D) and the activation of the mutation occurred at ten weeks of age in melanocytes, using the CreERt2-LoxP-tamoxifen system (Figure S6).

To understand the molecular mechanisms underlying the differences between NRAS and NRAS-ΔPTEN mouse melanomas and the role of PTEN in β-catenin nuclear localization, we first studied the MAPK and PI3K signaling pathways. After transformation, NRAS-ΔPTEN melanomas grew faster and larger than NRAS melanomas (Figure 4C, Figure S7). Western blot analysis revealed minimal differences in MAP kinase activity in NRAS vs. NRAS-ΔPTEN tumors, whereas the status of the PI3K/PTEN/AKT signaling pathway was significantly different for the two genotypes (Figure S8). PTEN was almost absent from NRAS-ΔPTEN tumor samples, suggesting that the expression of PTEN from the remaining wild-type allele is inhibited for unknown reasons. The amount of pAKT (Ser473) and pGSK3β (Ser9) was dramatically increased in NRAS-ΔPTEN compared with NRAS, however, most interestingly, the levels of pS6 remained unaffected. These results suggest that signaling via mTOR-associated proteins was the same in NRAS and NRAS-ΔPTEN melanomas.

11 Conde et al We proceeded to evaluate the amount of β-catenin and p16INK4A. In agreement with our results with melanoma cell lines, the level of pSer33/37-Thr41 β-catenin, targeted for proteasomal degradation, is largely unaltered in NRAS-ΔPTEN compared with

NRAS. Conversely, the amount of total and pSer675 β-catenin, corresponding to the transcriptionally active form of β-catenin, is significantly higher in NRAS-ΔPTEN compared with NRAS. Consequently, we reproducibly observed a reduction of p16INK4A protein in NRAS-ΔPTEN as compared with NRAS.

Melanoma appearance is associated with proliferation and bypass of senescence.

Prior to transformation, melanoblasts lacking PTEN do not grow faster than wild type

(Figure S9). OIS is bypassed efficiently in the absence of PTEN. We established cultures of melanocytes from Tyr::Cre/°; PTENf/f (Hom), Tyr::Cre/°; PTENf/+ (Het) and

Tyr::Cre/°; PTEN+/+ (WT) mice. No obvious difference was observed between Het and WT melanocytes. The initial rates of growth of the Het and Hom melanocytes in vitro were indistinguishable, confirming that the absence of PTEN does not induce proliferation prior to transformation (Figure 4D). Cultures of Hom melanocytes divided continuously and rapidly became immortalized. In contrast, Het melanocytes in culture stopped expanding within four weeks of explantation, and developed a large nucleus and a flattened morphology, and accumulated melanin, hallmark features of senescence (data not shown). Melanocyte cell lines could be established from 90%

(9 of 10) of Hom newborn pup skins, but only from 28% (2 of 7) of their Het littermates, implying that the absence of PTEN from melanocytes increased the efficiency of immortalization. As previously mentioned, melanocytes lacking PTEN had higher levels of β-catenin within the nucleus, suggesting that the immortalization process would occur at least in part through β-catenin signaling and p16INK4A repression (Figure 1K,L and 4E).

12 Conde et al Altogether, these results support the contention that NRASQ61K and PTEN loss are not mutually exclusive and act synergistically in melanomagenesis: NRASQ61K induces proliferation whereas PTEN loss allows senescence bypass by increasing the amount of transcriptionally active form of β-catenin and decreasing the amount of p16INK4A.

The absence of PTEN promotes efficient metastasis formation

Autopsy of seven NRAS and 17 NRAS-ΔPTEN mice carrying melanoma revealed the presence of lung metastasis in 1/7 and 8/17 mice, respectively (Figure S10).

Molecular analysis of NRAS and NRAS-ΔPTEN tumors was performed to evaluate the level of β-catenin, PTEN, CAV1, and the cell-cell adhesion molecule and β- catenin interactor, E-cadherin (ECAD). ECAD can be internalized using caveolae 23 and its levels and localization are affected by interaction with β-catenin 24.

Surprisingly, the amount of ECAD mRNA and protein was higher in the absence of

PTEN (Figure 5A,B). However, in the absence of PTEN, the amount of ECAD located at the cell-cell contact was much lower but the amount of internalized and cytoplasmic ECAD was dramatically increased (Figure 5C). This result suggested that the transcriptional regulation did not occur in vivo to minimize cell-cell adhesion but may explain the internalization and nuclear localization of β-catenin in these cells.

Fifty human melanoma samples were stained for PTEN and CAV1 on consecutive slides (Figure 5D). PTEN and CAV1 were expressed in 41 and 10 melanomas, respectively. When present, CAV1 was mainly located at the membrane, but could also be found in the cytoplasm and seldom in the nucleus. Interestingly, in 35/50 cases, the level of CAV1 was low while PTEN remained expressed at high levels.

13 Conde et al Altogether, these results demonstrate that melanoma samples lacking PTEN and expressing high level of CAV1 do exist making the molecular mechanism described above relevant in mouse and human melanomas associated with a higher level of aggressiveness.

β-catenin induces CAV1 through repression of miR-199a and miR-203

CAV1 is regulated by miR-203 in human breast cancer cells and miR-199a-5p in lung fibroblasts 25, 26, 27. The reduction of CAV1 may allow the cells to be less aggressive.

A miRnome was performed on NRAS and NRAS-ΔPTEN tumors, the amount of miR-

203 and miR-199a-5p are decreased in the absence of PTEN (Figure 6A, Table S3).

We first validated that these two miRs were able to affect the amount of CAV1 mRNA in the absence of PTEN. Hs944t human melanoma cells were transfected with miR-

203 and miR-199a-5p mimics, which led to the reduction of CAV1 mRNA and protein

(Figure 6B). Next we wondered whether the reduction of miR expression in the absence of PTEN was related to the increase activation of β-catenin signaling. In this respect, we quantified the levels of miR-203 and miR-199a-5p after modulating β- catenin. Indeed β-catenin represses miR-203 and miR-199a-5p transcription. (Figure

6C). Such regulation could be direct since ChIP experiments revealed that β-catenin binds the promoter region of miR-203 (not shown). Finally, we showed that β-catenin controls the level of CAV1 mRNA and protein (Figure 6D).

14 Conde et al DISCUSSION

In this study, we demonstrate the existence of a complex signaling network involving reciprocal interactions among PTEN, CAV1 and β-catenin; regulating molecular and cellular mechanisms that play a critical role in tumor initiation and progression. PTEN is classically known to inhibit the PI3K/AKT signaling axis, but here we show that it also remarkably controls the nuclear levels and transcriptional activity of β-catenin in a PI3K/AKT-independent way. β-catenin transcriptional activity represses p16INK4A transcription, leading to bypass of senescence, and the putative tumor suppressors mir-203 and mir-199a-5p, leading to a feedback loop regulation of

CAV1. CAV1 interacts with either PTEN or β-catenin, modulating the localization and co-transcriptional activity of β-catenin. Importantly, PTEN loss, via CAV1 interaction, also leads to the internalization of E-cad, leading to metastasis promotion. These events occur in epithelial (salivary and pancreatic) and non-epithelial (melanocyte) cells, and appear to be independent of the RAS-BRAF context.

Our work identifies a novel mechanism by which a subset of melanomas can escape OIS and result in aggressive tumors. This mechanism by which loss of PTEN induces bypass of senescence, allowing an efficient melanoma initiation after oncogenic NRASQ61K-induced senescence, was modeled in a mouse model, relevant for human melanomagenesis. In fact, based on a small melanoma series, it was generally assumed that NRAS mutations and PTEN loss are mutually exclusive events in human melanomagenesis; however, we showed that these two events coexist in a fraction of human melanomas. Our study was limited to the PTEN loss- mediated bypass of OIS on the NRASQ61K background, but the PTEN/CAV1/β-

15 Conde et al catenin/p16INK4A pathway may hold true in BRAFV600E melanomas as well (Fig.

3B,D,E). Moreover, in primary human fibroblasts and melanocytes, PTEN loss inhibits BRAFV600E (or HRASV12G) induced senescence 15, 16. Consequently, the loss of PTEN results in OIS bypass associated with RAS or RAF.

Bypassing senescence is classically associated with p53/MDM and

Rb/p16INK4A proteins. In our models, oncogenic NRAS with or without PTEN loss did not affect neither p53, MDM2 nor MDM4 expression levels (data not shown). This supports a p53-independent model of senescence in melanoma cells in the

NRASQ61K background, in which β-catenin regulated-expression of senescence- inducing p16INK4A is directly affected by the absence of PTEN 5, 6, 28.

The role of CAV1 in tumorigenesis is subject of debate 29, 30; expression is tissue specific and varies substantially depending on the stage of the disease 31. In melanomagenesis, its function was only investigated at the level of progression with controversial results depending likely on the molecular context 29, 30. We demonstrated that CAV1 immuno-complexes with β-catenin and PTEN in the melanocyte lineage. Moreover, CAV1 has been associated with accumulation of β- catenin in gastric cancer and HEK293T cells 21, 22. We showed that in human melanoma NRASQ61K PTEN-null cells p16INK4A is repressed through CAV1/β-catenin, this interaction is ablated upon PTEN re-expression. Thus, CAV1 serves as a promoter of tumor initiation and progression by enhancing β-catenin related transcription 6, 32, 33.

In NRAS-ΔPTEN murine melanoma tumors, western blot analysis revealed that the levels of CAV1, β-catenin and E-cadherin (ECAD) were higher than in NRAS

16 Conde et al tumors. Moreover, it appears that E-cadherin is more abundant in the cytoplasm of

NRAS-ΔPTEN melanoma cells than in NRAS cells, but less at the cell-cell contact

(Fig. 5C). ECAD is mainly found at the cell-cell contact, and can be internalized using caveolae 23. The reduction of ECAD at the cell-cell contact is likely a feature of melanoma progression and may induce a pseudo-epithelial to mesenchymal transition.

Whereas melanoma cell lines clearly demonstrated the causal relationship between PTEN, CAV1, β-catenin and p16INK4A expression to robustly bypass senescence, immunohistochemical studies of melanoma tissue revealed that this mechanism plays a role in only a fraction of cases. In fact, we observed the expected correlation trend (evaluated as p=0.065) of CAV1high PTENlow or the inverse CAV1low

PTENhigh in 11 of 50 samples. Other combinations were found in the remaining samples, indicating a high level of molecular and clinic-pathological complexity that indicates that other mechanisms of OIS escape exist in human melanomagenesis.

Thus, while the validity of our model of PTEN/CAV1/β-catenin-regulated p16INK4A repression is supported by our findings in cell culture, mouse models and human samples, the role of PTEN in senescence bypass is intricate and most likely context-dependent. Be as it may, our studies indicate that CAV1 and CAV1 related pathways may be a potential therapeutic target for melanoma treatment. On the other hand, our findings predict that PI3K/AKT inhibitors will not block effectively the mechanism of senescence bypass caused by PTEN loss.

17 Conde et al

METHODS

Patients and tumor material

The first set of human melanoma samples was analyzed previously 34. The second human melanoma set included specimens (101 paraffin-embedded samples) from 15 primary melanomas (9 superficial spreading melanomas, 3 nodular melanomas, 1

NOS melanoma, 2 lentigo malignant melanomas), 16 lymph node metastases, 65 cutaneous metastasis and 5 visceral metastases from the pathology archive of the

Radboud University Nijmegen Medical Center. Tissues were obtained, stored and used according to local ethical guidelines and approved by the local regulatory committee. Pathological and genomic data were obtained from paraffin-embedded tumor tissue.

Detection of NRAS mutations by allele-specific PCR amplification and by sequencing of DNA from human tissue

DNA was extracted from 20 µm-thick paraffin-embedded sections using NucleoSpin

Extract II (MACHEREY-NAGEL, #740590250) according to the manufacturer’s instructions, and was amplified by PCR. Allele-specific PCR of the NRAS gene was performed using a 5’ wild-type PCR primer (LL1827, 5’-CAT ACT GGA TAC AGC

TGG AC- 3’) and a mutated PCR primer corresponding to the NRASQ61K mutation

(LL1828, 5’-CAT ACT GGA TAC AGC TGG GA-3’). The reverse primer (LL1800, 5’-

TGA CTT GCT ATT ATT GAT GG-3’) was used for all the PCR 35. The PCR mixture contained Expand High fidelity buffer, 200mM of each dNTP (dNTP mix, Finnzyme,

#F560XL), 50pM of each primer, 2.6U of Expand High fidelity (Roche,

18 Conde et al #11732650001), and 100ng of DNA. PCR was performed for 38 cycles of 30 sec at

94°C, 90 sec at 56°C, and 30 sec at 72°C. Samples were incubated for 10-min at

94°C before the cycles. The NRAS gene in DNA extracted from tumors was also sequenced following PCR amplification. The primer sequences were 5’-GTT ATA

GAT GGT GAA ACC TG-3’ (LL1901; forward) and 5’-GAG GTT AAT ATC CGC AAA

TGA CTT-3’ (LL1918; reverse). NRAS gene exon 3 sequences were analyzed by direct DNA sequencing according to the Sanger technology.

Immunohistochemistry of human tissues

Staining for p16 and Caveolin-1 expression was performed on a Discovery XT

Autostainer (Ventana Medical System). All solutions used for automated immunohistochemistry were from Ventana Medical System unless otherwise specified. Tissue section (4μm) underwent de-paraffinization with the EZ PREP solution, heat-induced epitope retrieval with Cell Conditioning solution CC1 pH 8.0 at standard condition (60 min at 95°C). Pre-diluted mouse monoclonal anti-p16 (clone

E6H4, CINTec Roche) or polyclonal anti-Caveolin-1 (1/200, #3238, Cell Signalling) diluted in in antibody diluent were incubated for 32 min at 37°C, then followed by the detection kit (Omnimap anti-Mouse HRP, Ref# 760-4310) and developed with DAB.

A negative control was performed by the omission of the primary antibody. Slides were counterstained with Haematoxylin for four minutes, blued with Bluing Reagent for four minutes, removed from the autostainer, washed in warm soapy water, dehydrated through graded alcohols, cleared in xylene, and mounted with Permount.

Immunostaining for PTEN was performed manually. Following de-waxing and rehydration through xylene and graded alcohol baths, quenching of endogenous peroxidase (6% hydrogen peroxide in PBS, 30 min, RT), a microwave antigen

19 Conde et al retrieval step was performed (TRIS/EDTA pH9, 10 min at 95°C and then cool for 1 hour). Each section was incubated with mouse monoclonal anti-PTEN antibody

(1/100, clone 6H2.1, Dako) overnight at 4°C. Following three 10 min washes with

PBS, tissues were incubated with powervision poly-HRP-GAM/R/R IgG

(Immunologic) and immunoreactivity visualized with PowerDAB (Immunologic), counterstained with haematoxylin, and mounted with Permount. Slides were scanned with a ScanScope AT Turbo scanner (Aperio, Leica Biosystems) at 20X magnification.

Vascular endothelium served as an internal positive control for PTEN expression and breast carcinoma as an external positive control. Cytoplasmic and nuclear PTEN and p16 expression was scored as positive immunostaining. Cavelolin-1 staining included membranous and/or cytoplasmic expression. Two events occur independently when the % PTEN negative (36/[101-3]) times the % NRAS mutant (11/(101-3]) equals to the % PTEN negative and % NRAS mutant (3/101).

Transgenic mice and tumor collection

The transgenic Tyr::N-RASQ61K/° mouse line was described previously 3. Floxed

PTEN mice were provided by H. Wu (UCLA, CA, USA) and were obtained from F.

Beermann (EPFL, Lausanne, Switzerland). The characterization of the PTEN mice 36,

37, and Tyr::Cre mice 38 has been reported previously. All mice were backcrossed onto a C57BL/6 background for more than ten generations. Mice were maintained in the specific pathogen-free mouse colony at the Institut Curie, in line with French and

European Union law. Floxed PTEN heterozygous mice were crossed with Tyr::Cre and Tyr::NRASQ61K/° to generate Tyr::NRASQ61K/°;Tyr::Cre; PTENf/+ (NRAS-ΔPTEN

20 Conde et al mice), Tyr::NRASQ61K/°; PTENf/+ (NRAS mice) and Tyr::NRASQ61K/°;PTENf/f (NRAS mice). Mice were genotyped by PCR using DNA extracted from tails. The mice were evaluated weekly for tumor appearance and progression. Once tumors were 1 cm across, the mice were sacrificed and autopsied. Some mice were also sacrificed because of poor health. Tumor samples were fixed in 4% PFA and paraffin- embedded for histological analysis and immunostaining. When sufficient tumor tissue was available, samples were frozen for subsequent western blot analysis 39.

Histology and immunostaining of mouse tissues

Mouse melanomas were collected, rinsed in cold PBS, and fixed in 4% PFA at 4°C

O/N. Samples were dehydrated, embedded in paraffin wax, and sectioned into 5-µm- thick transverse sections. Paraffin-embedded sections were stained with

Haematoxylin and eosin, and examined by light microscopy. For immunostaining, sections were deparaffinized, rinsed in TBS, boiled for 20 min in 10mM sodium citrate, and treated overnight at 4°C in TBST (TBS/0.1% Tween-20) containing 5% normal goat serum with antibodies against S100 (Dako, #Z0311). AEC (Sigma-

Aldrich, A6926) was used to reveal bound antibody according to the manufacturer’s instructions. All sections were counterstained with Haematoxylin. Ki-67 (Nova-Costra,

NCL-Ki67p) and gp84 (E-cadherin antibody) antibodies were both produced in rabbit.

Cell culture and cell lines

Mouse primary melanocyte cell lines were established as previously described 6, 40.

Human melanoma cell lines used have been described previously 41, 42, 43, 44, 45, 46.

Human melanoma cell lines were grown in RPMI 1640 media (GIBCO, #21875-034), supplemented with 10% FBS (GIBCO, #10270-106), 1% Penicillin-Streptomycin

21 Conde et al (GIBCO, #15140), and 1% L-Glutamine (GIBCO, #25030). Normal human epidermal melanocytes (NHEM) were obtained from Promocell, grown and transfected according to the manufacturer (OZ BIOSCIENCES).

Western blotting

Whole cell lysate was prepared from human melanoma cell lines using RIPA buffer and whole tissue lysate was prepared from mouse melanoma tumor using SDS lysis buffer 39. Membranes were probed with antibodies against ERK (Cell Signaling,

#9102), pERK (Thr202/Thr204, Cell Signaling, #9106), CREB (Cell Signaling #

9192), pCREB (Cell Signaling #9191S), PTEN (Cell Signaling #9559), AKT (Cell

Signaling, #2938), pAKT (Ser473, Cell Signaling #3787), GSK3-β (Santa-Cruz, #sc-

9166), pGSK3-β (Ser9, Cell Signaling, #9336), S6 (Cell Signaling, #2317), pS6

(Ser235/236) (Cell Signaling, #4857), β-catenin (Abcam, #ab-6302), pβ-catenin

(Ser675, Cell Signaling, #4176), pβ-catenin (Ser33-37/Thr41, Cell Signaling, #9561), pβ-catenin (Thr41/Ser45, Cell Signaling, #9565S), p16 (Santa-Cruz, #sc-1661),

CAV1 (Cell Signaling, #3238), and β-actin (Sigma, #A5441).

Immunofluorescence microscopy Primary murine melanocytes were grown to near confluence upon which point were counted, 2.5 105 cells were seeded in 18mm glass cover slips and allowed 24h to recover prior immunofluorescence analysis. Similar procedure was followed for CSG,

KPC1, and KCPTEN2 cells. Human Hs944T melanoma cells were transfected with

CMV::PTEN-GFP (#1031) and allowed 48h to recover before being fixed in 4%PFA for 20 min at RT. Human or mouse cells were permeabilized with 0.2% v/v

PBS/Triton X-100 for 5 min at RT. Then, cells were washed twice with PBS and

22 Conde et al blocked with 1% BSA (w/v), 10% FBS in PBS for 20 min at RT. Cells were incubated with primary antibody, anti-β-catenin at 4°C overnight. Alexa 555 anti-rabbit (Sigma) secondary antibody was incubated for 1h at RT in the dark. Cells were counterstained with 0.5µg/µL DAPI to visualize the nucleus.

Luciferase assay

Cells were transiently transfected in 12 well plates with Magnetofectamine (OZ

Biosciences) following the manufactures specifications. Briefly, cells were transfected with 1.25µg of total plasmid DNA. As control cells were also co-transfected with thymidine kinase::Renilla luciferase 47. Luciferase activity was determined 48h post- transfection using a MicroLumat PLUS LB 96V luminometer (Berthold Technologies) and normalized to Renilla activity. Briefly, cells were transfected with 750ng of either

32 CMV::CAV1-GFP (#1040), CMV::PTEN-GFP (#1031) (Abcam), CMV::β-catenin

(#997) or CMV::GFP (#1085) and 350ng of CDKN2A::Luciferase promoter or

MITF::Luciferase promoter 6 (#778, #961) and TOP (#390) or FOP (#391) constructs.

Cells were co-transfected with thymidine kinase::Renilla luciferase construct as a control 47. Luciferase activity was determined 48h post-transfection and normalized to

Renilla luciferase. Statistical analysis was performed using Prism v5.0.

Co-Immunoprecipitation

Co-IP experiments were performed as previously described with slight modifications

48. Briefly, Hs944T human melanoma cell lines transfected with pcDNA-PTEN-GFP and pcDNA-GFP were scraped in 100μL of IP buffer [10mM Tris (pH8), 150mM NaCl,

1%(v/v) Triton X-100, 60nM Octyl β-D-glucopyranoside (Sigma O8001)], with protease and phosphatase inhibitors. Proteins (500μg) were pre-cleared for 45

23 Conde et al minutes with 100μL 1:1 slurry of protein PBS:G-Sepharose (GE Healthcare 17-0618-

01) at 4°C with gentle rocking. The beads were collected by centrifugation at 10,000 rpm for 10 min at 4°C, and the supernatant was transferred to new tubes and pre- incubated with anti-Caveolin 1 (1:50) for 3-4 hours, 4°C. Following the pre-incubation step, the mixture was placed in fresh 1:1 protein G-Sepharose:IP buffer slurry and incubated overnight at 4°C. Complexes were collected by centrifugation, washed four times with IP buffer and four times with 50mM Tris (pH8), 150mM NaCl, 1mM EDTA, and 1% (v/v) Triton-X100 and resolved in SDS-page gel after boiling. Similar procedure was performed using ROSI cell line.

siRNA knockdown siRNA targeting human Caveolin 1 (39) β-catenin (35) were purchased from

Dharmacon as a SMART pool mix of 4 sequences and PTEN (38) from Santa Cruz

Biotechnologies as a mix of three sequences. Caveolin-1: 5'-GCA AAU ACG UAG

ACU CGG A-3', 5'-AUU AAG AGC UUC CUG AUU G-3', 5'-GCA GUU GUA CCA

UGC AUU A-3', 5'-CUA AAC ACC UCA ACG AUG A-3'. β-catenin: 5'-GAA CGC AGC

AGC AGU UUG U-3', 5'-CAG CUG GCC UGG UUU GAU A-3', 5'- GCA AGU AGC

UGA UAU UGA C-3', 5'- GAU CUU AGC UUA UGG CAA U-3'. si scrambled, with no known human targets, was purchased from Invitrogen as a mix. Briefly, cells were transfected with 50pmol of siPTEN, siCAV1, siβ-catenin, or siScrambled (siScr) and were assayed for Luciferase activity or protein content 48h post-transfection.

LiCl and LY294002 treatment

24 Conde et al Briefly, after transfection cells were treated with 40mM LiCl for 1h as previously described 32. Similarly, cells were treated with the PI3K inhibitor LY294002

(Calbiochem, #440202) with 50μM prior to lysis for 1h as previously described 49.

Pull-down experiments

Briefly, 500μg of whole cell lysates were incubated with 20μl of β-catenin-GST beads in PBS supplemented with Protease inhibitors for 3h at 4°C under slight agitation.

Beads were then collected by centrifugation at 10,000 rpm for 10 min at 4°C, and washed 4 times with 10mM Tris (pH8), 150mM NaCl, 1%(v/v) Triton X-100, 60nM

Octyl β-D-glucopyranoside (Sigma O8001). Samples were resolved in 12% SDS-

PAGE gel.

miRNA overexpression

Cells were transfected with 100μM of miRNA mimics, hsa-miR-203 (miRIDIAN microRNA mimic - Dharmacon c-300562-03-0002), and hsa-miR-199a-5p (miRIDIAN microRNA mimic - Dharmacon c-300533-03-0005). Forty-eight hours post- transfection cells were lysed for mRNA and protein contents and analysed.

25 Conde et al

Acknowledgements

We are grateful to F. Haluksa, Yale SPORE in Skin Cancer Tissue Resource Core,

Ph. Chavrier, H. Clevers and R. Kemler for providing Hs944T and Yudede human melanoma cell lines and CAV1-RFP/-GFP, TOP-FOP constructs, and gp84 antibody, respectively. We thank the team caring for the animal colony of the Institut Curie, and especially Y. Bourgeois and H. Harmange. We thank V. Delmas for helpful discussion. GG was supported by a fellowship from Université de Versailles-Saint-

Quentin-en-Yvelines (CATINVEST) and by INCa. ACP was supported by a fellowship from Institut Curie. CL was supported by a fellowship from INCa and cancéropole

IdF. We are grateful to the Rimbaud family for its donation to our laboratory. This work was supported by the Ligue Nationale Contre le Cancer (Equipe labellisée) and

INCa.

The authors declare that they have no financial interest related to this work

26 Conde et al

REFERENCES

1. Dhomen N, et al. Oncogenic Braf induces melanocyte senescence and melanoma in mice. Cancer Cell 15, 294-303 (2009).

2. Michaloglou C, et al. BRAFE600-associated senescence-like cell cycle arrest of human naevi. Nature 436, 720-724 (2005).

3. Ackermann J, Frutschi M, Kaloulis K, McKee T, Trumpp A, Beermann F. Metastasizing melanoma formation caused by expression of activated N-RasQ61K on an INK4a- deficient background. Cancer Res 65, 4005-4011 (2005).

4. Barradas M, et al. Histone demethylase JMJD3 contributes to epigenetic control of INK4a/ARF by oncogenic RAS. Genes & Development 23, 1177-1182 (2009).

5. Sviderskaya EV, et al. p16(Ink4a) in melanocyte senescence and differentiation. J Natl Cancer Inst 94, 446-454 (2002).

6. Delmas V, et al. Beta-catenin induces immortalization of melanocytes by suppressing p16INK4a expression and cooperates with N-Ras in melanoma development. Genes & Development 21, 2923-2935 (2007).

7. Zhou XP, Gimm O, Hampel H, Niemann T, Walker MJ, Eng C. Epigenetic PTEN silencing in malignant melanomas without PTEN mutation. The American journal of pathology 157, 1123-1128 (2000).

8. Whiteman DC, Zhou XP, Cummings MC, Pavey S, Hayward NK, Eng C. Nuclear PTEN expression and clinicopathologic features in a population-based series of primary cutaneous melanoma. International journal of cancer Journal international du cancer 99, 63-67 (2002).

9. Wu H, Goel V, Haluska FG. PTEN signaling pathways in melanoma. Oncogene 22, 3113-3122 (2003).

10. Goel VK, Lazar AJ, Warneke CL, Redston MS, Haluska FG. Examination of mutations in BRAF, NRAS, and PTEN in primary cutaneous melanoma. J Invest Dermatol 126, 154-160 (2006).

11. Wakisaka T, Sou S. [A case of recurrent ovarian cancer successfully treated with etoposide]. Gan To Kagaku Ryoho 15, 1795-1798 (1988).

12. Tsao H, Mihm MC, Jr., Sheehan C. PTEN expression in normal skin, acquired melanocytic nevi, and cutaneous melanoma. Journal of the American Academy of Dermatology 49, 865-872 (2003).

27 Conde et al 13. Inoue-Narita T, et al. Pten deficiency in melanocytes results in resistance to hair graying and susceptibility to carcinogen-induced melanomagenesis. Cancer Research 68, 5760-5768 (2008).

14. Song MS, et al. Nuclear PTEN regulates the APC-CDH1 tumor-suppressive complex in a phosphatase-independent manner. Cell 144, 187-199 (2011).

15. Kennedy AL, et al. Activation of the PIK3CA/AKT pathway suppresses senescence induced by an activated RAS oncogene to promote tumorigenesis. Molecular cell 42, 36-49 (2011).

16. Vredeveld LC, et al. Abrogation of BRAFV600E-induced senescence by PI3K pathway activation contributes to melanomagenesis. Genes Dev 26, 1055-1069 (2012).

17. Dankort D, et al. Braf(V600E) cooperates with Pten loss to induce metastatic melanoma. Nat Genet 41, 544-552 (2009).

18. Conde-Perez A, Larue L. PTEN and melanomagenesis. Future Oncol 8, 1109-1120 (2012).

19. Caselli A, Mazzinghi B, Camici G, Manao G, Ramponi G. Some protein tyrosine phosphatases target in part to lipid rafts and interact with caveolin-1. Biochemical and biophysical research communications 296, 692-697 (2002).

20. Chalecka-Franaszek E, Chuang DM. Lithium activates the serine/threonine kinase Akt- 1 and suppresses glutamate-induced inhibition of Akt-1 activity in neurons. Proceedings of the National Academy of Sciences of the United States of America 96, 8745-8750 (1999).

21. Yuan G, et al. WNT6 is a novel target gene of caveolin-1 promoting chemoresistance to epirubicin in human gastric cancer cells. Oncogene 32, 375-387 (2013).

22. Yamamoto H, Sakane H, Michiue T, Kikuchi A. Wnt3a and Dkk1 regulate distinct internalization pathways of LRP6 to tune the activation of beta-catenin signaling. Developmental cell 15, 37-48 (2008).

23. Orlichenko L, et al. Caveolae mediate growth factor-induced disassembly of adherens junctions to support tumor cell dissociation. Molecular biology of the cell 20, 4140- 4152 (2009).

24. Morali OG, Delmas V, Moore R, Jeanney C, Thiery JP, Larue L. IGF-II induces rapid beta-catenin relocation to the nucleus during epithelium to mesenchyme transition. Oncogene 20, 4942-4950 (2001).

25. Miao L, et al. miR-203 inhibits tumor cell migration and invasion via caveolin-1 in pancreatic cancer cells. Oncol Lett 7, 658-662 (2014).

26. Orom UA, et al. MicroRNA-203 regulates caveolin-1 in breast tissue during caloric restriction. Cell Cycle 11, 1291-1295 (2012).

28 Conde et al 27. Lino Cardenas CL, et al. miR-199a-5p Is upregulated during fibrogenic response to tissue injury and mediates TGFbeta-induced lung fibroblast activation by targeting caveolin-1. PLoS genetics 9, e1003291 (2013).

28. Gray-Schopfer VC, et al. Cellular senescence in naevi and immortalisation in melanoma: a role for p16? Br J Cancer 95, 496-505 (2006).

29. Lobos-Gonzalez L, et al. E-cadherin determines Caveolin-1 tumor suppression or metastasis enhancing function in melanoma cells. Pigment cell & melanoma research 26, 555-570 (2013).

30. Felicetti F, et al. Caveolin-1 tumor-promoting role in human melanoma. International journal of cancer Journal international du cancer 125, 1514-1522 (2009).

31. Burgermeister E, Liscovitch M, Rocken C, Schmid RM, Ebert MP. Caveats of caveolin-1 in cancer progression. Cancer letters 268, 187-201 (2008).

32. Gallagher SJ, et al. Beta-catenin inhibits melanocyte migration but induces melanoma metastasis. Oncogene 32, 2230-2238 (2013).

33. Damsky WE, et al. beta-Catenin Signaling Controls Metastasis in Braf-Activated Pten- Deficient Melanomas. Cancer Cell 20, 741-754 (2011).

34. Curtin JA, et al. Distinct sets of genetic alterations in melanoma. N Engl J Med 353, 2135-2147 (2005).

35. Linard B, et al. A ras-mutated peptide targeted by CTL infiltrating a human melanoma lesion. Journal of immunology 168, 4802-4808 (2002).

36. Groszer M, et al. Negative regulation of neural stem/progenitor cell proliferation by the Pten tumor suppressor gene in vivo. Science 294, 2186-2189 (2001).

37. Lesche R, et al. Cre/loxP-mediated inactivation of the murine Pten tumor suppressor gene. Genesis 32, 148-149 (2002).

38. Delmas V, Martinozzi S, Bourgeois Y, Holzenberger M, Larue L. Cre-mediated recombination in the skin melanocyte lineage. Genesis 36, 73-80 (2003).

39. Gallagher SJ, et al. General strategy to analyse melanoma in mice. Pigment cell & melanoma research 24, 987-988 (2011).

40. Berlin I, et al. General strategy to analyse coat colour phenotypes in mice. Pigment cell & melanoma research 25, 117-119 (2012).

41. Tsao H, Zhang X, Fowlkes K, Haluska FG. Relative reciprocity of NRAS and PTEN/MMAC1 alterations in cutaneous melanoma cell lines. Cancer Res 60, 1800- 1804 (2000).

42. Alexaki VI, et al. GLI2-mediated melanoma invasion and metastasis. Journal of the National Cancer Institute 102, 1148-1159 (2010).

29 Conde et al 43. Hamai A, et al. ICAM-1 has a critical role in the regulation of metastatic melanoma tumor susceptibility to CTL lysis by interfering with PI3K/AKT pathway. Cancer Research 68, 9854-9864 (2008).

44. Hoeflich KP, Luo J, Rubie EA, Tsao MS, Jin O, Woodgett JR. Requirement for glycogen synthase kinase-3beta in cell survival and NF-kappaB activation. Nature 406, 86-90 (2000).

45. Halaban R, et al. PLX4032, a selective BRAF(V600E) kinase inhibitor, activates the ERK pathway and enhances cell migration and proliferation of BRAF melanoma cells. Pigment cell & melanoma research 23, 190-200 (2010).

46. Moore R, et al. Involvement of cadherins 7 and 20 in mouse embryogenesis and melanocyte transformation. Oncogene 23, 6726-6735 (2004).

47. Berlin I, et al. Phosphorylation of BRN2 modulates its interaction with the Pax3 promoter to control melanocyte migration and proliferation. Molecular and cellular biology 32, 1237-1247 (2012).

48. Capozza F, et al. Muscle-specific interaction of caveolin isoforms: differential complex formation between caveolins in fibroblastic vs. muscle cells. Am J Physiol Cell Physiol 288, C677-691 (2005).

49. Aziz SA, et al. Phosphatidylinositol-3-kinase as a therapeutic target in melanoma. Clinical cancer research : an official journal of the American Association for Cancer Research 15, 3029-3036 (2009).

30 Conde et al FIGURE LEGENDS

Figure 1. PTEN affects β-catenin nuclear localization in a PI3K- and GSK3β- independent fashion

(A-D) Immunofluorescence of transiently transfected Hs944T human melanoma cell line, which is mutated for NRAS (Q61K) and does not express PTEN, with an expression vector encoding PTEN-GFP under the control of CMV promoter (PTEN)

(A). Confocal microscopy revealed cells (labelled with arrows) with a heavily-laden β- catenin (bcat) nuclear staining (B), in contrast to nearby PTEN-GFP positive cells were β-catenin staining could seldom be observed within the nucleus, arrowheads.

Cells were counterstained with DAPI (C). Merged is shown (D). Scale bar = 10μm.

Human melanoma Lyse cells mutated for NRAS (Q61K) which produce PTEN were transfected with si Scr (F-G) and si PTEN (H-I). Cells were labeled for β-catenin (F,H) and counter stained with DAPI (G,I). The down regulation of PTEN in these cells was evaluated by western blot analysis (E). Confocal microscopy showing the localization of β-catenin in Tyr::Cre/°;PTENf/+ = PTENf/+ (K) and Tyr::Cre/°;PTENf/f = PTENf/f (L) melanocytes. Note the increase of nuclear β-catenin staining in PTENf/f cells. Scale bar = 10μm. Western blot analysis of total cell lysate, showing PTEN expression in

PTENf/f and PTENf/+ melanocytes (J). (M) Immunoblot analysis of PTEN, AKT (total and phosphorylated form Ser473), GSK3β (total and phosphorylated form Ser9), β- catenin (total, phosphorylated form Thr41/Ser45, and Ser675) and β-actin proteins in

Hs944T transfected with either expression vector encoding GFP (CMV::GFP) or

PTEN (CMV::PTEN-GFP). Cells expressing either exogenous GFP or PTEN treated with LiCl or LY294002 for 1h. Note that a higher concentration of GSK3β antibody

31 Conde et al reveals a second upper band. For (M), western blot analyses were performed three to six times, depending on the antibody, with similar outputs.

Figure 2. PTEN inhibits the caveolin-1/β-catenin immunocomplex

(A) Interactome of PTEN and β-catenin as determined by the in silico Ingenuity

Pathway Analysis (IPA). The Venn diagram reveals 63 common members. (B)

Interaction of caveolin-1 (CAV1) with β-catenin (β-cat) in Rosi human melanoma cell line. Cell lysates containing 500μg of proteins were subjected to immunoprecipitation

(IP) with an anti-CAV1 or an anti-β-cat antibody. The co-immunoprecipitation of β-cat with CAV1 was detected by western blotting (WB) with anti-β-catenin and anti-CAV1 antibodies. Total protein input is shown. (C) GST pull down using β-catenin-GST fusion Sepharose beads and whole cell protein lysates (500µg) from Hs944T cells

48h post-transfection with CMV::GFP (GFP) or CMV::PTEN-GFP (PTEN). The pellet and supernatant fractions were immunoblotted for various antibodies. (D) CAV1-β-cat immunocomplex in GFP (CMV::GFP) transiently transfected Hs944T cells. When transfected with CMV::PTEN, the proportion of β-cat in the immunocomplex is dramatically reduced, suggesting a competition between β-cat and PTEN for CAV1.

Total protein input is shown. For B-D, experiments were performed three times. (E-H)

Immunofluorescence of transiently transfected Hs944T human melanoma cell line with CMV::CAV1-RFP expression vector. CAV1-RFP (E), β-catenin staining (F),

DAPI (G) and merge (H). Arrows point towards caveolin-positive cells and arrowhead points towards caveolin-negative cell. Scale bar = 20μm. (I-Q) Immunofluorescence of mouse Carcinoma Submandibular Gland (CSG) cells transfected with siRNA directed against either PTEN (si Pten), CAV1 (si Cav1), or negative control (si Scr),

32 Conde et al stained for β-catenin (I,L,O). Cells were counterstained with DAPI (J,M,P). Merge shown in panels K,N,Q. Scale bar = 25μm for all panels.

Figure 3. CAV1 regulates the transcriptional activity of β-catenin.

(A,B) TOP-FLASH activity in Hs944T and Lu1205 cells 48 hours after overexpression of CMV::GFP (GFP), CMV::CAV1-RFP (CAV1), and CMV::β-cat (BCAT) constructs. (C,D) Similarly, TOP-FLASH activity was measured in the same cells 48 hours post transfection of siRNA directed against CAV1 (siCAV1), β-cat (siBCAT) and negative control (siSCR). (E) MITF::luciferase activity was quantified in Lu1205 cells after transfection with GFP, CAV1 or BCAT. (F,G) CMYC mRNA levels as measured by semi-quantitative PCR (qRT-PCR), following over-expression or knockdown of CAV1. Activity of p16INK4A::luciferase reporter was evaluated 48h post- transfection in Hs944T human melanoma cells (H) with GFP, CAV1 and BCAT expression vectors and (I) with siSCR, siCAV1 and siBCAT. All p16INK4A::luciferase,

TOP-FLASH, and MITF::luciferase reporter assays were evaluated in the presence of an internal control (Renilla-luciferase). (J,K) p16 mRNA level was measured by qRT-

PCR, following over-expression or knock-down of CAV1 with appropriate controls. (L)

Two human melanoma tumors were stained for CAV1, PTEN and p16. PTEN and p16 were absent and CAV1 was present for patient 1. Opposite observation was performed for patient 2. Stromal and endothelial cells were used as positive control for PTEN and CAV1, respectively. Scale bar = 100μm for all panels. Error bars represent standard deviation. *,**, and *** signify p-value <0.05, <0.01, and <0.001, respectively. Statistical significance was determined by Mann-Whitney test for A-D,

F-K, and t-test E. Each experiment was performed in at least biological triplicates.

33 Conde et al

Figure 4. NRASQ61K and the lack of PTEN cooperate during melanoma initiation

(A) Human melanoma library containing 101 samples was subjected to immunohistochemical analysis for PTEN expression alongside NRAS mutational status. Four different possible combinations were observed. For each case type: the minimized window in the foreground represents the DNA sequence of NRAS at codon 61, while the background picture is the corresponding PTEN immunostaining.

Wild-type NRAS and PTEN positive, was the most prevalent (50.5%). Similarly, wild- type NRAS with loss of PTEN was observed in 35.6% of the cases. NRASQ61K mutation was detected with positive PTEN staining (10.9%). NRASQ61K mutation and concomitant PTEN loss, was the least observed with a 3.0% occurrence.

Arrowheads indicate blood vessels, internal positive control for PTEN expression.

Vertical arrows indicate the location of the G to T mutation. Scale bar: 100μm. (B)

Kaplan-Meier (KM) melanoma free mice analysis of ΔPTEN (n=19), NRAS (n=35) and NRAS-ΔPTEN mice (n=35). The KM curves between NRAS and NRAS-ΔPTEN are significantly different (p<10-5) using the Mantel-Cox test. NRAS=Tyr::NRASQ61K/°,

ΔPTEN= Tyr::Cre/°; PTENf/+, and NRAS-ΔPTEN= Tyr::NRASQ61K/° ; Tyr::Cre/° ;

PTENf/+. The mean number of melanomas per mouse was 1.6 and 2.1 for NRAS and

NRAS-ΔPTEN mice respectively, with a p-value of 0.37 (Student t-test). (C) Tumor growths were measured and tabulated. The rate of growth of four representative tumors from NRAS and NRAS-ΔPTEN were plotted in relation to size during an 88- week interval. NRAS-ΔPTEN tumors averaged a steeper and earlier growth rate in comparison to NRAS controls. (D) Melanocytes were established from the skins of

Tyr::Cre/°;PTENf/+ and Tyr::Cre/°; PTENf/f pups. Cells were directly counted every

34 Conde et al week and the growth curve was plotted as relative number of cells in log2 form (see

Delmas et al. 2007). Each curve corresponds to the culture established from the back skin of a single pup. Cells with bi-allelic disruption of the PTEN gene, PTENf/f, bypassed efficiently senescence when comparing the heterozygous, PTENf/+. (E)

The amount of p16 mRNA was evaluated by RT-qPCR 48h post-transfection in

NHEM with CMV::GFP and CMV::PTEN-GFP expression vectors and with scramble

(siScr) and PTEN (siPTEN) siRNA. Error bars represent standard deviation. * signifies p-value <0.05. Statistical significance was determined by Mann-Whitney test. Experiments were performed in biological triplicates. fc means fold change.

Figure 5. The absence of PTEN induces E-cadherin internalization and promotes efficient metastasis formation

(A) mRNA levels of Ecad and Cav1 in NRAS and NRAS-ΔPTEN mouse melanoma as measured by qRT-PCR. Error bars represent standard deviation. * and *** signify p-value <0.05, <0.001, respectively. Statistical significance was determined by Mann-

Whitney test. fc means fold change. (B) Western blot analysis of uncultured whole tumor lysates from NRAS and NRAS-ΔPTEN using antibodies against β-cat (total and pSer675), PTEN, CAV1, Ecad, and β-actin. (C) Immunofluorescence of serial

NRAS and NRAS-ΔPTEN tumor sections, stained for anti-Ecad and anti-Cav1. Scale bar = 10 μm. (D) CAV1 and PTEN were detected by immunohistochemistry on a series of fifty human melanoma sections from the second cohort. Sections of patients were either AEC stained (red) for CAV1 (background image) or PTEN (foreground image - lower-right corner) and counterstained with haematoxylin (blue). Staining for

CAV1 was scored as high or low while the amount of PTEN as positive (pos) or

35 Conde et al negative (neg). Among 50 melanoma biopsies, thirty-five presented a low amount of

CAV1 and a positive staining for PTEN (35/50). Note that a trend between the presence of PTEN and the low levels of CAV1 in human melanoma was observed

(Fisher’s exact-test, p=0.065).

Figure 6. β-catenin induces CAV1 through repression of miR-199a and miR-203

(A) miRNA 199a-5p and 203 expression in NRAS and NRAS-ΔPTEN tumor samples from miRNA expression arrays. (B) CAV1 mRNA expression 48h post transfection with miRNA mimics for miR-199a and miR-203 in human Hs944T melanoma cells.

CAV1 knockdown after miRNA mimics overexpression from whole cell protein lysates in duplicates was validated through western blot (below). (C) miRNA levels as determined by qRT-PCR of mir-203 and mir-199a in Hs944T 48h post siRNA mediated knockdown of β-catenin (siBCAT) or conversely overexpression of CMV::β- catenin (BCAT). (D) CAV1 mRNA levels after either siBCAT or BCAT overexpression in Hs944T cells. Whole cell protein lysates were analysed via western blot (see below). Error bars represent standard deviation. *, **, *** signify p-value <0.05, <0.01,

<0.001 respectively. Statistical significance was determined by Mann-Whitney test.

Experiments were performed in biological triplicates. fc means fold change.

36 Conde et al ABHs944T M LY294002 LiCl PTEN AKT pAKT Ser473 GSK3

PTEN pGSK3Ser9 CDdapi merge s ps s s

GFP ++ + PTEN + ++

F H E Lyse K Ptenf/+

PTEN

si PTEN

G I J L Ptenf/f

PTEN

f/f f/+ dapi dapi Pten Pten si PTEN

Figure 1 Conde et al A PTEN -catenin B IP anti anti WB CAV1 scat Input

scat 139 63 937 CAV1

C D IP Input WB GFP PTEN GFP PTEN GFP PTEN GFP PTEN

scat PCNA

PTEN PTEN PTEN

GFP GFP CAV1

CAV1 tubullin si Scr si Pten si Cav1 pellet supernatant I L O E G dapi bcat J M P

FHbcat merge dapi K N Q

Hs944T CSG cells

Figure 2 Conde et al ABHs944t - TOP Lu1205 - TOP E Lu1205 - MITF luc ** 45 *** ** 20 * 2.0 35 10 * 25 ** 2 2 1.0 1 1 0 0 0.0 relative activity (au) relative activity (au) GFP CAV1 BCATrelative activity (au) GFP CAV1 BCAT GFP CAV1 BCAT

CDHs944t - TOP Lu1205 - TOP F Hs944t - MYCG Hs944t - MYC * * 1.5 2.0 ** 1.5 * 2.0 * ** 1.5 1.0 1.0 1.0 1.0 0.5 0.5 0.5

0.0 0.0 level (fc) mRNA 0.0 level (fc) mRNA 0.0

relative activity (au) siSCR siCAV1 siBCAT relative activity (au) siSCR siCAV1 siBCAT GFP CAV1 siSCR siCAV1

HIHs944t - p16 luc Hs944t - p16 luc L patient 1 patient 2 ** * 2.0 5 ** *** 1.5 4 3 1.0 2 0.5 1 0.0 0 relative activity (au) relative activity (au) GFP CAV1 BCAT siSCR siCAV1 siBCAT

JKHs944t - p16 Hs944t - p16 CAV1 PTEN ** 1.5 ** 4 3 1.0 2 0.5 1 P16

mRNA level (fc) mRNA 0.0 level (fc) mRNA 0 GFP CAV1 siSCR siCAV1

Figure 3 Conde et al. A NRAS Q61/Q61PTEN pos NRAS Q61/Q61PTEN neg B 100 PTEN 51/101 (50.5%) 36/101 (35.6%) 80 (0/19) TTC TTGTCC TTC TTGTCC 60 NRAS (18/35) 40

20 NRAS-PTEN (30/35) 0 melanoma free mice (%) 0 20 40 60 80 100 Weeks

C NRAS-PTEN NRAS NRAS Q61/K61PTEN pos NRAS Q61/K61PTEN neg 1500 11/101 (10.9%) 3/101 (3.0%) 3 TTC TTT TCC TTC TTT TCC 1000

500

tumor volume (mm ) 0 16 24 32 40 48 56 64 72 80 88 Weeks E NHEM D Tyr::Cre/°; PTEN f/+ Tyr::Cre/°; PTEN f/f 3 * 1.5 * 20 20 18 18 16 16 2 1.0 14 14 12 12 1 0.5 10 10

8 8 level (fc) p16 mRNA 6 6 0 0.0 relative number of cells (2i) of cells number relative 4 4 024 68101214 02468101214 GFP PTEN siSCR siPTEN weeks weeks

Figure 4 Conde et al A NRAS C NRAS WT PTEN WT PTEN 4 * 3 2

! "#$ 0 *** 5

0 ! "#$

BDNRAS pos WT PTEN 6/50 4/50 * * *

* s s Ser675 PTEN pos 35/50 5/50

A C miR-203 miR-203 NRAS NRAS PTEN ** 10 1.5 *** 1.5 1.0 5 0.5 1.0 0 0.0 relative level (fc) 0.5 siSCR siBCAT GFP BCAT

relative level (fc) miR-199a miR-199a 0 miR-199a-5p miR-203 20 ** 1.5 *** 15 1.0 B CAV1 10 0.5 5 2.0 *** 0 0.0 relative level (fc) 1.5 * siSCR siBCAT GFP BCAT

1.0 D CAV1 CAV1 0.5 1.5 ** 2.0 * 1.5 relative level (fc) 0.0 1.0 1.0 mim ctrl mim 199a mim 203a 0.5 0.5 0.0

relative level (fc) 0.0 siSCR siBCAT GFP BCAT mim ctrl mim 199a mim 203a

CAV1 CAV1 s-actin s-actin

Figure 6 Conde et al

A Novel Caveolin-Dependent and PI3K/AKT-Independent Role of PTEN

in β-Catenin Transcriptional Activity

Alejandro Conde-Perez1-4*, Gwendoline Gros1-4*, Christine Longvert1-4, Malin

Pedersen5, Valérie Petit1-4, Zackie Aktary1-4, Amaya Viros6, Florian Rambow1-4,

Boris C. Bastian7, Andrew D. Campbell8, Sophie Colombo1-4, Isabel Puig1-4,

Alfonso Bellacosa9, Owen Sansom8, Richard Marais6, Leon C.L.T. Van

Kempen10-12, & Lionel Larue1-4#

1 Institut Curie, Normal and Pathological Development of Melanocytes, 91405, Orsay, France 2 CNRS, UMR3347 Bat. 110, 91405, Orsay Cedex, France. 3 INSERM U1021 4 Equipe labellisée – Ligue Nationale contre le Cancer 5 Targeted Therapy Team, The Institute of Cancer Research, 237 Fulham Road, SW3 6JB, London, United Kingdom 6 Molecular Oncology Group, Cancer Research UK Manchester Institute, The University of Manchester, Wilmslow Road, M20 4BX, Manchester, United Kingdom. 7 Departments of Dermatology and Pathology and UCSF Helen Diller Family Comprehensive Cancer Center, University of California San Francisco, San Francisco. 8 The Beatson Institute for Cancer Research, Glasgow G61 1BD, UK 9 Fox Chase Cancer Center, Philadelphia, PA 19111, USA 10 Department of Pathology, Radboud University Nijmegen Medical Centre. Nijmegen, The Netherlands 11 Jewish General Hospital, Lady Davis Institute for Medical Research, Montreal, Quebec, Canada. 12 Department of Pathology, McGill University, Montreal, Quebec, Canada

Supplementary information

1 Conde et al

Methods

Determination of the number of melanoblasts. Tyr::Cre/°;PTENf/f, Tyr::Cre/°; PTENf/+ and Tyr::Cre/°;PTEN+/+ mice were crossed with Dct::LacZ mice (MacKenzie et al., 1997) and the resulting embryos were collected at various times during pregnancy. Embryos were stained with X-gal, as previously described (Delmas et al., 2003).

References

Delmas, V., Martinozzi, S., Bourgeois, Y., Holzenberger, M., and Larue, L. (2003). Cre- mediated recombination in the skin melanocyte lineage. Genesis 36, 73-80. MacKenzie, M.A., Jordan, S.A., Budd, P.S., and Jackson, I.J. (1997). Activation of the receptor tyrosine kinase Kit is required for the proliferation of melanoblasts in the mouse embryo. Dev Biol 192, 99-107.

2 Conde et al

Figure legends

Figure S1 (A-D) LY294002 did not affect the nuclear localization of β-catenin in the presence of exogenous CAV1-RFP. Cells were treated (D-F) or not (A-C) for one hour with LY294002. (A,D) CAV1-RFP and (B,E) β-catenin immunostainings. (C,F) merge: RFP and β-catenin immunostainings were counterstained with DAPI. Note that the dose of LY294002 was subtoxic but affected slightly the shape of the cells. Scale bar = 10µm.

Figure S2 (A) Immunofluorescence using siRNA mediated knockdown of either Pten or Cav1 in mouse Pancreatic cancer cells (KPC) stained for β-catenin. Cells were fixed and stained 48h post transfection. Western blot analysis of whole cell protein extract was used to validate the knockdown. Scale bar = 25 µm. (B) Immunofluorescence 48h post transfection of CMV::PTEN-GFP and CMV::CAV1- GFP (pseudocolored red) in mouse Pancreatic cancer cells (KPCPTEN2) lacking Pten protein, stained for β-catenin. The arrow points towards the membranous β- catenin. Western blot analysis of whole cell protein extract was used to validate the overexpression. X = exogenous Caveolin-1, N = endogenous Caveolin-1. Scale bar = 25 µm.

Figure S3 A second library of 105 human melanoma samples was assayed by CGH for PTEN status as well as the presence/absence of NRASQ61K mutation. Sixteen samples were identified as having the NRASQ61K mutation (red full circles). On the y-axis (log2), the PTEN copy number determined by CGH analysis: PTEN was absent from 2 cases out of 16 human melanomas carrying NRASQ61K mutation.

Figure S4 The loss of PTEN with coexistent activation of NRAS was assayed from a large panel of human melanoma cell lines. NRAS mutated cell line carried the K61 mutation validated by allelic specific PCR. Note that another cell line, besides Hs944T, was

3 Conde et al found to be mutated for NRAS and lacking PTEN (YUDEDE which is NRASQ61H). Western blot analysis for PTEN and β-actin proteins were performed three times.

Figure S5 Dorsal melanoma appearing in NRAS (A) and NRAS-ΔPTEN (B) mice (arrow). Melanoma arose from different part of the body including hairy part, pinnae, and tails/paws (see Table S2). (C-F) Haematoxylin and eosin staining of a NRAS (C,E) and NRAS-ΔPTEN (D,F) cutaneous melanoma. Scale bar for C,D = 100µm. (E,F) Higher magnification reveals irregularly shaped pigmented cells with diverse sizes and large nuclei. Scale bar = 10µm. Positive immunostaining for melanoma marker S100 in NRAS and NRAS-ΔPTEN tumors. Scale bar = 50µm. (G,H)

Figure S6 (A) Kaplan-Meier plot showing tumor free survival in months of studied mice. The experimental groups consisted of tamoxifen-treated Tyr::CreERt2/° ; NrasG12D/+ ; PTENf/+ (NRASG12D/+ - ΔPTEN, n=20), and Tyr::CreERt2/° ; NrasG12D/G12D ; PTENf/+ (NRASG12D/G12D - ΔPTEN, n=32). The control group consisted of tamoxifen treated Tyr::CreERt2/° ; Nras+/+ ; PTENf/+ (n=10), Tyr::CreERt2/° ; NrasG12D/+ ; PTEN+/+ (n=21) and Tyr::CreERt2/°; NrasG12D/G12D; PTEN+/+ (n=10) mice as well as ethanol- treated Tyr::CreERt2/°; NrasG12D/+; PTENf/+ (n=18), and Tyr::CreERt2/°; NrasG12D/G12D; PTENf/+ (n=17) mice. Median survival of +/G12D;+/PTEN mice is undefined and for G12D/G12D;+/PTEN is 10.5 months. (B) Macroscopic images of NRASG12D/+ - ΔPTEN and NRASG12D/G12D - ΔPTEN tumours. (C) Photomicrographs of hematoxilyn and eosin (H&E) stained skin from NRASG12D/+ - ΔPTEN and NRASG12D/G12D - ΔPTEN animals. Black arrows point to pigmented, dendritic melanocytes in the dermis. Scale bar = 50µm. (D) Photomicrographs of H&E stained tumours from NRASG12D/+ - ΔPTEN and NRASG12D/G12D - ΔPTEN animals. Black arrows point to mitotic cells. Scale bar = 300µm (left column), 50µm (right column). (E) Photomicrographs of immunohistochemistry (IHC) staining for Hmb45 (E), S100 (F), ppERK (G), pAKT (H) and Ki67 (I) from NRASG12D/+ - ΔPTEN and NRASG12D/G12D - ΔPTEN tumours. Scale bar = 50µm.

4 Conde et al Figure S7 (A) Positive Ki-67 staining of NRAS and NRAS-ΔPTEN tumor sections. Scale bar = 10µm. (B) Graphical representation of the relative number of Ki-67 positive cells in NRAS and NRAS-ΔPTEN tumor sections. The relative number of Ki-67 positive cells correspond to the ratio of the number of Ki-67+ cells from identical surface in NRAS or NRAS-ΔPTEN tumor sections vs. the number of Ki-67+ cells from identical surface in NRAS tumor sections. Statistical significance was determined by Mann-Whitney test. ***, signifies p-value < 0.001. Five hundred cells were assessed from four fields and four independent experiments for each genotype.

Figure S8. Immunoblot analysis of the MAPK and PI3K/AKT pathways reveals differential regulation of key proteins. Immunoblot analysis of protein lysates from 8 murine uncultured melanoma samples; 4 from NRAS and 4 from NRAS-ΔPTEN. Western blot analyses were performed between three and six times depending on the antibody.

Figure S9. During embryogenesis the lack of PTEN does not affect melanocyte precursor numbers. WT (Tyr::Cre/°; PTEN+/+; Dct::LacZ/°), ΔPTEN (Tyr::Cre/°; PTENf/f; Dct::LacZ/°), NRAS (Tyr::NRASQ61K; Tyr::Cre/°;PTEN+/+; Dct::LacZ/°) and NRAS- ΔPTEN (Tyr::NRASQ61K; Tyr::Cre/°; PTENf/f; Dct::LacZ/°) Dct-LacZ-positive cells were counted at E15.5 (n=5 for each genotype) at the trunk level of the embryos between the fore- and hind-limbs (somites 13 to 25) on the right side.

Figure S10. (A) Occurrence of lung metastasis in NRAS and NRAS-ΔPTEN mice. (B) Multiple lung melanoma metastases in NRAS-ΔPTEN mice. (C) Histological staining with haematoxylin and eosin showing pigmented cells, consistent with the diagnosis of melanoma lung metastasis. Scale bar = 20µm.

5 Conde et al Hs944t LY294002 - + A D CAV1

B E BCAT

C F merge

Figure S1

Conde et al A si Scr si Pten si Cav1

β-cat

DAPI

Merge

siScr siPten siScr siCav1

PTEN CAV1

β-actin β-actin

Figure S2A Conde et al B CMV::GFP CMV::PTEN CMV::CAV1

β-cat

GFP

DAPI

Merge

PTEN CAV1 GFP GFP GFP GFP X PTEN CAV1 N

β-actin β-actin

Figure S2B Conde et al gain 0.4 0.2 0.0 normal 2 -0.2 log -0.4 loss -0.6 PTEN copy numbercopyPTEN -0.8 homo loss

Figure S3 Conde et al Lyse Rosi Hs944T SK29

PTEN

β-Actin

NRAS status K61 Q61 K61 Q61

T183 G183 T183 G183

Figure S4 Conde et al A C E G

B D F H

Figure S5 Conde et al A B NRAS G12D/+ NRAS G12D/G12D ΔPTEN ΔPTEN 100 Controls l (%)

va 75 i

rv NRAS G12D/+

su 50 ΔPTEN ree -f 25 NRAS G12D/G12D mor

Tu ΔPTEN 0 0 4 8 12 16 20 24

Time (months) NRAS G12D/G12D ΔPTEN C

NRAS G12D/+ ΔPTEN NRAS G12D/G12D ΔPTEN D

NRAS G12D/+ ΔPTEN NRAS G12D/G12D ΔPTEN

Figure S6 Conde et al E

Hmb45

F !"##$

S100

ppERK

pAKT

Ki67

NRAS G12D/+ ΔPTEN NRAS G12D/G12D ΔPTEN

Figure S6 Conde et al AB

*** 6 NRAS 4

2 NRAS

ΔPTEN Ki-67 + cells (a.u) 0 NRAS NRAS ΔPTEN

Figure S7 Conde et al NRAS NRAS-ΔPTEN A ERK

pERK (Thr202/Tyr204) CREB

pCREB (Ser 133) β-actin B PTEN

AKT pAKT (Ser 473) GSK3-β pGSK3-β (Ser 9) S6

pS6 (Ser 235/236)

β-actin C β-catenin pβ-catenin (Ser 675) pβ-catenin (Ser 33/37 Th41) p16

β-actin

Figure S8 Conde et al melanoblast number (x103) 10 12 0 2 4 6 8 WT Figure S9 ∆ TN RS NRAS NRAS PTEN Conde etal ∆ PTEN A B 100

40 C

20 8/17

1/7

Occurrence of lung metastasis (%) 0 NRAS NRAS ΔPTEN

Symbol Synonym(s) Entrez Gene Name Location Family ABCB1 ABC20, Abcb4, Abcb1a, CD243, CLCS, Evi32, GP170, MDR1ATP-binding cassette, sub-family B (MDR/TAP), member Plasma1 Membrane transporter ABCC1 ABC29, ABCC, Abcc1a, Abcc1b, Avcc1a, GS-X, LOC1003627ATP-binding cassette, sub-family C (CFTR/MRP), memberPlasma Membrane transporter ABCD2 ABC39, ALDL1, ALDR, ALDRP, hALDR ATP-binding cassette, sub-family D (ALD), member 2 Cytoplasm transporter ABCD4 ABC41, EST352188, MAHCJ, P69r, P70R, P79R, PMP69, PXMP1ATP-binding cassette, sub-family D (ALD), member 4 Cytoplasm transporter ABL1 ABL, AI325092, c-ABL, CABL1, E430008G22Rik, JTK7, p145Abc-abl oncogene 1, non-receptor tyrosine kinase Nucleus kinase ACAN Agc, AGC1, AGCAN, Agg, b2b183Clo, BOS 20116, cmd, Cspcpaggrecan Extracellular Space other ACAP1 Centaurin b1 homolog, CENTB1, RP23-119B10.2 ArfGAP with coiled-coil, ankyrin repeat and PH domains 1Plasma Membrane other AChR Ach Receptor, Cholinergic receptor Plasma Membrane complex ACP1 4632432E04Rik, AI427468, HAAP, LMPTP, LMW-PTP, rCG 61acid phosphatase 1, soluble Cytoplasm phosphatase ACTA2 0610041G09RIK, a-SMA, AAT6, ACTSA, Actvs, Alpha-SMA, BOactin, alpha 2, smooth muscle, aorta Cytoplasm other ACTB A-X actin, actin, Actin beta, Actx, beta-actin, BOS 22932, BRWactin, beta Cytoplasm other ACTC1 ACTC, ASD5, CMD1R, CMH11, LVNC4, RP23-230H3.3 actin, alpha, cardiac muscle 1 Cytoplasm enzyme Actin G-actin Cytoplasm group ACTN4 ACTININ 4, Alpha actinin 4, C77391, FSGS, FSGS1, NON-MUactinin, alpha 4 Cytoplasm other ACTR3 1200003A09Rik, ARP3, BOS 1864 ARP3 actin-related protein 3 homolog (yeast) Plasma Membrane other ACVR2A Actr2a, ACTRII, ActrIIa, ACVR2, rActR-II, RP23-139F8.3, TactrIactivin A receptor, type IIA Plasma Membrane kinase ADIPOQ ACDC, ACRP30, adipo, Adipocyte complement related proteinadiponectin, C1Q and collagen domain containing Extracellular Space other ADRA2C ADRA2L2, ADRA2RL2, ADRARL2, Alpha 2c adrenergic recepadrenoceptor alpha 2C Plasma Membrane G-protein coupled receptor ADRB1 ADRB1R, Adrenergic Receptor Beta 1, B1AR, beta-AR, beta1adrenoceptor beta 1 Plasma Membrane G-protein coupled receptor ADSS ADEH, ADSS2, AI314886, AS, RP11-518L10.4 adenylosuccinate synthase Cytoplasm enzyme AES AES-1, AL024115, ESP1, GAM, GRG5, GRG, TLE5 amino-terminal enhancer of split Nucleus transcription regulator AFP Alpha fetoprotein, FETA, HPAFP alpha-fetoprotein Extracellular Space transporter AGRN AGR, AGRIN, LOC100503504, Neural agrin, nmf380, RP11-54agrin Plasma Membrane other AHCTF1 6230412P20Rik, AV011447, ELYS, LOC100365024, MST108,AT hook containing transcription factor 1 Nucleus transcription regulator AHR Ah, AH receptor, Ahh, Ahre, bHLHe76, DIOXIN receptor, In aryl hydrocarbon receptor Nucleus ligand-dependent nuclear receptor AIM1 AI462491, AI463325, CRYBG1, RP11-294H11.2, ST4 absent in melanoma 1 Extracellular Space other AJAP1 Gm573, MOT8, RP23-144K17.1, RP3-426F10.1, SHREW-1 adherens junctions associated protein 1 Plasma Membrane other AKAP11 6330501D17, 6330501D17Rik, Akap, AKAP220, Gm80, mKIAA0A kinase (PRKA) anchor protein 11 Cytoplasm other AKAP12 AI317366, AKAP12A, AKAP12B, AKAP12G, AKAP250, Srcs5,A kinase (PRKA) anchor protein 12 Cytoplasm transporter AKAP13 1700026G02RIK, 5730522G15RIK, 5830460E08RIK, AKAP-LA kinase (PRKA) anchor protein 13 Cytoplasm other AKAP5 3526401B18RIK, AKAP 150, AKAP75, AKAP79, BB098886, GA kinase (PRKA) anchor protein 5 Plasma Membrane other Akt B/Akt, Pkb, RAC-PK Cytoplasm group AKT1 AKT, BOS 20453, CWS6, PKB, PKB-ALPHA, PKB/Akt, PRKBA,v-akt murine thymoma viral oncogene homolog 1 Cytoplasm kinase AKT2 2410016A19Rik, AW554154, HIHGHH, PKB, PKBB, PKBBETA,v-akt murine thymoma viral oncogene homolog 2 Cytoplasm kinase ALCAM AI853494, ALCAM isoform 1, BEN, CD166, DM-GRASP, MEMDactivated leukocyte cell adhesion molecule Plasma Membrane other ALDH1A1 Ahd-2, ALDC, ALDEHYDE DEHYDROGENASE A1, ALDH-E1aldehyde dehydrogenase 1 family, member A1 Cytoplasm enzyme ALDH3A2 Ahd-3, Ahd-3r, AI194803, ALD10, ALDH10, Aldh4, Aldh4-r, FALaldehyde dehydrogenase 3 family, member A2 Cytoplasm enzyme ALG3 CDG1D, CDGS4, D16Ertd36e, Not56, NOT56L ALG3, alpha-1,3- mannosyltransferase Cytoplasm enzyme Alp 3.1.3.1, alkaline phenyl phosphatase, Alkaline Phosphatase, alkaline phosphohydrolase, alkaline phosphomonoesteraseOther group Alpha Actinin ACTININ, Actinin α, ACTN, α-Actinin Cytoplasm group Alpha catenin CTNN α Cytoplasm group AMER1 2810002O09RIK, AW492303, FAM123B, OSCS, RGD1560322APC membrane recruitment protein 1 Plasma Membrane other ANP32A Anp32, C15orf1, HPPCn, I1PP2A, LANP, LNAP, MAPM, PHAP1acidic (leucine-rich) nuclear phosphoprotein 32 family, membNucleus other ANP32B 2410015B15Rik, APRIL, BM554099, PAL31, PHAPI2, PHAPI2acidic (leucine-rich) nuclear phosphoprotein 32 family, membNucleus other ANXA1 annexin A1, Annexin-1, ANX1, C430014K04RIK, Lc1, Lipocortannexin A1 Plasma Membrane other ANXA2 annexin A2, annexin II, ANX2, ANX2L4, AW215814, CAL1H, annexinC A2 Plasma Membrane other AOC3 Carbazide-sensitive amine oxidase, HPAO, RP23-281C18.16-0amine oxidase, copper containing 3 Plasma Membrane enzyme AP3D1 AA407035, ADTD, AP3D, AP3D1 isoform 1, Bolvr, delta ADAPTadaptor-related protein complex 3, delta 1 subunit Cytoplasm transporter APC AI047805, APC (PROC), APC1, Apc7, AU020952, AW124434,adenomatous polyposis coli Nucleus enzyme APC-AXIN-CK1a-CTNN βAPC-AXIN-CK1-CTNNbeta-GSK3beta-G Cytoplasm complex APC/APC2 adenomatous polyposis coli, APC Cytoplasm group APC2 AI852447, APC, APCL, R75424 adenomatosis polyposis coli 2 Cytoplasm enzyme APOD AOPDGN, LOC100047583 apolipoprotein D Extracellular Space transporter APPL1 2900057D21RIK, 7330406P05Rik, AI585782, APPL, AW20907adaptor protein, phosphotyrosine interaction, PH domain Cytoplasma other AQP4 AQP4 isoform 1, AQP4.M23, HMIWC2, MIWC, MIWC2, WCH4aquaporin 4 Plasma Membrane transporter AQP5 aquaporin 5 Plasma Membrane transporter AR AIS, Andr, AW320017, DHTR, HUMARA, HYSP1, KD, NR3C4androgen receptor Nucleus ligand-dependent nuclear receptor ARFGAP3 0610009H19Rik, 1810004P07Rik, 1810035F16Rik, 9130416J1ADP-ribosylation factor GTPase activating protein 3 Cytoplasm transporter ARHGAP32 3426406O18RIK, GC-GAP, GRIT, mKIAA0712, p200RhoGAP,Rho GTPase activating protein 32 Cytoplasm other ARHGDIA 5330430M07Rik, Bles01, Gdi-1, GDIA, GDIA1, NPHS8, Rho-GRho GDP dissociation inhibitor (GDI) alpha Cytoplasm other ARHGEF7 BETA-PIX, Beta-Pix Cool, beta1PIX, betaPix-b, betaPix-c, CooRho guanine nucleotide exchange factor (GEF) 7 Cytoplasm other Arhgef7 Beta-PIX, P85 beta pix, P85spr, Pak3bp Rho guanine nucleotide exchange factor (GEF) 7 Plasma Membrane other ARID4B 5930400I17, 6330417L24Rik, 6720480E17Rik, 9330186M13,AT rich interactive domain 4B (RBP1-like) Nucleus other ARL4A AI467555, ARL4 ADP-ribosylation factor-like 4A Nucleus enzyme ARMC8 1200015K23Rik, GID5, HSPC056, RGD1310477, S863-2, VIDarmadillo repeat containing 8 Other other ASCL2 2410083I15Rik, ASH2, bHLHa45, HASH2, MASH2 achaete-scute complex homolog 2 (Drosophila) Nucleus transcription regulator ASH2L ASH2, ASH2L1, ASH2L2, Bre2 ash2 (absent, small, or homeotic)-like (Drosophila) Nucleus transcription regulator ATF2 CRE-BP, CRE-BP1, CREB2, D130078H02Rik, D18875, HB16activating transcription factor 2 Nucleus transcription regulator ATF3 AIT3, LRF-1, LRFI, LRG-21, RP11-338C15.1 activating transcription factor 3 Nucleus transcription regulator ATF4 C/ATF, CREB-2, TAXREB67, TXREB activating transcription factor 4 Nucleus transcription regulator ATM AI256621, AT1, ATA, ATC, ATD, ATDC, ATE, C030026E19RIK,ataxia telangiectasia mutated Nucleus kinase ATOH1 ATH1, bHLHa14, HATH1, MATH-1, RGD1565171 atonal homolog 1 (Drosophila) Nucleus transcription regulator ATP6V0A1 a1, AA959968, ATP6a1, ATP6N1, ATP6N1A, Atpv0a1, RP23-2ATPase, H+ transporting, lysosomal V0 subunit a1 Cytoplasm transporter AXIN1 AI316800, AXIN, AXIN form I, Fu, fused, Kb, Ki, kinky, knobblyaxin 1 Cytoplasm other AXIN2 Axi1, AXIL, Conductin, ODCRCS, RP23-202G21.3 axin 2 Cytoplasm other BAMBI 2610003H06Rik, NMA BMP and activin membrane-bound inhibitor Plasma Membrane other Bbc3 PUMA, PUMA/JFY1 BCL2 binding component 3 Cytoplasm other BCAP31 6C6-AG, b-cell receptor-associated protein 31, BAP31, CDM,B-cell receptor-associated protein 31 Cytoplasm transporter BCCIP 1110013J05RIK, TOK-1 BRCA2 and CDKN1A interacting protein Nucleus other BCL2 AW986256, Bcl2 alpha, C430015F12Rik, D630044D05RIK, D8B-cell CLL/lymphoma 2 Cytoplasm transporter BCL2L1 bBclxl, Bcl-X beta, Bcl-x(L), BCL-XL/S, BCL2L, BCLX, Bclx gaBCL2-like 1 Cytoplasm other BCL2L11 1500006F24RIK, BAM, BIM, BOD, BODL, LOC150819, RP23BCL2-like 11 (apoptosis facilitator) Cytoplasm other BCL3 AI528691, B CELL CLL/LYMPHOMA 3, B-cell leukemia/lymphB-cell CLL/lymphoma 3 Nucleus transcription regulator BCL9 2610202E01RIK, 8030475K17Rik, A330041G23Rik, Gm130,B-cell L CLL/lymphoma 9 Nucleus other Bcl9-Cbp/p300-Ctnnb1-Lef/Tcf Nucleus complex BCL9L B9L, BC003321, BCL9-2, DLNB11 B-cell CLL/lymphoma 9-like Cytoplasm other Betacatenin/TCF Beta-catenin-LEF/TCF Nucleus complex BGN BG, Biglycan, BOS 25442, BSPG1, DSPG1, PG-S1, PGI, RP2biglycan Extracellular Space other BHLHE40 Basic helix loop helix, Basic helix-loop-helix domain containingbasic helix-loop-helix family, member e40 Nucleus transcription regulator BIRC5 AAC-11, AP14, API4, EPR-1, RP23-268N22.2, Survivin, SURVIbaculoviral IAP repeat containing 5 Cytoplasm other BMP1 OI13, PCOLC, PCP, PCP2, Procollagen C Proteinase, Tld bone morphogenetic protein 1 Extracellular Space peptidase BMP2 AI467020, BDA2, BMP2A, BONE MORPHOGENIC protein 2,bone morphogenetic protein 2 Extracellular Space growth factor BMP4 BMP2B, BMP2B1, BOMPR4A, MCOPS6, OFC11, RP23-87H1bone morphogenetic protein 4 Extracellular Space growth factor BMP7 OP-1, osteogenic protein 1, RP11-560A15.5, RP23-188A4.1 bone morphogenetic protein 7 Extracellular Space growth factor BOC 4732455C11, CDON2, mFLJ00376, UNQ604/PRO1190 BOC cell adhesion associated, oncogene regulated Plasma Membrane other BRCA1 BRCAI, BRCC1, BROVCA1, IRIS, PNCA4, PPP1R53, PSCP,breast cancer 1, early onset Nucleus transcription regulator BRIX1 1110064N10Rik, BRIX, BXDC2, C76935, RGD1308508 BRX1, biogenesis of ribosomes, homolog (S. cerevisiae) Nucleus other BRMS1L 0710008O11Rik, AI159718, BRMS1, D12Ertd407e, LOC10003breast cancer metastasis-suppressor 1-like Other other BTF3 1700054E11RIK, BETA-NAC, BTF3a, BTF3b, mCG 114993, basicN transcription factor 3 Nucleus transcription regulator BTRC b-TrCP, BETA-TRCP, beta-TRCP1, bTrCP1, FBW1A, FBXW1,beta-transducin repeat containing E3 ubiquitin protein ligaCytoplasmse enzyme C1QBP AA407365, AA986492, complement component 1, D11Wsu182complement component 1, q subcomponent binding proteiCytoplasm transcription regulator C6 AW111623 complement component 6 Extracellular Space other CA3 BB219044, CAIII, CAR3, Carbonic anhydrase 3 carbonic anhydrase III, muscle specific Cytoplasm enzyme CA9 CA IX, Car9, MN, MN/CA9, RP23-195K8.9 carbonic anhydrase IX Nucleus enzyme CACNA1A Alpha1 2.1, alpha1A, APCA, BccA1, BI, BOS 7382, Caca1a, calciumC channel, voltage-dependent, P/Q type, alpha 1A suPlasma Membrane ion channel CACNA1G a1G, alpha-1G, Ca(V)T.1, Calcium Channel alpha1g, CaV3.1,calcium channel, voltage-dependent, T type, alpha 1G subPlasma Membrane ion channel CACYBP GIG5, hCacyBP, PNAS-107, RP1-102G20.6, S100A6BP, SIPcalcyclin binding protein Nucleus other Cadherin Plasma Membrane group Cadherin (E,N,P,VE) Cadherin (E,N,P,VE) Plasma Membrane group CALCOCO1 1810009B06RIK, calphoglin, Cocoa, Gcap11, mKIAA1536, NCcalcium binding and coiled-coil domain 1 Nucleus transcription regulator CALM1 (includes others)1500001E21RIK, AI256814, AI327027, AI461935, AL024000,calmodulin AL 1 (phosphorylase kinase, delta) Cytoplasm other CAMK2A Calmodulin kinase II, CAMKA, CaMKII, CAMKII alpha, mKIAA0calcium/calmodulin-dependent protein kinase II alpha Cytoplasm kinase CAPN1 CALCIUM ACTIVATED NEUTRAL PROTEASE, CALPAIN I, Ccalpain 1, (mu/I) large subunit Cytoplasm peptidase CAPNS1 30K, CALCIUM-DEPENDENT PROTEASE, SMALL subunit, calpain,C small subunit 1 Cytoplasm peptidase CAPZB 1700120C01Rik, AI325129, CAPB, CAPPB, Cappb1, Cappingcapping protein (actin filament) muscle Z-line, beta Cytoplasm other CARM1 PRMT4 coactivator-associated arginine methyltransferase 1 Nucleus transcription regulator CASC4 D130060C09Rik, H63, RGD1305985, RP23-328F20.1, UNQ2cancer susceptibility candidate 4 Other other CASK CAGH39, CAMGUK, CMG, DXPri1, DXRib1, FGS4, LIN-2, MIcalcium/calmodulin-dependent serine protein kinase (MAGPlasma Membrane kinase CASP3 A830040C14Rik, AC-3, Apopain, Caspase-3, CASPASE-3 p20caspase 3, apoptosis-related cysteine peptidase Cytoplasm peptidase CASP8 ALPS2B, CAP4, FLICE, MACH, MCH5, PROCASP8 caspase 8, apoptosis-related cysteine peptidase Nucleus peptidase CAV1 BSCL3, Cav, Cavelolin 1, CAVEOLIN, Caveolin1, CGL3, LOC1caveolin 1, caveolae protein, 22kDa Plasma Membrane transmembrane receptor CBL 4732447J05Rik, C-CBL, Cbl ubiquitin ligase, CBL2, CBLA, FRCbl proto-oncogene, E3 ubiquitin protein ligase Nucleus transcription regulator CBLL1 AI467391, c-Cbl-like, HAKAI, RNF188 Cbl proto-oncogene-like 1, E3 ubiquitin protein ligase Nucleus enzyme Cbp/p300 CBP, CBP-p300 Nucleus group CBY1 1110014P06Rik, arb1, C22orf2, CBY, HS508I15A, PGEA1, PGchibby homolog 1 (Drosophila) Cytoplasm other CCL7 chemokine ligand 7, Chemotactic protein 3, FIC, MARC, MCP-3chemokine (C-C motif) ligand 7 Extracellular Space cytokine CCNA1 CYCLIN A cyclin A1 Nucleus other CCNA2 AA408589, CCN1, CCNA, Cyca, CycA2, Cyclin a2, p60 cyclin A2 Nucleus other CCND1 AI327039, B-CELL CLL/LYMPHOMA 1, BCL1, BOS 25001, cDcyclin D1 Nucleus other CCND2 2600016F06RIK, AI256817, BF642806, BOS 6021, C86853, cyclincD D2 Nucleus other CCNE1 AW538188, CCNE, CycE1, CYCLE, cyclin E cyclin E1 Nucleus transcription regulator CCNE2 AV063769, CYCE2, RP23-343F17.5 cyclin E2 Nucleus other CCR7 BLR2, CD197, CDw197, CHEMOKINE CC7 receptor, CMKBRchemokine (C-C motif) receptor 7 Plasma Membrane G-protein coupled receptor CCT2 99D8.1, CCT-beta, CCTB, chaperonin containing TCP1, subunchaperonin containing TCP1, subunit 2 (beta) Cytoplasm kinase CD34 AU040960, CD34 ANTIGEN, MESENCHYMAL STEM CELL ANCD34 molecule Plasma Membrane other CD4 CD4 ANTIGEN, CD4 Receptor, CD4mut, CD4v4, L3T4, Ly-4,CD4 p molecule Plasma Membrane transmembrane receptor CD44 216062 AT, AL133330.1, AU023126, AW121933, AW146109, CD44C molecule (Indian blood group) Plasma Membrane enzyme Cd52 AI463198, B7, B7-Ag, CAMPATH-1, CLS1, MB7, RP23-314D2CD52 antigen Other other CD82 4F9, AA682076, AL023070, C33, C33 antigen, GR15, IA4, KAICD82 molecule Plasma Membrane other CD99 1110061M03Rik, 2410026K10RIK, D4, HBA71, MIC2, MIC2X,CD99 molecule Plasma Membrane other CDC27 AI452358, ANAPC3, APC3, BC023187, CDC27Hs, D0S1430E,cell division cycle 27 Nucleus other CDC73 8430414L16RIK, AC175246.2, BC027756, C130030P16Rik, cellC division cycle 73 Nucleus other CDH1 AA960649, Arc-1, Cadherin E, CD324, CDHE, CSEIL, E-cadhcadherin 1, type 1, E-cadherin (epithelial) Plasma Membrane other CDH10 A830016G23RIK, C030003B10RIK, C030011H18RIK, T2-cadhcadherin 10, type 2 (T2-cadherin) Plasma Membrane other CDH11 CAD11, CDH11 isoform 1, CDHOB, OB, OB CADHERIN 1, Obcadherin 11, type 2, OB-cadherin (osteoblast) Plasma Membrane other CDH15 AI323380, CDH14, CDH3, CDHM, MCAD, MRD3, Muscle-cadcadherin 15, type 1, M-cadherin (myotubule) Plasma Membrane other CDH16 KSP-cadherin, UNQ695/PRO1340 cadherin 16, KSP-cadherin Plasma Membrane enzyme CDH17 CDH16, HPT-1, HPT-1/LI, RP23-54P14.2 cadherin 17, LI cadherin (liver-intestine) Plasma Membrane transporter CDH18 B230220E17RIK, CDH14, CDH14L, CDH24 cadherin 18, type 2 Plasma Membrane other CDH2 CD325, CDHN, CDw325, N-cadherin, NCAD, Neural cadherincadherin 2, type 1, N-cadherin (neuronal) Plasma Membrane other CDH22 C20orf25, dJ998H6.1, Pb-Cadherin, RP23-428M13.3 cadherin 22, type 2 Plasma Membrane other CDH3 AI385538, Cadp, CDHP, HJMD, P-cadherin, PCAD cadherin 3, type 1, P-cadherin (placental) Plasma Membrane other CDH4 AW120700, CAD4, Cdh4l, FLJ22202, R-Cadh, R-cadherin, RCcadherin 4, type 1, R-cadherin (retinal) Plasma Membrane other CDH5 7B4, AA408225, CD144, Ve Cad2, VE-Cad, VE-CADHERIN, cadherinV 5, type 2 (vascular endothelium) Plasma Membrane other CDH6 CAD6, cadherin-6, K-cadherin, KCAD, Kidney-cadherin cadherin 6, type 2, K-cadherin (fetal kidney) Plasma Membrane other CDH7 9330156F07Rik, Cad7, CDH7L1 cadherin 7, type 2 Plasma Membrane other CDH8 AI851472, cad8, Nbla04261 cadherin 8, type 2 Plasma Membrane other CDH9 T1-cadherin cadherin 9, type 2 (T1-cadherin) Plasma Membrane other CDHE/CDHN CDH E/N Plasma Membrane group CDK2AP1 Apc10, Cdk associated protein 1, Cdkap1, DOC1, DORC1, LOcyclin-dependent kinase 2 associated protein 1 Nucleus other CDK5 AW048668, BOS 4735, Crk6, Neuronal cdc2-like kinase, PSSALcyclin-dependent kinase 5 Nucleus kinase CDK5R1 CDK5P35, CDK5R, CDK5R1 p35, CDK5R1/ p35, D11Bwg037cyclin-dependent kinase 5, regulatory subunit 1 (p35) Nucleus kinase CDK7 AI323415, AI528512, C230069N13, CAK1, CDKN7, Crk4, ENSMUcyclin-dependent kinase 7 Nucleus kinase CDKN1A CAP20, CDKI, CDKN1, CDKNA1, CIP1, MDA-6, P21, p21CIP1cyclin-dependent kinase inhibitor 1A (p21, Cip1) Nucleus kinase CDKN1B AA408329, AI843786, Cdki1b, CDKN4, CYCLIN-DEPENDENTcyclin-dependent kinase inhibitor 1B (p27, Kip1) Nucleus kinase CDKN1C AL024410, BWCR, BWS, CDK INHIBITOR 1C, CDK1C, CDKIcyclin-dependent kinase inhibitor 1C (p57, Kip2) Nucleus other CDKN2A Arf, ARF-INK4a, CDK4I, CDKN2, CMM2, CYCLIN-DEPENDENcyclin-dependent kinase inhibitor 2A Nucleus transcription regulator CDKN2B AV083695, CDK4I, INK4B, MTS2, P15, p15(INK4b), p15INK4,cyclin-dependent kinase inhibitor 2B (p15, inhibits CDK4)Nucleus transcription regulator CDKN2D INK4D, p19, p19-INK4D cyclin-dependent kinase inhibitor 2D (p19, inhibits CDK4)Cytoplasm transcription regulator CDON Cd0, CDO, CDON1, HPE11, ORCAM cell adhesion associated, oncogene regulated Plasma Membrane other CDX1 Cdx, Cdxa caudal type homeobox 1 Nucleus transcription regulator CDX2 CDX-3 caudal type homeobox 2 Nucleus transcription regulator CEACAM1 BGP, BGP1, BGPA, BGPI, BGPR, Cc1, CCAM105, CD66a, CEACcarcinoembryonic antigen-related cell adhesion molecule Plasma1 Membrane other CEBPA C/EBP alpha P30, C/EBP alpha P42, C/EBP-alpha, C/EBP-αCCAAT/enhancer, binding protein (C/EBP), alpha Nucleus transcription regulator CEBPB Agp/eb, ANF-1, ANF-2, C/Ebp Beta-Lip, C/EBP-beta, C/EBP-CCAAT/enhancerβ binding protein (C/EBP), beta Nucleus transcription regulator CELSR1 CDHF9, crash, Crsh, FMI2, HFMI2, ME2, RP5-1163J1.5, Scycadherin, EGF LAG seven-pass G-type receptor 1 Plasma Membrane G-protein coupled receptor CENPM 2610019I03Rik, AI853711, bK250D10.2, C22orf18, CTA-250Dcentromere protein M Cytoplasm other CER1 CERBERUS, Cerl, Cerl1, Cerr1, DAND4, RGD1563046, RP23cerberus 1, DAN family BMP antagonist Extracellular Space cytokine CFD ADIPSIN, ADN, DF, EVE, Factor D, PFD complement factor D (adipsin) Extracellular Space peptidase CHD8 5830451P18Rik, AU015341, AUTS18, DUPLIN, HELSNF1, KIchromodomain helicase DNA binding protein 8 Nucleus enzyme CHGA BOS 20454, CGA, ChrA, CHROMOGRANIN A, parathyroid sechromogranin A (parathyroid secretory protein 1) Cytoplasm other CHUK AI256658, Chuk predicted, Chuk1, CONSERVED HELIX-LOOconserved helix-loop-helix ubiquitous kinase Cytoplasm kinase CIDEC Adipoocyte-specific, CIDE-3, FPLD5, FSP27 cell death-inducing DFFA-like effector c Cytoplasm other CLDN2 AL022813, Claudin-2, RGD1560247, RP1-75H8.2, RP23-343M4claudin 2 Plasma Membrane other CLDN5 AI854493, AWAL, BEC1, CPETRL1, MBEC1, TMVCF claudin 5 Plasma Membrane other CLTA AV026556, BOS 8888, CLATHRIN LIGHT CHAIN-A, CLTA2, clathrin,L light chain A Plasma Membrane other Clu AI893575, APOJ, CLI, D14Ucla3, DAG, Gp80, RATTRPM2B,clusterin SG Cytoplasm other CNKSR3 6820402C05, BC024086, MAGI1, Prp4, RP11-486M3.1 CNKSR family member 3 Plasma Membrane kinase CNN2 AA408047, AI324678, Calpo2, H2-calponin calponin 2 Cytoplasm other COL1A1 alpha 1 (I) PROCOLLAGEN, alpha 1(I) COLLAGEN, Alpha1 typcollagen, type I, alpha 1 Extracellular Space other COL27A1 5730512J02Rik, AI449266, mKIAA1870, RP11-82I1.1, RP23-3collagen, type XXVII, alpha 1 Extracellular Space other COL2A1 ANFH, AOM, CG2A1A, COL11A3, COL2, Col2a, Collagen typecollagen, type II, alpha 1 Extracellular Space other COL4A1 arresten, BRU, Collagen type iv alpha1, Del(8)44H, HANAC, collagen,IC type IV, alpha 1 Extracellular Space other COL4A2 Collagen iv alpha2, ICH, POREN2, Procollagen iv alpha2, RP1collagen, type IV, alpha 2 Extracellular Space other COL4A5 ASLN, ATS, CA54, Collagen iv alpha5, COLLAGEN type IV, ISOcollagen, type IV, alpha 5 Extracellular Space other COL4A6 BB116301, CXDELq22.3, DELXq22.3, RP23-264D18.1, RP5-8collagen, type IV, alpha 6 Extracellular Space other COMMD3-BMI1 AW546694, Bmi1, Pcgf4, RP23-396N6.2 COMMD3-BMI1 readthrough Nucleus transcription regulator CONNEXIN Other group COPS2 AI315723, ALIEN, alien-like, C85265, CSN2, RP23-368I1.3, SGCOP9 signalosome subunit 2 Cytoplasm transcription regulator COPS3 CSN3, SGN3 COP9 signalosome subunit 3 Cytoplasm other COPS8 9430009J09RIK, AA408242, COP9, COP9 homolog, CSN8, SGCOP9 signalosome subunit 8 Nucleus other CPSF4 C79664, CPSF30, CPSF4 30KD, NAR, NEB1 cleavage and polyadenylation specific factor 4, 30kDa Nucleus other CRABP2 AI893628, Cellular retinoic acid binding protein ii, CRAB II, Cracellular retinoic acid binding protein 2 Cytoplasm transporter CRAT Acetyl Carnitine Transferase, ACT, AW107812, CARAT, CARNcarnitine O-acetyltransferase Cytoplasm enzyme Creb Cbp, Cyclic AMP response element binding Nucleus group CREB1 2310001E10Rik, 3526402H21RIK, AV083133, BOS 2010, CAMPcAMP responsive element binding protein 1 Nucleus transcription regulator CREBBP AW558298, CBP, CBP/p300, KAT3A, p300/CBP, RSTS, RTSCREB binding protein Nucleus transcription regulator CRIP1 CRHP, CRIP, CRP-1, Cysteine-rich intestinal, LOC686293, rCGcysteine-rich protein 1 (intestinal) Cytoplasm other CRYAB AACRYA, ABC, alpha B CRYSTALLIN, Alpha crystallin b chaincrystallin, alpha B Nucleus other CSF1R AI323359, C-FMS, CD115, CSF1 receptor, Csfmr, CSFR, FIM2colony stimulating factor 1 receptor Plasma Membrane kinase Csn1s1 AA959832, Alpha casein, AW212882, Casa, Csn1, Csna casein alpha s1 Extracellular Space other Csn1s2a Csn1s2b, Csng, Gamma casein casein alpha s2-like A Extracellular Space transporter CSN2 BOS 6716, CASB, Casein, CSNB, β-Casein casein beta Extracellular Space kinase CSNK1A1 2610208K14Rik, 4632404G05Rik, 5430427P18RIK, CASEINcasein kinase 1, alpha 1 Cytoplasm kinase CSNK1D 1200006A05Rik, AA409348, ASPS, Ck1 delta, CK1δ, CKIdeltacasein kinase 1, delta Cytoplasm kinase CSNK1E AI426939, AI551861, AW457082, CK1epsilon, CKI epsilon, CKIcasein kinase 1, epsilon Cytoplasm kinase CSNK2A1 Casein kinase II alpha 1 polypeptide, Ck II Alpha Subunit, CK1casein kinase 2, alpha 1 polypeptide Cytoplasm kinase CSNK2A2 1110035J23RIK, C77789, CASEIN KINASE 2, Casein kinasecasein I kinase 2, alpha prime polypeptide Cytoplasm kinase CST4 CYSTATIN S, CYSTATIN SA-III cystatin S Extracellular Space other CTBP1 50-kDaBFA-inducedADP-ribosylatedsubstrate, BARS, BARS-5C-terminal binding protein 1 Nucleus enzyme CTDSPL 2810418J22RIK, AI426263, C3orf8, CTDSP-like, HYA22, NIF-lCTD (carboxy-terminal domain, RNA polymerase II, polypeNucleus other CTGF AMPHIROGULIN, BOS 9793, CCN2, CTGF isoform 1, CTGRPconnective tissue growth factor Extracellular Space growth factor CTHRC1 1110014B07Rik, UNQ762/PRO1550 collagen triple helix repeat containing 1 Extracellular Space other Ctnna Alpha-catenin Cytoplasm group CTNNA1 2010010M04RIK, AA517462, AI988031, Alpha E-catenin, Alphcatenin (cadherin-associated protein), alpha 1, 102kDa Plasma Membrane other CTNNA2 AI481747, alpha N-CATENIN, CAP-R, Catna, CATNA2, cdf, chcatenin (cadherin-associated protein), alpha 2 Plasma Membrane other CTNNA3 4930429L08RIK, 4933408A16, Alpha T-catenin, Catna3, LOC1catenin (cadherin-associated protein), alpha 3 Plasma Membrane other CTNNAL1 ACRP, AI616177, alpha CATENIN LIKE, alpha CATULIN, alphcatenin (cadherin-associated protein), alpha-like 1 Plasma Membrane other CTNNB1 armadillo, Beta-cat, Beta-catenin, Bfc, CATENIN beta, CATNB,catenin (cadherin-associated protein), beta 1, 88kDa Nucleus transcription regulator CTNNBIP1 1110008O09Rik, 2310001I19Rik, AW457332, CATNBIP1, ICATcatenin, beta interacting protein 1 Cytoplasm other CTNND1 AA409437, AU019353, CAS, CATNS, CTNN δ, CTNN δ1, CTNcatenin (cadherin-associated protein), delta 1 Nucleus other CTNND2 CATND2, delta-CATENIN, GT24, neurojugin, NPRAP catenin (cadherin-associated protein), delta 2 Plasma Membrane other CTNNα-CTNNβ CTNNalpha-CTNNbeta Cytoplasm complex CTNNα-CTNNβ-CTNNδ CTNNalpha-CTNNbeta-CTNNdelta Cytoplasm complex CTNNβ-CDHE/N CTNNbeta-CDHE/N Plasma Membrane complex CTNNβ-LEF1 CTNNbeta-LEF1 Nucleus complex CTNNβ-TCF/LEF CTNNbeta-TCF/LEF Nucleus complex CTNNβ-TCF3-LEF1 Nucleus complex CTNNβ/γ CTNNbeta/gamma Cytoplasm group CTSF AI481912, Cathepsin F, CATSF, CLN13 cathepsin F Cytoplasm peptidase CTSZ AI787083, AU019819, Cathepsin X, Cathepsin Z, CATX, CTSX,cathepsin Z Cytoplasm peptidase CUL4A 2810470J21Rik, AW495282, CUL4, Cullin 4a, RGD1563853, cullinR 4A Nucleus other CUX1 AA407197, CASP, CDP, CDP/Cut, Cdp/cux, CDP1, Clox, COY1cut-like homeobox 1 Nucleus transcription regulator CXADR 2610206D03RIK, AU016810, AW553441, CAR, CAR4/6, HCARcoxsackie virus and adenovirus receptor Plasma Membrane transmembrane receptor Cxcl12 Pbsf, Scyb12, Sdf1, Stromal cell derived factor 1, Tlsf, Tpar1 chemokine (C-X-C motif) ligand 12 Extracellular Space cytokine Cxcl15 Il8, lungkine, Scyb15, weche chemokine (C-X-C motif) ligand 15 Extracellular Space cytokine CXCL9 BB139920, CMK, crg-10, Humig, MIG, MuMIG, SCYB9 chemokine (C-X-C motif) ligand 9 Extracellular Space cytokine CXXC4 9330210J02RIK, C030003J12RIK, IDAX CXXC finger protein 4 Cytoplasm other CYB5A 0610009N12Rik, B5, BOS 22127, CYB5, Cytb5, MCB5 cytochrome b5 type A (microsomal) Cytoplasm enzyme CYB5R3 0610016L08Rik, 2500002N19Rik, B5R, C85115, DIA1, ENSMUcytochrome b5 reductase 3 Cytoplasm enzyme Cyclin A Nucleus group Cyclin E Nucleus group CYP11A1 CHOLESTEROL SIDE-CHAIN CLEAVAGE ENZYME, Cscc, Ccytochrome P450, family 11, subfamily A, polypeptide 1 Cytoplasm enzyme CYP19A1 Ar, ArKO, ARO, ARO1, Aromatase, BOS 10885, CPV1, CYAR,cytochrome P450, family 19, subfamily A, polypeptide 1 Cytoplasm enzyme CYP1A2 CP12, Cyp1a1, CYPD45, CYPIA2, P-450d, P-450isf-g, P3-450cytochrome P450, family 1, subfamily A, polypeptide 2 Cytoplasm enzyme CYP24A1 1,25-dihydroxyvitamin d3 24-hydroxylase, 24-Hydroxylase, 24cytochrome P450, family 24, subfamily A, polypeptide 1 Cytoplasm enzyme CYP2A13 AI893559, Coh, CPAD, Cyp15a1, Cyp15a2, Cyp2a3, Cyp2a4,cytochrome P450, family 2, subfamily A, polypeptide 13 Cytoplasm enzyme CYP2D6 9030605E09Rik, AI303445, CPD6, CYP2D, Cyp2d1, Cyp2d10cytochrome P450, family 2, subfamily D, polypeptide 6 Cytoplasm enzyme CYP2E1 CPE1, CYP2E, CYPIIE1, P450 2e1, P450-J, P450C2E cytochrome P450, family 2, subfamily E, polypeptide 1 Cytoplasm enzyme CYP4F12 1300014O15Rik, Cyp4f1, Cyp4f14, Cyp4f2, F22329 1, UNQ56cytochrome P450, family 4, subfamily F, polypeptide 12 Cytoplasm enzyme CYP51A1 AI426508, Arr, CP51, CYP51, Cyp51a, Cyp51b, CYPL1, CYPLcytochrome P450, family 51, subfamily A, polypeptide 1 Cytoplasm enzyme CYP7B1 AW261589, CBAS3, Cholesterol 7 beta-hydroxylase, CP7B, Dcytochrome P450, family 7, subfamily B, polypeptide 1 Cytoplasm enzyme CYP8B1 CP8B, CYP12, CYP8B, CYPVIIIB1 cytochrome P450, family 8, subfamily B, polypeptide 1 Cytoplasm enzyme CYR61 AI325051, CCN1, Cysteine-rich protein 61, GIG1, IGFBP10 cysteine-rich, angiogenic inducer, 61 Extracellular Space other DACT1 4921528D17Rik, AI115603, DAPPER, DAPPER1, DPR1, Frd1dishevelled-binding antagonist of beta-catenin 1 Cytoplasm other DACT2 2900084M21Rik, A630024E20, bA503C24.7, C6orf116, Dappedishevelled-binding antagonist of beta-catenin 2 Cytoplasm other DACT3 DAPPER3, EG666671, MGC15476, naa-3, RGD1563892, RRdishevelled-binding antagonist of beta-catenin 3 Other other DAZAP2 AI314727, Brbp, GCAP28, gt6-12, mKIAA0058, PRTB DAZ associated protein 2 Nucleus other DBH DBM, DOPAMINE beta-HYDROXYLASE, dopamine beta-mondopamine beta-hydroxylase (dopamine beta-monooxygenaCytoplasm enzyme DCT DT, RGD1564975, slaty, slt, TRP-2, TYRP2 dopachrome tautomerase Cytoplasm enzyme DCX DBCN, Dbct, DC, Lissencephalin-X, LISX, rCG 23159, RP23-4doublecortin Cytoplasm other DDB1 AA408517, DDBA, DNA-damage-binding protein 1, p127-Ddb1damage-specific DNA binding protein 1, 127kDa Nucleus other DDX1 AA409185, DBP-RB, DEAD-box protein 1, UKVH5d DEAD (Asp-Glu-Ala-Asp) box helicase 1 Nucleus enzyme DDX17 2610007K22RIK, A430025E01Rik, AA521056, AI047725, C80DEAD (Asp-Glu-Ala-Asp) box helicase 17 Nucleus enzyme DDX5 2600009A06RIK, Dead box polypeptide 5, DEAD-box proteinDEAD p (Asp-Glu-Ala-Asp) box helicase 5 Nucleus enzyme DDX50 4933429B04Rik, 8430408E17RIK, GU2, GUB, mcdrh, RH-II, DEADR (Asp-Glu-Ala-Asp) box polypeptide 50 Nucleus enzyme DEFA5 DEF5, Defa29, Defcr29, Defcr5, DEFENSIN 5, HD-5 defensin, alpha 5, Paneth cell-specific Extracellular Space other DHX9 AI326842, Atp dependent DNA helicase ii, DDX9, HEL-5, leukoDEAH (Asp-Glu-Ala-His) box helicase 9 Nucleus enzyme DIAPH3 4930417P13Rik, AN, AUNA1, DIA2, Diap3, DRF3, mDia2, mKIdiaphanous-related formin 3 Cytoplasm enzyme DIO1 5'-deiodinase, 5'-MD, 5DI, D1, Deiodinase, iodothyronine, typedeiodinase, iodothyronine, type I Cytoplasm enzyme DIO2 5DII, AI324267, D2, DIOII, Iodothyronine 5'-deiodinase Type 2deiodinase, iodothyronine, type II Cytoplasm enzyme DIXDC1 4930563F16RIK, BC048182, CCD1, Ccd1Aalpha1L, Ccd1AbeDIX domain containing 1 Cytoplasm other DKK1 mdkk-1, SK, UNQ492/PRO1008 dickkopf WNT signaling pathway inhibitor 1 Extracellular Space growth factor DLG1 B130052P05Rik, Discs large 1 tumor suppressor, dJ1061C18.discs, large homolog 1 (Drosophila) Plasma Membrane kinase DLG5 4933429D20Rik, KIAA0583, LP-DLG, mKIAA0583, P-DLG5, discs,PD large homolog 5 (Drosophila) Plasma Membrane other DLGAP1 4933422O14RIK, 9630002F18, AI845682, AI848168, BB07578discs, large (Drosophila) homolog-associated protein 1 Plasma Membrane other DLL1 Delta, DELTA1, DL-1, UNQ146/PRO172 delta-like 1 (Drosophila) Plasma Membrane enzyme DLL4 Delta4, hdelta2, RP23-46P4.8, UNQ1895/PRO4341 delta-like 4 (Drosophila) Extracellular Space other DNAJC8 1110021D09Rik, 2010009J04RIK, AL024084, AU019262, AU0DnaJ (Hsp40) homolog, subfamily C, member 8 Nucleus other DOK1 AW557123, P62DOK docking protein 1, 62kDa (downstream of tyrosine kinase Plasma1 Membrane kinase DPEP1 AI327012, DEHYDROPEPTIDASE1, Dipeptidase 1, MBD, MBDdipeptidase 1 (renal) Cytoplasm peptidase DSC3 5430426I24RIK, BOS 22178, CDHF3, Desmocollin 4, DSC, Ddesmocollin 3 Plasma Membrane other DSP 2300002E22Rik, 5730453H04RIK, AA407887, AA407888, AWdesmoplakin Plasma Membrane other DVL1 DISHEVELED, DSH, DVL, DVL1L1, DVL1P1, mKIAA4029, RP2dishevelled segment polarity protein 1 Cytoplasm other DVL2 LOC100361515, RP23-172M21.1 dishevelled segment polarity protein 2 Cytoplasm other DVL3 dishevelled segment polarity protein 3 Cytoplasm other E2F4 2010111M04Rik, AI427446, rCG 51568 E2F transcription factor 4, p107/p130-binding Nucleus transcription regulator ECM1 AI663821, p85, RP11-54A4.6, URBWD extracellular matrix protein 1 Extracellular Space transporter EDIL3 DEL1 EGF-like repeats and discoidin I-like domains 3 Extracellular Space other EDN1 ET-1, HDLCQ7, PPET1, preproET endothelin 1 Extracellular Space cytokine EDN3 114-CH19, ET-3, HSCR4, ls, PPET3, preproET-3, RGD156482endothelin 3 Extracellular Space other EGR1 A530045N19Rik, AT225, Early Growth Response 1, egr, ETR1early growth response 1 Nucleus transcription regulator EHD1 AA409636, CDABP0131, H-PAST, HPAST1, Mpast1, PAST, PASTEH-domain containing 1 Cytoplasm other EIF5A AA410058, D19Wsu54e, eIF-4D, eIF-5A-1, eIF5AI, Initiation feukaryotica translation initiation factor 5A Cytoplasm translation regulator ELOVL3 CIG-30, CIN-2, Elovl3 (predicted) ELOVL fatty acid elongase 3 Cytoplasm enzyme EMD AW550900, EDMD, EMERIN, LEMD5, RP23-436K3.2, STA, XX-Femerin Nucleus other EMX2 Emx2 (predicted), Pdo, RGD1564797 empty spiracles homeobox 2 Nucleus transcription regulator ENO2 AI837106, D6Ertd375e, NEURONAL-SPECIFIC ENOLASE, Nenolase 2 (gamma, neuronal) Cytoplasm enzyme ENO3 BBE, Beta enolase, DN-183N8.17-002, ENOLASE 3, GSD13,enolase 3 (beta, muscle) Cytoplasm enzyme ENPP1 4833416E15RIK, AI428932, ARHR2, C76301, CD203c, Ly-41,ectonucleotide pyrophosphatase/phosphodiesterase 1 Plasma Membrane enzyme EOMES C77258, EOMESODERMIN, TBR-2 eomesodermin Nucleus transcription regulator EP400 1700020J09Rik, AU023439, CAGH32, mDomino, mKIAA1498E1A binding protein p400 Nucleus other EPAS1 bHLHe73, ECYT4, HIF-2alpha, Hif1alpha related factor, Hif2,endothelial H PAS domain protein 1 Nucleus transcription regulator EPCAM CD326, Coenzyme Q6, DIAR5, EGP, EGP-2, EGP314, EGP40epithelial cell adhesion molecule Plasma Membrane other EPHB2 CAPB, Cek5, DRT, EK5, EPHT3, EPTH3, ERK, ETECK, Hek5EPH receptor B2 Plasma Membrane kinase EPHB3 AW456895, Cek10, Efnb3r, ETK2, HEK2, MDK5, Sek4, TYROEPH receptor B3 Plasma Membrane kinase EPHB4 AI042935, Ephrin b4, HTK, MDK2, MYK1, TYRO11 EPH receptor B4 Plasma Membrane kinase ERBB2 C-erb-b2, c-neu, CD340, EGFR2, ERBB2 receptor, HER-2, HERv-erb-b2 avian erythroblastic leukemia viral oncogene homoPlasma Membrane kinase ERBB2IP 1700028E05Rik, ERBIN, LAP2, mKIAA1225 erbb2 interacting protein Plasma Membrane other ERBB3 C-erb-b3, C76256, EGFR3, erbB3-S, Erbb3r, HER-3 (ERBB3),v-erb-b2 avian erythroblastic leukemia viral oncogene homoPlasma Membrane kinase ERMN A330104H05Rik, AI854460, ermin, JN, juxtanodin, KIAA1189,ermin, ERM-like protein Extracellular Space other ESR2 beta ESTROGEN receptor, ER-BETA, Erb, ERB2, ER[b], ERβestrogen receptor 2 (ER beta) Nucleus ligand-dependent nuclear receptor ETV4 AW414408, E1A-F, PEA3, PEAS3, RP23-434F13.1 ets variant 4 Nucleus transcription regulator ETV5 1110005E01Rik, 8430401F14Rik, ERM, Ets variant gene 5 ets variant 5 Nucleus transcription regulator EVX1 RGD1565788 even-skipped homeobox 1 Nucleus transcription regulator EWSR1 AC002059.7, AU018891, bK984G1.4, Ewing sarcoma homoloEWS RNA-binding protein 1 Nucleus other EYA2 EAB1, RP23-138C10.1, RP5-890O15.2 eyes absent homolog 2 (Drosophila) Nucleus phosphatase EZH2 EHZ2, ENX-1, Enx1h, EZH1, EZH2b, KMT6, KMT6A, mKIAA4enhancer of zeste homolog 2 (Drosophila) Nucleus transcription regulator EZR AW146364, BOS 138, CVIL, CVL, Cytovillin2, EZRIN, p81, R7ezrin Plasma Membrane other F13A1 1200014I03Rik, AI462306, F13A, Factor xiiia, Fxiiia, RP11-23coagulation2 factor XIII, A1 polypeptide Extracellular Space enzyme F2R AI482343, CF2R, HTR, PAR-1, ThrR, TR, TRGPC coagulation factor II (thrombin) receptor Plasma Membrane G-protein coupled receptor FABP4 422/aP2, A-fab, A-FABP, Adipocyte fatty acid binding, ALBP, ALfatty acid binding protein 4, adipocyte Cytoplasm transporter FAF1 AA408698, CGI-03, Dffrx, FAF, Fam, hFAF1, HFAF1s, RP23-1Fas (TNFRSF6) associated factor 1 Nucleus other FAM126A AB030242, DRCTNNB1A, HCC, HLD5, HYCC1, RGD1562906family with sequence similarity 126, member A Cytoplasm other FANCC FA3, FAC, FACC, RP11-80I15.2 Fanconi anemia, complementation group C Nucleus other FANCL 2010322C19Rik, AW554273, B230118H11Rik, FAAP43, FLJ10Fanconi anemia, complementation group L Nucleus enzyme FAS AI196731, ALPS1A, APO-1, APT1, CD95, CD95 receptor, CD9Fas cell surface death receptor Plasma Membrane transmembrane receptor Fascin Cytoplasm group FAT1 2310038E12Rik, AU023433, CDHF7, CDHR8, FAT, Fath, hFatFAT atypical cadherin 1 Plasma Membrane other FBLN2 5730577E14RIK fibulin 2 Extracellular Space other FBRS FBS, FBS1, Fibrosin fibrosin Extracellular Space cytokine FBXW11 2310065A07Rik, AA536858, beta-TRCP2, BTRC2, BTRCP2,F-box F and WD repeat domain containing 11 Cytoplasm enzyme FCER1G AI573376, CD23, CD8 gamma, Fc epsilon R gamma, Fc epsiloFc fragment of IgE, high affinity I, receptor for; gamma polypPlasma Membrane transmembrane receptor FEN1 AW538437, MF1, RAD2 flap structure-specific endonuclease 1 Nucleus enzyme FER AV082135, C330004K01Rik, FerT, Fert2, Flk, Flk retired, PPP1fer (fps/fes related) tyrosine kinase Cytoplasm kinase FERMT2 AA960555, KIND2, KINDLIN 2, MIG2, PLEKHC1, RP23-359Ofermitin family member 2 Cytoplasm other FGD2 RP3-405J24.2, TCD2, tcs-2, ZFYVE4 FYVE, RhoGEF and PH domain containing 2 Cytoplasm other FGF18 D130055P09RIK, RP23-413O19.3, UNQ420/PRO856, ZFGF5fibroblast growth factor 18 Extracellular Space growth factor FGF8 AIGF, HBGF-8, HH6, KAL6 fibroblast growth factor 8 (androgen-induced) Extracellular Space growth factor FGF9 Eks, GAF, glia-activating factor, HBFG-9, HBGF-9, SYNS3 fibroblast growth factor 9 Extracellular Space growth factor FGFBP1 Fbp, FGF-BP, HBP17 fibroblast growth factor binding protein 1 Extracellular Space other FGFR1 AW208770, bFGF-R-1, BFGFR, BOS 23880, CD331, CEK, Eafibroblast growth factor receptor 1 Plasma Membrane kinase FHIT AP3Aase, AW045638, Fra14A2, FRA3B fragile histidine triad Cytoplasm enzyme FHL1 FHL, FHL1A, FHL1B, FLH1A, KYOT, LHL FOUR and A half LIMfour and a half LIM domains 1 Cytoplasm other FHL2 AAG11, C76204, DRAL, Skeletal muscle lim protein 3, SLIM-3four and a half LIM domains 2 Nucleus transcription regulator FLOT2 AI573412, CAVATELLIN, ECS-1, EPIDERMAL SURFACE AGflotillin 2 Plasma Membrane other FLT1 AI323757, FLT, sFlt1, VEGFR-1 fms-related tyrosine kinase 1 Plasma Membrane kinase FOSL1 AW538199, FRA, FRA1 FOS-like antigen 1 Nucleus transcription regulator FOXA2 HNF3-beta, HNF3B, HNF3β, RP23-207P16.2, TCF3B forkhead box A2 Nucleus transcription regulator FOXB1 C43, FKH5, Foxb1a, Foxb1b, Hfh-e5.1, HFKH-5, Mf3, Twh forkhead box B1 Nucleus transcription regulator FOXC1 ARA, ch, Fkh1, FKHL7, FLJ11796, FLJ11796 FIS, FREAC-3,forkhead f box C1 Nucleus transcription regulator FOXC2 Fkh14, FKHL14, Hfhbf3, LD, MFH-1 forkhead box C2 (MFH-1, mesenchyme forkhead 1) Nucleus transcription regulator FOXF2 Fkh20, FKHL6, FREAC-2, LUN, RP23-467M8.1 forkhead box F2 Nucleus transcription regulator FOXM1 AA408308, AW554517, BB238854, D1Mgi56, Fkh16, FKHL16forkhead box M1 Nucleus transcription regulator Foxo Cytoplasm group FOXO1 Afxh, AI876417, FKH1, FKHR, FKHR1, Forkhead, FOXO1A forkhead box O1 Nucleus transcription regulator FOXO3 1110048B16RIK, 2010203A17RIK, AF6q21, C76856, Fkhr2, Fforkhead box O3 Nucleus transcription regulator FOXO4 AFX, AFX1, Afxh, MLLT7, RGD1561201, RP23-356J7.2 forkhead box O4 Nucleus transcription regulator FOXQ1 HFH-1, Hfh1l, RP23-322J11.1, sa forkhead box Q1 Nucleus transcription regulator FRAT1 AW060382, GBP, RP11-452K12.1 frequently rearranged in advanced T-cell lymphomas Cytoplasm other FSHB BOS 15014, FSH, FSH beta, RP23-300H23.2 follicle stimulating hormone, beta polypeptide Extracellular Space other FSTL3 E030038F23Rik, FLRG, FSRP, UNQ674/PRO1308 follistatin-like 3 (secreted glycoprotein) Extracellular Space other FUS ALS6, D430004D17Rik, D930039C12Rik, ETM4, FUS1, Fusiofused in sarcoma Nucleus transcription regulator FYN AI448320, AW552119, C-FYN, FYNT, p59 Fyn B, p59-FYN, RP1FYN oncogene related to SRC, FGR, YES Plasma Membrane kinase FZD3 AU020229, D930050A07RIK, Fz-3 frizzled family receptor 3 Plasma Membrane G-protein coupled receptor FZD7 Fz7, FzE3, LOC100360552 frizzled family receptor 7 Plasma Membrane G-protein coupled receptor GAD1 CPSQ1, EP10, GAD, GAD25, GAD44, GAD67, Glutamic acidglutamate decarboxylase 1 (brain, 67kDa) Cytoplasm enzyme GADD45A AA545191, DDIT1, Gadd, GADD45, RP5-975D15.1 growth arrest and DNA-damage-inducible, alpha Nucleus other GADD45B AI323528, GADD45beta, MYD118, Myeloid differentiation primagrowth arrest and DNA-damage-inducible, beta Cytoplasm other GADD45G AI327420, C86281, CR6, DDIT2, GADD45gamma, Growth Arregrowth arrest and DNA-damage-inducible, gamma Nucleus other GAST GAS, GASTRIN, Gastrin-17, PPG34, RP23-392I3.8 gastrin Extracellular Space other GATA2 DCML, MGC2306, MONOMAC, NFE1B GATA binding protein 2 Nucleus transcription regulator GATA3 HDR, HDRS, jal, RP23-276D17.1 GATA binding protein 3 Nucleus transcription regulator GBAS AV006093, LOC498174, NIPSNAP2 glioblastoma amplified sequence Plasma Membrane other GCG Glp2, Glu, GRPP, PPG, Preproglucagon, Proglucagon, RP23-3glucagon Extracellular Space other GDNF Activity-dependent neurotrophic factor, AI385739, ATF1, ATF2,glial cell derived neurotrophic factor Extracellular Space growth factor GEMIN5 AA407055, AA407208, AI451603, BB194447, C330013N08, Lgem (nuclear organelle) associated protein 5 Nucleus other GET4 1110007L15Rik, AW412535, C7orf20, CEE, CGI-20, LOC5160golgi to ER traffic protein 4 homolog (S. cerevisiae) Cytoplasm other GHR AA986417, BOS 19817, Ghbp, GHR/BP, GROWTH HORMONgrowth hormone receptor Plasma Membrane transmembrane receptor GIPC1 C19orf3, GIPC, GLUT1CBP, Glut1CIP, Hs.6454, IIP-1, NIP, RGIPCg PDZ domain containing family, member 1 Cytoplasm other GIT2 1500036H07Rik, 5830420E16Rik, 6430510B20RIK, 9630056M0G protein-coupled receptor kinase interacting ArfGAP 2 Nucleus other GJA1 AU042049, AVSD3, AW546267, CMDR, Cnx43, Connexin-43,gap junction protein, alpha 1, 43kDa Plasma Membrane transporter GJB1 AI118175, CMTX, CMTX1, Cnx32, CX32, RP23-440J15.5 gap junction protein, beta 1, 32kDa Plasma Membrane transporter GJB2 AI325222, Cnx26, CX26, CXN-26, DFNA3, DFNA3A, DFNB1,gap junction protein, beta 2, 26kDa Plasma Membrane transporter GLI1 AV235269, GLI, ZFP5 GLI family zinc finger 1 Nucleus transcription regulator GLI2 AW546128, HPE9, THP1, THP2 GLI family zinc finger 2 Nucleus transcription regulator GLIS2 Gli5, Klf16, NKL, NPHP7 GLIS family zinc finger 2 Nucleus transcription regulator GLTSCR2 5330430H08Rik, 9430097C02Rik, AU041936, AW536441, D1glioma tumor suppressor candidate region gene 2 Cytoplasm other GLUL BOS 16078, GLNS, Glutamine Synthase, Glutamine Synthetaglutamate-ammonia ligase Cytoplasm enzyme GNA12 AI414047, AI504261, alpha subunit of the G12 family of HETERguanine nucleotide binding protein (G protein) alpha 12 Plasma Membrane enzyme GNAO1 alphaO, AW050213, G protein alpha O subunit, G protein ao,guanine G nucleotide binding protein (G protein), alpha activaPlasma Membrane enzyme GNB2L1 Activated Protein Kinase C Receptor, AL033335, BOS 7938, guanineD nucleotide binding protein (G protein), beta polypeCytoplasm enzyme GNG10 AV006524, RP23-211P15.5 guanine nucleotide binding protein (G protein), gamma 10Plasma Membrane enzyme GPR137B AI788917, AU016435, AW546472, C730041E01, C80550, C80G protein-coupled receptor 137B Plasma Membrane other GPR64 AW212196, B830041D06Rik, CTD-2245E12.1, EDDM6, HE6,G protein-coupled receptor 64 Plasma Membrane G-protein coupled receptor GPX2 GI-GPx, GPRP, GPRP-2, GPX-GI, GSHPx-2, GSHPX-GI glutathione peroxidase 2 (gastrointestinal) Cytoplasm enzyme GREM1 CKTSF1B1, DAND2, DRM, Grem, GREMLIN, GREMLIN 1, IHgremlin 1, DAN family BMP antagonist Extracellular Space other GRIK1 A830007B11Rik, D16Ium24, D16Ium24e, EAA3, EEA3, GLR5glutamate receptor, ionotropic, kainate 1 Plasma Membrane ion channel GRIK2 AW124492, EAA4, GLR6, GluK2, GLUK6, Glur beta-2, GLUR6glutamate receptor, ionotropic, kainate 2 Plasma Membrane ion channel GRIK5 EAA2, GluK5, GluRgamma2, GRIK2, iGlu5, KA2, KA2r glutamate receptor, ionotropic, kainate 5 Plasma Membrane ion channel GRIN1 GluN1, GluRdelta1, GluRzeta1, M100174, MRD8, Nmda nr1,glutamate N receptor, ionotropic, N-methyl D-aspartate 1 Plasma Membrane ion channel GRIN2A AK080997, EPND, GluN2A, NMDAR2A, NR2, NR2A glutamate receptor, ionotropic, N-methyl D-aspartate 2A Plasma Membrane ion channel GRIN2B AW490526, GluN2B, GluR epsilon 2, hNR3, MRD6, NMDAR2glutamate receptor, ionotropic, N-methyl D-aspartate 2B Plasma Membrane ion channel GRIP1 4931400F03Rik, eb, GRIP glutamate receptor interacting protein 1 Plasma Membrane transcription regulator Gsk3 Glycogen synthase kinase, Gsk Cytoplasm group GSK3 beta-Axin-APC-CtnnAPC-CTNNbeta-AXIN-GSK3beta, APC-CTNNβ-AXIN-GSK3β, AXIN-APC-GSKβ-CTNNβ, GSK3β-AXIN-APC-CTNNβ Cytoplasm complex GSK3B 7330414F15Rik, 8430431H08Rik, C86142, GSK-3, GSK-3betglycogen synthase kinase 3 beta Nucleus kinase GSKIP 4933433P14Rik, C14orf129, HSPC210, RGD1308470 GSK3B interacting protein Other other GTPBP6 AV119224, LL0XNC01-136G2.2, LOC100132347, LOC100133GTP binding protein 6 (putative) Other other H1F0 D130017D06Rik, H1(0), H10, H1FV, Histone h1 H1 histone family, member 0 Nucleus other HAPLN1 BB099155, BOS 8453, CLP, CRTL1, Crtl1l, Link, LP, LP-1 hyaluronan and proteoglycan link protein 1 Extracellular Space other HDAC2 D10Wsu179e, HD2, mRPD3, RGD: 619976, RPD3, YAF1, Yy1histone deacetylase 2 Nucleus transcription regulator HDAC3 AW537363, HD3, RPD3, RPD3-2 histone deacetylase 3 Nucleus transcription regulator HDAC4 4932408F19, 4932408F19Rik, AHO3, AI047285, BDMR, HA61histone deacetylase 4 Nucleus transcription regulator HDAC5 AI426555, HD5, Hdac4, mHDA1, mKIAA0600, NY-CO-9, RP23histone deacetylase 5 Nucleus transcription regulator HDAC6 CPBHM, HD6, Hdac5, JM21, mHDA2, RP23-198C2.1, Sfc6 histone deacetylase 6 Nucleus transcription regulator HDAC7 5830434K02Rik, HD7, HD7A, HDAC-D, HDAC7A, mFLJ00062histone deacetylase 7 Nucleus transcription regulator HDGF AI118077, D3Ertd299e, HMG1L2, RP11-66D17.10-003, Transfhepatoma-derived growth factor Extracellular Space growth factor HERC5 1700121D12Rik, 2510038N07RIK, 4930427L17Rik, AI451296HECT and RLD domain containing E3 ubiquitin protein ligaCytoplasm enzyme HESX1 ANF, CPHD5, HES-1, RGD1563858, RPX HESX homeobox 1 Nucleus transcription regulator HHEX HEX, Hex1, HHEX-RS2, HMPH, HOX11L-PEN, PRH, PRHXhematopoietically expressed homeobox Nucleus transcription regulator HHIP Hhip1, HIP, HIP1, LOC100366089, RGD1564108, UNQ5825/hedgehogPR interacting protein Plasma Membrane other HIC1 AA408311, RP23-143A14.2, ZBTB29, ZNF901 hypermethylated in cancer 1 Nucleus transcription regulator HIF1A AA959795, bHLHe78, HIF-1α, HIF-1α (hydroxylated), HIF1, HIhypoxia inducible factor 1, alpha subunit (basic helix-loop-hNucleus transcription regulator HINT1 AA673479, HINT, Histidine triad nucleotide-binding, Histidine histidinet triad nucleotide binding protein 1 Nucleus enzyme HIPK2 1110014O20RIK, B230339E18RIK, LOC100505582, LOC6530homeodomain interacting protein kinase 2 Nucleus kinase HIST1H1C 0610008C09Rik, H1.2, H1C, H1F2, H1s-1, H1var1, His1a, Histhistone cluster 1, H1c Nucleus other Histone h3 H3, H3.3, Histone H3B Nucleus group HMG20B AW610687, BRAF25, BRAF35, HMGX2, HMGXB2, PP7706, highp mobility group 20B Nucleus transcription regulator HMGB2 C80539, High mobility group 2, HMG-2, RGD1564519 high mobility group box 2 Nucleus transcription regulator HNF1A AI323641, HNF1, HNF1-alpha, HNF1α, HNF1α (MODY3), IDDHNF1 homeobox A Nucleus transcription regulator HNRNPA0 1110055B05RIK, 3010025E17Rik, hnRNP AQ, HNRPA0, HNRheterogeneous nuclear ribonucleoprotein A0 Nucleus other HNRNPA1 D15Ertd119e, HDP, HETEROGENOUS NUCLEAR RIBONUCheterogeneous nuclear ribonucleoprotein A1 Nucleus other HNRNPA2B1 9130414A06Rik, hnRNP, hnrnp-A, HNRNPA2, HNRNPB1, HNheterogeneous nuclear ribonucleoprotein A2/B1 Nucleus other HNRNPK CSBP, HNRPK, KBBP, NOVA, RP11-575L7.1, TUNP heterogeneous nuclear ribonucleoprotein K Nucleus other HNRNPM 2610023M21Rik, AA409009, CEAR, Heterogeneous nuclear heterogeneousri nuclear ribonucleoprotein M Nucleus other HNRNPU AA408410, AI256620, AL024194, AL024437, AW557595, C86heterogeneous nuclear ribonucleoprotein U (scaffold attachNucleus transporter HNRNPUL1 E130317O14Rik, E1B-55kDa-associated, E1B-55KDA-ASSOCheterogeneous nuclear ribonucleoprotein U-like 1 Nucleus other HOXA5 HOX1, HOX1.3, HOX1C homeobox A5 Nucleus transcription regulator HOXB4 B4, HOX-2.6, HOX2, HOX2F, RGD1560113, RP23-9G13.1 homeobox B4 Nucleus transcription regulator HOXB7 AI325018, HHO.C1, HOMEOBOX C1, Hox-2.3, HOX2, HOX2Chomeobox B7 Nucleus transcription regulator HSD17B2 17beta-HSD Type 2, 17Hsd, AI194836, AI194967, AI255511, hydroxysteroidED (17-beta) dehydrogenase 2 Cytoplasm enzyme Hsd3b4 (includes others)3 beta Hsd, 3 Beta hydroxysteroid dehydrogenase, Gm4450,hydroxy-delta-5-steroid H dehydrogenase, 3 beta- and steroiCytoplasm enzyme Hsp70 Hsp/Hsc70, Hsp70gene Cytoplasm group HSPA1A/HSPA1B DAAP-21F2.7, DAQB-147D11.1, HEAT SHOCK 70-KDA, heatheat shock 70kDa protein 1A Cytoplasm other HSPA8 2410008N15Rik, BOS 14437, DnaK-type chaperone hsp72/unheat shock 70kDa protein 8 Cytoplasm enzyme HSPB8 AU018630, AW413033, CMT2L, CRYAC, D5Ucla4, DHMN2, heatE2 shock 22kDa protein 8 Cytoplasm kinase HSPD1 CPN60, GROEL, HLD4, HSP60, HSP65, Hspd1-30p, HuCHA6heat shock 60kDa protein 1 (chaperonin) Cytoplasm enzyme HSPE1 CHAPERONIN 10, CPN10, EARLY PREGNANCY FACTOR, heatEPF shock 10kDa protein 1 (chaperonin 10) Cytoplasm enzyme HTRA1 AI429470, ARMD7, CARASIL, HTRA, IGFBP5-protease, L56,HtrA serine peptidase 1 Extracellular Space peptidase ID2 Ac2-300, AI255428, bHLHb26, C78922, GIG8, ID2H, IDB2, ininhibitorh of DNA binding 2, dominant negative helix-loop-heNucleus transcription regulator ID3 bHLHb25, HEIR-1, Helix-loop-helix protein (Id related), HLH 1inhibitorR of DNA binding 3, dominant negative helix-loop-heNucleus transcription regulator ID4 bHLHb27, IDB4 inhibitor of DNA binding 4, dominant negative helix-loop-heNucleus transcription regulator IDO1 IDO, IFN gamma INDUCIBLE INDOLEAMINE 2-3 DIOXYGENindoleamine 2,3-dioxygenase 1 Cytoplasm enzyme IFITM1 1110036C17Rik, 9-27, CD225, DSPA2a, HUM927A, IFI17, IFI2interferon induced transmembrane protein 1 Plasma Membrane transmembrane receptor IFN Beta IFNb, IFNβ, INF beta, Interferon beta Extracellular Space group IFNB1 IFB, IFF, Ifn beta1b, IFN-beta, IFN-β, IFN-β1, IFNB, IFNB1A, interferon,n beta 1, fibroblast Extracellular Space cytokine IFRD1 FRD1, Ifnl, PC4, TIS7 interferon-related developmental regulator 1 Nucleus other IGF1R A330103N21RIK, CD221, D930020L01, hyft, IGF1R beta chaiinsulin-like growth factor 1 receptor Plasma Membrane transmembrane receptor IGF2 AL033362, BOS 25070, C11orf43, IGF-II, IGF2 isoform 1, INSUinsulin-like growth factor 2 (somatomedin A) Extracellular Space growth factor IGF2BP1 AL024068, AW549074, CRD-BP, D030026A21Rik, D11Moh40insulin-like growth factor 2 mRNA binding protein 1 Cytoplasm translation regulator IGFBP2 AI255832, BOS 2084, IBP-2, IGF-BP53, ILGFBPA, mIGFBP-2insulin-like growth factor binding protein 2, 36kDa Extracellular Space other IGFBP5 AI256729, AW208790, IBP5, IGFBP-5P insulin-like growth factor binding protein 5 Extracellular Space other IGHM AGM1, AI326478, Ak007163, FLJ00385, IG gamma-1 chain cimmunoglobulin heavy constant mu Plasma Membrane transmembrane receptor IGJ 9530090F24Rik, AI323815, Ig joining chain, IGCJ, J CHAIN, immunoglobulinJC J polypeptide, linker protein for immunogloExtracellular Space other Igsf4 SynCAM immunoglobulin superfamily, member 4 Plasma Membrane other IHH BDA1, HHG2 indian hedgehog Extracellular Space enzyme Ikb I KAPPA B, Iκ-B Cytoplasm group IKBKB AI132552, AIM-1, I kappa b beta, Ikb Kinase Beta, IKK-2, IKK-binhibitor of kappa light polypeptide gene enhancer in B-celCytoplasm kinase IL10 AL513351.1, CSIF, GVHDS, IL10A, IL10X, RP11-262N9.1, TGinterleukin 10 Extracellular Space cytokine IL13 P600, RP23-239O19.1 interleukin 13 Extracellular Space cytokine IL1B IL-1, IL-1β, IL1-BETA, IL1F2, RP23-384K11.2 interleukin 1, beta Extracellular Space cytokine IL1R1 CD121A, CD121b, D2S1473, IL-1R-alpha, IL-iR, IL1R, IL1RA,interleukin 1 receptor, type I Plasma Membrane transmembrane receptor IL4 BCGF, BCGF-1, BSF-1, Il4e12, RP23-188H3.4 interleukin 4 Extracellular Space cytokine IL8 CXCL8, GCP-1, LECT, LUCT, LYNAP, MDNCF, MONAP, Monointerleukin 8 Extracellular Space cytokine ILF3 CBTF, DRBF, DRBP76, Interleukin binding factor 3, MBII-26, interleukinMMP4 enhancer binding factor 3, 90kDa Nucleus transcription regulator IMPDH2 ENSMUSG00000071041, Gm15210, hCG 2002013, Imp dehydIMP (inosine 5'-monophosphate) dehydrogenase 2 Cytoplasm enzyme INHA AW555078, INHIBIN A inhibin, alpha Extracellular Space growth factor INHBB activin AB beta polypeptide precursor, Activin B, activin beta B,inhibin, beta B Extracellular Space growth factor Ins1 Ins2-rs1, Insulin I, Preproinsulin, proinsulin insulin I Extracellular Space other INSL6 INSULIN-LIKE FACTOR 6, RIF1 insulin-like 6 Extracellular Space other INVS INV, NPH2, NPHP2, RGD1563359, RP11-208F1.1, RP24-558inversin Nucleus transcription regulator IQGAP1 AA682088, D7Ertd237e, D7Ertd257e, HUMORFA01, IQ MOTIIQ motif containing GTPase activating protein 1 Cytoplasm other IQGAP2 4933417J23RIK, A630053O10, AI788777 IQ motif containing GTPase activating protein 2 Cytoplasm other IRF3 C920001K05RIK, DRAFB, Ifn regulatory factor 3 interferon regulatory factor 3 Nucleus transcription regulator IRF4 AI385587, LSIRF, MUM1, NF-EM5, PIP, RP23-213G18.1, Spipinterferon regulatory factor 4 Nucleus transcription regulator IRF8 AI893568, H-ICSBP, HICSBP-1, ICSBP, ICSBP1, Myls interferon regulatory factor 8 Nucleus transcription regulator IRS1 ENSMUSG00000022591, G972R, HIRS-1, IRS1IRM insulin receptor substrate 1 Cytoplasm enzyme ISG15 G1P2, Gip2, hUCRP, HUMIFN15K, IFI-15K, IFI15, IFN-alpha-IISG15 ubiquitin-like modifier Extracellular Space other ISL1 ISLET1 ISL LIM homeobox 1 Nucleus transcription regulator ITGA1 alpha1 INTEGRIN, CD49A, E130012M19RIK, VLA1 integrin, alpha 1 Plasma Membrane other ITGA6 5033401O05Rik, AI115430, CD49f, Integrin α6, ITG alpha6, ITintegrin, alpha 6 Plasma Membrane transmembrane receptor ITGA9 (alpha)9, 2610002H11Rik, 6720458D17RIK, AI461869, ALPHA-Rintegrin, alpha 9 Plasma Membrane other ITGAL (p180), CD11A, INTEGRIN alpha-L, LFA-1, LFA-1A, Ly-15, Ly-2integrin, alpha L (antigen CD11A (p180), lymphocyte functiPlasma Membrane transmembrane receptor ITGB1 4633401G24RIK, AA409975, AA960159, BOS 12846, CD29,integrin, C beta 1 (fibronectin receptor, beta polypeptide, antiPlasma Membrane transmembrane receptor ITGB2 2E6, AI528527, beta2 INTEGRINS, CD18, Cr3 beta, Integrin integrin,b beta 2 (complement component 3 receptor 3 andPlasma Membrane transmembrane receptor ITGB7 CD103 beta, Ly69 integrin, beta 7 Plasma Membrane transmembrane receptor JRK Jerky, JH8 jerky homolog (mouse) Nucleus other JUP ARVD12, CTNNG, D930025P04Rik, DP3, DPIII, gamma-CATENjunction plakoglobin Plasma Membrane other KANK1 A930031B09RIK, ANKRD15, ANKYRIN REPEAT domain proteKN motif and ankyrin repeat domains 1 Nucleus transcription regulator KAT2A 1110051E14Rik, AW212720, GCN5, GCN5L2, hGCN5, mmGCK(lysine) acetyltransferase 2A Cytoplasm enzyme KAT2B A930006P13RIK, AI461839, AW536563, CAF, P/CAF, PCAF, K(lysine)Pca acetyltransferase 2B Nucleus transcription regulator KCNIP4 AV032399, CALP, Calp250, KCHIP4, KChIP4a Kv channel interacting protein 4 Plasma Membrane ion channel KDR 6130401C07, BOS 6667, CD309, Flk, FLK1, Kinase Insert Dokinase insert domain receptor (a type III receptor tyrosinePlasma ki Membrane kinase KIAA1109 4732443H21, 4932438A13Rik, B830039D19Rik, CT7-315N12KIAA1109 Other other KIF23 3110001D19Rik, C87313, CHO1, Kinesin-like 5, KNSL5, MKLP-1kinesin family member 23 Cytoplasm other KIF3B AI854312, AW549267, FLA8, HH0048, Kif3b predicted, KLP-1kinesin family member 3B Cytoplasm transporter KIFAP3 dJ190I16.1, FLA3, KAP-1, KAP-3, Kap3a, Kifap3 predicted, RP1kinesin-associated protein 3 Cytoplasm other KIFC1 DAQB-126H3.5, Gm4137, HSET, KIFC5A, Kifc5b, KINESIN-Rkinesin family member C1 Nucleus enzyme KLF4 EZF, GKLF, RP11-150J11.1, RP23-322L22.2, Zie Kruppel-like factor 4 (gut) Nucleus transcription regulator KLF5 4930520J07Rik, BTEB2, CKLF, IKLF, Kruppel-like factor 5, RP1Kruppel-like factor 5 (intestinal) Nucleus transcription regulator KLK2 hGK-1, hK2, KLK2A2 kallikrein-related peptidase 2 Extracellular Space peptidase KLK3 0610007D04Rik, APS, Egfbp-1, Egfbp-3, Egfbp2, Epidermal Gkallikrein-related peptidase 3 Extracellular Space peptidase KLRC3 Klrc2, NKG2-E, RP23-145F22.4 killer cell lectin-like receptor subfamily C, member 3 Plasma Membrane transmembrane receptor KMT2A 6430520K01, ALL-1, CXXC7, FLJ11783, hCG 1732268, HRX,lysine (K)-specific methyltransferase 2A Nucleus transcription regulator KMT2D AAD10, ALR, BC032281, BC058659, C430014K11Rik, CAGL1lysine (K)-specific methyltransferase 2D Nucleus transcription regulator KRAS AI929937, C-K-RAS, c-Ki-ras, c-Ki-ras p21, CFC2, K-RAS B,Kirsten K-R rat sarcoma viral oncogene homolog Cytoplasm enzyme KRT1 CK1, EHK, EHK1, EPPK, K1, Kb1, Keratin 1, Keratin 2-1, Kerakeratin 1 Cytoplasm other KRT5 3300001P10Rik, AW146334, CK5, Cytokeratin5, DDD, DDD1,keratin 5 Cytoplasm other KRT7 CK7, Cytokeratin 7, D15Wsu77e, K2C7, K7, Keratin complexkeratin 2 7 Cytoplasm other L1CAM CAML1, CD171, HSAS, HSAS1, Hyd, L1, L1 isoform, MASA,L1 MI cell adhesion molecule Plasma Membrane other L3MBTL3 AI481284, MBT-1, RP11-73O6.1 l(3)mbt-like 3 (Drosophila) Nucleus other LAMB1 C77966, C80098, C81607, CLM, D130003D08Rik, LAMB1-1,laminin, beta 1 Extracellular Space other LAMC2 AA589349, B2T, BM600, CSF, CSF 140 kDa subunit, EBR2, laminin,EBR gamma 2 Extracellular Space other LAP3 2410015L10Rik, AA410100, LAP, LAPEP, Leucine aminopeptileucine aminopeptidase 3 Cytoplasm peptidase LBH 1810009F10Rik, 6720416L16Rik, Cl2, LOC100048380, MSTP0limb bud and heart development Nucleus transcription regulator LCK Hck-3, Lck1, Lcktkr, LSK, Lskt, p56Lck, pp58lck, RP23-209C6lymphocyte-specific protein tyrosine kinase Cytoplasm kinase LDHB -lactate dehydrogenase h-chain, AI790582, H-Ldh, L-lactate delactate dehydrogenase B Cytoplasm enzyme LECT2 chm-II, chm2 leukocyte cell-derived chemotaxin 2 Extracellular Space other LEF1 3000002B05, AI451430, TCF/LEF, TCF10, TCF1ALPHA, TCF7lymphoid enhancer-binding factor 1 Nucleus transcription regulator LEO1 Gm185, RDL Leo1, Paf1/RNA polymerase II complex component, homoNucleus other LGALS3 Ager3, CBP35, GAL3, GALBP, GALECTIN-3, GALIG, GALIGlectin, O galactoside-binding, soluble, 3 Extracellular Space other LGALS9 AA407335, AI194909, AI265545, gal-9, galectin, galectin-9, HOlectin, galactoside-binding, soluble, 9 Extracellular Space other LGR5 FEX, GPR49, GPR67, GRP49, HG38, LOC687868 leucine-rich repeat containing G protein-coupled receptorPlasma 5 Membrane G-protein coupled receptor LHB CGB4, Gm683, hLHB, LH, LH beta, LOC100040019, LOC100luteinizing hormone beta polypeptide Extracellular Space other LHCGR BOS 11458, Gpcr19-rs1, HHG, LCGR, LGR2, LH receptor, LHluteinizing hormone/choriogonadotropin receptor Plasma Membrane G-protein coupled receptor LHX1 LIM-1, RP23-381C21.1 LIM homeobox 1 Nucleus transcription regulator LHX2 ap, apterous, hLhx2, LH2, LH2A, Lim2, RP23-399K8.3 LIM homeobox 2 Nucleus transcription regulator LIMA1 1110021C24Rik, 3526402A12Rik, D15Ertd366e, EPLIN, PP62LIM domain and actin binding 1 Cytoplasm other LIMD2 0610025L06RIK, AI413966, RGD1309967, RP23-81G14.8, SB1LIM domain containing 2 Other other LIPA AA960673, Aceh, CEH, CESD, Chole, Chole2, Cholesteryl estlipase A, lysosomal acid, cholesterol esterase Cytoplasm enzyme LMNA CDCD1, CDDC, CMD1A, CMT2B1, Dhe, EMD2, FPL, FPLD,lamin F A/C Nucleus other LMO2 Lmos2, LOC100048263, RBTN2, RBTNL1, RHOM2, RP23-26LIM domain only 2 (rhombotin-like 1) Nucleus other LMO7 C130003G01, C78582, E030010D13, FBX20, FBXO20, Gm91LIM domain 7 Cytoplasm enzyme LMX1B LMX1.1, LMX1.2, NPS1, RP23-65G6.3 LIM homeobox transcription factor 1, beta Nucleus transcription regulator LOC100362738/RGD1561LOC100362738, RGD1561179, RGD1561681 similar to pyruvate kinase (EC 2.7.1.40) isozyme M2 - ratCytoplasm other LPL HDLCQ11, Lipase, LIPD, Lipoprotein lipase 1 lipoprotein lipase Cytoplasm enzyme LRP2 AI315343, AW536255, D230004K18Rik, DBS, GP330, HEYMANlow density lipoprotein receptor-related protein 2 Plasma Membrane transporter LRP6 ADCAD2, C030016K15RIK, CD, Gw, LOC100502826, Low-delow density lipoprotein receptor-related protein 6 Plasma Membrane transmembrane receptor LRRFIP1 AU024550, FLAP-1, FLIIAP1, GCF-2, HUFI-1, TRIP leucine rich repeat (in FLII) interacting protein 1 Cytoplasm other LRRK2 4921513O20RIK, 9330188B09Rik, AURA17, AW561911, cI-46leucine-rich repeat kinase 2 Cytoplasm kinase LY6E Ly67, OIP-1, RIG-E, SCA-2, Thymic Shared Antigen 1, TSA-1lymphocyte antigen 6 complex, locus E Plasma Membrane other MACF1 ABP620, ACF7, Aclp7, Actin cross-linking family protein 7, ACTmicrotubule-actin crosslinking factor 1 Cytoplasm enzyme Macf1 ABP620, Acf7, Aclp7, KIAA1251, MACF, Microtubule-actin cromicrotubule-actin crosslinking factor 1 Cytoplasm enzyme MAGI1 AIP-3, BAIAP1, BAP-1, Gukmi1, Hs.476636, mKIAA4129, TNRmembrane associated guanylate kinase, WW and PDZ doPlasma Membrane kinase MAGI2 Acvri1, ACVRINP1, ACVRIP1, AIP-1, ARIP1, mKIAA0705, S-SCmembrane associated guanylate kinase, WW and PDZ doPlasma Membrane kinase MAML1 AI644666, AW743257, D930008C07RIK, Mam-1, mKIAA0200mastermind-like 1 (Drosophila) Nucleus transcription regulator MAN2B1 Acidic Mannosidase, AW107687, LAMAN, LYSMAN, MANB, mannosidase,MG alpha, class 2B, member 1 Cytoplasm enzyme MAP1LC3B 1010001C15Rik, Atg8, ATG8F, Jhl1, Lc3, lc3-II, LC3B, MAP1A/microtubule-associated protein 1 light chain 3 beta Cytoplasm other MAP2K5 AI324775, AI428457, HsT17454, MAP kinase kinase 5, MAPKK5mitogen-activated protein kinase kinase 5 Cytoplasm kinase MAP3K1 MAPK, MAPKKK1, MEK KINASE, MEK KINASE 1, MEKK, MEKKmitogen-activated protein kinase kinase kinase 1, E3 ubiquCytoplasm kinase MAP3K11 2610017K16RIK, MEKK11, MLK-3, PTK1, RHOE, SPRK mitogen-activated protein kinase kinase kinase 11 Cytoplasm kinase MAP4 AA407148, Microtubule Associated Protein 3, Mtap-4 microtubule-associated protein 4 Cytoplasm other MAPK8 AI849689, C-JUN N-TERMINAL KINASE1, JNK, JNK-46, JNK1mitogen-activated protein kinase 8 Cytoplasm kinase MAPK9 AI851083, Jnk p54, Jnk p55, JNK-55, JNK2, JNK2A, JNK2ALPHmitogen-activated protein kinase 9 Cytoplasm kinase MAPRE1 5530600P05RIK, AI462499, AI504412, AW260097, BIM1p, D2microtubule-associated protein, RP/EB family, member 1 Cytoplasm other MBD3 AI181826, AU019209 methyl-CpG binding domain protein 3 Nucleus other MCL1 AW556805, BCL2L3, EAT, MCL1-ES, mcl1/EAT, MCL1L, TM myeloid cell leukemia sequence 1 (BCL2-related) Cytoplasm transporter MDFI I-MF, I-mfa, RGD1560271, RP4-696P19.1 MyoD family inhibitor Cytoplasm other ME1 BRCAME, D9Ertd267e, HUMNDME, Malate Nadp Oxyreductamalic enzyme 1, NADP(+)-dependent, cytosolic Cytoplasm enzyme MECOM AML1-EVI-1, AML1/Evi-1, D630039M04Rik, EVI1, hCG 16404MDS1 and EVI1 complex locus Nucleus transcription regulator MEN1 AW045611, MEAI, MENIN, SCG2 multiple endocrine neoplasia I Nucleus transcription regulator MEOX1 AI385561, D330041M02Rik, KFS2, MOX1, RP23-434F13.2 mesenchyme homeobox 1 Nucleus transcription regulator MET AI838057, AUTS9, c-Met, HGF, HGF Binding, HGFR, LOC360met proto-oncogene Plasma Membrane kinase MFGE8 AA408458, AGS, AI325141, BA46, BOS 20119, EDIL1, HMFGmilk fat globule-EGF factor 8 protein Extracellular Space other MITF BCC2, bHLHe32, bw, CMM8, Gsfbcc2, MI, Microphthalmia-assomicrophthalmia-associated transcription factor Nucleus transcription regulator MLLT6 AF17, AI315037, RP23-94N18.5 myeloid/lymphoid or mixed-lineage leukemia (trithorax homoNucleus transcription regulator MME 6030454K05Rik, C85356, CALLA, CD10, ENDOPEPTIDASEmembrane metallo-endopeptidase Plasma Membrane peptidase MMP1 CLG, CLGN, Collagenase, INTERSTITIAL COLLAGENASE, matrixMco metallopeptidase 1 (interstitial collagenase) Extracellular Space peptidase MMP14 AI325305, MMP-X1, MT-MMP, MT-MMP-1, MT1-MMP, sabe matrix metallopeptidase 14 (membrane-inserted) Extracellular Space peptidase MMP15 AI503551, MT2-MMP, MTMMP2, SMCP-2 matrix metallopeptidase 15 (membrane-inserted) Extracellular Space peptidase MMP16 C8orf57, DKFZP761D112, MMP-X2, MT-MMP2, MT-MMP3, MTmatrix metallopeptidase 16 (membrane-inserted) Extracellular Space peptidase MMP2 BOS 17032, CLG4, CLG4A, GelA, GELATINASE, Gelatinasematrix A, metallopeptidase 2 (gelatinase A, 72kDa gelatinaseExtracellular Space peptidase MMP23B CA-MMP, MIFR, MIFR-1, MMP22, Mmp23, MMP23A, RP11-34matrix metallopeptidase 23B Extracellular Space peptidase MMP3 CHDS6, MT3-MMP, SL-1, SLN-1, STMY, STMY1, STR-1, STRmatrix metallopeptidase 3 (stromelysin 1, progelatinase) Extracellular Space peptidase MMP7 MAT, MPMM, MPSL1, PUMP-1 matrix metallopeptidase 7 (matrilysin, uterine) Extracellular Space peptidase MMP9 AW743869, B/MMP9, BOS 13297, CLG4B, COLLAGENASE matrixt metallopeptidase 9 (gelatinase B, 92kDa gelatinaseExtracellular Space peptidase MPEG1 MPG1, MPS1 macrophage expressed 1 Cytoplasm other MPZ CHM, CMT1, CMT1B, CMT2I, CMT2J, CMT4E, CMTDI3, CMTmyelin protein zero Plasma Membrane other MPZL2 EVA, EVA1, UNQ606/PRO1192 myelin protein zero-like 2 Plasma Membrane other MST1R CD136, CDw136, Fv-2, MSPR, PTK8, RON, STK macrophage stimulating 1 receptor (c-met-related tyrosinePlasma Membrane kinase MSX1 AA675338, AI324650, ECTD3, HOX7, Hox7.1, HYD1, msh, STmsh homeobox 1 Nucleus transcription regulator MSX2 BB122635, CRS2, FPP, HOX8, Hox8.1, MSH, PFM, PFM1 msh homeobox 2 Nucleus transcription regulator MT1L METALLOTHIONEIN 1L, MT1, MT1R, MTF metallothionein 1L (gene/pseudogene) Cytoplasm other MTA1 metastasis associated 1 Nucleus transcription regulator MTMR7 DJ710L4.2 myotubularin related protein 7 Cytoplasm phosphatase MUC1 CA 15-3, CD227, EMA, EMA1, Episialin, H23AG, KL-6, MAM6mucin 1, cell surface associated Plasma Membrane transcription regulator MUC6 mucin 6, oligomeric mucus/gel-forming Extracellular Space other Mup1 (includes others) 2610016E04Rik, AA589603, bM64F17.1, bM64F17.4, CT9906major urinary protein 1 Extracellular Space other MYF5 B130010J22Rik, bHLHc2 myogenic factor 5 Nucleus transcription regulator MYH3 dMHC, Embryonic myosin heavy chain, HEMHC, Mhc-emb, Mhmyosin, heavy chain 3, skeletal muscle, embryonic Cytoplasm enzyme MYL4 ALC1, AMLC, ELC, ELC1a, GT1, Malc, MLC1, MLC1a, MLC2A,myosin, light chain 4, alkali; atrial, embryonic Cytoplasm other MYLK 130 KDA MLCK, 9530072E15RIK, A930019C19RIK, AAT7, AWmyosin light chain kinase Cytoplasm kinase MYO7A DFNA11, DFNB2, Hdb, Myo7, Myosin 7A, MYOVIIA, MYU7A,myosin VIIA Cytoplasm enzyme MYOD1 AI503393, bHLHc1, MD1, MYF3, MYOD, PUM myogenic differentiation 1 Nucleus transcription regulator MYOG bHLHc3, MG, MYF4, myo, myogenic factor 4, myogenin myogenin (myogenic factor 4) Nucleus transcription regulator N-Cadherin Other group N-cor Nucleus group NAA10 2310039H09Rik, ARD1, ARD1A, DXS707, NATD, RGD156531N(alpha)-acetyltransferase 10, NatA catalytic subunit Nucleus enzyme NANOG 2410002E02Rik, ecat4, ENK, LOC100038891, LOC10029388Nanog homeobox Nucleus transcription regulator NAT8 0610037O16Rik, ATASE2, CML1, CML4, GLA, Hcml1, TSC50N-acetyltransferase 8 (GCN5-related, putative) Nucleus transcription regulator NCAM1 CD56, E-NCAM, MSK39, N-CAM, NCAM-C neural cell adhesion molecule 1 Plasma Membrane other NCL B530004O11RIK, C23, D0Nds28, D1Nds28, LOC100289394,nucleolin Nucleus other NCOA1 bHLHe42, bHLHe74, F-SRC-1, KAT13A, NCOA, RIP160, SRCnuclear receptor coactivator 1 Nucleus transcription regulator NCOA2 9530095N19, bHLHe75, D1Ertd433e, GRIP-1, KAT13C, SRC-2nuclear receptor coactivator 2 Nucleus transcription regulator NCOA3 2010305B15RIK, ACTR, AIB-1, AIB1 delta3, AW321064, bHLHnuclear receptor coactivator 3 Nucleus transcription regulator NCOR1 5730405M06RIK, A230020K14RIK, hN-CoR, mKIAA1047, N-Cnuclear receptor corepressor 1 Nucleus transcription regulator NCOR2 CTG26, N-CoR, RETINOID SILENCER, SMAP270, SMRT, SMRnuclear receptor corepressor 2 Nucleus transcription regulator NDRG1 CAP43, CMT4D, DRG-1, GC4, HMSNL, N-myc Downstream N-mycR downstream regulated 1 Nucleus kinase NDRG2 AI182517, AU040374, NDR2, Ndrg2b1, SYLD NDRG family member 2 Cytoplasm other NEURL2 C20orf163, Neur2, OZZ, OZZ-E3 neuralized homolog 2 (Drosophila) Cytoplasm other NEUROD1 BASIC HELIX-LOOP-HELIX, Beta2/NeuroD, BHF-1, bHLHa3,neuronal differentiation 1 Nucleus transcription regulator NEUROG1 AKA, bHLHa6, Math4C, NEUROD3, Ngn1 neurogenin 1 Nucleus transcription regulator NF2 ACN, BANF, merlin, neurofibromatosis 2 tumor suppressor, RP2neurofibromin 2 (merlin) Plasma Membrane other NFATC1 2210017P03Rik, AI449492, AV076380, NF-ATC, NFAT2, Nfatcbnuclear factor of activated T-cells, cytoplasmic, calcineurinNucleus transcription regulator NFkB (complex) NF-KAPPA B, NF-κB Nucleus complex NFKB1 EBP-1, KBF1, Nf kappa b DNA binding subunit, NF KAPPA Bnuclear su factor of kappa light polypeptide gene enhancer inNucleus transcription regulator NFKBIA AI462015, IkappaB alpha, Ikb Kinase Alpha, IKBA, IKBM, IκBnuclearα factor of kappa light polypeptide gene enhancer inCytoplasm transcription regulator NFYB AA985999, CBF-A, CBF-B, HAP3, Nfya nuclear transcription factor Y, beta Nucleus transcription regulator NIPSNAP1 4-Nitrophenylphosphatase domain and non-neuronal snap25-lnipsnap homolog 1 (C. elegans) Cytoplasm enzyme NKD1 2810434J10Rik, 9030215G15Rik, LOC283859, Naked1, Nkd,naked cuticle homolog 1 (Drosophila) Other other NKX2-1 AV026640, BCH, BHC, NK-2, NKX2.1, NKX2A, T/EBP, TEBP,NK2 homeobox 1 Nucleus transcription regulator NKX3-1 bagpipe, BAPX2, Bax, NKX3, NKX3.1, NKX3A NK3 homeobox 1 Nucleus transcription regulator NLK AI194375, LOC100044468, RGD1561602, RP23-399H5.11-00nemo-like kinase Nucleus kinase NME3 1810009F08Rik, AI413736, c371H6.2, DR-nm23, Ndk3, NDPK-CNME/NM23 nucleoside diphosphate kinase 3 Cytoplasm kinase NONO AA407051, AV149256, NMT55, Non-pou domain-containing octnon-POU domain containing, octamer-binding Nucleus other NOS2 BOS 18469, CALCIUM-INDEPENDENT NOS, HEP-NOS, Hepnitric oxide synthase 2, inducible Cytoplasm enzyme NOTCH1 9930111A19Rik, hN1, lin-12, Mis6, N1, NOTCH, RP23-306D20notch 1 Plasma Membrane transcription regulator NOX1 GP91-2, MOX1, NOH-1, NOX1a, NOX1alpha, RP1-146H21.1,NADPH oxidase 1 Cytoplasm ion channel NPHS2 AI790225, PDCN, Podocin, SRN1 nephrosis 2, idiopathic, steroid-resistant (podocin) Plasma Membrane other NPM1 B23, B23.1, B23NP, NO38, NPM, Nucleolar protein B23.2, NUnucleophosmin (nucleolar phosphoprotein B23, numatrin)Nucleus transcription regulator NPTX1 D11Bwg1004e, NEURONAL PENTRAXIN, NEURONAL PENTneuronal pentraxin I Extracellular Space other NR0B1 AHC, AHCH, AHX, DAX-1, DSS, GTD, HHG, NROB1, RP23-3nuclear receptor subfamily 0, group B, member 1 Nucleus ligand-dependent nuclear receptor NR4A1 Gfrp, GFRP1, Hbr-1, HMR, Hormone receptor, N10, NAK-1, Nnuclear receptor subfamily 4, group A, member 1 Nucleus ligand-dependent nuclear receptor NR4A2 HZF-3, NOT, NURR1, Nurr2, RNR-1, RP23-271B15.1, TINORnuclear receptor subfamily 4, group A, member 2 Nucleus ligand-dependent nuclear receptor NR5A1 AD4BP, Ad4BP/SF-1, BOS 12001, ELP, ELP-3, FTZ1, FTZF1,nuclear receptor subfamily 5, group A, member 1 Nucleus ligand-dependent nuclear receptor NR5A2 AU020803, B1F, B1F2, CPF, D1Ertd308e, FTF, FTF-2, FTZ-F1nuclear receptor subfamily 5, group A, member 2 Nucleus ligand-dependent nuclear receptor NRCAM Bravo, C030017F07Rik, C130076O07RIK, mKIAA0343, NGCAM,neuronal cell adhesion molecule Plasma Membrane other NRG1 6030402G23RIK, ARIA, D230005F13Rik, GGF, GGFII, GP30,neuregulin 1 Other growth factor NRP2 1110048P06RIK, Neuropilin-2, NP2, NPN2, PRO2714, RP23-1neuropilin 2 Plasma Membrane kinase NUDT7 1300007B24Rik, 2210404C19Rik, LOC440388, Nudix 7 nudix (nucleoside diphosphate linked moiety X)-type motifCytoplasm enzyme NUMB c14 5527, C14ORF41, Nb, S171 numb homolog (Drosophila) Plasma Membrane other NUP153 B130015D15Rik, C88147, HNUP153, N153, NUCZINK nucleoporin 153kDa Nucleus transporter NUP62 AA589433, AI426861, AI790512, AU045898, D7Ertd649e, IBSNnucleoporin 62kDa Nucleus transporter NUP98 4732457F17, ADIR2, AI849286, NUP196, NUP96 nucleoporin 98kDa Nucleus transporter OAT AI194874, GACR, HOGA, OATASE, OKT, Ornithine Transaminornithine aminotransferase Cytoplasm enzyme OGG1 FPG, HMMH, HOGG1, Mmh, MUTM, OGH1 8-oxoguanine DNA glycosylase Nucleus enzyme ORC4 mMmORC4, ORC4L, ORC4P, RP23-139F8.4 origin recognition complex, subunit 4 Nucleus other p160 Nucleus group PAK1 Alpha Pak, AW045634, Muk2, Pak, PAK1B, PAK20, PAKA, PAKap21 protein (Cdc42/Rac)-activated kinase 1 Cytoplasm kinase PARD3 AA960621, AI256638, ASIP, atypical pkc-specific binding, Baz,par-3 family cell polarity regulator Plasma Membrane other PARP1 5830444G22Rik, Adprp, Adprp1, ADPRT, ADPRT 1, AI893648poly (ADP-ribose) polymerase 1 Nucleus enzyme PAX1 hbs, hunchback, HUP48, RP23-191L7.5, RP5-1065O2.3, un,paired u box 1 Nucleus transcription regulator PAX3 CDHS, HUP2, Sp, splotch, WS1, WS3 paired box 3 Nucleus transcription regulator PAX7 HUP1, LOC284530, PAX7B, RGD1564360, RMS2, RP23-334paired box 7 Nucleus transcription regulator PAX8 Paired box gene 8, RP23-218B17.4 paired box 8 Nucleus transcription regulator PBDC1 2610029G23Rik, CXorf26, RGD1562502, RP23-250A14.3 polysaccharide biosynthesis domain containing 1 Other other Pbsn PB, Prbs, RP23-91C19.6 probasin Extracellular Space transporter PCCA C79630, Propionyl coa carboxylase alpha, RP11-151A6.1 propionyl CoA carboxylase, alpha polypeptide Cytoplasm enzyme PCDH9 C530050I23RIK, LOC638275, RP11-335P18.3 protocadherin 9 Plasma Membrane other PCNA Pcna/cyclin, PCNAR, RP23-33N15.1 proliferating cell nuclear antigen Nucleus enzyme PCNT AW476095, C86676, KEN, kendrin, LOC687681, m239Asp, m2pericentrin Cytoplasm other PCP2 GPSM4, L7, MGC41903 Purkinje cell protein 2 Cytoplasm other PCSK1 BDP, BMIQ12, NEC1, PC1, PC3, Phpp-1, SPC3 proprotein convertase subtilisin/kexin type 1 Extracellular Space peptidase PCSK6 C86343, PACE4, PAIRED BASIC AMINO ACID CLEAVING ENproprotein convertase subtilisin/kexin type 6 Extracellular Space peptidase PDAP1 28-kDa Heat- and Acid-Stable Phosphoprotein, HASPP28, PAPPDGFA associated protein 1 Cytoplasm other PDE1C Hcam3 phosphodiesterase 1C, calmodulin-dependent 70kDa Cytoplasm enzyme PDE4B DPDE4, dunce, PDE4/IVb, Pde4b1, Pde4b2, Pde4B3, Pde4B4phosphodiesterase 4B, cAMP-specific Cytoplasm enzyme Pdgfr Plasma Membrane group PDGFRB AI528809, CD140B, IBGC4, IMF1, JTK12, PDGF-R-beta, PDGplatelet-derived growth factor receptor, beta polypeptide Plasma Membrane kinase PECAM1 C85791, CD31, CD31/EndoCAM, endoCAM, GPIIA', PECA1,platelet/endothelial cell adhesion molecule 1 Plasma Membrane other PFN1 ALS18, DN-183N8.15-001, Pfn, PROFILIN profilin 1 Cytoplasm other PHB Bap32, PHB1, prohibitin 1, RP23-17C2.2 prohibitin Nucleus transcription regulator PHB2 AU044498, BAP, Bap-37, Bcap27, BCAP37, BCR ASSOCIATEDprohibitin 2 Cytoplasm transcription regulator PHF17 AU041499, D530048A03RIK, FLJ22479, JADE1, mKIAA1807PHD finger protein 17 Nucleus other PHF6 2700007B13Rik, 4931428F02RIK, AC004383.6, BFLS, BORJ,PHD finger protein 6 Nucleus other PHLDA2 BRW1C, BWR1C, HLDA2, IPL, TSSC3 pleckstrin homology-like domain, family A, member 2 Cytoplasm other PI3K (complex) 1-phosphatidylinositol 3-kinase, 2.7.1.137, ATP:1-phosphatidyl-1D-myo-inositol 3-phosphotransferase, PhosphatidylinosiCytoplasm complex PIGC 3110030E07Rik, AW212108, GPI2 phosphatidylinositol glycan anchor biosynthesis, class C Cytoplasm enzyme PIK3CA 6330412C24RIK, BOS 1038, caPI3K, CLOVE, CWS5, MCAP,phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic Cytoplasmsu kinase PIK3R1 AA414921, AGM7, BOS 19690, GRB1, p85, p85 subunit of PI3phosphoinositide-3-kinase, regulatory subunit 1 (alpha) Cytoplasm kinase PIN1 0610025L01Rik, D9Bwg1161e, DOD, UBL5 peptidylprolyl cis/trans isomerase, NIMA-interacting 1 Nucleus enzyme PITX2 9430085M16Rik, ARP1, Brx1, Brx1a, Brx1b, IDG2, IGDS, IGDpaired-like homeodomain 2 Nucleus transcription regulator PKD1 mFLJ00285, PBP, PC1, rCG 34128, TRPP1 polycystic kidney disease 1 (autosomal dominant) Plasma Membrane ion channel PKD2 APKD2, C030034P18RIK, PC2, PKD4, Polycystin 2, RGD155polycystic kidney disease 2 (autosomal dominant) Plasma Membrane ion channel PKM AA414905, AL024370, AL024424, CTHBP, M2-Pk, OIP3, Pk-2pyruvate kinase, muscle Cytoplasm kinase PKN2 6030436C20RIK, AI507382, PAK-2, PRK2, PRKCL2, PRO204protein kinase N2 Cytoplasm kinase PKP2 1200008D14RIK, 1200012P04Rik, AA516617, ARVD9, Pkp2lplakophilin 2 Plasma Membrane other PKP3 2310056L12Rik plakophilin 3 Plasma Membrane other PLAU ATF, BDPLT5, BOS 24163, Pro-UPA, QPD, RP11-417O11.1, plasminogenU activator, urokinase Extracellular Space peptidase PLAUR CD87, Par, Plaur3, U-PAR, uPAR-2, UPAR-3, Urinary plasminoplasminogen activator, urokinase receptor Plasma Membrane transmembrane receptor PLK1 PLK, STPK13 polo-like kinase 1 Nucleus kinase PLS3 AI115446, AL024105, RP23-162M7.1, T-fimbrin, T-plastin plastin 3 Cytoplasm other PMCH A230109K23RIK, Melanin Concentrating Hormone pro-melanin-concentrating hormone Extracellular Space other PML 1200009E24Rik, AI661194, PP8675, RGD1562602, RNF71, Tpromyelocytic leukemia Nucleus transcription regulator PMP22 CMT1A, CMT1E, DSS, GAS-3, HMSNIA, HNPP, PERIPHERALperipheral myelin protein 22 Plasma Membrane other PODXL AW121214, Gp200, Ly102, PC, PCLP, PCLP-1, Podocalyxin,podocalyxin-like PO Plasma Membrane kinase POLR2A BOS 18773, hRPB220, hsRPB1, Pol II Largest Subunit, Pol IIpolymerase (RNA) II (DNA directed) polypeptide A, 220kDaNucleus enzyme POLR2E 2410021N14Rik, AW208866, hRPB25, hsRPB5, LOC687055,polymerase (RNA) II (DNA directed) polypeptide E, 25kDaNucleus enzyme POU3F2 9430075J19RIK, A230098E07RIK, Brain-2, BRN2, NOCT3, OPOU class 3 homeobox 2 Nucleus transcription regulator POU5F1 DADB-104B20.2, NF-A3, Oct-3/4, OCT3, OCT4, OTF-3, Otf3-rs7POU class 5 homeobox 1 Nucleus transcription regulator PPAP2B 1110003O22RIK, 2610002D05Rik, AV025606, D4Bwg0538e,phosphatidic D acid phosphatase type 2B Plasma Membrane phosphatase PPARG CIMT1, GLM1, NR1C3, PPAR gamma 3, PPAR-gamma, Ppargperoxisome proliferator-activated receptor gamma Nucleus ligand-dependent nuclear receptor PPM1A 2310003C21RIK, 2900017D14Rik, AI427932, AU017636, MMPaprotein phosphatase, Mg2+/Mn2+ dependent, 1A Cytoplasm phosphatase PPP1R2 0610025N14Rik, 2310007G06Rik, 4930440J04Rik, 5430408E1protein phosphatase 1, regulatory (inhibitor) subunit 2 Cytoplasm phosphatase PPP2CA BOS 8121, PP2A, Pp2a1, PP2Ac, PP2AC alpha, PP2CA, PP2protein phosphatase 2, catalytic subunit, alpha isozyme Cytoplasm phosphatase PPP2R1A 6330556D22Rik, PP2A, PP2A AALPHA, Pp2a-pr65, PP2A/A,protein phosphatase 2, regulatory subunit A, alpha Cytoplasm phosphatase PPP3CA 2900074D19Rik, AI841391, AW413465, Calcineurin, Calcineuprotein phosphatase 3, catalytic subunit, alpha isozyme Cytoplasm phosphatase PRDM1 BLIMP1, PRDI-BF1, PRDM, RP1-134E15.1, ZNFPR1A1 PR domain containing 1, with ZNF domain Nucleus transcription regulator PRKACA A KINASE CATALYTIC subunit, Ampk alpha1, BOS 7381, Cs-PKA,protein kinase, cAMP-dependent, catalytic, alpha Cytoplasm kinase PRKAR1A 1300018C22Rik, ACRDYS1, ADOHR, Camp-dependent proteprotein kinase, cAMP-dependent, regulatory, type I, alphaCytoplasm kinase PRKCA AAG6, AI875142, BOS 19579, LOC146784, PKC α, PKC-alphprotein kinase C, alpha Cytoplasm kinase PRKCB A130082F03Rik, BOS 22739, PKC Type II, PKC Type III, PKCprotein kinase C, beta Cytoplasm kinase PRKCSH 80K-H, AGE-R2, G19P1, Glucosidase II beta subunit, LOC100protein kinase C substrate 80K-H Cytoplasm enzyme PRKG1 AAT8, AW125416, BOS 23279, cGK, cGK 1, CGKI, Cgmp-depprotein kinase, cGMP-dependent, type I Cytoplasm kinase PRMT1 6720434D09Rik, ANM1, AW214366, HCP1, Heterogeneous nuprotein arginine methyltransferase 1 Nucleus enzyme PROP1 CPHD2, df, RP23-292E3.9 PROP paired-like homeobox 1 Nucleus transcription regulator PRPF38B 1110021E09RIK, AU018955, FLJ10330, NET1, RP11-293A10.PRP38 pre-mRNA processing factor 38 (yeast) domain conOther other PRPF6 1190003A07Rik, 2610031L17Rik, ANT-1, C20orf14, hPrp6, PRpre-mRNA processing factor 6 Nucleus transcription regulator PRRC2A 3110039B05Rik, BAT2, D17H6S51E, D6S51, D6S51E, DADB-7proline-rich coiled-coil 2A Cytoplasm other PRSS35 6030424L22Rik, C6orf158, dJ223E3.1, P3D9, UNQ522/PRO1protease, serine, 35 Extracellular Space peptidase PSAP AI037048, Co-beta-glucosidase, CSAct, Dispersin, GLBA, IPI0prosaposin Extracellular Space other PSEN1 AD3, Ad3h, FAD, PS-1, S182 presenilin 1 Plasma Membrane peptidase PSEN2 AD3L, AD3LP, AD4, Ad4h, AI266870, ALG-3, CMD1V, E5-1, PS-2presenilin 2 (Alzheimer disease 4) Cytoplasm peptidase PSMD2 9430095H01Rik, AA407121, P97, RPN1, S2, TEG-190, Tex19proteasome (prosome, macropain) 26S subunit, non-ATPaCytoplasm other PSMD6 2400006A19RIK, FLJ30168, p42A, P44s10, PFAAP4, Rpn7, proteasomeS1 (prosome, macropain) 26S subunit, non-ATPaCytoplasm enzyme PTCH1 A230106A15RIK, BCNS, HPE7, mes, NBCCS, PTC, PTC1, PTpatched 1 Plasma Membrane transmembrane receptor PTCH2 PTC2, Ptch1, RP11-269F19.8, RP23-59L24.2 patched 2 Plasma Membrane transmembrane receptor PTCRA gp33, PRETALPHA, PT-ALPHA, pT-alpha-TCR, PTA, pT[a], Rpre T-cell antigen receptor alpha Plasma Membrane other PTEN 10q23del, 2310035O07RIK, A130070J02Rik, AI463227, B430phosphatase and tensin homolog Cytoplasm phosphatase PTGS2 BOS 16112, COX-2, CYCLO-OXYGENASE 2, GRIPGHS, hCoprostaglandin-endoperoxide synthase 2 (prostaglandin G/HCytoplasm enzyme PTH1R HKRK, PFE, PLP/PTH receptor, PPR, Pth/pthrp receptor, Pth/parathyroid hormone 1 receptor Plasma Membrane G-protein coupled receptor PTK7 8430404F20Rik, CCK-4, chz, mPTK7/CCK4, Otk, Srf protein tyrosine kinase 7 Plasma Membrane kinase PTN BOS 4734, HARP, HB-GAM, HBBN, HBGF-8, HBNF, NEGF1,pleiotrophin Extracellular Space growth factor PTPN1 protein-TYROSINE PHOSPHATASE, Ptp, PTP-1B, PTP-HA2,protein tyrosine phosphatase, non-receptor type 1 Cytoplasm phosphatase PTPN11 2700084A17Rik, AW536184, BPTP3, CFC, MGC14433, Noonprotein tyrosine phosphatase, non-receptor type 11 Cytoplasm phosphatase PTPN12 P19-PTP, PTP-P19, PTP-PEST, PTPG1, RKPTP, tcag7.1075protein tyrosine phosphatase, non-receptor type 12 Cytoplasm phosphatase PTPN13 AI324989, FAP-1, Fas-associated phosphatase-1, hPTP1E, LOprotein tyrosine phosphatase, non-receptor type 13 (APO-1Cytoplasm phosphatase PTPN14 C130080N23RIK, OTTMUSG00000022087, PEZ, PTP36, PTPDprotein tyrosine phosphatase, non-receptor type 14 Cytoplasm phosphatase PTPN6 HCP, HCPH, HPTP1C, me, motheaten, PTP-1C, Ptph6, SH-PTprotein tyrosine phosphatase, non-receptor type 6 Cytoplasm phosphatase PTPRB 3230402H02Rik, C130094E24, HPTP-BETA, HPTPB, LOC100protein tyrosine phosphatase, receptor type, B Plasma Membrane phosphatase PTPRC B220, CD45, CD45R, GP180, L-CA, loc, LY5, Lyt-4, Ox1, RP1protein tyrosine phosphatase, receptor type, C Plasma Membrane phosphatase PTPRF AA591035, LAR, Lar ptp2b, LARS, Leukocyte Antigen Relatedprotein tyrosine phosphatase, receptor type, F Plasma Membrane phosphatase PTPRG 5430405N12RIK, AW046354, AW549872, HPTPG, PTPG, R-PTprotein tyrosine phosphatase, receptor type, G Plasma Membrane phosphatase PTPRJ AI450271, BET, Byp, CD148, DEP-1, HPTPeta, PTP ETA C, PTprotein tyrosine phosphatase, receptor type, J Plasma Membrane phosphatase PTPRK AI853699, PTPk, R-PTP-kappa, RP3-480J14.1, Rptpk protein tyrosine phosphatase, receptor type, K Plasma Membrane phosphatase PTPRO D28, GLEPP, GLEPP1, NPHS6, PTP PHI, PTP-OC, PTP-U2,protein tyrosine phosphatase, receptor type, O Plasma Membrane phosphatase PTPRQ DFNB84, DFNB84A, LOC100129165, PTP-I32039, PTPGMC1protein tyrosine phosphatase, receptor type, Q Other other PTPRU FMI, Ftp-1, hPTP-J, PCP-2, PTP, PTP-J, PTP-lambda, PTP-PIprotein tyrosine phosphatase, receptor type, U Plasma Membrane phosphatase PTPRZ1 AI850339, DSD-1-PG, HPTPZ, HPTPzeta, Phosphacan, PTP-Zprotein tyrosine phosphatase, receptor-type, Z polypeptidePlasma Membrane phosphatase PXN AW108311, AW123232, FLJ23042, hCG 1778014, PAX, PAXILpaxillin Cytoplasm other PYGO2 1190004M21Rik, mpygo2, PP7910, RGD1308535 pygopus homolog 2 (Drosophila) Nucleus other QKI 1110003F05Rik, 1500005P18, Hqk, hqkI, l(17)-1Wis, l17Wis1,QKI, KH domain containing, RNA binding Nucleus other QPCT 5730422A13Rik, GCT, glutaminyl cyclase, QC, RGD1562284,glutaminyl-peptide cyclotransferase Cytoplasm enzyme RAB18 AA959686, RAB18LI1, RP11-148B2.1, WARBM3 RAB18, member RAS oncogene family Cytoplasm enzyme RAB3A RAB3 RAB3A, member RAS oncogene family Cytoplasm enzyme RAB8B 5930437D16, D330025I23RIK, LOC51762 RAB8B, member RAS oncogene family Cytoplasm enzyme RAC1 AL023026, D5Ertd559e, MIG5, p21-RAC, p21-Rac1, Rac, TC-2ras-related C3 botulinum toxin substrate 1 (rho family, smaPlasma Membrane enzyme RAD23A 2310040P19Rik, AL024030, HHR23A, HR23A, mHR23A RAD23 homolog A (S. cerevisiae) Nucleus other RAI14 1700008J19Rik, 1700020L11Rik, Ankycorbin, mKIAA1334, NOretinoic acid induced 14 Nucleus transcription regulator RANBP2 A430087B05Rik, AI256741, ANE1, BOS 11608, IIAE3, NUP35RAN binding protein 2 Nucleus enzyme Rap1 RAP1A/B Cytoplasm group RAPGEF2 5830453M24Rik, CNRasGEF, LOC100504025, mKIAA0313, RapN guanine nucleotide exchange factor (GEF) 2 Cytoplasm other RAPSN Nraps, Postsynaptic 43 kDa, Raps, RAPSYN, RNF205, RP23-1receptor-associated protein of the synapse Plasma Membrane other RARA alpha RAR, NR1B1, PLZF-RARα, RAR, Rar alpha, RARalpha1retinoic acid receptor, alpha Nucleus ligand-dependent nuclear receptor Ras Cytoplasm group RB1CC1 2900055E04Rik, 5930404L04Rik, ATG17, CC1, FIP200, KIAA0RB1-inducible coiled-coil 1 Nucleus other RBBP5 4933411J24Rik, C330016J05, RBQ3, SWD1 retinoblastoma binding protein 5 Nucleus other RBM39 1500012C14Rik, 2310040E03Rik, B330012G18RIK, C79248,RNA binding motif protein 39 Nucleus transcription regulator RBMX HNRNPG, HNRPG, RBMXP1, RBMXRT, RNMX, RP11-1114A5RNA binding motif protein, X-linked Nucleus other RBP4 APP-BP, Crbp IV, PLASMA RETINOL-binding, PRBP, PRO222retinol binding protein 4, plasma Extracellular Space transporter Rbx1 1500002P15Rik, AA517855, LOC100363742, ROC1 ring-box 1 Cytoplasm enzyme RCN1 PIG20, RCAL, RCN, Reticulocalbin 1, RP23-232D1.3 reticulocalbin 1, EF-hand calcium binding domain Cytoplasm other RETN ADSF, FIZZ3, HXCP1, RESISTIN, RETN1, RSTN, UNQ407/PRresistin Extracellular Space other RGN AI265316, CTD-2522E6.2, GNL, RC, Reguc, RP23-333P16.3,regucalcin Nucleus enzyme Rnr 18s, 28s, 28s Rnr, 32s, 36s, 45 S rRNA, 45s, 47S Pre-rRNA, 5.8s, Ribosomal, Ribosomal DNA Repeat Unit Other group RPL21 8430440E03Rik, L21, RP11-428O18.5 ribosomal protein L21 Cytoplasm other RPL41 1810055P16Rik, 2210411K19RIK, L41 ribosomal protein L41 Cytoplasm other RPLP2 2700049I22Rik, D11S2243E, LOC498555, LP2, P2, Ribosomaribosomal protein, large, P2 Cytoplasm other RPSA 37LRP, 40kDa Ribosomal, 40S RIBOSOMAL protein SA, 67LRribosomal protein SA Cytoplasm translation regulator RUNX2 AML3, Cbf, CBF-alpha 1, CBFA1, CCD, CCD1, CLCD, LS3, Orunt-related transcription factor 2 Nucleus transcription regulator RUNX3 AML2, CBF-alpha 3, CBFA3, PEA2-alpha C, Pebp2a3, PEBP2runt-related transcription factor 3 Nucleus transcription regulator RUVBL1 2510009G06Rik, ECP54, INO80H, NMP238, PONTIN, Pontin5RuvB-like AAA ATPase 1 Nucleus transcription regulator RUVBL2 CGI-46, ECP51, INO80J, mp47, p47, REPTIN, RuvB like DNARuvB-like AAA ATPase 2 Nucleus transcription regulator RXRA 9530071D11RIK, NR2B1, Retinoid X receptor alpha, RP23-41retinoid X receptor, alpha Nucleus ligand-dependent nuclear receptor RYK AW536699, D3S3195, DERAILED, ERK-3, Etk3, JTK5, JTK5A,receptor-like tyrosine kinase Plasma Membrane kinase S100A4 18A2, 42A, CAPL, FSP1, metastasin, MTS1, P9KA, PEL98, pk9S100 calcium binding protein A4 Cytoplasm other S100A8 60B8AG, AI323541, B8Ag, CAGA, calgranulin A, CALPROTECS100 calcium binding protein A8 Cytoplasm other SAA1 AW111173, PIG4, SAA, SAA2, SAAR, SAAR-RS, SERUM AMYLserum amyloid A1 Extracellular Space transporter Saa3 AV098916, l7R3, SAA ENHANCING FACTOR serum amyloid A 3 Other other SATB1 2610306G12Rik, AW413156 SATB homeobox 1 Nucleus transcription regulator SCAP 9530044G19, mKIAA0199, PSEC0227 SREBF chaperone Cytoplasm other SCD AA589638, ab, AI265570, Delta9 Desaturase, FADS5, MSTP0stearoyl-CoA desaturase (delta-9-desaturase) Cytoplasm enzyme SCGB2A2 MAMMAGLOBIN, MGB1, UGB2 secretoglobin, family 2A, member 2 Extracellular Space other SCN5A Cardiac sodium channel alpha subunit, CDCD2, CMD1E, CMPDsodium channel, voltage-gated, type V, alpha subunit Plasma Membrane ion channel SCRIB AI118201, CRC, CRIB, CRIB1, KIAA0147, mKIAA0147, RGD1scribbled planar cell polarity protein Cytoplasm other SDCBP MDA-9, RP23-89L15.4, ST1, SYCL, syntenin-1, TACIP18 syndecan binding protein (syntenin) Plasma Membrane enzyme SEC61A1 AA408394, AA410007, HSEC61, rSEC61alpha p, SEC61, SECSec61 alpha 1 subunit (S. cerevisiae) Cytoplasm transporter SEMA3C 1110036B02Rik, SEMAE, Semaphorin E, SemE sema domain, immunoglobulin domain (Ig), short basic doExtracellular Space other SEMA5A 5930434A13, 9130201M22RIK, AI464145, SEMAF, semF sema domain, seven thrombospondin repeats (type 1 andPlasma Membrane transmembrane receptor SEPW1 Muscle Selenoprotein, SelW selenoprotein W, 1 Cytoplasm enzyme SERBP1 1200009K13RIK, 9330147J08Rik, AL022786, CGI-55, CHD3IPSERPINE1 mRNA binding protein 1 Nucleus other SERPINA1 A1-PI, A1A, A1AT, AAT, AAT2, AI118301, alpha 1 antiprotease,serpin peptidase inhibitor, clade A (alpha-1 antiproteinaseExtracellular, Space other SERPINA3 A3n, AACT, ACT, alpha1 ACT, Alpha1-antitrypsin proteinase inserpin peptidase inhibitor, clade A (alpha-1 antiproteinaseExtracellular, Space other SERPINA5 4933415L04, PAI-3, PCI, PCI-B, PLANH3, PLASMA SERINEserpin PR peptidase inhibitor, clade A (alpha-1 antiproteinaseExtracellular, Space other SERPINE1 beta MIGRATING PLAS ACTIVATOR, beta-MIGRATING PLASMIserpin peptidase inhibitor, clade E (nexin, plasminogen actExtracellular Space other SERPINE2 B230326M24Rik, GDN, GDNPF, GDNPN1, GLIA DERIVED Nserpin peptidase inhibitor, clade E (nexin, plasminogen actExtracellular Space other SESN1 1110002G11Rik, AU044290, PA26, RP11-787I22.2, SEST1, Sesestrin 1 Nucleus other SET 2610030F17Rik, 2PP2A, 5730420M11Rik, AA407739, Ab1-115SET nuclear oncogene Nucleus phosphatase SF3A1 1200014H24Rik, 5930416L09Rik, AI159724, PRP21, PRPF21splicing factor 3a, subunit 1, 120kDa Nucleus other SFN 14-3-3 Sigma, 14-3-3σ, ER, HME1, Mme1, RP23-137L22.11-0stratifin Cytoplasm other SFRP1 2210415K03RIK, AW011917, AW107218, AW742929, BOS 23secreted frizzled-related protein 1 Plasma Membrane transmembrane receptor SFRP4 Frp, FRP-4, FRPHE secreted frizzled-related protein 4 Plasma Membrane transmembrane receptor SGK1 RP1-188K17.1, Serum/Glucocorticoid Regulated Serine/Threoserum/glucocorticoid regulated kinase 1 Cytoplasm kinase SH2B2 APS, SH2B2alpha SH2B adaptor protein 2 Cytoplasm other SH3KBP1 1200007H22Rik, 1700125L08Rik, 5830464D22Rik, AI447724,SH3-domain kinase binding protein 1 Cytoplasm other SHH 9530036O11Rik, Dsh, HHG1, HLP3, HPE3, HX, Hxl3, M10008sonic hedgehog Extracellular Space peptidase SHOX2 6330543G17Rik, OG12, OG12X, Prx3, SHOT short stature homeobox 2 Nucleus transcription regulator SIAH1 AA982064, AI853500, D9MGI7, SIAH, SIAH1A, Sinh1a siah E3 ubiquitin protein ligase 1 Nucleus enzyme SIM2 bHLHe15, HMC13F06, HMC29C01, SIM single-minded homolog 2 (Drosophila) Nucleus transcription regulator SIRT1 AA673258, RP11-57G10.3, Sir2, Sir2a, Sir2alpha, SIR2L1, SIRsirtuin 1 Nucleus transcription regulator SIX1 BB138287, BOS3, DFNA23, TIP39 SIX homeobox 1 Nucleus transcription regulator SKP1 2610043E24Rik, 2610206H23Rik, EMC19, OCP-II, OCP2, p19S-phase kinase-associated protein 1 Nucleus transcription regulator SLC12A2 9330166H04Rik, BSC, BSC2, mBSC2, Na-k-cl cotransporter,solute carrier family 12 (sodium/potassium/chloride transpoPlasma Membrane transporter SLC1A2 1700091C19Rik, 2900019G14RIK, AI159670, EAAT2, Glt, GLTsolute carrier family 1 (glial high affinity glutamate transportPlasma Membrane transporter SLC1A5 AAAT, ASCT2, ATBO, H4-ASCT2, M7V1, M7VS1, R16, RDRCsolute carrier family 1 (neutral amino acid transporter), mePlasma Membrane transporter SLC26A2 D5S1708, DTD, DTDST, EDM4, MST153, MSTP157, ST-OBsolute carrier family 26 (anion exchanger), member 2 Plasma Membrane transporter SLC6A1 A730043E01, GABATHG, GABATR, Gabt, GABT1, GAT-1, XTsolute carrier family 6 (neurotransmitter transporter), membPlasma Membrane transporter SLC6A2 BOS 17027, Nat, NAT1, NE-T, NET1, PRESYNAPTIC NOREPIsolute carrier family 6 (neurotransmitter transporter), membPlasma Membrane transporter SLC9A3R1 EBP-50, NHE-RF, NHERF-1, NPHLOP2, RP23-342L24.4 solute carrier family 9, subfamily A (NHE3, cation proton anPlasma Membrane other SLC9A3R2 0610011L07Rik, 1200011K07Rik, 2010007A20Rik, E3KARP, soluteN carrier family 9, subfamily A (NHE3, cation proton anPlasma Membrane transporter Slco1a1 A530084B21, Oatp, OATP-1, Oatp1a1, Slc21a1, Slco1a solute carrier organic anion transporter family, member 1a1Plasma Membrane transporter SMAD1 AI528653, BSP-1, DKFZP586M0622, JV4-1, MADH1, MADR1SMAD family member 1 Nucleus transcription regulator SMAD2 7120426M23RIK, hMAD-2, hSMAD2, JV18, JV18-1, MADH2,SMAD family member 2 Nucleus transcription regulator SMAD3 AU022421, DKFZP586N0721, hMAD-3, HSPC193, HsT17436SMAD family member 3 Nucleus transcription regulator SMAD4 AW743858, D18Wsu70e, DPC4, JIP, MADH4, MYHRS, SmauSMAD family member 4 Nucleus transcription regulator SMAD6 AOVD2, b2b390Clo, HsT17432, MADH6, MADH7 SMAD family member 6 Nucleus transcription regulator SMAD7 CRCS3, MADH7, MADH8 SMAD family member 7 Nucleus transcription regulator SMARCA4 b2b692Clo, BAF190, BAF190A, BRG, BRG1, HP1-BP72, hSNSWI/SNF related, matrix associated, actin dependent reguNucleus transcription regulator SMARCA5 4933427E24Rik, D030040M08RIK, D330027N15Rik, hISWI, SWI/SNFh related, matrix associated, actin dependent reguNucleus transcription regulator SMS AI427066, ENSMUSG00000067829, Gm14680, Gy, gyro, MRSRspermine synthase Cytoplasm enzyme SNAI1 AI194338, dJ710H13.1, RP23-118A2.5, SLUGH2, SNA, Sna1,snail family zinc finger 1 Nucleus transcription regulator SNAI2 SLUG, Slugh, SLUGH1, SNAIL2, WS2D snail family zinc finger 2 Nucleus transcription regulator SNCA AD AMYLOID, alpha SYNUCLEIN, alphaSYN, ASYN, NACP, synuclein,P alpha (non A4 component of amyloid precursor)Cytoplasm other SNRNP70 2700022N21Rik, 3200002N22Rik, AI325098, R74807, RNPU1small nuclear ribonucleoprotein 70kDa (U1) Nucleus other SNRPD1 AA407109, AL023031, HsT2456, SMD1, Smn, snRNP D1, SNsmall nuclear ribonucleoprotein D1 polypeptide 16kDa Nucleus other SNX9 2700073N08Rik, LOC100039155, RP11-266C7.10-001, SDP1sorting nexin 9 Cytoplasm transporter SORBS3 SCAM-1, SH3D4, SH3P3, VINE, vinexin-g sorbin and SH3 domain containing 3 Cytoplasm other Sox Nucleus group SOX11 1110038H03RIK, 6230403H02RIK, AI836553, end1 SRY (sex determining region Y)-box 11 Nucleus transcription regulator SOX17 Sox, VUR3 SRY (sex determining region Y)-box 17 Nucleus transcription regulator SOX2 AL606746.1, ANOP3, lcc, MCOPS3, RGD1565646, Sry-2, ysbSRY (sex determining region Y)-box 2 Nucleus transcription regulator SOX4 AA682046, EVI16, Ire-abp, RP23-262C6.1 SRY (sex determining region Y)-box 4 Nucleus transcription regulator SOX5 A730017D01RIK, AI528773, L-SOX5, LOC100503149, LOC31SRY (sex determining region Y)-box 5 Nucleus transcription regulator SOX6 AI987981, HSSOX6, SOX-LZ, SOXD SRY (sex determining region Y)-box 6 Nucleus transcription regulator SOX7 SRY (sex determining region Y)-box 7 Nucleus transcription regulator SOX9 2010306G03Rik, AV220920, CMD1, CMPD1, mKIAA4243, RP2SRY (sex determining region Y)-box 9 Nucleus transcription regulator SP7 6430578P22Rik, C22, OI11, OI12, Osterix, OSX Sp7 transcription factor Nucleus transcription regulator SPAG11B 9230111C08Rik, Bin1b, EDDM2B, EG546038, EP2, EP2C, Epsperm associated antigen 11B Extracellular Space other SPI1 Dis-1, hCG 25181, LOC100503306, OF, PU.1, RP23-20F9.1,spleen SF focus forming virus (SFFV) proviral integration oncoNucleus transcription regulator SPP1 2AR, Apl-1, BNSP, Bone Sialoprotein, Bopn, BOS 6536, Bsp,secreted BSPI phosphoprotein 1 Extracellular Space cytokine SQSTM1 A170, OSF-6, Osi, OSIL, Osip, Oxidative Stress, p60, p62, p62sequestosome 1 Cytoplasm transcription regulator SRC ASV, AW259666, BS27, c-SRC, p60-Src, PP60, Pp60/c-Src, v-srcp avian sarcoma (Schmidt-Ruppin A-2) viral oncogeneCytoplasm kinase SRF AW049942, AW240594, MCM1, RGD1559787, Sfr serum response factor (c-fos serum response element-binNucleus transcription regulator STARD7 AI852671, AL022671, AW544915, GTT1, RP23-206D14.5 StAR-related lipid transfer (START) domain containing 7 Other other STK39 AW227544, AW556857, DCHT, PASK, RF005, Rnl5, RP23-27serine threonine kinase 39 Nucleus kinase STXBP1 AI317162, AI326233, ANC18HA, MMS10-G, Ms10g, Munc-18asyntaxin binding protein 1 Cytoplasm transporter SUFU 2810026F04Rik, b2b273Clo, PRO1280, RP11-47A8.1, Su, SUsuppressor of fused homolog (Drosophila) Nucleus transcription regulator SUV39H1 AI852103, AL022883, DXHXS7466e, H3-K9-HMTase 1, KMT1suppressor of variegation 3-9 homolog 1 (Drosophila) Nucleus enzyme SUZ12 2610028O16Rik, AI195385, AU016842, AW536442, CHET9, SUZ12D polycomb repressive complex 2 subunit Nucleus enzyme SYK p72-Syk, Ptk72 spleen tyrosine kinase Cytoplasm kinase SYNM 4930412K21RIK, AI852401, DMN, E130104F11, KIAA0353, SYNsynemin, intermediate filament protein Cytoplasm other T Bra, Brachy, BRACHYURY, BraT, cou, D17Mit170, Low, Lr, meT, brachyury homolog (mouse) Nucleus transcription regulator TADA2A ADA2, ADA2-like, ADA2A, AV319371, D030022J10Rik, hADA2transcriptional adaptor 2A Nucleus transcription regulator TADA3 1110004B19Rik, ADA3, ADA3L, AI987856, hADA3, NGG1, STtranscriptional adaptor 3 Nucleus transcription regulator TAX1BP3 1300011C24Rik, GIP, RP23-263M10.10, RP23-263M10.10-00Tax1 (human T-cell leukemia virus type I) binding protein Cytoplasm3 transcription regulator TBL1X 5330429M20, EBI, RGD1563868, RP23-238B14.2, SMAP55,transducin (beta)-like 1X-linked Nucleus transcription regulator TBL1XR1 8030499H02Rik, A630076E03Rik, AW539987, C21, C230089Itransducin (beta)-like 1 X-linked receptor 1 Nucleus transcription regulator TBP GTF2D, GTF2D1, HDL4, RP1-191N21.3, SCA17, TATA BOX TATAF box binding protein Nucleus transcription regulator TBR1 LOC100365364, LOC679107, RP23-1O11.4, Tbrain 1, TES-56T-box, brain, 1 Nucleus transcription regulator TBX20 9430010M06RIK, AL022859, ASD4, Tbx12 T-box 20 Nucleus transcription regulator TBX5 HOS T-box 5 Nucleus transcription regulator TCF T cell factor Other group TCF/LEF LEF/TCF Nucleus group TCF3 A1, AA408400, ALF2, AW209082, bHLHb21, E12, E12/E47, E2transcription factor 3 Nucleus transcription regulator TCF3/4 Nucleus group TCF4 5730422P05RIK, ASP-I2, bHLHb19, E2-2, E2.2, ITF-2, ME2,transcription MI factor 4 Nucleus transcription regulator TCF4-CTNNβ TCF4-CTNNbeta Nucleus complex TCF7 AI465550, RP23-223A11.3, TCF-1 transcription factor 7 (T-cell specific, HMG-box) Nucleus transcription regulator TCF7L1 bHLHb21, LOC100361823, TCF-3 transcription factor 7-like 1 (T-cell specific, HMG-box) Nucleus transcription regulator TCF7L2 LOC683733, mTcf-4B, mTcf-4E, RP11-357H24.1, TCF-4, TCFtranscription factor 7-like 2 (T-cell specific, HMG-box) Nucleus transcription regulator TDGF1 CR, CR1, CRGF, CRIPTO, Cripto-1, LOC686890 teratocarcinoma-derived growth factor 1 Extracellular Space growth factor TELO2 1200003M09Rik, AI415602, CLK2, mKIAA0683, rCG 34115, telomereR maintenance 2 Cytoplasm other TERT CMM9, DKCA2, DKCB4, EST2, hEST2, HTERT, hTRT, PFBMFtelomerase reverse transcriptase Nucleus enzyme TFAP2A activating enhancer-binding protein 2 alpha, Activator protein-2transcription factor AP-2 alpha (activating enhancer bindingNucleus transcription regulator TFDP1 DP1, DRTF1, RP11-230F18.1, TB2/DP1 transcription factor Dp-1 Nucleus transcription regulator TGFA ETGF, RATTGFAA, TFGA, Tgf alpha, TGF-α, TGFAA, wa-1 transforming growth factor, alpha Extracellular Space growth factor TGFB3 ARVD, TGF-beta3, TGF-β, TRANSFORMING GROWTH FACTtransforming growth factor, beta 3 Extracellular Space growth factor TGFBR2 1110020H15Rik, AAT3, AU042018, DNIIR, FAA3, LDS1B, LDS2transforming growth factor, beta receptor II (70/80kDa) Plasma Membrane kinase TGM2 Ftg, G-ALPHA-h, GNAH, G[a]h, RP23-396G1.2, RP5-1054A22transglutaminase 2 Cytoplasm enzyme TH DYT14, DYT5b, The, TYH, TYROSINE 3-MONOOXYGENASEtyrosine hydroxylase Cytoplasm enzyme THRB C-ERBA-2, C-ERBA-BETA, ERBA2, GRTH, NR1A2, PRTH, Rthyroid hormone receptor, beta Nucleus ligand-dependent nuclear receptor thymidine kinase 2'-deoxythymidine kinase, 2.7.1.21, ATP:thymidine 5'-phosphotransferase, deoxythymidine kinase (phosphorylating), thOther group TIMP1 CLGI, EPA, EPO, HCI, Metalloproteinase inhibitor, RP1-230G1TIMP metallopeptidase inhibitor 1 Extracellular Space other TIMP3 HSMRK222, K222, K222TA2, RP1-309I22.1, SFD TIMP metallopeptidase inhibitor 3 Extracellular Space other TJP1 ZO-1, zona occludens 1 tight junction protein 1 Plasma Membrane other TLE1 C230057C06Rik, ESG, ESG1, Estm14, GRG1, GROUCHO 1,transducin-like enhancer of split 1 (E(sp1) homolog, DrosoNucleus transcription regulator TLE4 5730411M05Rik, AA792082, BCE-1, E(spI), ESG, ESG4, Esp2transducin-like enhancer of split 4 (E(sp1) homolog, DrosoNucleus transcription regulator TMEM2 3110012M15Rik, KIAA1412, mKIAA1412, RP11-52I12.1 transmembrane protein 2 Other other TMPO 5630400D24Rik, AI195756, AI606875, AW214352, AW547477thymopoietin Nucleus other TMSB15A NB THYMOSIN beta, Tb15, TbNB, THYMOSIN beta (IDENTIFthymosin beta 15a Cytoplasm other TNC 150-225, AI528729, C130033P17Rik, cytotactin, DFNA56, GMEM,tenascin C Extracellular Space other Tnc Hxb tenascin C Other other TNFRSF11B OCIF, OPG, osteoprotegerin, TNFR11, TR1 tumor necrosis factor receptor superfamily, member 11b Plasma Membrane transmembrane receptor TNFSF11 CD254, hRANKL2, Ly109l, ODF, OPG, OPGL, OPTB2, RANKLtumor necrosis factor (ligand) superfamily, member 11 Extracellular Space cytokine TNIK 1500031A17RIK, 4831440I19RIK, AI451411, C530008O15Rik,TRAF2 and NCK interacting kinase Cytoplasm kinase TNRC6B 2700090M07RIK, A730065C02Rik, AI848765, Cbl27, D230019trinucleotide repeat containing 6B Other other TNS4 9930017A07Rik, AA589547, AU016405, CTEN, PP14434, RGtensin 4 Cytoplasm other TOB1 APRO6, PIG49, RP23-244C22.1, TOB, TRANSDUCER of ERtransducer of ERBB2, 1 Nucleus transcription regulator TOB2 2900090N22Rik, 4930545K18Rik, AV071822, CTA-223H9.7, transducermKI of ERBB2, 2 Nucleus other TOP2A DNA TOPOISOMERASE II alpha, RP23-333D2.5, TOP2, TOPOtopoisomerase (DNA) II alpha 170kDa Nucleus enzyme TP63 AI462811, AIS, B(p51A), B(p51B), Delta N p63, Delta N p63 Altumor protein p63 Nucleus transcription regulator TPRA1 GPR175, LOC51210, PP6566, TMEM227, TPRA40 transmembrane protein, adipocyte asscociated 1 Plasma Membrane G-protein coupled receptor TRA IMD7, PT alpha, TCR α, TCRA, Tcralpha, TCRD, TRA@, TRACT cell receptor alpha locus Plasma Membrane transmembrane receptor TRAF1 4732496E14Rik, EBI6, MGC:10353, RP23-9N11.6 TNF receptor-associated factor 1 Cytoplasm other TRAF4 A530032M13Rik, CART1, MLN62, msp2, RNF83, RP23-185A1TNF receptor-associated factor 4 Cytoplasm other TRD TCR delta, TCRD, TCRDV1, TRD-alpha, TRD@ T cell receptor delta locus Cytoplasm other TRH Pro-TRH, THR, TRF, TRH01 thyrotropin-releasing hormone Extracellular Space other Trp53cor1 Gm16197, LincRNA-p21, LOC100499420, LOC100505253, Otumor protein p53 pathway corepressor 1 Other other TRRAP AI481500, PAF350/400, PAF400, PCAF-associated factor 400transformation/transcription domain-associated protein Nucleus transcription regulator TSC22D1 AA589566, AW105905, Cerebral protein-2, Egr5, Ptg-2, RP11-2TSC22 domain family, member 1 Nucleus transcription regulator TSPAN8 C76990, CO-029, CO-29, E330007O21Rik, TM4SF3 tetraspanin 8 Plasma Membrane other TUBA1A Alpha tubulin isotype M alpha 1, Alpha1 tubulin, B-ALPHA-1, tubulin,L alpha 1a Cytoplasm other TUBA4A Alpha tubulin, Alpha-tubulin 1, FLJ30169, H2-ALPHA, M[a]4, tubulin,T alpha 4a Cytoplasm other TWIST1 AA960487, ACS3, bHLHa38, BPES2, BPES3, CRS1, M-Twisttwist basic helix-loop-helix transcription factor 1 Nucleus transcription regulator TWIST2 bHLHa39, DERMO1, FFDD3, SETLSS twist basic helix-loop-helix transcription factor 2 Nucleus transcription regulator UBA1 A1S9, A1S9T, A1ST, AMCX1, CTD-2522E6.1, E1, GXP1, POCubiquitin-like modifier activating enzyme 1 Cytoplasm enzyme UBE2B 17-kDa Ubiquitin-Conjugating Enzyme E2, 2610301N02RIK, ubiquitin-conjugatingE2 enzyme E2B Cytoplasm enzyme UBE2D1 E2 H5A, E2(17)KB1, SFT, UBC4/5, UBC5, UBC5A, UBCH5, ubiquitin-conjugatingU enzyme E2D 1 Cytoplasm enzyme UBE2R2 1200003M11Rik, CDC34B, E2-CDC34B, LOC362852, LOC68ubiquitin-conjugating enzyme E2R 2 Other enzyme UBQLN4 A1U, A1Up, AI663987, C1orf6, CIP75, RGD1308273, RP11-33ubiquilin 4 Cytoplasm other UBTF A930005G04RIK, LOC679205, NOR-90, RP23-461C4.7, TCFupstream binding transcription factor, RNA polymerase I Nucleus transcription regulator UCHL1 AW822034, C88048, gad, PARK5, Pgp, PGP 9.5, PGP95, R75ubiquitin carboxyl-terminal esterase L1 (ubiquitin thiolesteraCytoplasm peptidase UGCG AU043821, C80537, CERAMIDE TRANSFERASE, Cgt, Epcs2UDP-glucose ceramide glucosyltransferase Cytoplasm enzyme UHRF2 2310065A22Rik, AI426270, AW214556, D130071B19Rik, DKFubiquitin-like with PHD and ring finger domains 2, E3 ubiquNucleus enzyme USF1 bHLHb11, FCHL, FCHL1, HYPLIP1, MLTF, MLTFI, RP11-544M2upstream transcription factor 1 Nucleus transcription regulator USO1 BOS 6783, MGI:1929095, P115, TAP, Transcytosis associatedUSO1 vesicle transport factor Cytoplasm transporter USP9X 5730589N07Rik, AA407302, AA407699, AL022658, AL022749ubiquitin specific peptidase 9, X-linked Plasma Membrane peptidase VAV1 p95 VAV, VAV vav 1 guanine nucleotide exchange factor Nucleus transcription regulator VCAM1 CD106, INCAM-100, Vcam, VCAM1B, VECAM1 vascular cell adhesion molecule 1 Plasma Membrane transmembrane receptor VCAN 5430420N07RIK, 9430051N09, CHONDROITIN SULFATE PRversican Extracellular Space other VCL 9430097D22, AA571387, AI462105, AW545629, CMD1W, CMHvinculin Plasma Membrane enzyme VDR BOS 5154, NR1I1 vitamin D (1,25- dihydroxyvitamin D3) receptor Nucleus transcription regulator VEGFA BOS 21465, eVEGF120, eVEGF164, Gd-vegf, MVCD1, RP1-2vascular endothelial growth factor A Extracellular Space growth factor VEZT 6330418D12, AI854408, DKFZP434O158, VEZATIN vezatin, adherens junctions transmembrane protein Plasma Membrane other WHSC1 5830445G22Rik, 9430010A17Rik, AW555663, C130020C13RWolf-Hirschhorn syndrome candidate 1 Nucleus enzyme WIF1 AW107799, UNQ191/PRO217 WNT inhibitory factor 1 Extracellular Space other WISP1 AW146261, CCN4, Elm1, WISP1c, WISP1i, WISP1tc WNT1 inducible signaling pathway protein 1 Extracellular Space other WNT1 BMND16, INT1, OI15, sw, swaying, Wg wingless-type MMTV integration site family, member 1 Extracellular Space cytokine WNT11 HWNT11 wingless-type MMTV integration site family, member 11 Extracellular Space other WNT4 RP1-224A6.7, RP23-246F18.1, SERKAL wingless-type MMTV integration site family, member 4 Extracellular Space cytokine WNT6 AA409270 wingless-type MMTV integration site family, member 6 Extracellular Space other WNT7B RP11-435J19.1 wingless-type MMTV integration site family, member 7B Extracellular Space other WT1 AWT1, D630046I19RIK, GUD, NPHS4, RP23-232D1.2, WAGRWilms tumor 1 Nucleus transcription regulator WWTR1 2310058J06Rik, 2610021I22Rik, C78399, DKFZp586I1419, TAZWW domain containing transcription regulator 1 Nucleus transcription regulator XRCC5 AI314015, KARP-1, KU (p70/p80) subunit, KU80, Ku86, KUB2X-ray repair complementing defective repair in Chinese haNucleus enzyme XRCC6 CTA-216E10.7, CTC75, CTCBF, G22P1, KU70, Kup70, ML8,X-ray T repair complementing defective repair in Chinese haNucleus enzyme YAP1 AI325207, YAP, Yap2, YAP65, YKI, Yorkie Yes-associated protein 1 Nucleus transcription regulator YBX1 1700102N10RIK, BOS 3612, BP-8, Byb1, C79409, Cbfa, CSDY box binding protein 1 Nucleus transcription regulator YES1 c-Yes, HsT441, p60c-yes, P61-YES, Yes v-yes-1 Yamaguchi sarcoma viral oncogene homolog 1 Cytoplasm kinase YTHDC2 3010002F02RIK, BC037178, CAHL, LOC100365272, rCG 437YTH domain containing 2 Other other ZBTB33 AW260253, E130014G12Rik, Kaiso, RGD1566309, RP23-322zinc finger and BTB domain containing 33 Nucleus other ZBTB7A 9030619K07RIK, 9130006G12Rik, AI452336, FBI-1, LRF, OCZzinc finger and BTB domain containing 7A Nucleus transcription regulator ZEB1 3110032K11Rik, AREB6, BZP, DELTAEF1, FECD6, MEB1, Nilzinc finger E-box binding homeobox 1 Nucleus transcription regulator ZFP42 LOC100364508, REX1, Zfp42l, Zfp971, ZNF754 ZFP42 zinc finger protein Nucleus transcription regulator Zfp94 zinc finger protein 94 Other other ZFYVE9 E030027L17, hSARA, MADHIP, NSP, RP23-406B13.8, SARA,zinc finger, FYVE domain containing 9 Cytoplasm peptidase ZIC1 ZIC, ZNF201 Zic family member 1 Nucleus transcription regulator ZNF318 2610034E08Rik, D530032D06Rik, HRIHFB2436, LOC683524zinc finger protein 318 Nucleus other ZNF624 5033428C05Rik, KRAB15, mKIAA4196, mkr-3, mszf14, mszf5zinc finger protein 624 Nucleus other © 2000-2014 Ingenuity Systems, Inc. All rights reserved. PTEN interactome

Symbol Synonym(s) Entrez Gene Name Location Family ACTB A-X actin, actin, Actin beta, Actx, beta-actin, BOS 22932, BRWS1, E4actin, beta Cytoplasm other Actin G-actin Cytoplasm group AFF1 9630032B01Rik, AF4, AF4-MLL, AL731554.2, AW319193, MLL/AF4,AF4/FMR2 family, member 1 Nucleus transcription regulator Akt B/Akt, Pkb, RAC-PK Cytoplasm group AKT1 AKT, BOS 20453, CWS6, PKB, PKB-ALPHA, PKB/Akt, PRKBA, Prov-akt murine thymoma viral oncogene homolog 1 Cytoplasm kinase Alpha actin Actin-alpha, Actin-α, α-Actin Cytoplasm group Alpha tubulin TUBULIN alpha, Tubulin alpha chain Cytoplasm group AMHR2 AMHR, MIS receptor, Misiir, MISR2, MISRII, MRII anti-Mullerian hormone receptor, type II Plasma Membrane kinase ANAPC4 2610306D21Rik, APC4, D5ERTD249E anaphase promoting complex subunit 4 Nucleus enzyme ANAPC5 2510006G12Rik, AA408751, AA536819, AA986414, ANAPHASE PRanaphase promoting complex subunit 5 Nucleus enzyme ANAPC7 APC7, AW545589 anaphase promoting complex subunit 7 Nucleus other ANG AI385586, ALS9, Ang1, Ang2, ANGIOGENIN 2, BOS 10502, BRN, angiogenin,H ribonuclease, RNase A family, 5 Extracellular Space enzyme APC (complex) anaphase promoting complex, APC holoprotein, APC-C Cytoplasm complex ARHGAP26 1810044B20RIK, 2610010G17RIK, 4933432P15RIK, AI853435, GRRho GTPase activating protein 26 Cytoplasm other ATF2 CRE-BP, CRE-BP1, CREB2, D130078H02Rik, D18875, HB16, LOCactivating transcription factor 2 Nucleus transcription regulator BAD AI325008, BBC2, BCL2L8 BCL2-associated agonist of cell death Cytoplasm other BAP1 2300006C11Rik, AA989761, AW553466, HUCEP-13, hucep-6, mKIAA0BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolaNucleus peptidase BBC3 JFY-1, PUMA, PUMA/JFY1 BCL2 binding component 3 Cytoplasm other BCAR1 AI385681, CAS, CAS1, CASS1, CRKAS, hCG 1980470, LOC10013breast cancer anti-estrogen resistance 1 Plasma Membrane enzyme BCL6 BCL5, BCL6A, LAZ3, ZBTB27, zinc finger protein 51, ZNF51 B-cell CLL/lymphoma 6 Nucleus transcription regulator BMI1 AW546694, FLVI2/BMI1, PCGF4, RNF51, RP11-573G6.1, RP23-396BMI1 polycomb ring finger oncogene Nucleus transcription regulator CASP3 A830040C14Rik, AC-3, Apopain, Caspase-3, CASPASE-3 p20, CC3caspase 3, apoptosis-related cysteine peptidase Cytoplasm peptidase CASP8 ALPS2B, CAP4, FLICE, MACH, MCH5, PROCASP8 caspase 8, apoptosis-related cysteine peptidase Nucleus peptidase CAV1 BSCL3, Cav, Cavelolin 1, CAVEOLIN, Caveolin1, CGL3, LOC10036caveolin 1, caveolae protein, 22kDa Plasma Membrane transmembrane receptor CBL 4732447J05Rik, C-CBL, Cbl ubiquitin ligase, CBL2, CBLA, FRA11B,Cbl proto-oncogene, E3 ubiquitin protein ligase Nucleus transcription regulator CCNE2 AV063769, CYCE2, RP23-343F17.5 cyclin E2 Nucleus other CDC27 AI452358, ANAPC3, APC3, BC023187, CDC27Hs, D0S1430E, D17cell division cycle 27 Nucleus other CDKN2A Arf, ARF-INK4a, CDK4I, CDKN2, CMM2, CYCLIN-DEPENDENT KINcyclin-dependent kinase inhibitor 2A Nucleus transcription regulator CDX2 CDX-3 caudal type homeobox 2 Nucleus transcription regulator CENPC CENPC1, hcp-4, MIF2 centromere protein C Nucleus other CHGB BOS 13278, Chromogranin b, RP23-77H16.1, SCG1 chromogranin B (secretogranin 1) Extracellular Space other COPS6 CSN6, MOV-34, MOV34-34KD, Sgn3, VIP/MOV34 COP9 signalosome subunit 6 Nucleus other COPZ1 5930435A22Rik, AA407760, CGI-120, COPZ, Copz1 predicted, D4Ertcoatomer protein complex, subunit zeta 1 Cytoplasm transporter CREB1 2310001E10Rik, 3526402H21RIK, AV083133, BOS 2010, CAMP RESPOcAMP responsive element binding protein 1 Nucleus transcription regulator CREBBP AW558298, CBP, CBP/p300, KAT3A, p300/CBP, RSTS, RTS CREB binding protein Nucleus transcription regulator CRKL 1110025F07Rik, AA589403, AI325100, Crkol, mgc94609 v-crk avian sarcoma virus CT10 oncogene homolog-like Cytoplasm kinase CRTC1 AI413414, MECT1, mKIAA0616, R74955, TORC-1, WAMTP1 CREB regulated transcription coactivator 1 Nucleus transcription regulator CSNK2A1 Casein kinase II alpha 1 polypeptide, Ck II Alpha Subunit, CK1 alphacasein kinase 2, alpha 1 polypeptide Cytoplasm kinase CSNK2A2 1110035J23RIK, C77789, CASEIN KINASE 2, Casein kinase II, alphcasein kinase 2, alpha prime polypeptide Cytoplasm kinase CTBP2 AA407280, D7Ertd45e, Gtrgeo6, Ribeye, RP11-59C5.2 C-terminal binding protein 2 Nucleus transcription regulator CUL4B 2700050M05Rik, AA409770, KIAA0695, mKIAA0695, MRXHF2, MRcullin 4B Nucleus other DBF4B ASKL1, CHIFB, DRF1, FLJ13087, UNQ3002, ZDBF1B DBF4 homolog B (S. cerevisiae) Nucleus other DBN1 D0S117E, Drebrin E, DREBRIN E2, RP23-211O9.1 drebrin 1 Cytoplasm other DDB1 AA408517, DDBA, DNA-damage-binding protein 1, p127-Ddb1, UV-Ddamage-specific DNA binding protein 1, 127kDa Nucleus other DLG1 B130052P05Rik, Discs large 1 tumor suppressor, dJ1061C18.1.1, Ddiscs, large homolog 1 (Drosophila) Plasma Membrane kinase DLG4 Dlgh4, PSD-95, RP23-172M21.9, SAP-90, SAP90A discs, large homolog 4 (Drosophila) Plasma Membrane kinase DYNLL2 1700064A15Rik, 6720463E02Rik, C87222, Dlc2, DLC8, DLC8b, DNdynein, light chain, LC8-type 2 Cytoplasm other EEF1A2 Eef1a, EEF1AL, EF-1-alpha-2, EF1A, EF1alpha, Elongation factor 1eukaryotic translation elongation factor 1 alpha 2 Cytoplasm translation regulator EGR1 A530045N19Rik, AT225, Early Growth Response 1, egr, ETR103, Gearly growth response 1 Nucleus transcription regulator EIF2AK2 2310047A08Rik, 4732414G15Rik, AI467567, AI747578, DAI, DOUBLeukaryotic translation initiation factor 2-alpha kinase 2 Cytoplasm kinase EIF4EBP1 4E-BP1, 4EBP, AA959816, BP-1, Eukaryotic translation initiation facteukaryotic translation initiation factor 4E binding protein 1 Cytoplasm translation regulator EPHB1 9330129L11, AW488255, C130099E04Rik, Cek6, Efnb1r, ELK, ELKHEPH receptor B1 Plasma Membrane kinase ERBB2 C-erb-b2, c-neu, CD340, EGFR2, ERBB2 receptor, HER-2, HER-2 v-erb-b2(ER avian erythroblastic leukemia viral oncogene homologPlasma Membrane kinase ERK1/2 p42/44 mapk, P42/p44 erk, p42/p44 MAP KINASE, P42/p44 mapk, p44/p42 MAPK Cytoplasm group EZH2 EHZ2, ENX-1, Enx1h, EZH1, EZH2b, KMT6, KMT6A, mKIAA4065, enhancerW of zeste homolog 2 (Drosophila) Nucleus transcription regulator FABP5 C-FABP, DA11, E-FABP, Fabp epithelial, Fabpe, KFABP, Klbp, mal1,fatty acid binding protein 5 (psoriasis-associated) Cytoplasm transporter FBN2 BC063774, BOS 7829, CCA, DA9, Fib-2, mKIAA4226, RGD1563221fibrillin 2 Extracellular Space other FBXW7 1110001A17Rik, AGO, CDC4, FBW6, FBW7, Fbwd6, FBX30, FBXOF-box and WD repeat domain containing 7, E3 ubiquitin proteinNucleus transcription regulator Focal adhesion kinase FAK Cytoplasm group Foxo Cytoplasm group FRK BSK, BSK/IYK, C85044, GTK, PTK5, RAK fyn-related kinase Nucleus kinase FZR1 AW108046, CDC20C, CDH1, Cdh1/Hct1 homolog, FYR, FZR, FZR2fizzy/cell division cycle 20 related 1 (Drosophila) Nucleus kinase G3BP2 AA409541, E430034L04Rik, G3BP, GTPASE ACTIVATING FACTORGTPase activating protein (SH3 domain) binding protein 2 Nucleus enzyme GFI1 AW495828, GFI1A, Pal-1, SCN2, ZNF163 growth factor independent 1 transcription repressor Nucleus transcription regulator GFRA2 GDNF receptor alpha2, GDNFALPHA-2, GDNFRB, GFRA2 isoformGDNF family receptor alpha 2 Plasma Membrane transmembrane receptor GLTSCR2 5330430H08Rik, 9430097C02Rik, AU041936, AW536441, D1Mgi9,glioma tumor suppressor candidate region gene 2 Cytoplasm other GPR113 Gm1041, hGPCR37, PGR23, UNQ9196 G protein-coupled receptor 113 Plasma Membrane G-protein coupled receptor GRIN1 GluN1, GluRdelta1, GluRzeta1, M100174, MRD8, Nmda nr1, NMDAglutamate receptor, ionotropic, N-methyl D-aspartate 1 Plasma Membrane ion channel GSK3A 2700086H06RIK, Gsk3 alpha glycogen synthase kinase 3 alpha Nucleus kinase GSK3B 7330414F15Rik, 8430431H08Rik, C86142, GSK-3, GSK-3beta, GSK-3glycogen synthase kinase 3 beta Nucleus kinase GSN ADF, AGEL, Gelsolin, Gelsolin plasma isoform, RP11-477J21.1, RP2gelsolin Extracellular Space other HBA1/HBA2 alpha GLOBIN 2, Alpha-2 globin, Alpha-Globin, CD31, Hba, Hba-a1,hemoglobin, alpha 1 Cytoplasm transporter HDAC3 AW537363, HD3, RPD3, RPD3-2 histone deacetylase 3 Nucleus transcription regulator HDAC5 AI426555, HD5, Hdac4, mHDA1, mKIAA0600, NY-CO-9, RP23-461Chistone deacetylase 5 Nucleus transcription regulator HDAC7 5830434K02Rik, HD7, HD7A, HDAC-D, HDAC7A, mFLJ00062 histone deacetylase 7 Nucleus transcription regulator HIF1A AA959795, bHLHe78, HIF-1α, HIF-1α (hydroxylated), HIF1, HIF1-ALhypoxia inducible factor 1, alpha subunit (basic helix-loop-helixNucleus t transcription regulator Histone h3 H3, H3.3, Histone H3B Nucleus group HTR2C 5-HT 2C receptor, 5-HT2C, 5-HT2cR, 5-HTR2C, 5HT-1C, HTR1C, R5-hydroxytryptamine (serotonin) receptor 2C, G protein-coupledPlasma Membrane G-protein coupled receptor INHBE inhibin, beta E Extracellular Space growth factor IRS4 PY160, RP23-415G1.3 insulin receptor substrate 4 Cytoplasm other ITK EMT, EMTTK, LPFS1, LYK, PSCTK2, RP23-273O7.1, Tcsk, Tsk IL2-inducible T-cell kinase Cytoplasm kinase JARID2 JMJ, jumonji jumonji, AT rich interactive domain 2 Nucleus transcription regulator KAT2B A930006P13RIK, AI461839, AW536563, CAF, P/CAF, PCAF, Pcaf-bK(lysine) acetyltransferase 2B Nucleus transcription regulator KDM1A 1810043O07Rik, AA408884, AOF2, BHC110, D4Ertd478e, KDM1, KIlysine (K)-specific demethylase 1A Nucleus enzyme KLF6 Aa1017, AI448727, BCD1, C86813, CBA1, COPEB, CPBP, ErythropKruppel-like factor 6 Nucleus transcription regulator KPNA1 AW494490, IMPORTIN alpha 5, Importin alpha1, IPOA5, KARYOPHkaryopherin alpha 1 (importin alpha 5) Nucleus transporter KPNB1 AA409963, IMB1, Impnb, IMPORTIN 90, Importin Beta 1, IPO1, IPOkaryopherin (importin) beta 1 Nucleus transporter KRT10 BCIE, BIE, CK10, D130054E02RIK, EHK, K10, K1C1, Ka10, Ker59,keratin 10 Cytoplasm other KRT14 50KDA type I EPIDERMAL KERATIN, AI626930, CK14, Cytokeratinkeratin 14 Cytoplasm other LATS1 AW208599, RGD1564085, WARTS, wts large tumor suppressor kinase 1 Nucleus kinase LCK Hck-3, Lck1, Lcktkr, LSK, Lskt, p56Lck, pp58lck, RP23-209C6.8, RP4lymphocyte-specific protein tyrosine kinase Cytoplasm kinase LEPREL4 1110036O03Rik, AI413214, NO55, NOL55, NUCLEOLAR AUTOANTleprecan-like 4 Nucleus other LIMA1 1110021C24Rik, 3526402A12Rik, D15Ertd366e, EPLIN, PP624, SRLIM domain and actin binding 1 Cytoplasm other MAGI Cytoplasm group Magi-Pten Cytoplasm complex MAGI2 Acvri1, ACVRINP1, ACVRIP1, AIP-1, ARIP1, mKIAA0705, S-SCAMmembrane associated guanylate kinase, WW and PDZ domainPlasma Membrane kinase MAGI3 4732496O19Rik, 6530407C02Rik, AA407180, AC162922.3, AI12013membrane associated guanylate kinase, WW and PDZ domainCytoplasm kinase MAN2C1 1110025H24Rik, MAN6A8, MANA, MANA1 mannosidase, alpha, class 2C, member 1 Cytoplasm enzyme MAP2K6 Mapk kinase 6, MAPKK6, MEK6, MKK6, MKK6BE, PRKMK6, Rac, mitogen-activatedR protein kinase kinase 6 Cytoplasm kinase Mapk Map Kinase, NGF/EGF DEPENDENT KINASE Cytoplasm group MAST1 9430008B02Rik, KIAA0973, SAST, SAST170 microtubule associated serine/threonine kinase 1 Cytoplasm kinase MAST2 Mast2 predicted, MAST205, MTSSK, RP23-276M23.5, RP4-533D7.microtubule associated serine/threonine kinase 2 Cytoplasm kinase MAST3 BC024265, LOC684053, mKIAA0561 microtubule associated serine/threonine kinase 3 Other kinase MC1R CMM5, Melanocortin 1 Receptor, MSH-R, Mshra, SHEP2, Tob melanocortin 1 receptor (alpha melanocyte stimulating hormonePlasma Membrane G-protein coupled receptor MCRS1 C78274, ICP22BP, INO80Q, MCRS2, Microspherule protein 1, MSP5microspherule protein 1 Nucleus other MED12 ARC240, CAGH45, FGS1, HOPA, LOC683401, MED12S, Mopa, OHmediator complex subunit 12 Nucleus transcription regulator Mek Erk Kinase, MAP2K, MAPKK, MITOGEN-ASSOCIATED EXTRACELLULAR SIGNAL-REGULATED KINASE, MKK Cytoplasm group MTOR 2610315D21Rik, AI327068, Flat, FRAP, FRAP1, FRAP2, FRB, RAFTmechanistic target of rapamycin (serine/threonine kinase) Nucleus kinase multiple inositol-polyphosp1D-myo-inositol-hexakisphosphate 5-phosphohydrolase, 3.1.3.62, inositol (1,3,4,5)-tetrakisphosphate 3-phosphatase, inositol 1,3,4Other group MVP 2310009M24Rik, LRP, VAULT1 major vault protein Nucleus other MYL2 Beta ml2v, CMH10, Crlc, MLC-2, MLC-2v, Mlv2v, MRLC, MRLC2, Mylmyosin, light chain 2, regulatory, cardiac, slow Cytoplasm other NCOA3 2010305B15RIK, ACTR, AIB-1, AIB1 delta3, AW321064, bHLHe42,nuclear C receptor coactivator 3 Nucleus transcription regulator NDFIP1 0610010M22Rik, MGC10924, N4WBP5, PSEC0192 Nedd4 family interacting protein 1 Cytoplasm other NDFIP2 0710001O20Rik, 2810436B12RIK, 9130207N19Rik, mKIAA1165, N4Nedd4 family interacting protein 2 Cytoplasm other NEDD4 AA959633, AL023035, AU019897, E430025J12Rik, mKIAA0093, NEDneural precursor cell expressed, developmentally down-regulateCytoplasm enzyme NFKB1 EBP-1, KBF1, Nf kappa b DNA binding subunit, NF KAPPA B subuninuclear factor of kappa light polypeptide gene enhancer in B-ceNucleus transcription regulator NFKBIA AI462015, IkappaB alpha, Ikb Kinase Alpha, IKBA, IKBM, IκBα, MADnuclear factor of kappa light polypeptide gene enhancer in B-ceCytoplasm transcription regulator NFKBIB IKappaBbeta, IkB, IKB-beta, IKBB, IκB, TRIP9 nuclear factor of kappa light polypeptide gene enhancer in B-ceNucleus transcription regulator NOTCH1 9930111A19Rik, hN1, lin-12, Mis6, N1, NOTCH, RP23-306D20.12-0notch 1 Plasma Membrane transcription regulator NOTCH2 AGS2, AI853703, HJCYS, hN2, N2 notch 2 Plasma Membrane transcription regulator NR2E1 fierce, frc, Mtl1, Mtll, RP3-429G5.1, tailless, TLL, TLX, XTLL nuclear receptor subfamily 2, group E, member 1 Nucleus ligand-dependent nuclear rece P38 MAPK P38, p38 MAP KINASE, P38 MITOGEN-ACTIVATED protein KINASE Cytoplasm group p85 (pik3r) p85, p85 (pik3r), P85 FROM PIK3R, p85 PI3K, p85 Pi3kinase, PI3K p85 subunit Cytoplasm group PARK7 CAP1, CTA-215D11.1, DJ-1, RP23-272N19.5, SP22 parkinson protein 7 Nucleus enzyme Pdgfr Plasma Membrane group PDGFRA AI115593, APDGFR, BOS 6695, CD140A, PDGFACE, Pdgfar, PDGFplatelet-derived growth factor receptor, alpha polypeptide Plasma Membrane kinase PDGFRB AI528809, CD140B, IBGC4, IMF1, JTK12, PDGF-R-beta, PDGFR, platelet-derivedPD growth factor receptor, beta polypeptide Plasma Membrane kinase phosphatase 3.1.3.-, phosphoric monoester hydrolase, protein phosphatase Other group phosphatidylinositol-3,4,51-phosphatidyl-1D-myo-inositol-3,4,5-trisphosphate 3-phosphohydrolase, 3.1.3.67, phosphatidylinositol-3,4,5-trisphosphate 3-phospOther group phosphatidylinositol-3-ph1-phosphatidyl-1D-myo-inositol-3-phosphate 3-phosphohydrolase, 3-phosphatase activity, 3.1.3.64, D-myo-inositol-1,3-bisphosphaOther group PIK3CA 6330412C24RIK, BOS 1038, caPI3K, CLOVE, CWS5, MCAP, MCM,phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subuniCytoplasm kinase PIK3CB 1110001J02Rik, AI447572, P110BETA, Pi-3-Kinase, p110, Beta Subphosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subuniCytoplasm kinase PIK3R1 AA414921, AGM7, BOS 19690, GRB1, p85, p85 subunit of PI3-kinaphosphoinositide-3-kinase, regulatory subunit 1 (alpha) Cytoplasm kinase PIK3R2 MPPH, p85, p85-BETA, P85B, PI3K p85β, Pi3kr2 phosphoinositide-3-kinase, regulatory subunit 2 (beta) Cytoplasm kinase PINK1 1190006F07Rik, AU042772, AW557854, BRPK, mFLJ00387, PARK6PTEN induced putative kinase 1 Cytoplasm kinase PKN2 6030436C20RIK, AI507382, PAK-2, PRK2, PRKCL2, PRO2042, RP5protein kinase N2 Cytoplasm kinase PLAGL1 AL713985.1, LOT1, RP3-468K18.1, ZAC, ZAC1 pleiomorphic adenoma gene-like 1 Nucleus transcription regulator PLCG1 AI894140, BOS 13285, CDED, NCKAP3, PI-PLCγ1, PIPLC gamma,phospholipase C, gamma 1 Cytoplasm enzyme PPARG CIMT1, GLM1, NR1C3, PPAR gamma 3, PPAR-gamma, Pparg1, PPperoxisome proliferator-activated receptor gamma Nucleus ligand-dependent nuclear rece PPP1CA dism2, PP-1A, Pp-1c, PP1alpha, PP1C alpha, PPP1A, Ppp1c, Proteprotein phosphatase 1, catalytic subunit, alpha isozyme Cytoplasm phosphatase PPP1R10 2610025H06Rik, CAT53, D17ERTD808E, DADB-129D20.4, FB19, proteinp phosphatase 1, regulatory subunit 10 Nucleus other PPP2R4 2610042B21Rik, C77440, N28142, PP2A, PP2A B, PP2A B', PR53,protein phosphatase 2A activator, regulatory subunit 4 Cytoplasm phosphatase PPP3CA 2900074D19Rik, AI841391, AW413465, Calcineurin, Calcineurin A Alprotein phosphatase 3, catalytic subunit, alpha isozyme Cytoplasm phosphatase PRDX1 ENHANCER, Enhancer protein, Hbp23, MSP23, NKEF-A, OSF-3, PAGperoxiredoxin 1 Cytoplasm enzyme PREX2 6230420N16RIK, AI316880, AI553603, C030045D06RIK, D430013K0phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchanCytoplasm other PSMA1 20S PROTEASOME alpha 1 subunit, alpha-type, C2, HC2, Macropaproteasome (prosome, macropain) subunit, alpha type, 1 Cytoplasm peptidase PTEN 10q23del, 2310035O07RIK, A130070J02Rik, AI463227, B430203M1phosphatase and tensin homolog Cytoplasm phosphatase PTK2 BOS 13717, FADK, FAK, FAK related non-kinase, FAK1, FRNK, mKIprotein tyrosine kinase 2 Cytoplasm kinase PTK2B CADTK, CAKB, CAKbeta, E430023O05Rik, FADK2, FAK2, FRNK, proteinPKB, tyrosine kinase 2 beta Cytoplasm kinase PTPase 3.1.3.48, phosphoprotein phosphatase (phosphotyrosine), phosphotyrosine histone phosphatase, phosphotyrosine phosphatase, Cytoplasmp group PTPN14 C130080N23RIK, OTTMUSG00000022087, PEZ, PTP36, PTPD2, proteinR tyrosine phosphatase, non-receptor type 14 Cytoplasm phosphatase PTPN6 HCP, HCPH, HPTP1C, me, motheaten, PTP-1C, Ptph6, SH-PTP1, proteinSH tyrosine phosphatase, non-receptor type 6 Cytoplasm phosphatase PXN AW108311, AW123232, FLJ23042, hCG 1778014, PAX, PAXILLIN paxillin Cytoplasm other QRFPR AQ27, GPR103, SP9155 pyroglutamylated RFamide peptide receptor Plasma Membrane G-protein coupled receptor RAB11B A730055L17RIK, H-YPT3, YPT3 RAB11B, member RAS oncogene family Cytoplasm enzyme RAD51 AV304093, BRCC5, HRAD51, HsRad51, HsT16930, MRMV2, RAD5RAD51 recombinase Nucleus enzyme RB1 OSRC, p105, p105-Rb, p110 RB, pp110, pRb, RB, RB-ASSOCIATEDretinoblastoma 1 Nucleus transcription regulator RBFOX2 2810460A15Rik, AA407676, AI118529, dJ106I20.3, FBM2, FOX2, FRNA binding protein, fox-1 homolog (C. elegans) 2 Nucleus transcription regulator ROCK1 1110055K06Rik, Ac2-154, BOS 11805, LOC100129157, p160 ROCK-1Rho-associated, coiled-coil containing protein kinase 1 Cytoplasm kinase RPL14 3100001N19RIK, 60S ribosomal protein L14, AA407502, AL022816ribosomal, protein L14 Cytoplasm other Rps27a 0610006J14Rik, LOC100363345, RP23-92B18.5, Uba52, Ubb, Ubcribosomal protein S27A Cytoplasm other RPS6KB1 2610318I15RIK, 4732464A07RIK, AA959758, AI256796, AI314060ribosomal, protein S6 kinase, 70kDa, polypeptide 1 Cytoplasm kinase RPS6KB2 KLS, P54, p70 S6 kinase beta, p70(S6K)-beta, P70-beta, P70-beta-1ribosomal protein S6 kinase, 70kDa, polypeptide 2 Cytoplasm kinase S100A4 18A2, 42A, CAPL, FSP1, metastasin, MTS1, P9KA, PEL98, pk9a, PlS100 calcium binding protein A4 Cytoplasm other S100A7 PSOR1, psoriasin 1, S100A7c S100 calcium binding protein A7 Cytoplasm other S100A8 60B8AG, AI323541, B8Ag, CAGA, calgranulin A, CALPROTECTIN,S100 calcium binding protein A8 Cytoplasm other S100A9 60B8AG, AW546964, BEE22, CAGB, calgranulin B, CFAG, CGLB, S100G calcium binding protein A9 Cytoplasm other S1PR2 1100001A16Rik, AGR16, EDG-5, Gpcr13, GPCR18, H218, LPB2, S1sphingosine-1-phosphate receptor 2 Plasma Membrane G-protein coupled receptor SHARPIN 0610041B22RIK, AW121341, Conneck1, cpdm, DKFZP434N1923, SHANK-associatedPSEC RH domain interactor Plasma Membrane other SHC1 p52SHC, p66, p66SHC, RP11-307C12.1, SHC, Shc (46 kDa isoform),SHC (Src homology 2 domain containing) transforming protein Cytoplasm1 kinase SLC9A3R1 EBP-50, NHE-RF, NHERF-1, NPHLOP2, RP23-342L24.4 solute carrier family 9, subfamily A (NHE3, cation proton antiportPlasma Membrane other SLC9A3R2 0610011L07Rik, 1200011K07Rik, 2010007A20Rik, E3KARP, NHE3Rsolute carrier family 9, subfamily A (NHE3, cation proton antiportPlasma Membrane transporter SMAD2 7120426M23RIK, hMAD-2, hSMAD2, JV18, JV18-1, MADH2, MADRSMAD family member 2 Nucleus transcription regulator SMAD3 AU022421, DKFZP586N0721, hMAD-3, HSPC193, HsT17436, JV15SMAD family member 3 Nucleus transcription regulator SMAD4 AW743858, D18Wsu70e, DPC4, JIP, MADH4, MYHRS, Smaug1 SMAD family member 4 Nucleus transcription regulator SMTN smsmo smoothelin Extracellular Space other SMURF2 2810411E22RIK, AI558114, AI649275, RGD1310067, RP23-170A23SMAD specific E3 ubiquitin protein ligase 2 Cytoplasm enzyme SNAI1 AI194338, dJ710H13.1, RP23-118A2.5, SLUGH2, SNA, Sna1, SNAHsnail family zinc finger 1 Nucleus transcription regulator SRC ASV, AW259666, BS27, c-SRC, p60-Src, PP60, Pp60/c-Src, pp60c-src,v-src avian sarcoma (Schmidt-Ruppin A-2) viral oncogene homoCytoplasm kinase STAT5A AA959963, BOS 19069, MGF, pp95, RP23-279L23.4, STAT5, STAT5signal transducer and activator of transcription 5A Nucleus transcription regulator STK11 AA408040, hLKB1, LKB1, LKB1-L, mLKB1, Par-4, PJS, R75140 serine/threonine kinase 11 Cytoplasm kinase STUB1 0610033N24Rik, 2210017D18Rik, 2310040B03RIK, AW046544, CHSTIP1 homology and U-box containing protein 1, E3 ubiquitin proCytoplasm enzyme SUMO3 2810014B19Rik, AA409334, AW121497, AW536077, D10Ertd345e,small ubiquitin-like modifier 3 Nucleus other SUZ12 2610028O16Rik, AI195385, AU016842, AW536442, CHET9, D11ERSUZ12 polycomb repressive complex 2 subunit Nucleus enzyme TCEB3C (includes others)EloA3, HsT828, HsT829, LOC101060468, TCEB3CL, TCEB3CL2, transcriptionT elongation factor B polypeptide 3C (elongin A3) Nucleus other TP63 AI462811, AIS, B(p51A), B(p51B), Delta N p63, Delta N p63 Alpha, tumorEEC protein p63 Nucleus transcription regulator TP73 P73, p73RhoGAP, RP23-254N4.10-001, Trp73 tumor protein p73 Nucleus transcription regulator TTBK2 2610507N02RIK, AI326283, B930008N24Rik, KIAA0847, mKIAA084tau tubulin kinase 2 Other kinase TXN ADF, AW550880, BOS 9316, EOSINOPHIL CYTOTOXICITY FACTOthioredoxin Cytoplasm enzyme UBE2 E2, UBC2, UBIQUITIN CONJUGATING ENZYME E2, UCE2 Cytoplasm group UBE2I 5830467E05Rik, C358B7.1, F830028O17RIK, LA16c-358B7.1, P18,ubiquitin-conjugating enzyme E2I Nucleus enzyme UBE2L3 C79827, E2-F1, L-UBC, Ubce7, UBCH7, UbcM4 ubiquitin-conjugating enzyme E2L 3 Nucleus enzyme UHRF2 2310065A22Rik, AI426270, AW214556, D130071B19Rik, DKFZp43ubiquitin-like4 with PHD and ring finger domains 2, E3 ubiquitin Nucleusp enzyme UTP14A 2700066J21RIK, dJ537K23.3, HIP16, JsdX, mKIAA0266, NY-CO-16UTP14, U3 small nucleolar ribonucleoprotein, homolog A (yeastNucleus other VIM BOS 12844, CTRCT30, PAL-E, RP11-124N14.1, RP23-185P20.1, Vvimentin Cytoplasm other WNT4 RP1-224A6.7, RP23-246F18.1, SERKAL wingless-type MMTV integration site family, member 4 Extracellular Space cytokine WWP1 8030445B08Rik, AIP5, hSDRP1, SDRP1, Tiul1 WW domain containing E3 ubiquitin protein ligase 1 Cytoplasm enzyme WWP2 1300010O06Rik, AA690238, AIP2, AW554328, WWp2-like WW domain containing E3 ubiquitin protein ligase 2 Cytoplasm enzyme XIAP 1110015C02RIK, Aipa, API3, APOPTOSIS INHIBITOR3, BIRC4, hIAP-3X-linked inhibitor of apoptosis Cytoplasm enzyme YKT6 0610042I15Rik, 1810013M05Rik, AW105923, RP23-340E18.4 YKT6 v-SNARE homolog (S. cerevisiae) Cytoplasm enzyme ZEB2 9130203F04RIK, D130016B08RIK, HRIHFB2411, HSPC082, LOC10zinc finger E-box binding homeobox 2 Nucleus transcription regulator ZNF787 2210018M03Rik, RGD1310536, TIP20, Zfp787 zinc finger protein 787 Other other Common list for PTEN and CTNNB1

Symbol Entrez Gene Name Location Type(s) ACTB actin, beta Cytoplasm other AKT1 v-akt murine thymoma viral oncogene homolog 1 Cytoplasm kinase ATF2 activating transcription factor 2 Nucleus transcription regulator BBC3 BCL2 binding component 3 Cytoplasm other CASP3 caspase 3, apoptosis-related cysteine peptidase Cytoplasm peptidase CASP8 caspase 8, apoptosis-related cysteine peptidase Nucleus peptidase CAV1 caveolin 1, caveolae protein, 22kDa Plasma Membrane transmembrane receptor CBL Cbl proto-oncogene, E3 ubiquitin protein ligase Nucleus transcription regulator CCNE2 cyclin E2 Nucleus other CDC27 cell division cycle 27 Nucleus other CDKN2A cyclin-dependent kinase inhibitor 2A Nucleus transcription regulator CDX2 caudal type homeobox 2 Nucleus transcription regulator CREB1 cAMP responsive element binding protein 1 Nucleus transcription regulator CREBBP CREB binding protein Nucleus transcription regulator CSNK2A1 casein kinase 2, alpha 1 polypeptide Cytoplasm kinase CSNK2A2 casein kinase 2, alpha prime polypeptide Cytoplasm kinase DDB1 damage-specific DNA binding protein 1, 127kDa Nucleus other DLG1 discs, large homolog 1 (Drosophila) Plasma Membrane kinase EGR1 early growth response 1 Nucleus transcription regulator ERBB2 v-erb-b2 avian erythroblastic leukemia viral oncogenePlasma Membrane kinase EZH2 enhancer of zeste homolog 2 (Drosophila) Nucleus transcription regulator GLTSCR2 glioma tumor suppressor candidate region gene 2 Cytoplasm other GRIN1 glutamate receptor, ionotropic, N-methyl D-aspartatePlasma Membrane ion channel GSK3B glycogen synthase kinase 3 beta Nucleus kinase HDAC3 histone deacetylase 3 Nucleus transcription regulator HDAC5 histone deacetylase 5 Nucleus transcription regulator HDAC7 histone deacetylase 7 Nucleus transcription regulator HIF1A hypoxia inducible factor 1, alpha subunit (basic helix-lNucleus transcription regulator KAT2B K(lysine) acetyltransferase 2B Nucleus transcription regulator LCK lymphocyte-specific protein tyrosine kinase Cytoplasm kinase LIMA1 LIM domain and actin binding 1 Cytoplasm other MAGI2 membrane associated guanylate kinase, WW and PDPlasma Membrane kinase NCOA3 nuclear receptor coactivator 3 Nucleus transcription regulator NFKB1 nuclear factor of kappa light polypeptide gene enhanNucleus transcription regulator NFKBIA nuclear factor of kappa light polypeptide gene enhanCytoplasm transcription regulator NOTCH1 notch 1 Plasma Membrane transcription regulator PDGFRB platelet-derived growth factor receptor, beta polypeptPlasma Membrane kinase PDGFRB platelet-derived growth factor receptor, beta polypeptPlasma Membrane kinase PIK3CA phosphatidylinositol-4,5-bisphosphate 3-kinase, cataCytoplasm kinase PIK3R1 phosphoinositide-3-kinase, regulatory subunit 1 (alphCytoplasm kinase PKN2 protein kinase N2 Cytoplasm kinase PPARG peroxisome proliferator-activated receptor gamma Nucleus ligand-dependent nuclear receptor PPP3CA protein phosphatase 3, catalytic subunit, alpha isozymeCytoplasm phosphatase PTEN phosphatase and tensin homolog Cytoplasm phosphatase PTPN14 protein tyrosine phosphatase, non-receptor type 14Cytoplasm phosphatase PTPN6 protein tyrosine phosphatase, non-receptor type 6 Cytoplasm phosphatase PXN paxillin Cytoplasm other S100A4 S100 calcium binding protein A4 Cytoplasm other S100A8 S100 calcium binding protein A8 Cytoplasm other SLC9A3R1 solute carrier family 9, subfamily A (NHE3, cation proPlasma Membrane other SLC9A3R2 solute carrier family 9, subfamily A (NHE3, cation proPlasma Membrane transporter SMAD2 SMAD family member 2 Nucleus transcription regulator SMAD3 SMAD family member 3 Nucleus transcription regulator SMAD4 SMAD family member 4 Nucleus transcription regulator SNAI1 snail family zinc finger 1 Nucleus transcription regulator SRC v-src avian sarcoma (Schmidt-Ruppin A-2) viral oncoCytoplasm kinase SUZ12 SUZ12 polycomb repressive complex 2 subunit Nucleus enzyme TP63 tumor protein p63 Nucleus transcription regulator UHRF2 ubiquitin-like with PHD and ring finger domains 2, E3Nucleus enzyme Conde_TableS2

NRAS NRAS-ΔPTEN

Hairy skin 86.2% (25/29) 82.5% (52/63)

Pinnae 3.4% (1/29) 9.5% (6/63)

Tail or paw 6.9% (2/29) 3.2% (2/63)

Mucosa 3.4% (1/29) 4.8% (3/63)

Table S1 NEW5 NRAS MEL8 NRAS MEL17 pten MEL18 pten miRNA Int Int Int Int mmu-let-7a 24928,1 21008,5 25549,8 39098,1 mmu-let-7a* 42,4 56,1 56,5 72,5 mmu-let-7b 15837,1 14316,8 20446,8 24395,3 mmu-let-7b* 13,6 14,9 14,4 49,2 mmu-let-7c 22573,5 17042,9 26090,0 32803,8 mmu-let-7c-1* 20,4 23,3 27,2 53,7 mmu-let-7d 8182,0 5989,0 7186,9 9814,1 mmu-let-7d* 32,1 30,3 33,0 82,8 mmu-let-7e 3172,2 2743,3 2962,3 6789,2 mmu-let-7f 26535,5 20209,0 22341,0 35190,7 mmu-let-7f* 12,7 13,5 12,9 32,5 mmu-let-7g 6785,6 4931,8 8012,0 11118,2 mmu-let-7g* 13,6 15,2 15,9 24,0 mmu-let-7i 7760,0 9145,9 10240,3 13263,3 mmu-let-7i* 12,5 13,3 14,0 19,5 mmu-miR-1 4574,1 1226,5 12,2 16,5 mmu-miR-100 371,2 855,0 1225,5 1807,5 mmu-miR-101a 675,6 308,3 498,7 876,5 mmu-miR-101a* 13,9 15,5 12,2 9,7 mmu-miR-101b 217,1 170,3 184,4 233,9 mmu-miR-103 1853,3 1643,7 2722,8 3042,9 mmu-miR-105 11,0 12,7 11,8 19,7 mmu-miR-106a 75,2 99,1 66,1 102,8 mmu-miR-106b 721,9 1708,4 1437,8 2008,0 mmu-miR-106b* 29,4 46,3 30,5 38,3 mmu-miR-107 2309,7 1910,2 3473,5 4481,9 mmu-miR-10a 217,0 2330,3 224,7 4474,3 mmu-miR-10a* 21,2 47,3 18,6 38,7 mmu-miR-10b 401,4 1254,9 326,1 1206,4 mmu-miR-10b* 18,0 30,3 13,7 9,0 mmu-miR-122 13,8 15,7 12,5 11,9 mmu-miR-1224 3391,9 4548,3 16344,0 2940,5 mmu-miR-124 23,4 15,4 13,2 7,2 mmu-miR-124* 12,8 13,0 13,4 12,3 mmu-miR-125a-3p 126,9 189,9 198,5 83,7 mmu-miR-125a-5p 980,0 1712,7 1109,6 1894,3 mmu-miR-125b* 15,7 21,3 14,3 16,4 mmu-miR-125b-3p 13,1 14,8 19,1 5,8 mmu-miR-125b-5p 12468,0 35065,0 19425,1 29805,5 mmu-miR-126-3p 1262,1 4592,6 2565,1 2924,8 mmu-miR-126-5p 96,8 264,5 116,8 105,9 mmu-miR-127 35,5 412,2 16,8 59,6 mmu-miR-127* 12,6 14,2 12,0 8,0 mmu-miR-128 368,1 88,0 198,0 132,6 mmu-miR-129-3p 535,2 30,0 12,3 37,9 mmu-miR-129-5p 101,5 21,6 20,9 20,9 mmu-miR-130a 1306,5 1935,5 3041,5 3023,6 mmu-miR-130b 574,5 107,0 353,3 214,8 mmu-miR-130b* 106,5 20,1 24,7 46,6 mmu-miR-132 32,6 1235,1 205,1 38,0 mmu-miR-133a 1243,8 398,8 13,5 22,3 mmu-miR-133a* 64,0 27,1 10,6 3,8 mmu-miR-133b 2095,3 716,9 13,4 25,5 mmu-miR-134 34,3 80,1 117,9 25,9 mmu-miR-135a 12,1 77,6 11,6 21,5 mmu-miR-135a* 78,7 137,2 186,1 191,6 mmu-miR-135b 11,0 16,2 11,4 21,9 mmu-miR-136 15,4 102,2 14,6 31,7 mmu-miR-136* 11,9 26,5 11,7 12,5 mmu-miR-137 10,9 12,6 10,7 3,9 mmu-miR-138 820,1 30,7 56,0 25,5 mmu-miR-138* 125,3 28,0 29,8 20,7 mmu-miR-139-3p 100,6 283,8 683,9 99,4 mmu-miR-139-5p 70,5 194,3 115,2 104,3 mmu-miR-140 352,4 1016,5 722,9 845,6 mmu-miR-140* 439,6 1474,0 709,0 742,6 mmu-miR-141 27,4 64,7 17,5 26,7 mmu-miR-141* 12,2 15,4 12,1 11,2 mmu-miR-142-3p 411,3 2534,5 1037,1 396,6 mmu-miR-142-5p 74,2 313,6 132,2 54,5 mmu-miR-143 200,8 369,0 452,8 529,8 mmu-miR-144 101,7 14,1 572,1 31,9 mmu-miR-145 44,3 70,0 41,1 47,2 mmu-miR-145* 12,0 13,1 12,6 17,5 mmu-miR-146a 3609,8 3169,3 278,6 407,2 mmu-miR-146b 159,6 356,0 50,6 162,8 mmu-miR-146b* 11,6 12,7 11,5 7,4 mmu-miR-147 11,2 11,5 11,7 6,8 mmu-miR-148a 123,1 620,4 120,5 111,6 mmu-miR-148a* 11,3 16,5 11,6 12,5 mmu-miR-148b 275,3 159,2 282,1 222,2 mmu-miR-149 767,6 177,5 487,7 992,8 mmu-miR-150 62,3 163,5 23,0 38,2 mmu-miR-150* 23,7 33,0 21,6 12,3 mmu-miR-151-3p 19,2 21,8 18,2 16,1 mmu-miR-151-5p 1207,6 935,7 929,1 1284,0 mmu-miR-152 439,6 887,1 471,3 413,9 mmu-miR-153 54,1 64,4 10,5 3,9 mmu-miR-154 13,6 64,5 11,8 39,6 mmu-miR-154* 11,2 51,9 11,6 17,9 mmu-miR-155 134,7 298,1 112,0 111,5 mmu-miR-15a 2910,0 5602,2 6208,9 6426,4 mmu-miR-15a* 12,5 14,9 12,8 17,1 mmu-miR-15b 4821,8 6355,1 7469,8 8677,8 mmu-miR-15b* 41,0 46,9 38,1 46,6 mmu-miR-16 6253,7 8582,8 9970,6 10660,6 mmu-miR-16* 15,2 19,9 12,1 11,4 mmu-miR-17 82,5 111,1 73,1 115,8 mmu-miR-17* 82,9 123,0 81,1 171,8 mmu-miR-181a 941,3 473,3 608,8 2229,5 mmu-miR-181a-1* 62,2 49,6 85,2 189,9 mmu-miR-181a-2* 11,0 11,4 12,9 31,6 mmu-miR-181b 445,8 267,1 347,9 902,9 mmu-miR-181c 112,6 174,5 209,4 451,5 mmu-miR-181d 73,3 269,8 185,8 346,0 mmu-miR-182 20,2 37,4 11,9 20,1 mmu-miR-183 22,7 43,3 11,8 18,6 mmu-miR-183* 14,1 17,2 16,0 9,2 mmu-miR-184 24,1 44,6 17,2 11,4 mmu-miR-185 256,3 204,4 261,1 457,5 mmu-miR-186 170,3 88,1 126,7 121,0 mmu-miR-186* 20,4 21,1 28,0 22,5 mmu-miR-187 11,8 12,9 12,7 1,9 mmu-miR-188-3p 23,2 20,3 16,2 12,6 mmu-miR-188-5p 142,4 201,0 815,5 188,4 mmu-miR-18a 52,3 155,5 109,9 92,9 mmu-miR-18a* 14,7 19,2 15,5 36,6 mmu-miR-18b 11,3 13,0 11,1 8,9 mmu-miR-190 12,3 13,5 13,3 9,1 mmu-miR-190b 18,7 14,3 10,8 9,7 mmu-miR-191 27,9 31,5 21,3 16,9 mmu-miR-191* 21,9 23,8 24,9 47,8 mmu-miR-192 96,7 49,7 113,9 139,0 mmu-miR-193 26,6 366,5 53,7 52,8 mmu-miR-193* 17,9 46,5 14,7 7,5 mmu-miR-193b 393,4 522,4 135,3 766,3 mmu-miR-194 86,8 35,9 82,7 104,3 mmu-miR-195 655,9 1040,8 5926,4 9625,3 mmu-miR-196a 91,9 1037,7 23,3 372,8 mmu-miR-196a* 11,6 12,6 11,7 11,1 mmu-miR-196b 39,7 674,0 18,8 69,5 mmu-miR-197 25,6 34,2 24,3 58,1 mmu-miR-199a-3p 1318,6 17659,4 1475,9 1201,3 mmu-miR-199a-5p 298,3 5449,6 374,8 291,7 mmu-miR-199b* 397,7 5805,3 460,0 400,4 mmu-miR-19a 62,5 144,7 129,6 129,6 mmu-miR-19a* 10,8 11,0 11,3 7,9 mmu-miR-19b 742,0 1356,3 955,4 1725,4 mmu-miR-200a 48,4 84,1 12,2 49,2 mmu-miR-200a* 19,4 31,5 14,1 12,1 mmu-miR-200b 79,1 160,6 14,0 79,6 mmu-miR-200b* 18,5 25,3 15,5 10,8 mmu-miR-200c 76,6 185,4 26,6 74,1 mmu-miR-200c* 12,4 12,3 12,6 14,4 mmu-miR-201 19,6 13,2 12,6 64,9 mmu-miR-202-3p 253,2 515,1 464,9 392,1 mmu-miR-202-5p 11,1 10,5 11,7 15,3 mmu-miR-203 536,6 1344,7 13,6 466,8 mmu-miR-203* 18,3 28,8 11,1 18,8 mmu-miR-204 166,2 19,6 2035,7 774,5 mmu-miR-205 472,2 1479,1 13,5 377,5 mmu-miR-206 46,1 168,9 14,7 11,4 mmu-miR-207 24,7 25,9 12,4 25,0 mmu-miR-208a 10,0 10,1 10,7 3,0 mmu-miR-208b 42,1 39,2 11,7 1,5 mmu-miR-20a 582,4 907,4 637,7 1137,7 mmu-miR-20a* 21,9 20,6 21,6 39,5 mmu-miR-20b 325,6 538,0 371,5 670,8 mmu-miR-20b* 11,1 12,2 10,4 9,3 mmu-miR-21 14216,2 128520,0 12746,5 13063,6 mmu-miR-21* 15,2 73,6 17,9 15,4 mmu-miR-210 414,1 104,9 1813,9 216,0 mmu-miR-211 6370,5 68,2 5353,3 2211,0 mmu-miR-212 103,9 305,0 96,7 55,4 mmu-miR-214 197,9 4491,3 313,7 175,8 mmu-miR-214* 15,1 174,1 17,1 14,0 mmu-miR-215 14,9 16,5 12,5 14,4 mmu-miR-216a 11,4 15,8 12,0 9,5 mmu-miR-216b 11,2 18,8 12,5 4,8 mmu-miR-217 13,4 18,8 12,1 8,6 mmu-miR-218 72,3 343,9 35,4 36,6 mmu-miR-218-1* 13,2 15,3 12,3 19,2 mmu-miR-218-2* 13,0 13,4 12,7 3,8 mmu-miR-219 21,5 21,3 26,4 22,5 mmu-miR-22 6203,2 9190,4 15026,4 10177,9 mmu-miR-22* 133,7 192,4 257,6 148,0 mmu-miR-220 10,8 9,5 11,2 1,9 mmu-miR-221 198,3 1301,5 144,8 309,1 mmu-miR-222 76,4 454,6 40,9 53,1 mmu-miR-223 1203,8 7160,1 3643,8 785,2 mmu-miR-224 104,0 192,3 100,9 84,5 mmu-miR-23a 22314,4 13353,5 23417,0 36897,2 mmu-miR-23b 11877,5 5171,4 16948,3 22448,5 mmu-miR-24 12970,9 6775,3 17815,8 21594,4 mmu-miR-24-1* 111,1 65,1 328,6 263,2 mmu-miR-24-2* 335,5 206,9 549,0 595,6 mmu-miR-25 1089,2 3038,6 1454,9 2396,2 mmu-miR-26a 10909,2 6935,3 9640,1 15307,6 mmu-miR-26b 3993,4 2967,5 3757,9 6781,3 mmu-miR-26b* 17,6 18,2 17,5 32,9 mmu-miR-27a 6250,0 5683,3 11527,3 13499,5 mmu-miR-27a* 12,2 14,4 14,2 9,8 mmu-miR-27b 3841,8 2273,7 7684,1 8094,5 mmu-miR-27b* 19,2 17,4 19,8 13,2 mmu-miR-28 147,3 280,5 212,9 339,7 mmu-miR-28* 24,9 46,0 25,4 23,8 mmu-miR-290-3p 13,1 13,5 13,1 29,5 mmu-miR-290-5p 101,8 107,4 113,3 86,8 mmu-miR-291a-3p 11,0 11,0 11,2 19,9 mmu-miR-291a-5p 14,3 17,1 32,5 10,2 mmu-miR-291b-3p 10,9 11,1 11,5 19,0 mmu-miR-291b-5p 17,8 23,9 19,7 15,4 mmu-miR-292-3p 12,2 13,0 12,5 19,8 mmu-miR-292-5p 23,3 28,9 38,5 34,4 mmu-miR-293 10,5 11,3 11,7 14,3 mmu-miR-293* 10,6 10,7 11,2 9,9 mmu-miR-294 12,0 12,7 12,1 51,6 mmu-miR-294* 14,2 17,6 54,6 13,4 mmu-miR-295 10,7 10,9 11,4 16,5 mmu-miR-295* 20,1 29,4 16,2 16,3 mmu-miR-296-3p 12,4 13,6 12,9 7,6 mmu-miR-296-5p 19,1 42,6 38,1 39,7 mmu-miR-297a* 14,4 27,2 11,7 20,9 mmu-miR-297b-5p 11,6 11,5 11,4 6,4 mmu-miR-297c 11,9 16,5 11,8 8,0 mmu-miR-298 13,1 13,3 12,9 28,5 mmu-miR-299 11,5 18,6 11,3 3,7 mmu-miR-299* 17,3 279,1 14,3 60,5 mmu-miR-29a 17954,8 11261,2 8956,1 80278,6 mmu-miR-29a* 75,1 45,3 24,1 132,4 mmu-miR-29b 6029,2 3553,3 3096,1 23488,7 mmu-miR-29b* 119,0 132,2 96,5 523,6 mmu-miR-29c 3162,4 2123,5 2042,9 12058,6 mmu-miR-29c* 59,7 32,8 50,0 82,5 mmu-miR-300 19,2 202,9 20,0 34,5 mmu-miR-300* 12,5 18,2 14,8 14,8 mmu-miR-301a 222,7 166,5 599,7 358,8 mmu-miR-301b 40,0 14,9 39,3 15,9 mmu-miR-302a 11,8 12,5 11,6 20,8 mmu-miR-302a* 11,5 12,6 11,4 15,9 mmu-miR-302b 11,5 11,8 11,9 19,0 mmu-miR-302b* 11,6 11,1 10,8 9,9 mmu-miR-302c 11,8 12,0 12,3 20,2 mmu-miR-302c* 22,9 15,8 12,0 16,3 mmu-miR-302d 10,4 12,0 11,7 13,2 mmu-miR-30a 4179,5 1027,2 9351,4 7105,4 mmu-miR-30a* 512,9 91,7 1083,4 749,7 mmu-miR-30b 2958,2 1613,7 3270,2 4752,2 mmu-miR-30b* 28,4 27,9 47,8 70,5 mmu-miR-30c 8039,6 2146,0 7107,6 12583,1 mmu-miR-30c-1* 26,0 25,8 31,6 51,0 mmu-miR-30c-2* 55,0 29,8 107,1 93,3 mmu-miR-30d 2268,7 1369,5 4260,3 6397,9 mmu-miR-30e 1252,9 722,7 2709,5 6334,7 mmu-miR-30e* 382,1 141,6 832,3 1532,8 mmu-miR-31 62,6 6034,6 14,8 788,9 mmu-miR-31* 22,2 1242,0 12,3 220,6 mmu-miR-32 24,3 21,1 47,5 34,7 mmu-miR-320 136,1 195,0 136,4 122,0 mmu-miR-322 457,8 2227,2 1190,5 756,4 mmu-miR-322* 26,0 36,4 29,8 17,5 mmu-miR-323-3p 10,7 15,4 10,6 5,0 mmu-miR-323-5p 12,6 11,6 10,8 4,9 mmu-miR-324-3p 158,8 179,2 129,8 169,3 mmu-miR-324-5p 279,3 178,7 437,3 351,5 mmu-miR-325 11,2 10,6 11,7 21,7 mmu-miR-325* 11,4 11,1 12,5 10,4 mmu-miR-326 266,0 87,7 332,7 453,2 mmu-miR-327 19,4 27,7 19,6 7,3 mmu-miR-328 90,0 36,6 78,2 135,1 mmu-miR-329 19,6 138,5 14,8 64,5 mmu-miR-33 25,9 21,5 42,0 43,5 mmu-miR-33* 13,3 13,3 12,2 13,7 mmu-miR-330 11,8 12,2 13,1 15,3 mmu-miR-330* 25,0 29,8 34,1 20,7 mmu-miR-331-3p 409,4 296,8 521,8 636,7 mmu-miR-331-5p 12,6 14,2 12,5 2,1 mmu-miR-335-3p 29,1 135,2 32,2 30,6 mmu-miR-335-5p 167,2 291,3 365,5 50,4 mmu-miR-337-3p 13,0 49,5 13,2 25,9 mmu-miR-337-5p 15,3 87,3 13,4 17,3 mmu-miR-338-3p 49,8 123,9 222,0 84,0 mmu-miR-338-5p 64,0 149,4 21,3 21,2 mmu-miR-339-3p 14,6 18,6 26,0 7,9 mmu-miR-339-5p 14,7 17,4 14,9 6,8 mmu-miR-340-3p 122,8 143,5 196,2 240,4 mmu-miR-340-5p 92,7 305,5 231,9 127,7 mmu-miR-341 26,0 55,8 62,1 31,3 mmu-miR-342-3p 643,0 2135,8 534,9 364,7 mmu-miR-342-5p 20,4 47,3 19,5 13,7 mmu-miR-343 11,6 13,6 11,5 21,0 mmu-miR-344 11,7 15,0 12,3 13,6 mmu-miR-345-3p 14,2 19,4 21,1 3,7 mmu-miR-345-5p 198,4 250,1 521,1 386,3 mmu-miR-346 13,8 32,8 12,7 29,4 mmu-miR-34a 4832,6 1591,6 292,6 4908,1 mmu-miR-34b-3p 131,0 155,6 13,7 33,2 mmu-miR-34b-5p 490,8 654,1 40,2 78,5 mmu-miR-34c 433,8 646,0 42,8 50,2 mmu-miR-34c* 79,7 71,7 16,9 10,3 mmu-miR-350 822,2 905,9 1111,0 1283,1 mmu-miR-351 22,7 38,6 22,1 29,2 mmu-miR-361 446,1 256,9 467,6 635,4 mmu-miR-362-3p 313,6 247,0 213,9 259,3 mmu-miR-362-5p 66,9 60,6 72,5 69,0 mmu-miR-363 11,4 13,2 14,2 13,5 mmu-miR-365 504,5 1913,8 304,7 979,1 mmu-miR-367 11,9 14,7 11,6 10,6 mmu-miR-369-3p 10,7 15,2 11,6 8,7 mmu-miR-369-5p 12,0 28,9 12,1 27,8 mmu-miR-370 66,1 110,1 225,6 51,1 mmu-miR-374 88,1 104,9 114,6 105,5 mmu-miR-374* 11,5 12,1 13,0 12,8 mmu-miR-375 14,1 15,0 9,9 5,3 mmu-miR-376a 13,8 115,7 14,5 23,7 mmu-miR-376a* 12,0 16,1 11,2 17,2 mmu-miR-376b 12,4 60,8 12,4 13,6 mmu-miR-376b* 11,9 33,4 11,6 18,9 mmu-miR-376c 13,9 124,2 12,2 10,7 mmu-miR-376c* 10,6 10,6 12,5 17,4 mmu-miR-377 11,9 56,3 13,1 16,5 mmu-miR-378 804,5 339,5 234,6 679,3 mmu-miR-378* 121,2 50,3 36,0 106,3 mmu-miR-379 25,7 521,5 20,0 57,1 mmu-miR-380-3p 11,3 24,7 11,9 16,2 mmu-miR-380-5p 11,5 12,1 12,7 4,0 mmu-miR-381 12,7 48,8 12,4 15,3 mmu-miR-382 21,9 102,8 14,3 28,2 mmu-miR-382* 11,3 25,5 13,1 18,5 mmu-miR-383 50,5 117,5 12,4 11,8 mmu-miR-384-3p 10,8 11,2 11,8 5,1 mmu-miR-384-5p 10,5 10,2 12,8 9,0 mmu-miR-409-3p 15,1 57,9 11,3 13,2 mmu-miR-409-5p 12,4 32,8 12,0 17,0 mmu-miR-410 13,8 67,9 14,2 21,5 mmu-miR-411 14,5 121,3 12,8 18,4 mmu-miR-411* 12,9 67,4 13,0 29,1 mmu-miR-412 12,3 13,4 13,7 16,3 mmu-miR-421 28,7 40,4 44,7 13,3 mmu-miR-423-3p 22,6 31,1 25,9 24,2 mmu-miR-423-5p 121,1 226,6 159,1 107,1 mmu-miR-425 142,4 239,6 214,0 225,0 mmu-miR-425* 15,6 16,5 17,3 16,5 mmu-miR-429 44,4 77,8 12,4 50,3 mmu-miR-431 14,3 39,2 14,2 19,2 mmu-miR-431* 16,1 24,8 13,2 16,3 mmu-miR-433 12,1 25,8 11,6 14,6 mmu-miR-433* 13,6 19,1 14,1 25,6 mmu-miR-434-3p 22,0 263,5 16,7 61,2 mmu-miR-434-5p 13,1 76,4 12,5 19,2 mmu-miR-448 10,4 10,4 11,6 5,4 mmu-miR-449a 19,0 45,4 11,2 20,8 mmu-miR-449b 12,3 13,0 10,9 8,8 mmu-miR-449c 11,7 12,0 12,1 4,8 mmu-miR-450a-3p 16,1 24,0 70,7 10,1 mmu-miR-450a-5p 95,2 190,7 102,8 44,2 mmu-miR-450b-3p 28,1 44,7 37,7 12,9 mmu-miR-450b-5p 16,6 21,6 21,0 11,7 mmu-miR-451 8173,9 413,3 53271,9 3428,2 mmu-miR-452 50,0 96,0 46,4 19,3 mmu-miR-453 11,7 11,5 12,5 9,2 mmu-miR-455 33,5 363,5 90,3 52,7 mmu-miR-455* 12,2 57,6 20,5 22,5 mmu-miR-463 10,7 11,5 11,2 5,8 mmu-miR-463* 12,2 11,1 12,0 18,4 mmu-miR-464 10,8 11,7 11,9 8,5 mmu-miR-465a-3p 12,0 13,0 12,6 13,4 mmu-miR-465a-5p 11,2 12,1 11,3 4,9 mmu-miR-465b-5p 13,5 14,3 11,1 8,9 mmu-miR-465c-5p 11,6 11,9 10,9 6,2 mmu-miR-466a-3p 19,1 97,9 16,2 51,1 mmu-miR-466a-5p 11,3 12,4 11,3 4,1 mmu-miR-466b-5p 11,9 13,4 10,5 4,5 mmu-miR-466c-5p 69,1 126,4 26,9 17,3 mmu-miR-466d-3p 15,3 22,9 12,8 15,2 mmu-miR-466d-5p 10,3 10,0 10,9 1,0 mmu-miR-466f-3p 134,7 296,2 42,0 30,3 mmu-miR-466f-5p 13,4 16,3 11,6 3,3 mmu-miR-466g 107,9 225,8 25,4 19,7 mmu-miR-466h 16,2 24,2 12,7 14,9 mmu-miR-467a 13,0 41,4 13,9 20,5 mmu-miR-467a* 54,8 150,9 19,3 56,2 mmu-miR-467b 17,6 118,7 18,2 68,3 mmu-miR-467b* 43,2 90,5 13,5 20,7 mmu-miR-467c 14,0 30,6 13,6 17,0 mmu-miR-467d 11,7 11,7 11,4 2,3 mmu-miR-467e 16,8 46,9 13,7 37,5 mmu-miR-467e* 35,1 74,7 13,4 21,7 mmu-miR-468 39,9 71,2 16,7 29,2 mmu-miR-469 10,7 11,4 12,1 22,1 mmu-miR-470 14,7 18,8 14,1 12,9 mmu-miR-470* 25,3 39,2 18,8 17,7 mmu-miR-471 10,7 11,4 11,0 14,9 mmu-miR-483 115,0 211,6 300,7 94,2 mmu-miR-483* 24,1 27,4 18,2 37,8 mmu-miR-484 129,5 129,7 210,6 210,0 mmu-miR-485 11,7 16,9 10,7 11,8 mmu-miR-485* 14,6 19,1 12,1 27,0 mmu-miR-486 179,2 60,1 654,8 65,9 mmu-miR-487b 42,4 86,6 13,4 19,0 mmu-miR-488 11,6 12,2 11,3 20,5 mmu-miR-488* 10,8 12,1 11,4 7,8 mmu-miR-489 11,2 12,7 12,7 5,9 mmu-miR-490 14,2 16,7 16,3 7,7 mmu-miR-491 15,1 15,5 14,0 19,3 mmu-miR-493 12,5 17,7 15,4 7,8 mmu-miR-494 1210,1 2858,4 1890,4 1004,8 mmu-miR-495 13,0 38,9 12,9 13,1 mmu-miR-496 12,0 50,4 11,8 12,2 mmu-miR-497 233,0 513,8 4942,0 6585,1 mmu-miR-499 11,6 11,3 12,1 8,7 mmu-miR-500 507,6 362,7 337,9 324,3 mmu-miR-501-3p 29,5 21,1 19,5 8,7 mmu-miR-501-5p 21,1 18,8 17,6 13,8 mmu-miR-503 33,3 166,4 63,1 22,5 mmu-miR-503* 13,4 14,2 12,6 11,4 mmu-miR-504 11,3 11,9 11,9 21,7 mmu-miR-505 24,9 17,4 24,6 33,0 mmu-miR-509-3p 11,7 11,8 11,3 10,1 mmu-miR-509-5p 11,0 11,9 10,9 9,2 mmu-miR-511 12,2 26,1 11,7 25,1 mmu-miR-532-3p 111,4 65,1 49,9 68,9 mmu-miR-532-5p 360,2 177,8 153,3 239,5 mmu-miR-539 11,1 15,1 11,1 18,1 mmu-miR-540-3p 12,6 15,9 12,8 10,5 mmu-miR-540-5p 11,5 11,5 11,8 25,0 mmu-miR-541 12,4 123,3 11,9 16,1 mmu-miR-542-3p 37,8 60,5 58,7 16,1 mmu-miR-542-5p 32,6 40,5 46,5 19,7 mmu-miR-543 11,6 23,2 12,2 11,6 mmu-miR-544 11,0 10,9 11,1 8,6 mmu-miR-546 20,0 28,3 49,4 11,6 mmu-miR-547 17,9 13,4 11,1 39,9 mmu-miR-551b 12,5 12,0 13,1 25,8 mmu-miR-568 10,7 11,5 11,2 5,7 mmu-miR-574-3p 122,6 202,3 39,1 55,8 mmu-miR-574-5p 670,0 1266,3 316,6 98,3 mmu-miR-582-3p 11,2 11,8 11,4 11,1 mmu-miR-582-5p 192,3 129,2 281,6 345,2 mmu-miR-590-3p 11,7 11,5 11,4 6,1 mmu-miR-590-5p 11,6 12,9 11,9 6,1 mmu-miR-592 10,8 12,6 12,7 8,7 mmu-miR-598 24,0 12,5 11,8 16,5 mmu-miR-615-3p 14,0 24,0 12,4 36,4 mmu-miR-615-5p 11,0 12,9 12,6 5,3 mmu-miR-652 816,7 855,0 893,2 931,6 mmu-miR-653 10,3 9,7 12,8 10,3 mmu-miR-654-3p 11,4 13,1 12,1 24,0 mmu-miR-654-5p 10,9 11,8 11,1 3,6 mmu-miR-665 11,2 15,7 12,9 4,1 mmu-miR-666-3p 11,7 13,6 11,5 11,2 mmu-miR-666-5p 18,0 23,9 22,4 11,0 mmu-miR-667 18,3 28,3 20,2 18,1 mmu-miR-668 13,0 17,5 15,0 27,7 mmu-miR-669a 33,0 99,8 16,4 51,6 mmu-miR-669b 26,3 64,3 15,4 16,2 mmu-miR-669c 188,2 349,0 31,2 41,4 mmu-miR-670 14,8 19,1 10,9 5,8 mmu-miR-671-3p 14,4 17,1 13,2 8,5 mmu-miR-671-5p 72,8 129,6 436,4 55,3 mmu-miR-672 25,1 43,0 13,5 14,1 mmu-miR-673-3p 12,0 13,6 12,8 7,8 mmu-miR-673-5p 13,0 13,2 13,1 15,2 mmu-miR-674 34,2 63,2 48,7 46,4 mmu-miR-674* 131,2 240,9 260,2 299,4 mmu-miR-675-3p 12,0 12,2 10,8 23,9 mmu-miR-675-5p 11,5 11,8 11,8 6,4 mmu-miR-676 89,5 58,9 40,6 85,9 mmu-miR-676* 13,5 12,7 11,0 20,1 mmu-miR-677 13,1 26,1 22,9 13,4 mmu-miR-678 32,7 69,0 49,3 24,2 mmu-miR-679 12,1 12,2 12,1 9,0 mmu-miR-680 146,8 178,3 274,4 108,3 mmu-miR-681 36,1 74,9 50,1 15,5 mmu-miR-682 16,1 27,3 15,5 12,1 mmu-miR-683 11,1 12,3 11,0 19,2 mmu-miR-684 10,7 11,3 10,4 13,2 mmu-miR-685 30,5 50,1 425,8 19,7 mmu-miR-686 19,6 26,4 15,4 6,7 mmu-miR-687 13,1 15,3 11,9 4,8 mmu-miR-688 12,1 13,9 11,3 18,9 mmu-miR-689 357,2 413,0 1962,9 378,6 mmu-miR-690 1476,8 6408,8 1521,3 963,9 mmu-miR-691 25,3 42,4 38,4 9,2 mmu-miR-692 12,8 12,8 12,0 10,1 mmu-miR-693-3p 11,8 11,7 12,4 9,1 mmu-miR-693-5p 11,3 12,6 11,4 18,5 mmu-miR-694 11,2 12,2 14,0 7,8 mmu-miR-695 13,3 14,2 12,1 8,9 mmu-miR-696 15,4 21,9 16,5 11,9 mmu-miR-697 53,8 114,6 112,1 80,1 mmu-miR-698 11,1 11,4 10,4 23,2 mmu-miR-699 14,4 18,9 11,9 5,1 mmu-miR-700 31,9 34,1 40,7 43,0 mmu-miR-701 13,9 29,7 20,3 13,5 mmu-miR-702 17,4 20,1 17,6 45,5 mmu-miR-703 37,2 52,7 22,7 16,0 mmu-miR-704 11,7 12,3 11,0 13,3 mmu-miR-705 130,4 212,1 198,2 105,3 mmu-miR-706 29,5 124,8 104,3 26,0 mmu-miR-707 12,1 11,4 11,6 11,2 mmu-miR-708 20,1 22,8 35,6 12,6 mmu-miR-708* 11,9 12,2 12,1 8,0 mmu-miR-709 23557,3 17745,5 7143,6 11912,3 mmu-miR-710 25,9 41,6 40,3 10,0 mmu-miR-711 23,3 41,6 45,2 8,3 mmu-miR-712 39,3 63,4 61,7 29,2 mmu-miR-712* 12,8 70,9 79,1 8,6 mmu-miR-713 13,2 15,5 12,3 6,1 mmu-miR-714 23,3 69,7 81,4 13,5 mmu-miR-715 17,6 20,6 20,2 12,5 mmu-miR-717 11,1 12,8 11,2 12,4 mmu-miR-718 39,6 32,7 38,9 54,4 mmu-miR-719 10,0 11,2 9,7 7,8 mmu-miR-720 3246,3 8142,4 3957,3 4068,1 mmu-miR-721 289,1 776,7 520,7 187,7 mmu-miR-741 11,3 12,0 11,0 12,4 mmu-miR-742 13,0 15,9 12,3 5,7 mmu-miR-742* 10,9 12,0 10,5 9,9 mmu-miR-743a 13,6 17,3 12,2 7,1 mmu-miR-743b-3p 10,9 11,2 11,3 4,5 mmu-miR-743b-5p 11,2 11,7 11,7 8,8 mmu-miR-744 90,1 51,3 102,5 65,8 mmu-miR-744* 16,2 15,2 19,8 39,8 mmu-miR-758 12,0 11,6 10,3 12,8 mmu-miR-759 10,7 12,0 12,5 7,3 mmu-miR-760 44,9 58,7 47,6 22,6 mmu-miR-761 12,2 12,4 10,6 5,2 mmu-miR-762 24,6 38,4 66,1 10,3 mmu-miR-763 13,2 18,1 11,7 8,0 mmu-miR-764-3p 10,5 11,9 10,9 10,5 mmu-miR-764-5p 11,7 12,2 11,8 25,8 mmu-miR-770-3p 27,2 40,1 38,2 14,2 mmu-miR-770-5p 16,0 20,0 15,7 10,6 mmu-miR-7a 40,2 219,2 74,8 73,4 mmu-miR-7a* 29,0 57,0 36,9 51,8 mmu-miR-7b 12,5 18,2 13,8 14,9 mmu-miR-801_v10,1 45,8 362,5 153,1 35,2 mmu-miR-802 11,7 10,1 18,6 18,5 mmu-miR-804 16,1 17,7 16,8 25,7 mmu-miR-805 53,4 75,4 50,2 59,5 mmu-miR-871 12,8 16,9 16,5 10,8 mmu-miR-872 151,9 199,7 183,1 257,8 mmu-miR-872* 20,0 30,7 18,9 22,9 mmu-miR-873 11,1 16,4 10,5 12,8 mmu-miR-874 91,2 90,2 84,4 47,4 mmu-miR-875-3p 11,8 12,9 12,5 7,0 mmu-miR-875-5p 11,6 11,5 13,5 17,3 mmu-miR-876-3p 10,9 10,6 11,0 4,7 mmu-miR-876-5p 10,4 10,6 10,8 7,2 mmu-miR-877 199,5 172,0 247,2 185,2 mmu-miR-877* 32,0 36,4 23,1 29,7 mmu-miR-878-3p 47,7 97,3 78,5 52,9 mmu-miR-878-5p 11,0 12,1 11,8 3,1 mmu-miR-879 12,0 11,0 10,4 6,4 mmu-miR-879* 10,6 10,7 11,7 4,3 mmu-miR-880 12,5 14,3 13,2 20,2 mmu-miR-881 10,7 11,7 12,2 12,1 mmu-miR-881* 10,7 10,2 11,7 7,9 mmu-miR-882 12,7 21,1 46,6 5,5 mmu-miR-883a-3p 10,9 12,0 11,2 10,4 mmu-miR-883a-5p 13,9 20,7 20,0 6,7 mmu-miR-883b-3p 11,0 10,7 12,5 16,6 mmu-miR-883b-5p 13,8 13,6 11,3 6,6 mmu-miR-9 116,1 21,6 1797,6 12,1 mmu-miR-9* 66,6 15,6 1123,7 9,4 mmu-miR-92a 1139,1 1580,5 874,3 1089,0 mmu-miR-92a* 15,0 18,9 13,7 11,0 mmu-miR-92b 17,1 32,7 13,8 17,2 mmu-miR-93 580,9 1448,7 945,0 1233,0 mmu-miR-93* 15,2 19,0 13,5 19,5 mmu-miR-96 26,4 53,5 12,7 24,9 mmu-miR-98 954,7 665,1 1337,9 1366,8 mmu-miR-99a 1629,8 1235,0 2140,5 4892,6 mmu-miR-99b 512,3 622,2 653,9 1003,3 mmu-miR-99b* 33,7 48,9 45,3 46,7 DISCUSSION AND PERSPECTIVES

A. Effect β-catenin on melanosome trafficking and distribution Melanosome migration is dictated by different processes which vary depending on cellular localization. Bi-directional migration typically occurs along microtubule tracks while unidirectional is associated with actin filaments. β-catenin has an indispensable role in melanocyte equilibrium. A plethora of melanocyte functions have been attributed to β-catenin activity. However, there is few if any evidence suggesting that β-catenin can directly influence melanosome dynamics. Our data formally identifies a novel role of β-catenin in melanosome. Firstly we characterized in depth cells isolated from transgenic mice carrying a transcriptionally active form of β-catenin. Interestingly, we observed an impaired spatial distribution melanosomes in β-catenin overexpressing mutant melanocytes. Considering the important of β-catenin in melanocyte homeostasis, we decided to further characterize the phenomenon. We hypothesize that β-catenin nuclear presence deregulates key process in melanosome dynamics. For this reason, we decided to assess physical parameters of the melanosomes, such as total and average distance, average velocity, and percent pausing in live cell melanosome tracking. We observed that in mutant cells melanosomes tended to be further extended with throughout the entirety of the trajectory. Additionally, the increase in distance was associated with increase in average velocity. Interestingly, melanosomes from mutant cells paused less frequently on average compared to melanosomes from wild-type cells. These results allowed us to postulate that β-catenin overexpression affects melanosome migration. Using a supervised approached mRNA levels of known components of melanosome homeostasis and others not yet associated to melanosomes but to Lysosomal Related Organels (LRO), we identified several mRNAs which were deregulated in mutant cells compared to wild-type. Amongst others, a

component of the dynein motor macromolecular structure, Dynlt3 (dynein, light chain, Tctex-type 3), was found down-regulated in mutant cells. Dynein light chains act as non-catalytic accessory components and can direct microtubule trafficking from the plasma membrane to the nucleus and has been studied as an alternative to gene delivery (Favaro et al., 2014; Toledo et al., 2013). We thus hypothesized that Dynlt3 expression is necessary for proper melanosome trafficking and that disruption of Dynlt3 expression would interfere with this process. We wondered whether β-catenin could actively repress that expression of Dynlt3. In this regard using transcription factor binding prediction algorithms we were able to identify putative binding sites in the proximal promoter region of Dynlt3 for Lef/Tcf7l2. Consistently, we were able to demonstrate reversible regulation of Dynlt3 mRNA and protein upon β-catenin modulation. Additionally, we could partly phenocopy the melanosome distribution pattern observed in mutant β-catenin melanocytes upon siRNA mediated knockdown of Dynlt3 in wild-type cells. Ultimately, these results expand on the role of β- catenin in melanocyte function. Following these result, it is of great interest to characterize the role of Dynlt3 in an in vivo mouse model, were modification of expression is restricted to the melanocyte lineage. Moreover, the question that still remains unanswered is whether observations result in an advantage or disadvantage in melanosome homeostasis. It is important to note that mutant β-catenin mice display a slight hypopigmentation phenotype. Whether this phenotype is at any level related to the regulation of melanosome location or migration is unknown. Another point of discussion still open is the similarity in phenotype of the β-catenin melanocytes to the OA1 (Ocular albinism 1/G-protein coupled receptor 143) melanocytes. Oa1 null melanocytes display perturbed melanosome distribution, with peripheral accumulation, as well as the occurrence of macromelanosomes (Palmisano et al., 2008). However, we did not identify a clear indication which would suggest that our mutant cell melanosome phenotype was a result of Oa1 dysregulation. Be that as it may, we cannot fully exclude that Oa1 may play a role in our observed phenotype.

B. The role β-catenin/Caveolin-1 axis in melanomagenesis in mouse and humans It is important to have a thorough understanding of the intrinsic and extrinsic processes that maintain proper melanocyte function in order to effectively determine the cause if cellular function goes array. This understanding, from the process of development to the functional role, yields invaluable information on the regulation of the melanocyte lineage. Some of these properties and intrinsic characteristics can be maintained in the transformed and disease causing melanomas. As such it is imperative that full lineage specific understanding of melanocyte behavior is catalogued and annotated to better predict and treat melanoma. Melanoma is a very aggressive type of skin cancer once it has evolved enough to metastasize. At the current rate of incidence it will become a serious epidemiological issue for future generations. Even though, considerable advances have been achieved in the area of diagnosis and treatment, there is still no cure for the disease. Although the role of PTEN in human melanoma has been investigated before, it has been heavily associated with the BRAFV600E mutation, with very few studies addressing its role with other recurring melanoma mutations. In human melanoma samples the association of oncogenic BRAF and loss of PTEN are highly correlated and have been studied in depth using mouse melanoma models. We decided to investigate the role of PTEN loss in a similar context, however with a different oncogenic mutation, NRASQ61K. Ras mutations are the second most recurring somatic mutations observed in melanoma and have been associated with increased cellular progression. We decided to investigate NRAS in particular, because even though the cooperative capacity of oncogenic HRASG12D and PTEN loss has been studied (Nogueira et al., 2010), this model lacks human relevance as the observed mutational rate for HRAS is extremely low, thus having both genetic events appear in the same melanoma is highly unlikely. On the contrary to NRAS is observed to be mutated in approximately 20% of human patients in an almost exclusive manner from BRAF.

Firstly, our data clearly provides evidence that unlike previously though NRASQ61K mutations and loss of PTEN do indeed occur in human melanoma cells. In order to exclude that possibility that culture conditions might have attributed to further genetic instability and that either genetic event was a result, we also examined the prevalence of both mutations in a set of human melanoma biopsies. Effectively, both alterations can coexist in the same tumor. These first set of data allowed us to hypothesize that perhaps the previous assumption of mutual exclusivity may not have been entirely applicable and that these two events may impart some selective advantage to tumor cells. This is of further interest since one studied showed that NRAS mutations can have a worse prognosis than BRAF (Devitt et al., 2011). We proceeded to determine in more detail the significance of such cooperation and generated a mouse model that recapitulated human melanomas histo-pathologically, that arose from perturbations of the NRAS and PTEN genes. As such, disruption of the PTEN allele in an NRAS background significantly induced aggressive murine melanomas with a higher penetrance and incidence as well as lung metastasis. Additionally, our results implicate that although PTEN is a major regulator of the PI3K/AKT signaling pathway, it also has important PI3K/AKT independent functions. This is evident as PTEN may affect, in a phosphatase independent manner, the interaction between β-catenin and Caveolin-1. As such we demonstrated that this interaction facilitates the transcriptional activity of β-catenin. Thus we were able to demonstrate a negative role of PTEN in preventing β-catenin transcriptional regulation mediated through Caveolin-1. Moreover, our in vitro data was further validated by the strong trend in inverse expression of PTEN and Caveolin-1 in our library human melanoma biopsies. Lastly, surprisingly we identify two putative β-catenin miRNA targets which can potentially compound the signaling by targeting Caveolin-1. Our data demonstrate that β-catenin can actively repress the expression of miR- 203 and miR-199a-5p which consequently increase the levels of Caveolin-1 thereby perpetuating β-catenin transcriptional regulation. Altogether, for the first time we provide circumstantial evidence promoting a PI3K/AKT independent PTEN signaling mediated through β-catenin/Caveolin-1 that

64 promotes efficient tumorigenesis in mice and may present an exploitable therapeutic alternative. These results raise several points which would be of interest to pursue further. For instance, it would be interesting to determine the cellular impact of overexpressing Caveolin-1, miR-203, and miR-199a-5p in our melanoma cells. If these genetic modifications would alter physical properties such as proliferation, migration, invasion, or colony formation in an in vitro setting. Additionally, it would be interesting to generate mice which have conditional deletion of the miR-203 and miR-199a-5p genes under the control of a melanocyte specific promoter and determine if the loss of expression is sufficient to drive melanoma formation. An important question which still remains is how does β-catenin enter the nucleus? Our data suggests that Caveolin-1 facilitates the translocation from the plasma membrane; however the exact mechanism of entry is still unclear. Another point of contention is that of the implications of Caveolin-1 in disease malignancy. It is a highly debated topic as to whether Caveolin-1 can promote disease progression by regulating signaling pathways. For instance, it has been recently suggested that instead of functioning as a Clatherin-independent endocytosis pathway, Caveolin-1 rather functions as a membrane reservoir and functions as a mechanosensing protein, and that it’s this function may have evolved primordially (Sinha et al., 2011; Spisni et al., 2003; Spisni et al., 2006). It is not difficult to imagine that Caveolin-1 may function in both manners and that a bifurcation in function may exits depending on the amounts of the protein present which is often cellular and context dependent. Thus in this scenario one function may prevail over the other on a given cellular context. In light with our data, it seems that both, membrane reservoir and inducing intracellular signaling functions, may contribute to stress resistance and favor tumorigenesis.

BIBLIOGRAPHY

Ackermann, J., Frutschi, M., Kaloulis, K., Mckee, T., Trumpp, A., and Beermann, F. (2005). Metastasizing melanoma formation caused by expression of activated N-RasQ61K on an INK4a-deficient background. Cancer research 65, 4005-11. Adameyko, I., Lallemend, F., Aquino, J. B., Pereira, J. A., Topilko, P., Muller, T., Fritz, N., Beljajeva, A., Mochii, M., Liste, I., et al. (2009). Schwann cell precursors from nerve innervation are a cellular origin of melanocytes in skin. Cell 139, 366-79. Adams, P. D. (2007). Remodeling of chromatin structure in senescent cells and its potential impact on tumor suppression and aging. Gene 397, 84-93. Adams, P. D. (2009). Healing and hurting: molecular mechanisms, functions, and pathologies of cellular senescence. Molecular cell 36, 2-14. Aldridge, R. B., Zanotto, M., Ballerini, L., Fisher, R. B., and Rees, J. L. (2011). Novice identification of melanoma: not quite as straightforward as the ABCDs. Acta dermato-venereologica 91, 125-30. Alonso, R., Suarez, A., Castro, P., Lacave, A. J., and Gutierrez, C. (2005). Influence of interleukin-10 genetic polymorphism on survival rates in melanoma patients with advanced disease. Melanoma research 15, 53-60. Ando, H., Kondoh, H., Ichihashi, M., and Hearing, V. J. (2007). Approaches to identify inhibitors of melanin biosynthesis via the quality control of tyrosinase. The Journal of investigative dermatology 127, 751-61. Ascierto, P. A., Minor, D., Ribas, A., Lebbe, C., O'hagan, A., Arya, N., Guckert, M., Schadendorf, D., Kefford, R. F., Grob, J. J., et al. (2013). Phase II trial (BREAK-2) of the BRAF inhibitor dabrafenib (GSK2118436) in patients with metastatic melanoma. Journal of clinical oncology : official journal of the American Society of Clinical Oncology 31, 3205-11. Bastian, B. C., Kashani-Sabet, M., Hamm, H., Godfrey, T., Moore, D. H., 2nd, Brocker, E. B., Leboit, P. E., and Pinkel, D. (2000a). Gene amplifications characterize acral melanoma and permit the detection of occult tumor cells in the surrounding skin. Cancer research 60, 1968-73. Bastian, B. C., Leboit, P. E., and Pinkel, D. (2000b). Mutations and copy number increase of HRAS in Spitz nevi with distinctive histopathological features. The American journal of pathology 157, 967-72. Bastian, B. C., Olshen, A. B., Leboit, P. E., and Pinkel, D. (2003). Classifying melanocytic tumors based on DNA copy number changes. Am J Pathol 163, 1765-70. Bauer, J., Curtin, J. A., Pinkel, D., and Bastian, B. C. (2007). Congenital melanocytic nevi frequently harbor NRAS mutations but no BRAF mutations. The Journal of investigative dermatology 127, 179-82. Baynash, A. G., Hosoda, K., Giaid, A., Richardson, J. A., Emoto, N., Hammer, R. E., and Yanagisawa, M. (1994). Interaction of endothelin-3 with endothelin-B receptor is essential for development of epidermal melanocytes and enteric neurons. Cell 79, 1277-85. Bellows, C. F., Belafsky, P., Fortgang, I. S., and Beech, D. J. (2001). Melanoma in African-Americans: trends in biological behavior and clinical characteristics over two decades. Journal of surgical oncology 78, 10-6. Bennett, D. C. (2003). Human melanocyte senescence and melanoma susceptibility genes. Oncogene 22, 3063-9.

Bishop, J. A., Wachsmuth, R. C., Harland, M., Bataille, V., Pinney, E., Mac, K. P., Baglietto, L., Cuzick, J., and Bishop, D. T. (2000). Genotype/phenotype and penetrance studies in melanoma families with germline CDKN2A mutations. The Journal of investigative dermatology 114, 28-33. Boniol, M., Armstrong, B. K., and Dore, J. F. (2006). Variation in incidence and fatality of melanoma by season of diagnosis in new South Wales, Australia. Cancer epidemiology, biomarkers & prevention : a publication of the American Association for Cancer Research, cosponsored by the American Society of Preventive Oncology 15, 524-6. Bradford, P. T., Goldstein, A. M., Mcmaster, M. L., and Tucker, M. A. (2009). Acral lentiginous melanoma: incidence and survival patterns in the United States, 1986-2005. Archives of dermatology 145, 427-34. Brahmer, J. R., Tykodi, S. S., Chow, L. Q., Hwu, W. J., Topalian, S. L., Hwu, P., Drake, C. G., Camacho, L. H., Kauh, J., Odunsi, K., et al. (2012). Safety and activity of anti-PD-L1 antibody in patients with advanced cancer. The New England journal of medicine 366, 2455-65. Busam, K. J., Murali, R., Pulitzer, M., Mccarthy, S. W., Thompson, J. F., Shaw, H. M., Brady, M. S., Coit, D. G., Dusza, S., Wilmott, J., et al. (2009). Atypical spitzoid melanocytic tumors with positive sentinel lymph nodes in children and teenagers, and comparison with histologically unambiguous and lethal melanomas. The American journal of surgical pathology 33, 1386-95. Capozza, F., Trimmer, C., Castello-Cros, R., Katiyar, S., Whitaker-Menezes, D., Follenzi, A., Crosariol, M., Llaverias, G., Sotgia, F., Pestell, R. G., et al. (2012). Genetic ablation of Cav1 differentially affects melanoma tumor growth and metastasis in mice: role of Cav1 in Shh heterotypic signaling and transendothelial migration. Cancer research 72, 2262-74. Carrel, S., Schmidt-Kessen, A., and Giuffre, L. (1985). Recombinant interferon- gamma can induce the expression of HLA-DR and -DC on DR-negative melanoma cells and enhance the expression of HLA-ABC and tumor- associated antigens. European journal of immunology 15, 118-23. Chabot, B., Stephenson, D. A., Chapman, V. M., Besmer, P., and Bernstein, A. (1988). The proto-oncogene c-kit encoding a transmembrane tyrosine kinase receptor maps to the mouse W locus. Nature 335, 88-9. Chang, A. E., Karnell, L. H., and Menck, H. R. (1998). The National Cancer Data Base report on cutaneous and noncutaneous melanoma: a summary of 84,836 cases from the past decade. The American College of Surgeons Commission on Cancer and the American Cancer Society. Cancer 83, 1664-78. Chapman, P. B., Hauschild, A., Robert, C., Haanen, J. B., Ascierto, P., Larkin, J., Dummer, R., Garbe, C., Testori, A., Maio, M., et al. (2011). Improved survival with vemurafenib in melanoma with BRAF V600E mutation. The New England journal of medicine 364, 2507-16. Chin, L., Tam, A., Pomerantz, J., Wong, M., Holash, J., Bardeesy, N., Shen, Q., O'hagan, R., Pantginis, J., Zhou, H., et al. (1999). Essential role for oncogenic Ras in tumour maintenance. Nature 400, 468-72. Clark, W. H., Jr., From, L., Bernardino, E. A., and Mihm, M. C. (1969). The histogenesis and biologic behavior of primary human malignant melanomas of the skin. Cancer research 29, 705-27. Conde-Perez, A., and Larue, L. (2012). PTEN and melanomagenesis. Future oncology 8, 1109-20.

Copeland, N. G., Gilbert, D. J., Cho, B. C., Donovan, P. J., Jenkins, N. A., Cosman, D., Anderson, D., Lyman, S. D., and Williams, D. E. (1990). Mast cell growth factor maps near the steel locus on mouse chromosome 10 and is deleted in a number of steel alleles. Cell 63, 175-83. Creagan, E. T., Ahmann, D. L., Green, S. J., Long, H. J., Frytak, S., O'fallon, J. R., and Itri, L. M. (1984a). Phase II study of low-dose recombinant leukocyte A interferon in disseminated malignant melanoma. Journal of clinical oncology : official journal of the American Society of Clinical Oncology 2, 1002-5. Creagan, E. T., Ahmann, D. L., Green, S. J., Long, H. J., Rubin, J., Schutt, A. J., and Dziewanowski, Z. E. (1984b). Phase II study of recombinant leukocyte A interferon (rIFN-alpha A) in disseminated malignant melanoma. Cancer 54, 2844-9. Damsky, W. E., Curley, D. P., Santhanakrishnan, M., Rosenbaum, L. E., Platt, J. T., Gould Rothberg, B. E., Taketo, M. M., Dankort, D., Rimm, D. L., Mcmahon, M., et al. (2011). beta-catenin signaling controls metastasis in Braf-activated Pten-deficient melanomas. Cancer cell 20, 741-54. Dankort, D., Curley, D. P., Cartlidge, R. A., Nelson, B., Karnezis, A. N., Damsky, W. E., Jr., You, M. J., Depinho, R. A., Mcmahon, M., and Bosenberg, M. (2009). Braf(V600E) cooperates with Pten loss to induce metastatic melanoma. Nature genetics 41, 544-52. Davies, H., Bignell, G. R., Cox, C., Stephens, P., Edkins, S., Clegg, S., Teague, J., Woffendin, H., Garnett, M. J., Bottomley, W., et al. (2002). Mutations of the BRAF gene in human cancer. Nature 417, 949-54. Delevoye, C., Giordano, F., Van Niel, G., and Raposo, G. (2011). [Biogenesis of melanosomes - the chessboard of pigmentation]. Medecine sciences : M/S 27, 153-62. Delmas, V., Beermann, F., Martinozzi, S., Carreira, S., Ackermann, J., Kumasaka, M., Denat, L., Goodall, J., Luciani, F., Viros, A., et al. (2007). Beta-catenin induces immortalization of melanocytes by suppressing p16INK4a expression and cooperates with N-Ras in melanoma development. Genes & development 21, 2923-35. Demunter, A., Libbrecht, L., Degreef, H., De Wolf-Peeters, C., and Van Den Oord, J. J. (2002). Loss of membranous expression of beta-catenin is associated with tumor progression in cutaneous melanoma and rarely caused by exon 3 mutations. Modern pathology : an official journal of the United States and Canadian Academy of Pathology, Inc 15, 454-61. Devitt, B., Liu, W., Salemi, R., Wolfe, R., Kelly, J., Tzen, C. Y., Dobrovic, A., and Mcarthur, G. (2011). Clinical outcome and pathological features associated with NRAS mutation in cutaneous melanoma. Pigment cell & melanoma research 24, 666-72. Dhomen, N., Reis-Filho, J. S., Da Rocha Dias, S., Hayward, R., Savage, K., Delmas, V., Larue, L., Pritchard, C., and Marais, R. (2009). Oncogenic Braf induces melanocyte senescence and melanoma in mice. Cancer cell 15, 294-303. Diaz, J., Mendoza, P., Ortiz, R., Diaz, N., Leyton, L., Stupack, D., Quest, A. F., and Torres, V. A. (2014). Rab5 is required for Caveolin-1-enhanced Rac1 activation, migration and invasion of metastatic cancer cells. Journal of cell science. Dissanayake, S. K., Wade, M., Johnson, C. E., O'connell, M. P., Leotlela, P. D., French, A. D., Shah, K. V., Hewitt, K. J., Rosenthal, D. T., Indig, F. E., et al. (2007). The Wnt5A/protein kinase C pathway mediates motility in melanoma 68

cells via the inhibition of metastasis suppressors and initiation of an epithelial to mesenchymal transition. The Journal of biological chemistry 282, 17259- 71. Dorsky, R. I., Raible, D. W., and Moon, R. T. (2000). Direct regulation of nacre, a zebrafish MITF homolog required for pigment cell formation, by the Wnt pathway. Genes & development 14, 158-62. Dutcher, J. P., Gaynor, E. R., Boldt, D. H., Doroshow, J. H., Bar, M. H., Sznol, M., Mier, J., Sparano, J., Fisher, R. I., Weiss, G., et al. (1991). A phase II study of high-dose continuous infusion interleukin-2 with lymphokine-activated killer cells in patients with metastatic melanoma. Journal of clinical oncology : official journal of the American Society of Clinical Oncology 9, 641-8. Ernfors, P. (2010). Cellular origin and developmental mechanisms during the formation of skin melanocytes. Experimental cell research 316, 1397-407. Falchook, G. S., Long, G. V., Kurzrock, R., Kim, K. B., Arkenau, T. H., Brown, M. P., Hamid, O., Infante, J. R., Millward, M., Pavlick, A. C., et al. (2012). Dabrafenib in patients with melanoma, untreated brain metastases, and other solid tumours: a phase 1 dose-escalation trial. Lancet 379, 1893-901. Fang, D., Nguyen, T. K., Leishear, K., Finko, R., Kulp, A. N., Hotz, S., Van Belle, P. A., Xu, X., Elder, D. E., and Herlyn, M. (2005). A tumorigenic subpopulation with stem cell properties in melanomas. Cancer research 65, 9328-37. Favaro, M. T., De Toledo, M. A., Alves, R. F., Santos, C. A., Beloti, L. L., Janissen, R., De La Torre, L. G., Souza, A. P., and Azzoni, A. R. (2014). Development of a non-viral gene delivery vector based on the dynein light chain Rp3 and the TAT peptide. Journal of biotechnology 173, 10-8. Fedorenko, I. V., Gibney, G. T., and Smalley, K. S. (2013). NRAS mutant melanoma: biological behavior and future strategies for therapeutic management. Oncogene 32, 3009-18. Felicetti, F., Errico, M. C., Bottero, L., Segnalini, P., Stoppacciaro, A., Biffoni, M., Felli, N., Mattia, G., Petrini, M., Colombo, M. P., et al. (2008). The promyelocytic leukemia zinc finger-microRNA-221/-222 pathway controls melanoma progression through multiple oncogenic mechanisms. Cancer research 68, 2745-54. Felicetti, F., Parolini, I., Bottero, L., Fecchi, K., Errico, M. C., Raggi, C., Biffoni, M., Spadaro, F., Lisanti, M. P., Sargiacomo, M., et al. (2009). Caveolin-1 tumor- promoting role in human melanoma. International journal of cancer. Journal international du cancer 125, 1514-22. Fitzpatrick TB, Szabo G, Seiji M, Quevedo WC. Biology of the melanin pigmentary system. In: Fitzpatrick TB. Dermatology in General Medicine. New York: Academic Press; 1979. pp. 131–163. Flaherty, K. T., Infante, J. R., Daud, A., Gonzalez, R., Kefford, R. F., Sosman, J., Hamid, O., Schuchter, L., Cebon, J., Ibrahim, N., et al. (2012a). Combined BRAF and MEK inhibition in melanoma with BRAF V600 mutations. The New England journal of medicine 367, 1694-703. Flaherty, K. T., Puzanov, I., Kim, K. B., Ribas, A., Mcarthur, G. A., Sosman, J. A., O'dwyer, P. J., Lee, R. J., Grippo, J. F., Nolop, K., et al. (2010). Inhibition of mutated, activated BRAF in metastatic melanoma. The New England journal of medicine 363, 809-19. Flaherty, K. T., Robert, C., Hersey, P., Nathan, P., Garbe, C., Milhem, M., Demidov, L. V., Hassel, J. C., Rutkowski, P., Mohr, P., et al. (2012b). Improved survival

with MEK inhibition in BRAF-mutated melanoma. The New England journal of medicine 367, 107-14. Forschner, A., Heinrich, V., Pflugfelder, A., Meier, F., and Garbe, C. (2013). The role of radiotherapy in the overall treatment of melanoma. Clinics in dermatology 31, 282-9. Friedman, R. J., Rigel, D. S., and Kopf, A. W. (1985). Early detection of malignant melanoma: the role of physician examination and self-examination of the skin. CA: a cancer journal for clinicians 35, 130-51. Gambacorti-Passerini, C., Radrizzani, M., Marolda, R., Belli, F., Sciorelli, G., Galazka, A. R., Schindler, J. D., Cascinelli, N., and Parmiani, G. (1988). In vivo activation of lymphocytes in melanoma patients receiving escalating doses of recombinant interleukin 2. International journal of cancer. Journal international du cancer 41, 700-6. Garnett, M. J., and Marais, R. (2004). Guilty as charged: B-RAF is a human oncogene. Cancer cell 6, 313-9. Gembarska, A., Luciani, F., Fedele, C., Russell, E. A., Dewaele, M., Villar, S., Zwolinska, A., Haupt, S., De Lange, J., Yip, D., et al. (2012). MDM4 is a key therapeutic target in cutaneous melanoma. Nature medicine. Goel, V. K., Lazar, A. J., Warneke, C. L., Redston, M. S., and Haluska, F. G. (2006). Examination of mutations in BRAF, NRAS, and PTEN in primary cutaneous melanoma. The Journal of investigative dermatology 126, 154-60. Goetz, J. G., Minguet, S., Navarro-Lerida, I., Lazcano, J. J., Samaniego, R., Calvo, E., Tello, M., Osteso-Ibanez, T., Pellinen, T., Echarri, A., et al. (2011). Biomechanical remodeling of the microenvironment by stromal caveolin-1 favors tumor invasion and metastasis. Cell 146, 148-63. Gomez, L., Rubio, M. P., Martin, M. T., Vazquez, J. J., Idoate, M., Pastorfide, G., Pestana, A., Seizinger, B. R., Barnhill, R. L., and Castresana, J. S. (1996). Chromosome 17 allelic loss and NF1-GRD mutations do not play a significant role as molecular mechanisms leading to melanoma tumorigenesis. The Journal of investigative dermatology 106, 432-6. Gonzalez R, Ribas A, Daud A, et al. Phase IB study of vemurafenib in combination with the MEK inhibitor, GDC-0973, in patients (pts) with unresectable or metastatic BRAFV600 mutated melanoma (BRIM7). ESMO 2012 Congress; Vienna; Sept 28–Oct 2, 2012. Abstr LBA28. Goodall, J., Carreira, S., Denat, L., Kobi, D., Davidson, I., Nuciforo, P., Sturm, R. A., Larue, L., and Goding, C. R. (2008). Brn-2 represses microphthalmia- associated transcription factor expression and marks a distinct subpopulation of microphthalmia-associated transcription factor-negative melanoma cells. Cancer research 68, 7788-94. Gortazar, A. R., Martin-Millan, M., Bravo, B., Plotkin, L. I., and Bellido, T. (2013). Crosstalk between caveolin-1/extracellular signal-regulated kinase (ERK) and beta-catenin survival pathways in osteocyte mechanotransduction. The Journal of biological chemistry 288, 8168-75. Gray-Schopfer, V. C., Cheong, S. C., Chong, H., Chow, J., Moss, T., Abdel-Malek, Z. A., Marais, R., Wynford-Thomas, D., and Bennett, D. C. (2006). Cellular senescence in naevi and immortalisation in melanoma: a role for p16? British journal of cancer 95, 496-505. Grulich, A. E., Bataille, V., Swerdlow, A. J., Newton-Bishop, J. A., Cuzick, J., Hersey, P., and Mccarthy, W. H. (1996). Naevi and pigmentary characteristics as risk factors for melanoma in a high-risk population: a case-control study in 70

New South Wales, Australia. International journal of cancer. Journal international du cancer 67, 485-91. Guldberg, P., Thor Straten, P., Birck, A., Ahrenkiel, V., Kirkin, A. F., and Zeuthen, J. (1997). Disruption of the MMAC1/PTEN gene by deletion or mutation is a frequent event in malignant melanoma. Cancer research 57, 3660-3. Ha, L., Merlino, G., and Sviderskaya, E. V. (2008). Melanomagenesis: overcoming the barrier of melanocyte senescence. Cell cycle 7, 1944-8. Haflidadottir, B. S., Bergsteinsdottir, K., Praetorius, C., and Steingrimsson, E. (2010). miR-148 regulates Mitf in melanoma cells. PloS one 5, e11574. Halaban, R. (1996). Growth factors and melanomas. Seminars in oncology 23, 673- 81. Hamid, O., Robert, C., Daud, A., Hodi, F. S., Hwu, W. J., Kefford, R., Wolchok, J. D., Hersey, P., Joseph, R. W., Weber, J. S., et al. (2013a). Safety and tumor responses with lambrolizumab (anti-PD-1) in melanoma. The New England journal of medicine 369, 134-44. Hamid, O., Robert, C., Daud, A., Hodi, F. S., Hwu, W. J., Kefford, R., Wolchok, J. D., Hersey, P., Joseph, R. W., Weber, J. S., et al. (2013b). Safety and tumor responses with lambrolizumab (anti-PD-1) in melanoma. The New England journal of medicine 369, 134-44. Harbour, J. W., Onken, M. D., Roberson, E. D., Duan, S., Cao, L., Worley, L. A., Council, M. L., Matatall, K. A., Helms, C., and Bowcock, A. M. (2010). Frequent mutation of BAP1 in metastasizing uveal melanomas. Science 330, 1410-3. Harley, C. B., Futcher, A. B., and Greider, C. W. (1990). Telomeres shorten during ageing of human fibroblasts. Nature 345, 458-60. Hauschild, A., Grob, J. J., Demidov, L. V., Jouary, T., Gutzmer, R., Millward, M., Rutkowski, P., Blank, C. U., Miller, W. H., Jr., Kaempgen, E., et al. (2012). Dabrafenib in BRAF-mutated metastatic melanoma: a multicentre, open-label, phase 3 randomised controlled trial. Lancet 380, 358-65. Hausser, J., Syed, A. P., Bilen, B., and Zavolan, M. (2013). Analysis of CDS-located miRNA target sites suggests that they can effectively inhibit translation. Genome research 23, 604-15. Hayflick, L., and Moorhead, P. S. (1961). The serial cultivation of human diploid cell strains. Experimental cell research 25, 585-621. Hayward, N. K. (2003). Genetics of melanoma predisposition. Oncogene 22, 3053-62. Hersey, P., Macdonald, M., Burns, C., and Cheresh, D. A. (1987). Enhancement of cytotoxic and proliferative responses of lymphocytes from melanoma patients by incubation with monoclonal antibodies against ganglioside GD3. Cancer immunology, immunotherapy : CII 24, 144-50. Hingorani, S. R., Jacobetz, M. A., Robertson, G. P., Herlyn, M., and Tuveson, D. A. (2003). Suppression of BRAF(V599E) in human melanoma abrogates transformation. Cancer research 63, 5198-202. Hodgkinson, C. A., Moore, K. J., Nakayama, A., Steingrimsson, E., Copeland, N. G., Jenkins, N. A., and Arnheiter, H. (1993). Mutations at the mouse microphthalmia locus are associated with defects in a gene encoding a novel basic-helix-loop-helix-zipper protein. Cell 74, 395-404. Hodi, F. S., Corless, C. L., Giobbie-Hurder, A., Fletcher, J. A., Zhu, M., Marino- Enriquez, A., Friedlander, P., Gonzalez, R., Weber, J. S., Gajewski, T. F., et al. (2013). Imatinib for melanomas harboring mutationally activated or amplified KIT arising on mucosal, acral, and chronically sun-damaged skin. 71

Journal of clinical oncology : official journal of the American Society of Clinical Oncology 31, 3182-90. Hodi, F. S., O'day, S. J., Mcdermott, D. F., Weber, R. W., Sosman, J. A., Haanen, J. B., Gonzalez, R., Robert, C., Schadendorf, D., Hassel, J. C., et al. (2010). Improved survival with ipilimumab in patients with metastatic melanoma. The New England journal of medicine 363, 711-23. Hoeflich, K. P., Gray, D. C., Eby, M. T., Tien, J. Y., Wong, L., Bower, J., Gogineni, A., Zha, J., Cole, M. J., Stern, H. M., et al. (2006). Oncogenic BRAF is required for tumor growth and maintenance in melanoma models. Cancer research 66, 999-1006. Hoek, K. S., and Goding, C. R. (2010). Cancer stem cells versus phenotype-switching in melanoma. Pigment cell & melanoma research 23, 746-59. Hoop, C. L., Sivanandam, V. N., Kodali, R., Srnec, M. N., and Van Der Wel, P. C. (2012). Structural characterization of the caveolin scaffolding domain in association with cholesterol-rich membranes. Biochemistry 51, 90-9. Hosoda, K., Hammer, R. E., Richardson, J. A., Baynash, A. G., Cheung, J. C., Giaid, A., and Yanagisawa, M. (1994). Targeted and natural (piebald-lethal) mutations of endothelin-B receptor gene produce megacolon associated with spotted coat color in mice. Cell 79, 1267-76. Howell, W. M., Turner, S. J., Bateman, A. C., and Theaker, J. M. (2001). IL-10 promoter polymorphisms influence tumour development in cutaneous malignant melanoma. Genes and immunity 2, 25-31. Hume, A. N., and Seabra, M. C. (2011). Melanosomes on the move: a model to understand organelle dynamics. Biochemical Society transactions 39, 1191-6. Igoucheva, O., and Alexeev, V. (2009). MicroRNA-dependent regulation of cKit in cutaneous melanoma. Biochemical and biophysical research communications 379, 790-4. Ikeya, M., Lee, S. M., Johnson, J. E., Mcmahon, A. P., and Takada, S. (1997). Wnt signalling required for expansion of neural crest and CNS progenitors. Nature 389, 966-70. Infante, JR Falchook, GS Lawrence, DP et al. Phase I/II study to assess safety, pharmacokinetics, and efficacy of the oral MEK 1/2 inhibitor GSK1120212 (GSK212) dosed in combination with the oral BRAF inhibitor GSK2118436 (GSK436). Proc Am Soc Clin Oncol, 29 (suppl) (2011) abstr CRA8503. Jang, S., and Atkins, M. B. (2013). Which drug, and when, for patients with BRAF- mutant melanoma? The lancet oncology 14, e60-9. Johannessen, C. M., Boehm, J. S., Kim, S. Y., Thomas, S. R., Wardwell, L., Johnson, L. A., Emery, C. M., Stransky, N., Cogdill, A. P., Barretina, J., et al. (2010). COT drives resistance to RAF inhibition through MAP kinase pathway reactivation. Nature 468, 968-72. Joshi, B., Bastiani, M., Strugnell, S. S., Boscher, C., Parton, R. G., and Nabi, I. R. (2012). Phosphocaveolin-1 is a mechanotransducer that induces caveola biogenesis via Egr1 transcriptional regulation. The Journal of cell biology 199, 425-35. Karasarides, M., Chiloeches, A., Hayward, R., Niculescu-Duvaz, D., Scanlon, I., Friedlos, F., Ogilvie, L., Hedley, D., Martin, J., Marshall, C. J., et al. (2004). B-RAF is a therapeutic target in melanoma. Oncogene 23, 6292-8. Karreth, F. A., Tay, Y., Perna, D., Ala, U., Tan, S. M., Rust, A. G., Denicola, G., Webster, K. A., Weiss, D., Perez-Mancera, P. A., et al. (2011). In vivo

identification of tumor- suppressive PTEN ceRNAs in an oncogenic BRAF- induced mouse model of melanoma. Cell 147, 382-95. Kim, J. E., Leung, E., Baguley, B. C., and Finlay, G. J. (2013). Heterogeneity of expression of epithelial-mesenchymal transition markers in melanocytes and melanoma cell lines. Frontiers in genetics 4, 97. Klein, W. M., Wu, B. P., Zhao, S., Wu, H., Klein-Szanto, A. J., and Tahan, S. R. (2007). Increased expression of stem cell markers in malignant melanoma. Modern pathology : an official journal of the United States and Canadian Academy of Pathology, Inc 20, 102-7. Kobayashi, T., Imokawa, G., Bennett, D. C., and Hearing, V. J. (1998). Tyrosinase stabilization by Tyrp1 (the brown locus protein). The Journal of biological chemistry 273, 31801-5. Kozubek, J., Ma, Z., Fleming, E., Duggan, T., Wu, R., Shin, D. G., and Dadras, S. S. (2013). In-depth characterization of microRNA transcriptome in melanoma. PloS one 8, e72699. Krauthammer, M., Kong, Y., Ha, B. H., Evans, P., Bacchiocchi, A., Mccusker, J. P., Cheng, E., Davis, M. J., Goh, G., Choi, M., et al. (2012). Exome sequencing identifies recurrent somatic RAC1 mutations in melanoma. Nature genetics 44, 1006-14. Kruit, W. H., Goey, S. H., Monson, J. R., Stahel, R. A., Calabresi, F., Mertelsmann, R., Holdener, E. E., Eggermont, A. M., Bolhuis, R. L., De Mulder, P. H., et al. (1991). Clinical experience with the combined use of recombinant interleukin- 2 (IL2) and interferon alfa-2a (IFN alpha) in metastatic melanoma. British journal of haematology 79 Suppl 1, 84-6. Kunz, M. (2013). MicroRNAs in melanoma biology. Advances in experimental medicine and biology 774, 103-20. Kurz, D. J., Decary, S., Hong, Y., and Erusalimsky, J. D. (2000). Senescence- associated (beta)-galactosidase reflects an increase in lysosomal mass during replicative ageing of human endothelial cells. Journal of cell science 113 ( Pt 20), 3613-22. Lang, D., Mascarenhas, J. B., and Shea, C. R. (2013). Melanocytes, melanocyte stem cells, and melanoma stem cells. Clinics in dermatology 31, 166-78. Larue, L., and Beermann, F. (2007). Cutaneous melanoma in genetically modified animals. Pigment cell research / sponsored by the European Society for Pigment Cell Research and the International Pigment Cell Society 20, 485-97. Larue, L., and Bellacosa, A. (2005). Epithelial-mesenchymal transition in development and cancer: role of phosphatidylinositol 3' kinase/AKT pathways. Oncogene 24, 7443-54. Larue, L., Luciani, F., Kumasaka, M., Champeval, D., Demirkan, N., Bonaventure, J., and Delmas, V. (2009). Bypassing melanocyte senescence by beta-catenin: a novel way to promote melanoma. Pathologie-biologie 57, 543-7. Le Douarin N. The neural crest. Cambridge: Cambridge university Press; 1982. Li, G., Schaider, H., Satyamoorthy, K., Hanakawa, Y., Hashimoto, K., and Herlyn, M. (2001). Downregulation of E-cadherin and Desmoglein 1 by autocrine hepatocyte growth factor during melanoma development. Oncogene 20, 8125- 35. Lin, K., Baritaki, S., Militello, L., Malaponte, G., Bevelacqua, Y., and Bonavida, B. (2010). The Role of B-RAF Mutations in Melanoma and the Induction of EMT via Dysregulation of the NF-kappaB/Snail/RKIP/PTEN Circuit. Genes & cancer 1, 409-420. 73

Lino Cardenas, C. L., Henaoui, I. S., Courcot, E., Roderburg, C., Cauffiez, C., Aubert, S., Copin, M. C., Wallaert, B., Glowacki, F., Dewaeles, E., et al. (2013). miR- 199a-5p Is upregulated during fibrogenic response to tissue injury and mediates TGFbeta-induced lung fibroblast activation by targeting caveolin-1. PLoS genetics 9, e1003291. Liu, C., Mallick, B., Long, D., Rennie, W. A., Wolenc, A., Carmack, C. S., and Ding, Y. (2013). CLIP-based prediction of mammalian microRNA binding sites. Nucleic acids research 41, e138. Liu, H., He, Z., and Simon, H. U. (2014). Autophagy suppresses melanoma tumorigenesis by inducing senescence. Autophagy 10, 372-3. Lobos-Gonzalez, L., Aguilar-Guzman, L., Fernandez, J. G., Munoz, N., Hossain, M., Bieneck, S., Silva, V., Burzio, V., Sviderskaya, E. V., Bennett, D. C., et al. (2014). Caveolin-1 is a risk factor for postsurgery metastasis in preclinical melanoma models. Melanoma research 24, 108-19. Lobos-Gonzalez, L., Aguilar, L., Diaz, J., Diaz, N., Urra, H., Torres, V. A., Silva, V., Fitzpatrick, C., Lladser, A., Hoek, K. S., et al. (2013). E-cadherin determines Caveolin-1 tumor suppression or metastasis enhancing function in melanoma cells. Pigment cell & melanoma research 26, 555-70. Logozzi, M., De Milito, A., Lugini, L., Borghi, M., Calabro, L., Spada, M., Perdicchio, M., Marino, M. L., Federici, C., Iessi, E., et al. (2009). High levels of exosomes expressing CD63 and caveolin-1 in plasma of melanoma patients. PloS one 4, e5219. Long, G. V., Menzies, A. M., Nagrial, A. M., Haydu, L. E., Hamilton, A. L., Mann, G. J., Hughes, T. M., Thompson, J. F., Scolyer, R. A., and Kefford, R. F. (2011). Prognostic and clinicopathologic associations of oncogenic BRAF in metastatic melanoma. Journal of clinical oncology : official journal of the American Society of Clinical Oncology 29, 1239-46. Luciani, F., Champeval, D., Herbette, A., Denat, L., Aylaj, B., Martinozzi, S., Ballotti, R., Kemler, R., Goding, C. R., De Vuyst, F., et al. (2011). Biological and mathematical modeling of melanocyte development. Development 138, 3943-54. Maertens, O., Johnson, B., Hollstein, P., Frederick, D. T., Cooper, Z. A., Messiaen, L., Bronson, R. T., Mcmahon, M., Granter, S., Flaherty, K., et al. (2013). Elucidating distinct roles for NF1 in melanomagenesis. Cancer discovery 3, 338-49. Margolin, K. A., Rayner, A. A., Hawkins, M. J., Atkins, M. B., Dutcher, J. P., Fisher, R. I., Weiss, G. R., Doroshow, J. H., Jaffe, H. S., Roper, M., et al. (1989). Interleukin-2 and lymphokine-activated killer cell therapy of solid tumors: analysis of toxicity and management guidelines. Journal of clinical oncology : official journal of the American Society of Clinical Oncology 7, 486-98. Mcpherson, M., Elwood, M., English, D. R., Baade, P. D., Youl, P. H., and Aitken, J. F. (2006). Presentation and detection of invasive melanoma in a high-risk population. Journal of the American Academy of Dermatology 54, 783-92. Miao, L., Xiong, X., Lin, Y., Cheng, Y., Lu, J., Zhang, J., and Cheng, N. (2014). miR- 203 inhibits tumor cell migration and invasion via caveolin-1 in pancreatic cancer cells. Oncology letters 7, 658-662. Michaloglou, C., Vredeveld, L. C., Soengas, M. S., Denoyelle, C., Kuilman, T., Van Der Horst, C. M., Majoor, D. M., Shay, J. W., Mooi, W. J., and Peeper, D. S. (2005). BRAFE600-associated senescence-like cell cycle arrest of human naevi. Nature 436, 720-4. 74

Migliore, C., Petrelli, A., Ghiso, E., Corso, S., Capparuccia, L., Eramo, A., Comoglio, P. M., and Giordano, S. (2008). MicroRNAs impair MET-mediated invasive growth. Cancer research 68, 10128-36. Milagre, C., Dhomen, N., Geyer, F. C., Hayward, R., Lambros, M., Reis-Filho, J. S., and Marais, R. (2010). A mouse model of melanoma driven by oncogenic KRAS. Cancer research 70, 5549-57. Miranda, B. H., Haughton, D. N., and Fahmy, F. S. (2012). Subungual melanoma: an important tip. Journal of plastic, reconstructive & aesthetic surgery : JPRAS 65, 1422-4. Moloney, F. J., and Menzies, S. W. (2011). Key points in the dermoscopic diagnosis of hypomelanotic melanoma and nodular melanoma. The Journal of dermatology 38, 10-5. Monzani, E., Facchetti, F., Galmozzi, E., Corsini, E., Benetti, A., Cavazzin, C., Gritti, A., Piccinini, A., Porro, D., Santinami, M., et al. (2007). Melanoma contains CD133 and ABCG2 positive cells with enhanced tumourigenic potential. European journal of cancer 43, 935-46. Nazarian, R., Shi, H., Wang, Q., Kong, X., Koya, R. C., Lee, H., Chen, Z., Lee, M. K., Attar, N., Sazegar, H., et al. (2010). Melanomas acquire resistance to B- RAF(V600E) inhibition by RTK or N-RAS upregulation. Nature 468, 973-7. Nikolaou, V. A., Stratigos, A. J., Flaherty, K. T., and Tsao, H. (2012). Melanoma: new insights and new therapies. The Journal of investigative dermatology 132, 854-63. Noguchi, S., Mori, T., Otsuka, Y., Yamada, N., Yasui, Y., Iwasaki, J., Kumazaki, M., Maruo, K., and Akao, Y. (2012). Anti-oncogenic microRNA-203 induces senescence by targeting E2F3 protein in human melanoma cells. The Journal of biological chemistry 287, 11769-77. Nogueira, C., Kim, K. H., Sung, H., Paraiso, K. H., Dannenberg, J. H., Bosenberg, M., Chin, L., and Kim, M. (2010). Cooperative interactions of PTEN deficiency and RAS activation in melanoma metastasis. Oncogene 29, 6222- 32. Ohbayashi, N., Maruta, Y., Ishida, M., and Fukuda, M. (2012). Melanoregulin regulates retrograde melanosome transport through interaction with the RILP- p150Glued complex in melanocytes. Journal of cell science 125, 1508-18. Orlow, S. J. (1995). Melanosomes are specialized members of the lysosomal lineage of organelles. The Journal of investigative dermatology 105, 3-7. Orom, U. A., Lim, M. K., Savage, J. E., Jin, L., Saleh, A. D., Lisanti, M. P., and Simone, N. L. (2012). MicroRNA-203 regulates caveolin-1 in breast tissue during caloric restriction. Cell cycle 11, 1291-5. Osterlind, A., Tucker, M. A., Stone, B. J., and Jensen, O. M. (1988). The Danish case- control study of cutaneous malignant melanoma. II. Importance of UV-light exposure. International journal of cancer. Journal international du cancer 42, 319-24. Pal, H. C., Sharma, S., Strickland, L. R., Katiyar, S. K., Ballestas, M. E., Athar, M., Elmets, C. A., and Afaq, F. (2014). Fisetin inhibits human melanoma cell invasion through promotion of mesenchymal to epithelial transition and by targeting MAPK and NFkappaB signaling pathways. PloS one 9, e86338. Palmisano, I., Bagnato, P., Palmigiano, A., Innamorati, G., Rotondo, G., Altimare, D., Venturi, C., Sviderskaya, E. V., Piccirillo, R., Coppola, M., et al. (2008). The ocular albinism type 1 protein, an intracellular G protein-coupled receptor, 75

regulates melanosome transport in pigment cells. Human molecular genetics 17, 3487-501. Parton, R. G. (2001). Cell biology. Life without caveolae. Science 293, 2404-5. Patschan, S., Chen, J., Polotskaia, A., Mendelev, N., Cheng, J., Patschan, D., and Goligorsky, M. S. (2008). Lipid mediators of autophagy in stress-induced premature senescence of endothelial cells. American journal of physiology. Heart and circulatory physiology 294, H1119-29. Peinado, H., Olmeda, D., and Cano, A. (2007). Snail, Zeb and bHLH factors in tumour progression: an alliance against the epithelial phenotype? Nature reviews. Cancer 7, 415-28. Pencheva, N., Tran, H., Buss, C., Huh, D., Drobnjak, M., Busam, K., and Tavazoie, S. F. (2012). Convergent multi-miRNA targeting of ApoE drives LRP1/LRP8- dependent melanoma metastasis and angiogenesis. Cell 151, 1068-82. Peppicelli, S., Bianchini, F., Torre, E., and Calorini, L. (2014). Contribution of acidic melanoma cells undergoing epithelial-to-mesenchymal transition to aggressiveness of non-acidic melanoma cells. Clinical & experimental metastasis. Piliang, M. P. (2011). Acral lentiginous melanoma. Clinics in laboratory medicine 31, 281-8. Pingault, V., Bondurand, N., Kuhlbrodt, K., Goerich, D. E., Prehu, M. O., Puliti, A., Herbarth, B., Hermans-Borgmeyer, I., Legius, E., Matthijs, G., et al. (1998). SOX10 mutations in patients with Waardenburg-Hirschsprung disease. Nature genetics 18, 171-3. Poliseno, L., Salmena, L., Zhang, J., Carver, B., Haveman, W. J., and Pandolfi, P. P. (2010). A coding-independent function of gene and pseudogene mRNAs regulates tumour biology. Nature 465, 1033-8. Pollock, P. M., and Hayward, N. (2002). Mutations in exon 3 of the beta-catenin gene are rare in melanoma cell lines. Melanoma research 12, 183-6. Potterf, S. B., Furumura, M., Dunn, K. J., Arnheiter, H., and Pavan, W. J. (2000). Transcription factor hierarchy in Waardenburg syndrome: regulation of MITF expression by SOX10 and PAX3. Human genetics 107, 1-6. Raposo, G., and Marks, M. S. (2007). Melanosomes--dark organelles enlighten endosomal membrane transport. Nature reviews. Molecular cell biology 8, 786-97. Rigel, D. S., Russak, J., and Friedman, R. (2010). The evolution of melanoma diagnosis: 25 years beyond the ABCDs. CA: a cancer journal for clinicians 60, 301-16. Rimm, D. L., Caca, K., Hu, G., Harrison, F. B., and Fearon, E. R. (1999). Frequent nuclear/cytoplasmic localization of beta-catenin without exon 3 mutations in malignant melanoma. Am J Pathol 154, 325-9. Robyn L., Tony M., Wayne S., Bruce A. (2006).Solar Ultraviolet Radiation: Global burden of disease from solar ultraviolet radiation (PDF). Environmental Burden of Disease Series 13. World Health Organization. ISBN 92-4-159440- 3 Robert, C., Thomas, L., Bondarenko, I., O'day, S., M, D. J., Garbe, C., Lebbe, C., Baurain, J. F., Testori, A., Grob, J. J., et al. (2011). Ipilimumab plus dacarbazine for previously untreated metastatic melanoma. The New England journal of medicine 364, 2517-26.

Saez-Ayala, M., Montenegro, M. F., Sanchez-Del-Campo, L., Fernandez-Perez, M. P., Chazarra, S., Freter, R., Middleton, M., Pinero-Madrona, A., Cabezas- Herrera, J., Goding, C. R., et al. (2013). Directed phenotype switching as an effective antimelanoma strategy. Cancer cell 24, 105-19. Salerni, G., Lovatto, L., Carrera, C., Puig, S., and Malvehy, J. (2011). Melanomas detected in a follow-up program compared with melanomas referred to a melanoma unit. Archives of dermatology 147, 549-55. Satzger, I., Mattern, A., Kuettler, U., Weinspach, D., Niebuhr, M., Kapp, A., and Gutzmer, R. (2012). microRNA-21 is upregulated in malignant melanoma and influences apoptosis of melanocytic cells. Experimental dermatology 21, 509- 14. Saxe, N., Hoffman, M., Krige, J. E., Sayed, R., King, H. S., and Hounsell, K. (1998). Malignant melanoma in Cape Town, South Africa. The British journal of dermatology 138, 998-1002. Segura, M. F., Belitskaya-Levy, I., Rose, A. E., Zakrzewski, J., Gaziel, A., Hanniford, D., Darvishian, F., Berman, R. S., Shapiro, R. L., Pavlick, A. C., et al. (2010). Melanoma MicroRNA signature predicts post-recurrence survival. Clinical cancer research : an official journal of the American Association for Cancer Research 16, 1577-86. Segura, M. F., Hanniford, D., Menendez, S., Reavie, L., Zou, X., Alvarez-Diaz, S., Zakrzewski, J., Blochin, E., Rose, A., Bogunovic, D., et al. (2009). Aberrant miR-182 expression promotes melanoma metastasis by repressing FOXO3 and microphthalmia-associated transcription factor. Proceedings of the National Academy of Sciences of the United States of America 106, 1814-9. Senetta, R., Stella, G., Pozzi, E., Sturli, N., Massi, D., and Cassoni, P. (2013). Caveolin-1 as a promoter of tumour spreading: when, how, where and why. Journal of cellular and molecular medicine 17, 325-36. Shen, W. H., Balajee, A. S., Wang, J., Wu, H., Eng, C., Pandolfi, P. P., and Yin, Y. (2007). Essential role for nuclear PTEN in maintaining chromosomal integrity. Cell 128, 157-70. Shenenberger, D. W. (2012). Cutaneous malignant melanoma: a primary care perspective. American family physician 85, 161-8. Shi, H., Kong, X., Ribas, A., and Lo, R. S. (2011). Combinatorial treatments that overcome PDGFRbeta-driven resistance of melanoma cells to V600EB-RAF inhibition. Cancer research 71, 5067-74. Siegel, R., Naishadham, D., and Jemal, A. (2012a). Cancer statistics for Hispanics/Latinos, 2012. CA: a cancer journal for clinicians 62, 283-98. Siegel, R., Naishadham, D., and Jemal, A. (2012b). Cancer statistics for Hispanics/Latinos, 2012. CA Cancer J Clin 62, 283-98. Sinha, B., Koster, D., Ruez, R., Gonnord, P., Bastiani, M., Abankwa, D., Stan, R. V., Butler-Browne, G., Vedie, B., Johannes, L., et al. (2011). Cells respond to mechanical stress by rapid disassembly of caveolae. Cell 144, 402-13. Sisley, K., Rennie, I. G., Parsons, M. A., Jacques, R., Hammond, D. W., Bell, S. M., Potter, A. M., and Rees, R. C. (1997). Abnormalities of chromosomes 3 and 8 in posterior uveal melanoma correlate with prognosis. Genes, chromosomes & cancer 19, 22-8. Sitaram, A., and Marks, M. S. (2012). Mechanisms of protein delivery to melanosomes in pigment cells. Physiology 27, 85-99. Situm, M., Bolanca, Z., and Buljan, M. (2010). Lentigo maligna melanoma--the review. Collegium antropologicum 34 Suppl 2, 299-301. 77

Song, M. S., Carracedo, A., Salmena, L., Song, S. J., Egia, A., Malumbres, M., and Pandolfi, P. P. (2011). Nuclear PTEN regulates the APC-CDH1 tumor- suppressive complex in a phosphatase-independent manner. Cell 144, 187-99. Sosman, J. A., Kim, K. B., Schuchter, L., Gonzalez, R., Pavlick, A. C., Weber, J. S., Mcarthur, G. A., Hutson, T. E., Moschos, S. J., Flaherty, K. T., et al. (2012). Survival in BRAF V600-mutant advanced melanoma treated with vemurafenib. The New England journal of medicine 366, 707-14. Southard-Smith, E. M., Kos, L., and Pavan, W. J. (1998). Sox10 mutation disrupts neural crest development in Dom Hirschsprung mouse model. Nature genetics 18, 60-4. Spisni, E., Bianco, M. C., Griffoni, C., Toni, M., D'angelo, R., Santi, S., Riccio, M., and Tomasi, V. (2003). Mechanosensing role of caveolae and caveolar constituents in human endothelial cells. Journal of cellular physiology 197, 198-204. Spisni, E., Toni, M., Strillacci, A., Galleri, G., Santi, S., Griffoni, C., and Tomasi, V. (2006). Caveolae and caveolae constituents in mechanosensing: effect of modeled microgravity on cultured human endothelial cells. Cell biochemistry and biophysics 46, 155-64. Stoter, G., Aamdal, S., Rodenhuis, S., Cleton, F. J., Iacobelli, S., Franks, C. R., Oskam, R., and Shiloni, E. (1991). Sequential administration of recombinant human interleukin-2 and dacarbazine in metastatic melanoma: a multicenter phase II study. Journal of clinical oncology : official journal of the American Society of Clinical Oncology 9, 1687-91. Streicher, K. L., Zhu, W., Lehmann, K. P., Georgantas, R. W., Morehouse, C. A., Brohawn, P., Carrasco, R. A., Xiao, Z., Tice, D. A., Higgs, B. W., et al. (2012). A novel oncogenic role for the miRNA-506-514 cluster in initiating melanocyte transformation and promoting melanoma growth. Oncogene 31, 1558-70. Su, F., Viros, A., Milagre, C., Trunzer, K., Bollag, G., Spleiss, O., Reis-Filho, J. S., Kong, X., Koya, R. C., Flaherty, K. T., et al. (2012). RAS mutations in cutaneous squamous-cell carcinomas in patients treated with BRAF inhibitors. The New England journal of medicine 366, 207-15. Sullivan, R. J., and Flaherty, K. T. (2013). Resistance to BRAF-targeted therapy in melanoma. European journal of cancer 49, 1297-304. Swan, M. C., and Hudson, D. A. (2003). Malignant melanoma in South Africans of mixed ancestry: a retrospective analysis. Melanoma research 13, 415-9. Taft, R. J., Pang, K. C., Mercer, T. R., Dinger, M., and Mattick, J. S. (2010). Non- coding RNAs: regulators of disease. The Journal of pathology 220, 126-39. Taft, R. J., Pheasant, M., and Mattick, J. S. (2007). The relationship between non- protein-coding DNA and eukaryotic complexity. BioEssays : news and reviews in molecular, cellular and developmental biology 29, 288-99. Tay, Y., Kats, L., Salmena, L., Weiss, D., Tan, S. M., Ala, U., Karreth, F., Poliseno, L., Provero, P., Di Cunto, F., et al. (2011). Coding-independent regulation of the tumor suppressor PTEN by competing endogenous mRNAs. Cell 147, 344-57. Theos, A. C., Tenza, D., Martina, J. A., Hurbain, I., Peden, A. A., Sviderskaya, E. V., Stewart, A., Robinson, M. S., Bennett, D. C., Cutler, D. F., et al. (2005). Functions of adaptor protein (AP)-3 and AP-1 in tyrosinase sorting from endosomes to melanosomes. Molecular biology of the cell 16, 5356-72.

Toledo, M. A., Favaro, M. T., Alves, R. F., Santos, C. A., Beloti, L. L., Crucello, A., Santiago, A. S., Mendes, J. S., Horta, M. A., Aparicio, R., et al. (2013). Characterization of the human dynein light chain Rp3 and its use as a non- viral gene delivery vector. Applied microbiology and biotechnology. Topalian, S. L., Hodi, F. S., Brahmer, J. R., Gettinger, S. N., Smith, D. C., Mcdermott, D. F., Powderly, J. D., Carvajal, R. D., Sosman, J. A., Atkins, M. B., et al. (2012). Safety, activity, and immune correlates of anti-PD-1 antibody in cancer. The New England journal of medicine 366, 2443-54. Topczewska, J. M., Postovit, L. M., Margaryan, N. V., Sam, A., Hess, A. R., Wheaton, W. W., Nickoloff, B. J., Topczewski, J., and Hendrix, M. J. (2006). Embryonic and tumorigenic pathways converge via Nodal signaling: role in melanoma aggressiveness. Nature medicine 12, 925-32. Tournillac, I., Picot, M. C., Dereure, O., Guilhou, J. J., and Guillot, B. (1999). [Dubreuilh melanoma: and epidemiologic and prognostic study]. Annales de dermatologie et de venereologie 126, 676-80. Toyofuku, K., Wada, I., Valencia, J. C., Kushimoto, T., Ferrans, V. J., and Hearing, V. J. (2001). Oculocutaneous albinism types 1 and 3 are ER retention diseases: mutation of tyrosinase or Tyrp1 can affect the processing of both mutant and wild-type proteins. FASEB journal : official publication of the Federation of American Societies for Experimental Biology 15, 2149-61. Tsao, H., Zhang, X., Benoit, E., and Haluska, F. G. (1998). Identification of PTEN/MMAC1 alterations in uncultured melanomas and melanoma cell lines. Oncogene 16, 3397-402. Tsao, H., Zhang, X., Fowlkes, K., and Haluska, F. G. (2000). Relative reciprocity of NRAS and PTEN/MMAC1 alterations in cutaneous melanoma cell lines. Cancer research 60, 1800-4. Tschandl, P., Berghoff, A. S., Preusser, M., Burgstaller-Muehlbacher, S., Pehamberger, H., Okamoto, I., and Kittler, H. (2013). NRAS and BRAF mutations in melanoma-associated nevi and uninvolved nevi. PloS one 8, e69639. Tyring, S. K., Klimpel, G., Brysk, M., Gupta, V., Stanton, G. J., Fleischmann, W. R., Jr., and Baron, S. (1984). Eradication of cultured human melanoma cells by immune interferon and leukocytes. Journal of the National Cancer Institute 73, 1067-73. Urra, H., Torres, V. A., Ortiz, R. J., Lobos, L., Diaz, M. I., Diaz, N., Hartel, S., Leyton, L., and Quest, A. F. (2012). Caveolin-1-enhanced motility and focal adhesion turnover require tyrosine-14 but not accumulation to the rear in metastatic cancer cells. PloS one 7, e33085. Valencia L.C., Hearing V. J. (2012). The Role of Glycosylation in the Control of Processing and Cellular Transport of the Functional Amyloid PMEL17, Glycosylation, Dr. Stefana Petrescu (Ed.), ISBN: 978-953-51-0771-2, InTech, DOI: 10.5772/48265. Available from: http://www.intechopen.com/books/glycosylation/the-role-of-glycosylation-in- the-control-of-processing-and-cellular-transport-of-the-functional-amyl Van Kempen, L. C., Van Den Hurk, K., Lazar, V., Michiels, S., Winnepenninckx, V., Stas, M., Spatz, A., and Van Den Oord, J. J. (2012). Loss of microRNA-200a and c, and microRNA-203 expression at the invasive front of primary cutaneous melanoma is associated with increased thickness and disease

progression. Virchows Archiv : an international journal of pathology 461, 441-8. Verhey, K. J., Kaul, N., and Soppina, V. (2011). Kinesin assembly and movement in cells. Annual review of biophysics 40, 267-88. Villanueva, J., Vultur, A., Lee, J. T., Somasundaram, R., Fukunaga-Kalabis, M., Cipolla, A. K., Wubbenhorst, B., Xu, X., Gimotty, P. A., Kee, D., et al. (2010). Acquired resistance to BRAF inhibitors mediated by a RAF kinase switch in melanoma can be overcome by cotargeting MEK and IGF-1R/PI3K. Cancer cell 18, 683-95. Wagle, N., Emery, C., Berger, M. F., Davis, M. J., Sawyer, A., Pochanard, P., Kehoe, S. M., Johannessen, C. M., Macconaill, L. E., Hahn, W. C., et al. (2011). Dissecting therapeutic resistance to RAF inhibition in melanoma by tumor genomic profiling. Journal of clinical oncology : official journal of the American Society of Clinical Oncology 29, 3085-96. Wan, P. T., Garnett, M. J., Roe, S. M., Lee, S., Niculescu-Duvaz, D., Good, V. M., Jones, C. M., Marshall, C. J., Springer, C. J., Barford, D., et al. (2004). Mechanism of activation of the RAF-ERK signaling pathway by oncogenic mutations of B-RAF. Cell 116, 855-67. Watanabe, A., Takeda, K., Ploplis, B., and Tachibana, M. (1998). Epistatic relationship between Waardenburg syndrome genes MITF and PAX3. Nature genetics 18, 283-6. Wehbe, M., Soudja, S. M., Mas, A., Chasson, L., Guinamard, R., De Tenbossche, C. P., Verdeil, G., Van Den Eynde, B., and Schmitt-Verhulst, A. M. (2012). Epithelial-mesenchymal-transition-like and TGFbeta pathways associated with autochthonous inflammatory melanoma development in mice. PloS one 7, e49419. Wellbrock, C., Ogilvie, L., Hedley, D., Karasarides, M., Martin, J., Niculescu-Duvaz, D., Springer, C. J., and Marais, R. (2004). V599EB-RAF is an oncogene in melanocytes. Cancer research 64, 2338-42. Whiteman, D. C., Zhou, X. P., Cummings, M. C., Pavey, S., Hayward, N. K., and Eng, C. (2002a). Nuclear PTEN expression and clinicopathologic features in a population-based series of primary cutaneous melanoma. International journal of cancer. Journal international du cancer 99, 63-7. Whiteman, D. C., Zhou, X. P., Cummings, M. C., Pavey, S., Hayward, N. K., and Eng, C. (2002b). Nuclear PTEN expression and clinicopathologic features in a population-based series of primary cutaneous melanoma. International journal of cancer. Journal international du cancer 99, 63-7. Wiesner, T., He, J., Yelensky, R., Esteve-Puig, R., Botton, T., Yeh, I., Lipson, D., Otto, G., Brennan, K., Murali, R., et al. (2014). Kinase fusions are frequent in Spitz tumours and spitzoid melanomas. Nature communications 5, 3116. Wiesner, T., Murali, R., Fried, I., Cerroni, L., Busam, K., Kutzner, H., and Bastian, B. C. (2012). A distinct subset of atypical Spitz tumors is characterized by BRAF mutation and loss of BAP1 expression. The American journal of surgical pathology 36, 818-30. Winter, J., Jung, S., Keller, S., Gregory, R. I., and Diederichs, S. (2009). Many roads to maturity: microRNA biogenesis pathways and their regulation. Nature cell biology 11, 228-34. Wu, H., Goel, V., and Haluska, F. G. (2003). PTEN signaling pathways in melanoma. Oncogene 22, 3113-22.

Wu, K. N., Queenan, M., Brody, J. R., Potoczek, M., Sotgia, F., Lisanti, M. P., and Witkiewicz, A. K. (2011). Loss of stromal caveolin-1 expression in malignant melanoma metastases predicts poor survival. Cell cycle 10, 4250-5. Xu, Y., Brenn, T., Brown, E. R., Doherty, V., and Melton, D. W. (2012). Differential expression of microRNAs during melanoma progression: miR-200c, miR-205 and miR-211 are downregulated in melanoma and act as tumour suppressors. British journal of cancer 106, 553-61. Yang, C. H., Yue, J., Pfeffer, S. R., Handorf, C. R., and Pfeffer, L. M. (2011). MicroRNA miR-21 regulates the metastatic behavior of B16 melanoma cells. The Journal of biological chemistry 286, 39172-8. Zhang, R., Poustovoitov, M. V., Ye, X., Santos, H. A., Chen, W., Daganzo, S. M., Erzberger, J. P., Serebriiskii, I. G., Canutescu, A. A., Dunbrack, R. L., et al. (2005). Formation of MacroH2A-containing senescence-associated heterochromatin foci and senescence driven by ASF1a and HIRA. Developmental cell 8, 19-30. Zhou, X. P., Gimm, O., Hampel, H., Niemann, T., Walker, M. J., and Eng, C. (2000a). Epigenetic PTEN silencing in malignant melanomas without PTEN mutation. The American journal of pathology 157, 1123-8. Zhou, X. P., Gimm, O., Hampel, H., Niemann, T., Walker, M. J., and Eng, C. (2000b). Epigenetic PTEN silencing in malignant melanomas without PTEN mutation. The American journal of pathology 157, 1123-8.

APPENDICES

During this PhD thesis, I had the opportunity to participate to writing of two Reviews (accepted for publication in Future Oncology and European Journal of Cell Biology).

Review 1: Relevance of NRAS/BRAF mouse melanoma models for humans. Conde-Perez A., Larue L., European Journal of Cell Biology. 2013, doi: 10.1016/j.ejcb.2013.10.010. PMID: 24342721

Review 2: Pten and Melanomagenesis. Conde-Perez A., Larue L.,. Future Oncology. 2012, 9:1109-1120.

ARTICLE 3

Relevance of NRAS/BRAF mouse melanoma models for humans

European Journal of Cell Biology 93 (2014) 82–86

Contents lists available at ScienceDirect

European Journal of Cell Biology

jo urnal homepage: www.elsevier.com/locate/ejcb

Review

Human relevance of NRAS/BRAF mouse melanoma models

a,b,c a,b,c,∗

Alejandro Conde-Perez , Lionel Larue

Institut Curie, Normal and Pathological Development of Melanocytes, 91405 Orsay, France

CNRS UMR3347, France

INSERM U1021, France

a r t i c l e i n f o a b s t r a c t

Article history: Melanoma is a major problem for many individuals worldwide. Although no effective treatment is avail-

Received 22 August 2013

able, promising new strategies are being developed. A better understanding of the inner workings of the

Received in revised form 27 October 2013

disease would undoubtedly lead to improved treatments. Mouse melanoma models have been used to

Accepted 28 October 2013

elucidate many key regulatory pathways involved in melanoma initiation and progression, and models

with mutations in the oncogenes RAF and RAS have been particularly informative. Here, we summa-

Keywords:

rize and evaluate the human relevance of various RAF and RAS mouse melanoma models and their

PTEN

contribution to our understanding of melanoma.

␤-Catenin

Progression

Introduction effects (Hamid et al., 2013). Other therapeutic approaches tried

include the use of KIT inhibitor (Imatinib) for patients who carry

Malignant melanoma is a multi-etiological disease and a world- mutations or ampliﬁcation in KIT; unfortunately, this approach

wide health problem. In the USA alone, there were an estimated is of limited value in the case of melanoma (Hodi et al., 2013).

76,250 new cases and 9180 deaths in 2012 (Siegel et al., 2012). More promising however, is targeted therapy with Vemurafenib

V600E

It is the most deadly skin cancer, with a high metastatic poten- or Dabrafenib, speciﬁc inhibitors of BRAF ; however, the bene-

tial and resistance to conventional therapy. The median survival of ﬁts are often short lived and many patients relapse (Flaherty et al.,

patients with metastatic melanoma is 9 months (Balch et al., 2009). 2010). In addition, BRAF treatment is only relevant to patients who

Melanomagenesis is characterized by several distinct histopatho- carry the V600 mutation (about half the melanoma population).

logical stages; (i) common acquired nevi and dysplastic nevi, (ii) To develop better treatments, a thorough understanding of

radial growth phase (RGP) melanoma, (iii) vertical growth phase the mechanism(s) involved in the initiation (emergence) and pro-

(VGP) melanoma, and (iv) malignant metastatic melanoma (Fig. 1). gression (evolution) of the disease is required. Details of the

Various genetic (such as BRAF, NRAS, NF1 and KIT mutations) and mechanism(s) of the cellular transformation underlying melanoma

epigenetic modiﬁcations (including promoter methylation at the emergence have remained elusive, although recent advances

PTEN or CDKN2A loci) have been described. in sequencing technology promise a better resolution of the

The general therapeutic approach to melanoma has been chang- melanoma landscape. A series of studies have revealed previously

ing rapidly recently due to the introduction of small molecule uncharacterized chromosomal rearrangements in key melanoma

therapies and immunotherapy. Immunotherapy with agents such susceptibility regions and in particular led to the discovery of a

as anti-CTLA4 (Ipilimumab), anti-PDL1 (BMS-936559) and anti-PD1 new set of mutations (Krauthammer et al., 2012; Kunz et al., 2013;

(Lambrolizumab) antibodies (Brahmer et al., 2012; Hamid et al., Nikolaev et al., 2012; Wadt et al., 2012). Whole genome sequenc-

2013; Jang and Atkins, 2013) shows some promise. For instance, ing of melanomas revealed unclassiﬁed synonymous mutations

the response rate to treatment with anti-PD1 in one study was in several genes that may alter their regulation (Gartner et al.,

52%, but only using the highest dose administered (10 mg/kg every 2013). It is clear that progress in sequencing technology will allow

two weeks), which was strongly associated with adverse secondary an unprecedented level of resolution in terms of systems and

molecular biology; nevertheless, rigorous functional validation of

discoveries is required if therapies are to be developed and adapted

∗ to the needs of patients. It seems inevitable that, as a consequence,

Corresponding author at: Institut Curie, Bat 110, 91405 Orsay Cedex, France.

more mouse models will be developed for use in the analysis of the

Tel.: +33 1 69 86 71 07; fax: +33 1 69 86 71 09.

E-mail address: [email protected] (L. Larue). cellular and molecular mechanisms involved.

A. Conde-Perez, L. Larue / European Journal of Cell Biology 93 (2014) 82–86 83

Fig. 1. Schematic representation of melanomagenesis as a multistep process. Melanomagenesis is composed of two main processes: melanoma initiation and progression.

During melanoma initiation, proteins of the MAP kinase pathway (BRAF, NRAS, HRAS, KRAS and NF1) are involved in proliferation, and proteins of the PI3K (PTEN) and

INK4A

WNT (␤-catenin) pathways, and p16 are involved in the bypass of senescence. Melanoma progression is the combination of invasion and metastasis. At the cellular

level, melanoma invasion results from a combination of several mechanisms: a pseudoepithelial–mesenchymal transition, a loss of cell-to-cell adhesion, a loss of cell–matrix

adhesion, matrix degradation, and chemo-attraction/repulsion and migration. RGP, radial growth phase; VGP, vertical growth phase; met, metastasis. Kc, keratinocyte; Mc,

melanocyte; and BM, basement membrane.

The mouse has become the standard model system for Proteins involved in proliferation

melanoma research. Using genetic manipulation technologies, for

example random integration, homologous recombination, and Aberrant signaling by the RAF and RAS family of kinases has been

most recently Cre/CreERT2-LoxP, a wide range of spatial and identiﬁed as being critical for melanoma (Davies et al., 2002). Gain

temporal controls of transgenes can be exploited (Larue and of function mutations in various members of the mitogen-activated

Beermann, 2007). Thus, reverse genetics can be used to, it is pos- protein kinase (MAPK) pathway account for 70% of melanomas:

V600E Q61K

sible to study function/phenotype relationships thoroughly via 50% display BRAF (BRAF ) and 20% NRAS (NRAS ) muta-

various approaches including full gene knock-out, conditional and tions (Demunter et al., 2001; Goel et al., 2006) (Fig. 1). There are

spatio/temporal mutations or even gene traps. Numerous differ- several members of the RAF family of kinases including BRAF,

ent transgenic mouse lines have been developed over the last CRAF and ARAF; BRAF mutation is associated with melanoma and

two decades with the aim of better understanding and treating CRAF is important for Vemurafenib-treated melanoma resistance.

Q61K

melanoma. For example, the Tyr::Cre mice have proven use- Similarly, speciﬁc mutations in RAS family kinases (NRAS ,

G12V G12V

ful for elucidating the normal development of the melanocyte KRAS and HRAS ) have been observed in melanoma at

lineage from early melanocyte precursors to fully differentiated various frequencies (20%, 2%, and 1%, respectively). RAS muta-

melanocytes (Delmas et al., 2003; Luciani et al., 2011). Such mod- tions have also been found in giant congenital nevi (Bauer et al.,

els have been able to shed light on the spatial and temporal 2007). Alterations of the RAS signaling inhibitor, NF1, have also

cues required for normal melanocyte development. Similarly, the been observed in human melanoma. Sequencing studies reveal a

tamoxifen-inducible Tyr::Cre-ERT2 system has been extensively loss of heterozygosity (LOH) at the NF1 locus in approximately

used to study the role of somatic mutations in the develop- 10% of melanoma patients (Gomez et al., 1996; Krauthammer

ment of melanoma in adult mice (Bosenberg et al., 2006; Yajima et al., 2012), and NF1 mutations have recently been found to be

et al., 2006). This approach is very powerful as it can also be associated with resistance to treatment with the Vemurafenib

V600E

utilized for drug screening. Unfortunately, every model system analog, PLX4720, in a BRAF background (Maertens et al.,

suffers limitations. One problem with using the mouse to as a 2013).

model for human melanoma is the absence of melanocytes from Constitutive activating mutations in either BRAF or NRAS induce

the epidermal–dermal junction in hairy parts of the skin. How- anomalous cell growth, often followed by premature growth arrest

ever, this problem can be circumvented by the introduction of through Oncogene Induced Senescence or OIS (Ackermann et al.,

Q61K

mutations such as NRAS , or transgenic endothelin 3 (ET3), 2005; Chin, 1999; Michaloglou et al., 2005). Without further genetic

which force epidermal colonization of the skin, thereby mim- instability, many such lesions remain benign and do not progress to

icking human melanoma (Ackermann et al., 2005; Garcia et al., malignancy. However, the acquisition of further genetic abnormal-

INK4A

2008). ities, such as the loss of tumor suppressors p16 or PTEN, often

Here, we will focus on melanoma initiation, a phenomenon results in the eventual bypass of the senescence program and ulti-

which is increasingly well understood at the cellular (proliferation mately malignant transformation in mice (Bardeesy et al., 2001;

and bypass of senescence) and molecular (MAPK, PI3K, WNT/␤- Dhomen et al., 2009; Ferguson et al., 2010; Kannan et al., 2003;

catenin signaling pathways) levels. Monahan et al., 2010; Nogueira et al., 2010; You et al., 2002).

84 A. Conde-Perez, L. Larue / European Journal of Cell Biology 93 (2014) 82–86

Fig. 2. General strategy for generating relevant mouse models. Genetic or epigenetic modiﬁcations are revealed by molecular analysis of melanoma biopsies or cell lines (1). The

′

functionality of these modiﬁcations can be tested somatically or germinally in animal models including mouse (2), in organo-culture/3D (2 ) and in melanocyte/melanoma cell

′′

lines (2 ). The various approaches shed light on different aspects of melanomagenesis. Classical molecular genetics are used to generate physiological and physiopathological

information using appropriate clinical analysis (3). Such analysis reveals the main cellular mechanisms affected by the genetic modiﬁcation made. Primary and metastasis

melanoma biopsies can be removed, and analyzed histologically and molecularly (4). Details are given elsewhere (Berlin et al., 2012; Gallagher et al., 2011). Melanocyte and

melanoma cell lines can be established in culture from such genetically modiﬁed mice. Cell lines established from patients and animal models are certainly very useful and,

indeed, crucial for deciphering processes at cell biological and biochemical levels. The molecular consequences can be determined by modern techniques to studying DNA,

RNA (coding, non-coding) and proteins (including protein–protein interaction, post-translational modiﬁcation) (6). Bioinformatics is essential for comparing data from the

models with data from humans (7). At each level (molecular, physiology/physiopathology, tissue and cell) the relevance of the model can be evaluated by comparison with

the situation in humans. However, human melanomas are very heterogeneous, and consequently, there is no single perfect model for human melanoma in general; rather,

any one mouse model may be a good model for a particular human melanoma.

INK4A

Proteins involved in the bypass of senescence results in the repression of CDKN2A/p16 in melanocytes and

consequently contribute to immortalization (Delmas et al., 2007).

Senescence bypass results in unobstructed continued cellular PTEN negatively regulates PI3K/AKT signaling through the

proliferation indicative of malignant transformation and “true” de-phosphorylation of the PIP3. This regulation is essential for

melanoma initiation. Bypass of the senescence program is often modulating important cellular processes, including but not limited

INK4A

associated with p53 and Rb/p16 proteins: however, in both to, cell growth, survival and proliferation. Through the regulation

human and mouse melanocytes, the absence of p53 does not appear of PI3K/AKT pathway, PTEN can also modulate the intracellular

to be the dominant cause of melanocytes bypassing senescence, levels of ␤-catenin. Inactivation by mutation and/or deletion of

we cannot currently exclude the possibility that dysregulation of PTEN is observed in 5–20% of uncultured primary and metastatic

the p53 pathway is not involved in melanomagenesis, even though melanomas (Goel et al., 2006; Whiteman et al., 2002; Wu et al.,

there is a low mutational load in early melanoma. MDM4, but not 2003; Zhou et al., 2000) and in 30–40% of melanoma cell lines

MDM2, may be involved in melanoma initiation in a mouse model (Guldberg et al., 1997; Tsao et al., 1998; Wu et al., 2003). Loss of the

(Gembarska et al., 2012). By contrast, much more is known about phosphatase and tensin homologue PTEN has been demonstrated

INK4A

p16 , PTEN, and ␤-catenin as they relate to melanomagenesis to orchestrate, in part, disease progression. CGH analysis revealed

in mice. frequent loss of PTEN in melanoma (Bastian et al., 2003).

INK4A

The protein p16 is encoded by the CDKN2A gene. It is a

product of an alternative reading frame within the gene that also Melanoma initiation requires proliferation and bypass of

INK4A

encodes the structurally unrelated protein ARF. p16 nega- senescence

tively regulates cyclin-dependent kinase 4 (CDK4) and thus has an

important function in G1 cell-cycle control. Deletion or mutations Dysregulation of proteins involved in proliferation and bypass

INK4A

in p16 are associated with bypass of the senescence barrier. of senescence leads efﬁciently to melanoma initiation. Such events

For instance, about 60% of cutaneous melanomas display loss of can be forced using molecular genetics in mice, but have to be

the CDKN2A locus (9p21.3) and to other promoter methylation observed in human melanomas if they are to be validated as clini-

and sequence variations are also found, albeit less frequently, in cally relevant.

melanomas. One of the ﬁrst examples of a model of the proliferating/bypass

INK4A

␤-Catenin can be found at focal adhesion junctions in a com- of senescence association is the NRAS-p16 mouse. These mice

plex with E-cadherin/␣-catenin, and associates with the T cell develop melanomas efﬁciently, and with a higher penetrance and

Q61K

factor/lymphoid enhancer factor, TCF/LEF, and thereby transac- lower latency compared than NRAS mutants (Ackermann et al.,

V600E

tivates genes. It is a key regulatory component in melanocyte 2005). The BRAF mutation was shown to cooperate with

homeostasis and melanoma. Nuclear translocation of ␤-catenin is PTEN loss in mice to induce malignant melanoma, histopathologi-

observed in approximately 30% of melanoma samples and genetic cally characterized by intradermal colonization of the surrounding

aberrations are found in approximately 5% of uncultured malig- stroma and abnormal mitotic counts, with a strong propensity to

nant melanoma cases (Rimm et al., 1999) (COSMIC database). We metastasize; all mice with a primary melanoma had regional lymph

previously demonstrated that nuclear accumulation of ␤-catenin metastasis (Dankort et al., 2009). Moreover, in transgenic mice

A. Conde-Perez, L. Larue / European Journal of Cell Biology 93 (2014) 82–86 85

V600E

stabilized ␤-catenin in combination with the BRAF mutant Bauer, J., Curtin, J.A., Pinkel, D., Bastian, B.C., 2007. Congenital melanocytic nevi fre-

quently harbor NRAS mutations but no BRAF mutations. Journal of Investigative

and PTEN loss, is associated with accelerated melanomagenesis

Dermatology 127, 179–182.

and increased metastasis to distal organs (Damsky et al., 2011).

Berlin, I., Luciani, F., Gallagher, S.J., Rambow, F., Conde-Perez, A., Colombo, S., Cham-

V600E

Similarly, constitutive active BRAF and heterozygous loss of peval, D., Delmas, V., Larue, L., 2012. General strategy to analyse coat colour

INK4A phenotypes in mice. Pigment Cell & Melanoma Research 25, 117–119.

p16 , in the melanocyte lineage, results in effective senescence

Bosenberg, M., Muthusamy, V., Curley, D.P., Wang, Z., Hobbs, C., Nelson, B., Nogueira,

bypass (Dhomen et al., 2009). In a similar context, the loss of the

C., Horner 2nd, J.W., Depinho, R., Chin, L., 2006. Characterization of melanocyte-

tumor suppressor, PTEN, can enhance immortalization efﬁciency if speciﬁc inducible Cre recombinase transgenic mice. Genesis 44, 262–267.

V12G Brahmer, J.R., Tykodi, S.S., Chow, L.Q., Hwu, W.J., Topalian, S.L., Hwu, P., Drake, C.G.,

associated with other mutations. For example, the HRAS muta-

Camacho, L.H., Kauh, J., Odunsi, K., Pitot, H.C., Hamid, O., Bhatia, S., Martins, R.,

tion cooperates with loss of PTEN to favor melanoma development

Eaton, K., Chen, S., Salay, T.M., Alaparthy, S., Grosso, J.F., Korman, A.J., Parker,

V600E +/−

(Nogueira et al., 2010). Work with conditional BRAF PTEN S.M., Agrawal, S., Goldberg, S.M., Pardoll, D.M., Gupta, A., Wigginton, J.M., 2012.

Safety and activity of anti-PD-L1 antibody in patients with advanced cancer.

mouse models shows that the combination is more likely than

New England Journal of Medicine 366, 2455–2465.

the individual mutations to result in melanoma development. For

Chin, L., 1999. Modeling malignant melanoma in mice: pathogenesis and mainte-

instance, there is evidence that OIS bypass via loss of PTEN expres- nance. Oncogene 18, 5304–5310.

V600E

sion in a BRAF background is sufﬁcient to induce melanocyte Damsky, W.E., Curley, D.P., Santhanakrishnan, M., Rosenbaum, L.E., Platt, J.T., Gould

Rothberg, B.E., Taketo, M.M., Dankort, D., Rimm, D.L., McMahon, M., Bosenberg,

transformation in melanocytes in vitro, and to generate melanoma

M., 2011. beta-Catenin signaling controls metastasis in braf-activated pten-

in vivo (Vredeveld et al., 2012).

deﬁcient melanomas. Cancer Cell 20, 741–754.

Dankort, D., Curley, D.P., Cartlidge, R.A., Nelson, B., Karnezis, A.N., Damsky Jr., W.E.,

You, M.J., DePinho, R.A., McMahon, M., Bosenberg, M., 2009. Braf(V600E) coop-

erates with Pten loss to induce metastatic melanoma. Nature Genetics 41,

Evaluation of the relevance of mouse models for human 544–552.

melanoma

Davies, H., Bignell, G.R., Cox, C., Stephens, P., Edkins, S., Clegg, S., Teague, J., Woffendin,

H., Garnett, M.J., Bottomley, W., Davis, N., Dicks, E., Ewing, R., Floyd, Y., Gray, K.,

Hall, S., Hawes, R., Hughes, J., Kosmidou, V., Menzies, A., Mould, C., Parker, A.,

There are many advantages of using model systems to study

Stevens, C., Watt, S., Hooper, S., Wilson, R., Jayatilake, H., Gusterson, B.A., Cooper,

diseases. The ﬁrst and largest is that they allow direct testing of

C., Shipley, J., Hargrave, D., Pritchard-Jones, K., Maitland, N., Chenevix-Trench, G.,

new preliminary therapies to determine toxicity and efﬁciency, in a Riggins, G.J., Bigner, D.D., Palmieri, G., Cossu, A., Flanagan, A., Nicholson, A., Ho,

J.W., Leung, S.Y., Yuen, S.T., Weber, B.L., Seigler, H.F., Darrow, T.L., Paterson, H.,

context that is more biologically relevant than cell lines. Preclinical

Marais, R., Marshall, C.J., Wooster, R., Stratton, M.R., Futreal, P.A., 2002. Mutations

trials of new therapeutic agents in model systems are indispens-

of the BRAF gene in human cancer. Nature 417, 949–954.

able for the development of novel treatments. As a consequence, Delmas, V., Beermann, F., Martinozzi, S., Carreira, S., Ackermann, J., Kumasaka, M.,

it is desirable that the model system shares substantial similarities Denat, L., Goodall, J., Luciani, F., Viros, A., Demirkan, N., Bastian, B.C., Goding,

C.R., Larue, L., 2007. Beta-catenin induces immortalization of melanocytes by

with the human disease so that it is as relevant as possible. Ideally,

suppressing p16INK4a expression and cooperates with N-Ras in melanoma

molecular data from the model system are compatible with, and can

development. Genes & Development 21, 2923–2935.

be pooled with, those from the human disease; such compilation of Delmas, V., Martinozzi, S., Bourgeois, Y., Holzenberger, M., Larue, L., 2003. Cre-

mediated recombination in the skin melanocyte lineage. Genesis 36, 73–80.

the data can contribute to developing a better understanding of the

Demunter, A., De Wolf-Peeters, C., Degreef, H., Stas, M., van den Oord, J.J., 2001.

underlying mechanisms. The same applies to other levels, including

Expression of the endothelin-B receptor in pigment cell lesions of the skin.

physiopathology, molecular histology, biochemistry and cell biol- Evidence for its role as tumor progression marker in malignant melanoma.

Virchows Archiv 438, 485–491.

ogy (Fig. 2). Models can also be used for human tumor allografts,

Dhomen, N., Reis-Filho, J.S., da Rocha Dias, S., Hayward, R., Savage, K., Delmas, V.,

facilitating the analysis of rare and scarce samples. The complexi-

Larue, L., Pritchard, C., Marais, R., 2009. Oncogenic Braf induces melanocyte

ties of the initiation and progression of melanoma are reﬂected by senescence and melanoma in mice. Cancer Cell 15, 294–303.

Ferguson, B., Konrad Muller, H., Handoko, H.Y., Khosrotehrani, K., Beermann, F.,

the numerous distinct components that contribute to the disease

Hacker, E., Soyer, H.P., Bosenberg, M., Walker, G.J., 2010. Differential roles of the

(such as KIT, RET, HGF, GRM1, APC and MITF). This complexity is

pRb and Arf/p53 pathways in murine naevus and melanoma genesis. Pigment

also manifest as heterogeneity both between patients and within Cell & Melanoma Research 23, 771–780.

Flaherty, K.T., Puzanov, I., Kim, K.B., Ribas, A., McArthur, G.A., Sosman, J.A., O’Dwyer,

tumors; this heterogeneity may make melanoma stem cells difﬁ-

P.J., Lee, R.J., Grippo, J.F., Nolop, K., Chapman, P.B., 2010. Inhibition of mutated,

cult to ﬁnd. Thus, the question to be addressed must be considered

activated BRAF in metastatic melanoma. New England Journal of Medicine 363,

carefully before generating the appropriate mouse to provide an 809–819.

answer experimentally; only by such rigorous formulation of the Gallagher, S.J., Luciani, F., Berlin, I., Rambow, F., Gros, G., Champeval, D., Delmas, V.,

Larue, L., 2011. General strategy to analyse melanoma in mice. Pigment Cell &

questions can models signiﬁcant to the human disease be devel-

Melanoma Research 24, 987–988.

oped. In the last decade, with the help of several mouse models,

Garcia, R.J., Ittah, A., Mirabal, S., Figueroa, J., Lopez, L., Glick, A.B., Kos, L., 2008.

there have been major advances in the diagnosis and treatment Endothelin 3 induces skin pigmentation in a keratin-driven inducible mouse

model. Journal of Investigative Dermatology 128, 131–142.

of the disease. It still remains to be seen whether targeted patient

Gartner, J.J., Parker, S.C., Prickett, T.D., Dutton-Regester, K., Stitzel, M.L., Lin, J.C., Davis,

therapy can be adequately tailored through the use of a “personal-

S., Simhadri, V.L., Jha, S., Katagiri, N., Gotea, V., Teer, J.K., Wei, X., Morken, M.A.,

ized mouse model” so as to maximize treatment quality and result Bhanot, U.K., Chen, G., Elnitski, L.L., Davies, M.A., Gershenwald, J.E., Carter, H.,

Karchin, R., Robinson, W., Robinson, S., Rosenberg, S.A., Collins, F.S., Parmigiani,

in cures for this currently untreatable disease.

G., Komar, A.A., Kimchi-Sarfaty, C., Hayward, N.K., Margulies, E.H., Samuels, Y.,

2013. Whole-genome sequencing identiﬁes a recurrent functional synonymous

mutation in melanoma. Proceedings of the National Academy of Sciences of the

References United States of America 110, 13481–13486.

Gembarska, A., Luciani, F., Fedele, C., Russell, E.A., Dewaele, M., Villar, S., Zwolin-

ska, A., Haupt, S., de Lange, J., Yip, D., Goydos, J., Haigh, J.J., Haupt, Y., Larue, L.,

Ackermann, J., Frutschi, M., Kaloulis, K., McKee, T., Trumpp, A., Beermann, F.,

Jochemsen, A., Shi, H., Moriceau, G., Lo, R.S., Ghanem, G., Shackleton, M., Bernal,

2005. Metastasizing melanoma formation caused by expression of activated

F., Marine, J.C., 2012. MDM4 is a key therapeutic target in cutaneous melanoma.

N-RasQ61K on an INK4a-deﬁcient background. Cancer Research 65, 4005–4011.

Nature Medicine 18, 1239–1247.

Balch, C.M., Gershenwald, J.E., Soong, S.J., Thompson, J.F., Atkins, M.B., Byrd, D.R.,

Goel, V.K., Lazar, A.J., Warneke, C.L., Redston, M.S., Haluska, F.G., 2006. Examination

Buzaid, A.C., Cochran, A.J., Coit, D.G., Ding, S., Eggermont, A.M., Flaherty, K.T.,

of mutations in BRAF, NRAS, and PTEN in primary cutaneous melanoma. Journal

Gimotty, P.A., Kirkwood, J.M., McMasters, K.M., Mihm Jr., M.C., Morton, D.L., Ross,

of Investigative Dermatology 126, 154–160.

M.I., Sober, A.J., Sondak, V.K., 2009. Final version of 2009 AJCC melanoma staging

Gomez, L., Rubio, M.P., Martin, M.T., Vazquez, J.J., Idoate, M., Pastorﬁde, G., Pestana,

and classiﬁcation. Journal of Clinical Oncology: Ofﬁcial Journal of the American

A., Seizinger, B.R., Barnhill, R.L., Castresana, J.S., 1996. Chromosome 17 allelic loss

Society of Clinical Oncology 27, 6199–6206.

and NF1-GRD mutations do not play a signiﬁcant role as molecular mechanisms

Bardeesy, N., Bastian, B.C., Hezel, A., Pinkel, D., DePinho, R.A., Chin, L., 2001. Dual

leading to melanoma tumorigenesis. Journal of Investigative Dermatology 106,

inactivation of RB and p53 pathways in RAS-induced melanomas. Molecular

432–436.

and Cellular Biology 21, 2144–2153.

Guldberg, P., thor Straten, P., Birck, A., Ahrenkiel, V., Kirkin, A.F., Zeuthen, J., 1997.

Bastian, B.C., Olshen, A.B., LeBoit, P.E., Pinkel, D., 2003. Classifying melanocytic

Disruption of the MMAC1/PTEN gene by deletion or mutation is a frequent event

tumors based on DNA copy number changes. American Journal of Pathology

in malignant melanoma. Cancer Research 57, 3660–3663. 163, 1765–1770.

86 A. Conde-Perez, L. Larue / European Journal of Cell Biology 93 (2014) 82–86

Hamid, O., Robert, C., Daud, A., Hodi, F.S., Hwu, W.J., Kefford, R., Wolchok, J.D., Hersey, Monahan, K.B., Rozenberg, G.I., Krishnamurthy, J., Johnson, S.M., Liu, W., Bradford,

P., Joseph, R.W., Weber, J.S., Dronca, R., Gangadhar, T.C., Patnaik, A., Zarour, H., M.K., Horner, J., Depinho, R.A., Sharpless, N.E., 2010. Somatic p16(INK4a) loss

Joshua, A.M., Gergich, K., Elassaiss-Schaap, J., Algazi, A., Mateus, C., Boasberg, P., accelerates melanomagenesis. Oncogene 29, 5809–5817.

Tumeh, P.C., Chmielowski, B., Ebbinghaus, S.W., Li, X.N., Kang, S.P., Ribas, A., 2013. Nikolaev, S.I., Rimoldi, D., Iseli, C., Valsesia, A., Robyr, D., Gehrig, C., Harshman, K.,

Safety and tumor responses with lambrolizumab (anti-PD-1) in melanoma. New Guipponi, M., Bukach, O., Zoete, V., Michielin, O., Muehlethaler, K., Speiser, D.,

England Journal of Medicine 369, 134–144. Beckmann, J.S., Xenarios, I., Halazonetis, T.D., Jongeneel, C.V., Stevenson, B.J.,

Hodi, F.S., Corless, C.L., Giobbie-Hurder, A., Fletcher, J.A., Zhu, M., Marino-Enriquez, Antonarakis, S.E., 2012. Exome sequencing identiﬁes recurrent somatic MAP2K1

A., Friedlander, P., Gonzalez, R., Weber, J.S., Gajewski, T.F., O’Day, S.J., Kim, K.B., and MAP2K2 mutations in melanoma. Nature Genetics 44, 133–139.

Lawrence, D., Flaherty, K.T., Luke, J.J., Collichio, F.A., Ernstoff, M.S., Heinrich, M.C., Nogueira, C., Kim, K.H., Sung, H., Paraiso, K.H., Dannenberg, J.H., Bosenberg, M., Chin,

Beadling, C., Zukotynski, K.A., Yap, J.T., Van den Abbeele, A.D., Demetri, G.D., L., Kim, M., 2010. Cooperative interactions of PTEN deﬁciency and RAS activation

Fisher, D.E., 2013. Imatinib for melanomas harboring mutationally activated in melanoma metastasis. Oncogene 29, 6222–6232.

or ampliﬁed kit arising on mucosal, acral, and chronically sun-damaged skin. Rimm, D.L., Caca, K., Hu, G., Harrison, F.B., Fearon, E.R., 1999. Frequent

Journal of Clinical Oncology: Ofﬁcial Journal of the American Society of Clinical nuclear/cytoplasmic localization of beta-catenin without exon 3 mutations in

Oncology 31, 3182–3190. malignant melanoma. American Journal of Pathology 154, 325–329.

Jang, S., Atkins, M.B., 2013. Which drug, and when, for patients with BRAF-mutant Siegel, R., Naishadham, D., Jemal, A., 2012. Cancer statistics for Hispanics/Latinos,

melanoma? Lancet Oncology 14, e60–e69. 2012. CA: A Cancer Journal for Clinicians 62, 283–298.

Kannan, K., Sharpless, N.E., Xu, J., O’Hagan, R.C., Bosenberg, M., Chin, L., 2003. Com- Tsao, H., Zhang, X., Benoit, E., Haluska, F.G., 1998. Identiﬁcation of PTEN/MMAC1

ponents of the Rb pathway are critical targets of UV mutagenesis in a murine alterations in uncultured melanomas and melanoma cell lines. Oncogene 16,

melanoma model. Proceedings of the National Academy of Sciences of the United 3397–3402.

States of America 100, 1221–1225. Vredeveld, L.C., Possik, P.A., Smit, M.A., Meissl, K., Michaloglou, C., Horlings, H.M.,

Krauthammer, M., Kong, Y., Ha, B.H., Evans, P., Bacchiocchi, A., McCusker, J.P., Cheng, Ajouaou, A., Kortman, P.C., Dankort, D., McMahon, M., Mooi, W.J., Peeper, D.S.,

E., Davis, M.J., Goh, G., Choi, M., Ariyan, S., Narayan, D., Dutton-Regester, K., 2012. Abrogation of BRAFV600E-induced senescence by PI3K pathway activa-

Capatana, A., Holman, E.C., Bosenberg, M., Sznol, M., Kluger, H.M., Brash, D.E., tion contributes to melanomagenesis. Genes & Development 26, 1055–1069.

Stern, D.F., Materin, M.A., Lo, R.S., Mane, S., Ma, S., Kidd, K.K., Hayward, N.K., Wadt, K., Choi, J., Chung, J.Y., Kiilgaard, J., Heegaard, S., Drzewiecki, K.T., Trent, J.M.,

Lifton, R.P., Schlessinger, J., Boggon, T.J., Halaban, R., 2012. Exome sequencing Hewitt, S.M., Hayward, N.K., Gerdes, A.M., Brown, K.M., 2012. A cryptic BAP1

identiﬁes recurrent somatic RAC1 mutations in melanoma. Nature Genetics 44, splice mutation in a family with uveal and cutaneous melanoma, and paragan-

1006–1014. glioma. Pigment Cell & Melanoma Research 25, 815–818.

Kunz, M., Dannemann, M., Kelso, J., 2013. High-throughput sequencing of the Whiteman, D.C., Zhou, X.P., Cummings, M.C., Pavey, S., Hayward, N.K., Eng, C., 2002.

melanoma genome. Experimental Dermatology 22, 10–17. Nuclear PTEN expression and clinicopathologic features in a population-based

Larue, L., Beermann, F., 2007. Cutaneous melanoma in genetically modiﬁed animals. series of primary cutaneous melanoma. International Journal of Cancer 99,

Pigment Cell Research 20, 485–497. 63–67.

Luciani, F., Champeval, D., Herbette, A., Denat, L., Aylaj, B., Martinozzi, S., Ballotti, Wu, H., Goel, V., Haluska, F.G., 2003. PTEN signaling pathways in melanoma. Onco-

R., Kemler, R., Goding, C.R., De Vuyst, F., Larue, L., Delmas, V., 2011. Biologi- gene 22, 3113–3122.

cal and mathematical modeling of melanocyte development. Development 138, Yajima, I., Belloir, E., Bourgeois, Y., Kumasaka, M., Delmas, V., Larue, L., 2006. Spa-

3943–3954. tiotemporal gene control by the Cre-ERT2 system in melanocytes. Genesis 44,

Maertens, O., Johnson, B., Hollstein, P., Frederick, D.T., Cooper, Z.A., Messiaen, L., 34–43.

Bronson, R.T., McMahon, M., Granter, S., Flaherty, K., Wargo, J.A., Marais, R., You, M.J., Castrillon, D.H., Bastian, B.C., O’Hagan, R.C., Bosenberg, M.W., Parsons, R.,

Cichowski, K., 2013. Elucidating distinct roles for NF1 in melanomagenesis. Can- Chin, L., DePinho, R.A., 2002. Genetic analysis of Pten and Ink4a/Arf interac-

cer Discovery 3, 338–349. tions in the suppression of tumorigenesis in mice. Proceedings of the National

Michaloglou, C., Vredeveld, L.C., Soengas, M.S., Denoyelle, C., Kuilman, T., van der Academy of Sciences of the United States of America 99, 1455–1460.

Horst, C.M., Majoor, D.M., Shay, J.W., Mooi, W.J., Peeper, D.S., 2005. BRAFE600- Zhou, X.P., Gimm, O., Hampel, H., Niemann, T., Walker, M.J., Eng, C., 2000. Epige-

associated senescence-like cell cycle arrest of human naevi. Nature 436, netic PTEN silencing in malignant melanomas without PTEN mutation. American

720–724. Journal of Pathology 157, 1123–1128.

ARTICLE 4

Pten and Melanomagenesis.

For reprint orders, please contact: [email protected] Review PTEN and melanomagenesis Future Oncology

Alejandro Conde-Perez1,2,3 & Lionel Larue*1,2,3 1Institut Curie, Developmental Genetics of Melanocytes, Bat. 110, 91405, Orsay, France 2CNRS, UMR3347 Bat. 110, 91405, Orsay Cedex, France 3INSERM, U1021 Bat. 110, 91405, Orsay Cedex, France *Author for correspondence: Tel.: +33 1 69 86 71 07 n Fax: +33 1 69 86 71 09 n [email protected]

The PI3K–PTEN–AKT signaling pathway is involved in various cellular activities, including proliferation, migration, cell growth, cell survival and differentiation during adult homeostasis as well as in tumorigenesis. It has been suggested that the constitutive activation of PI3K/AKT signaling with concurrent loss of function of the tumor suppressor molecule PTEN contributes to cancer formation. Members of the PI3K–PTEN–AKT pathway, including these proteins and mTOR, are altered in melanoma tumors and cell lines. A hallmark of activation of the pathway is the loss of function of PTEN. Indeed, loss of heterozygosity of PTEN has been observed in approximately 30% of human melanomas, implicating this signaling pathway in this cancer. PI3K signaling activation, via loss of PTEN function, can inhibit proapoptotic genes such as the FoxO family of transcription factors, while inducing cell growth- and cell survival-related elements such as p70S6K and AKT. Determining how the PI3K–PTEN–AKT signaling pathway, alone or in cooperation with other pathways, orchestrates the induction of target genes involved in a diverse range of activities is a major challenge in research into melanoma initiation and progression. Moreover, the acquisition of basic knowledge will help patient management with appropriate therapies that are already, or will shortly be, on the market.

Malignant melanoma is the most highly aggres- understood. This is partly because most of the sive type of skin cancer, and the incidence of its functional studies addressing PTEN function diagnosis in westernized countries is increas- have used carcinoma, prostate and breast cancer ing. Identification of the molecular mechanisms models. Dissection of the PI3K–PTEN–AKT of melanoma formation (melanomagenesis) is axis in melanoma should provide further insight imperative, as this cancer has a high propen- into the melanocyte-specific molecular and cel- sity to metastasize and in many cases is resis- lular events involved in the initiation and/or tant to currently available treatment. There has progression of melanocytes towards melanoma. been extensive research undertaken to dissect and describe the key genetic and epigenetic Melanomagenesis alterations that result in aberrant signaling Melanomagenesis is a multistep process that and subsequent malignancy. Several regulatory develops through a series of stages: pathways play important roles in melanoma- n Common acquired nevi and dysplastic nevi; genesis including, but not limited to, MAPK, n WNT and PI3K (FIGURE 1). Although there are Radial growth phase melanoma; undoubtedly cooperative effects between these n Vertical growth phase melanoma; pathways, this issue is beyond the scope of this review. Constitutive activation of PI3K, via n Metastatic melanoma [4,5]. gain-of-function mutations in the PIK3CA In a schematic way, considering cellular gene encoding the class I PI3K catalytic subunit mechanisms, melanomagenesis may be defined p110a, are observed in a variety of malignan- as the initiation and progression of melanoma, cies, from glioblastomas to lung cancers [1,2], in which initiation includes proliferation and but only infrequently in melanoma. However, bypassing senescence, and progression includes mutation, epigenetic and deletion events involv- invasion and metastasis [6]. Invasion results from ing the tumor suppressor PTEN may be pres- a combination of mechanisms: ent in as many as 40–50% of sporadic mela- n Pseudoepithelial-to-mesenchymal transition Keywords nomas [3]. Loss of PTEN function is a major (melanocytes are not epithelial cells); contributing factor to increased signaling n catenin n LOH n MAPK downstream from PI3K/AKT. A number of n Loss of cell–cell adhesion; n melanoblasts n PI3K PI3K–PTEN–AKT cascade components have n Loss of cell–matrix adhesion; been identified, but their functions and regulation in the melanocyte lineage are still poorly n Matrix degradation; part of

IGF HGF

FGF WNT

RTK FRZ

* RAS * * * RAF PI3K PTEN∆ * * MEK AKT DSH

* ERK NF-κB GSK3β

* β-cat LEF

* ∆ CREBNF-κB M-MITF p16

Figure 1. Oversimpliﬁed signaling pathways associated with PTEN. Three main signaling pathways (PI3K, MAPK and WNT/b-catenin) are connected with PTEN. Some downstream targets are induced in normal conditions. Associated proteins can be mutated. Mutations are depicted as point mutations (*) or deletions (D).

n Chemo-attraction/repulsion; This approach is widely acknowledged to be insufficient and misleading, as irregularity and n Migration. heterogeneity varies within samples and not all Metastasis formation requires intravasation, relevant growths are necessarily identified [8,9]. extravasation, implantation at sites and subse- Accurate diagnosis often requires a skin biopsy, quent angiogenesis. Typically, benign tumors which still remains the quickest method of detec- remain ‘stuck’ at or before radial growth phase, tion [10]. The Breslow index is a prognostic factor and are proliferative but noninvasive. However, for melanoma based on measuring the depth of the acquisition of further genetic aberrations or tumor [11]. Monitoring the Breslow thickness in epigenetic modifications often leads to a bypass patients through time can be informative: higher of the senescence barrier and a phenotypic switch values of the index are positively correlated with from proliferative to invasive. This is accompa- poor prognosis and can be used as an indicator nied, during the later stages of the disease, by colo- for surgical removal. Currently, clinical evalu- nization of distal organs, including lung, liver and ations for loss of PTEN involve a combination brain. Metastatic melanoma ultimately becomes of sequencing and immunohistochemical tech- highly resistant to all current forms of therapy. niques, with the latter being more effective in endometrial carcinomas [12]. These techniques General clinical information can be readily applied to melanoma samples. The most basic mode of early detection/identification, within the first stage, utilizes the ABCD Current therapy for melanoma guideline system [7]: Although major improvements have been n Asymmetry; made in decoding the mechanisms involved in melanoma genesis, translation into clini- n Border irregularity; cal applications has unfortunately not been so effective. Over the last decade, melanoma n Color; research has focused on identifying possible n Diameter. therapeutic targets downstream of the RAS

1110 Future Oncol. (2012) 8(9) future science group PTEN & melanomagenesis Review signaling cascade and recently PI3K–PTEN– Different types of melanoma AKT, and seeking potential inhibitors. Two mol- Melanoma exists in different forms. Superficial ecules, vemurafenib (PLX4032) and dabrafenib spreading melanoma accounts for approxi- (GSK2118436), have been identified as inhibi- mately 40–70% of all cases of melanoma tors targeting BRAF mutations, specifically the [23–26]. The most common locations are the V600E mutation. BRAF inhibitors have shown legs of women and the backs of men, and great promise in the clinic: 80% of patients with they occur most commonly between 30 and tumors associated with a V600E mutation in 50 years of age. Many are barely raised from BRAF respond to the treatment. Unfortunately, the surrounding skin and vary in color. Such resistance emerges approximately 6–9 months melanomas evolve over 1–5 years and can be after the start of treatment with these agents. readily caught at an early stage if they are This resistance may be due to compensation by detected and removed. Nodular melanoma the MAPK and/or PI3K pathways. It has been is the second most common subtype, and is shown that PTEN loss confers BRAF inhibi- described in 15% of melanoma cases [27]. It is tor resistance in melanoma cells [13]. In addi- vertically invasive and generally has a higher tion, resistance may also arise via a switch in propensity to metastasize. They present as sym- signaling from BRAF to the CRAF isoform and metrical nodules with colors ranging from blue, subsequent hyperactivation of MEK–ERK [14]. to brown, pink and grey (for review, see [28]). In accordance, tumor samples obtained from Lentigo maligna melanoma typically develops melanoma patients treated with vemurafenib on the chronically sun-exposed skin of the head carry an activating mutation in MEK1 (C121S), and neck [29]. Precursor lesions are termed len- which was absent from pretreated tumors; this tigo maligna and commonly appear as irregu- mutation results in increased kinase activity and lar brownish pigmented macular lesions that strong resistance to the inhibitor [15]. Similarly, persist for years. The incidence increases with mutation of MEK1 (K59del) decreases sensi- age and generally peaks at between 70 and 80 tivity to dabrafenib treatment in A375 human years of age [30]. Acral lentiginous melanoma melanoma cells [16]. Thus, resistance to currently (ALM) is the rarest type of melanoma (~1% available BRAF inhibitors appears to result from of malignant melanomas for the Australian a signaling switch between RAF isoforms and population) and occurs at the same frequency MEK1 mutations. in people of different phototypes [23]. It has a Another therapeutic agent currently in use worse prognosis than the other types of mela- is the anti-CTLA4 antibody ipilimumab, with noma [31–33]. Dermatological signs include 10–20% of patients responding positively to the dark, irregular macules, papules or nodules therapy. CKIT activity inhibitors may also be on the feet and, less commonly, the hands. beneficial [17,18]. Inhibitors targeting functional Subungual occurrence in the fingers is uncom- components of the PI3K–PTEN–AKT pathway mon, and is reported in 1–13% of all cases of are available. The best characterized is rapamy- ALM [34]. Histologically, ALM is characterized cin, which inhibits the mTORC1 complex and, by asymmetric, poorly circumscribed prolifera- at high concentrations, mTORC2. The mTOR tion of continuous single melanocytes at the complex is an attractive target for therapeu- dermal–epidermal junction [35]. tic exploitation as it regulates cell growth and The four subtypes display different histo- survival. Treatment with rapamycin in in vitro pathological features, diagnostic criteria and cellular models leads to increased apoptosis, and overall survival rates. Different genetic altera- decreased metastatic potential [19]. Currently, tions are associated with different subtypes of efforts are being made to develop isoform-specific the disease. The modification of PTEN may mTOR inhibitors, in order to increase effective- affect the development of superficial spread- ness while decreasing off-target effects [20]. Recent ing melanoma, nodular melanoma and lentigo evidence has suggested that combinatorial ther- maligna melanoma, but does not seem to influ- apy using BRAF inhibitors with mTOR inhibi- ence ALM [36]. Comparative genome hybrid- tors may be beneficial to bypass initial resistance ization analysis showed that chromosomal to the BRAF inhibitor [21,22]. Various in vitro amplifications in regions 5p15, 5p13, 12q13–22 studies indicate that combinatorial therapies may and 16q21–22 are more frequently associated provide the basis for new treatment strategies in with ALM and may drive tumor formation, the near future; nevertheless, the development of irrespective of the status of 10q23 where PTEN appropriate and effective regimens of this type for is located [36]. However, this does not exclude patients is still far from trivial. that PTEN expression is altered in ALM.

future science group www.futuremedicine.com 1111 Review Conde-Perez & Larue

Melanomagenesis: initiation cells overcome this senescence barrier to hyper- & progression proliferate is one of the keys to improving our The transformation of melanocytes, which are knowledge of melanoma initiation. located in the skin and produce melanin pig- ments, leads to malignant melanoma. Both epi- PTEN genetic and genetic alterations contribute to the The gene encoding TEP1/MMAC1 was origi- etiology of melanoma. This includes genes cor- nally identified as a tumor suppressor, later responding to WNT/b-catenin (b-catenin and on renamed PTEN due to its propensity to be APC), MAPK (BRAF and NRAS) and PI3K mutated or lost in advanced cancers, resulting (PTEN and AKT3) signaling, cell adhesion in a loss of function. It was formally proven as a (ITGB3, ITGAV and CDH1) and cell cycle con- tumor suppressor in vivo once its absence led to trol (CDKN2A or INK4A–ARF, MYC, RB1 and initiation of tumors. It shares significant similar- TP53) [37–39]. During the initial stage of mela- ity with the catalytic domain of protein phos- nomagenesis, abnormal melanocytic growth phatases and the cytoskeletal proteins auxillin is observed in the form of nevi (moles). The and tensin; consequently, it was classified as a cause of this abnormal proliferation is prob- dual protein and lipid phosphatase [47,48]. ably uncontrolled cell division and/or delayed However, unlike other protein phosphatases, senescence. Generally, once senescence occurs, PTEN preferentially dephosphorylates phos- these nevi do not progress towards malignancy. phatidylinositol 3,4,5-trisphosphate (PIP3) at Mutated and hyperactive forms of NRAS and the 3´ position [49], thereby negatively regulating BRAF have been shown to be associated in the AKT signaling pathway. melanocytes with proliferation and induction of senescence, respectively [40,41]. According to PTEN structure this, immortalization of the cells is required The PTEN protein has 403 amino acids and for melanoma to form. However, one must not two key functional domains: a phosphatase forget that melanoma may still arise from a domain and a C2-spanning region regulating single melanocyte when both proliferation and membrane stability [50]. It has an N-terminal immortalization events occur. In this case, it phosphatidylinositol 3,4-bisphosphate (PIP2) is possible that the molecular event associated binding region and a C-terminal PDZ domain with immortalization may occur first without regulating protein–protein interactions [51,52]. any apparent lesion. In melanocytes, the MAPK The N-terminal domain, the first 185 amino (RAS/RAF/MEK/ERK) pathway is activated acids, contains a protein tyrosine phosphatase by growth factors, including SCF, HGF and signature motif and shows structural similar- FGF, resulting in ERK activation and thus ity to the dual-specificity phosphatase VHR proliferation [6,42]. BRAF is mutated in up to (FIGURE 2). However, crystallographic ana lysis 70% of benign nevi and melanomas, leading reveals that the residues corresponding to the to constitutive activation of the MAPK path- active site in PTEN generate a larger groove for way [43]. Oncogenes such as BRAF (or NRAS) substrate binding than is observed for VHR, are themselves incapable of transforming pri- such that the substrate specificity is different mary cells, or can do so only poorly, as they [50]. The active site contains a HCXXGXXR cause oncogene-induced senescence [40,44,45]. amino acid signature commonly found in pro- Mutation and/or alteration of gene expression tein tyrosine phosphatases and dual specific- may lead to the immortalization of melanocytes. ity phosphatases [50]. The C2 domain (amino The P16/RB and P14/P53 pathways are classi- acids 186–352) contains a CBR3 loop dif- cally involved in the bypass of senescence. In fering slightly from those in PLCd1, PKCb melanoma, the P16/RB pathway is particularly and cPLA2, with only one calcium-binding important in overcoming the senescence barrier residue (Asp286). Nevertheless, the loop has to oncogenic stress, and P53 plays a larger role in an overall net positive charge, resembling melanomagenesis during melanoma progression the Ca2+-dependent binding sites in the C2 (for review, see [46]). Deletion, mutation and domains of PLCd and PKCd; these structures silencing of P16 are the main molecular pro- may be involved in membrane binding [50]. cesses associated with the bypass of senescence The PIP2-binding region also contributes to in melanoma. In accordance, it has been shown the protein associating with the membrane [51]. that P16 can be silenced by repression by the Residues 401–403 in the PDZ-binding domain b-catenin–TCF4 complex or by methylation of have been shown to mediate binding to MAG its promoter [37]. Understanding how oncogenic family kinases [52].

1112 Future Oncol. (2012) 8(9) future science group PTEN & melanomagenesis Review

1 15 185 351 400 403 AA

PBM Phosphatase domain C2 domain Reg domain PDZ

Figure 2. PTEN structure. PTEN is composed of 403 AAs. It possesses ﬁve main domains or motifs. The plasma membrane-binding motif allows the binding of PTEN to PIP2. The phosphatase domain allows the dephosphorylation of PIP3 and, with lower efﬁciency, of proteins such as FAK. PTEN mutations found by deep sequencing (THR167ALA, CYS136TYR and TYR155CYS) map to this domain. The C2 domain allows the stabilization of PTEN to the membrane. The Reg domain, or regulatory domain, contains phosphorylable residues (Ser362, Thr366, Ser370 and Ser385) that are important for PTEN activity. PDZ allows the interaction with MAG family kinase. AA: Amino acid.

PTEN function P53 transcript and protein levels [65], although PTEN has been implicated in a plethora of the role of the PTEN–P53 interaction is con- cellular processes. A major role of PTEN is to troversial as others have reported that PTEN dephosphorylate PIP3 resulting in an increase inactivation leads to an increase of P53 pro- in the amount of PIP2 species and subse- duction [66]. Nuclear PTEN is also involved in quently leading to a decrease in AKT signaling promoting APC–CDH1 complexing resulting (reviewed in [53]). PIP2 is a major substrate of in cellular senescence [67]. The upregulation of the PI3 family of kinases and its phosphory- PTEN is also associated with an increase in lation by PI3K, on the third hydroxyl group, energy expenditure and mitochondrial oxidative results in production of the lipid second mes- phosphorylation providing a protective effect senger, PIP3, which enables AKT binding to the against oncogenic transformation [68]. membrane and subsequent phosphorylation of THR308 by PDK1 and SER473 by mTORC2 Regulation of PTEN complex, leading to its activation [54,55]. This The gene for PTEN maps to the chromosomal in turn leads to activation of the downstream region 10q23, and is often lost in various malig- signaling components of the PI3K–AKT cas- nancies [49]. Loss of function of PTEN is often cade, ultimately modulating cellular processes associated with an increase of PIP3 within including cell growth, cell size, cell cycle pro- the cells and subsequent activation of down- gression, cell survival, proliferation, growth and stream AKT signaling. Indeed, re-expression angiogenesis [56,57]. PTEN also has nuclear func- in PTEN-null cells leads to decreased cell pro- tions. In the majority of cutaneous melanomas liferation and tumorigenicity [3]. PTEN activ- PTEN may be found in the nucleus. Absence ity is regulated by a multitude of processes, from the nucleus has been associated with poor including post-translational acetylation by prognosis [58]. The absence of PTEN from the p300/CBP, which negatively affects its func- nucleus has also been described in other cancers tion [69]. Oxidative stress impairs PTEN cata- including colorectal cancer, pancreatic islet cell lytic activity by reducing cysteines 71 and 124, tumors and large B-cell lymphoma, leading to resulting in disulﬁde bonds [70–72]. NOTCH1 the view that the tumor suppressive activity of also regulates PTEN expression [73]. PTEN is PTEN is not solely associated with its cytoplas- mono- and poly-ubiquitinated by the E3 ubiq- mic functions [59–61]. Indeed, PTEN has been uitin ligase, and NEDD4-1 has been reported reported to be predominantly cytoplasmic in to mediate its subcellular translocation and neoplastic tissue, although nuclear in normal degradation, although this is still debated tissue, suggesting the existence of a nuclear [74–76]. In several types of malignancy, PTEN tumor-suppressing activity for this protein [62]. expression is affected by miRNA 26a and 21, It is thought that nuclear PTEN is involved in and the 106b-25 miRNA cluster. Interestingly, cell cycle progression, chromatin stability and the PTEN pseudogene PTENP1 was recently control of double-strand break DNA repair by found to compete for miRNA targeting PTEN, interaction with the RAD51 promoter [63,64]. thereby affecting the delicate balance of regu- PTEN has been reported to interact directly lation [77]. Recently, PREX2 and MAGI2, with the promoter of P53, thereby increasing known to interact with PTEN, were found to

future science group www.futuremedicine.com 1113 Review Conde-Perez & Larue

be mutated [78]. The presence of these muta- gene/protein, including PTEN. For instance, tions may affect their interactions with PTEN. cells move in the organism during both embry- Functionally, it was previously shown that onic and cancer development. For oncolo- PREX2 negatively regulates the phospholipid gists, the movement of a ‘transformed’ cell in activity of PTEN. However, it was not shown the organism is not spatially and temporally whether such mutation was effectively affect- controlled by this cell itself, and is discordant; ing PTEN activity when PREX2 was mutated. consequently, the term ‘invasion’ may be better Lastly, PTEN activity is regulated by a series adapted. For embryologists, the movement of a of phosphorylation events driven sequentially cell in the organism has two characteristics: it is through CK2 and GSK3b [79–81]. These regu- spatially and temporally controlled and is in har- latory effects all have consequences for cellular mony with the other cells. As a result, the term processes that are associated with migration, ‘colonization’ is generally used. Despite these dif- proliferation, apoptosis, metabolism and the ferences, both ‘colonization’ and ‘invasion’ result cell cycle. from combinations of different mechanisms: loss of cell–cell adhesion, loss of cell–matrix adhe- Commonly associated PTEN disorders in sion, matrix degradation, chemo-attraction/ humans repulsion and migration. The PI3K pathway is PTEN mutations and deletions have been clearly involved in these different cellular mech- described in many human cancers including, anisms [88–91]. For instance, it has been shown but not limited to, prostate cancer, breast can- that AKT regulates E-cadherin expression, there- cer and melanoma. Germline mutations have fore it is important for cell–cell adhesion [88]. been found to be associated with Cowden’s, Molecular oncologists often refer to invasion as Lhermitte–Duclos and Bannayan–Zonana observed in tests in vitro using various matrices, syndromes resulting in increased susceptibility for example Matrigel™ (BD Biosciences, NJ, to developing breast and nonmedullary thyroid USA). Obviously this test, although very use- carcinoma, dysplastic gliocytoma and endome- ful, only partly reﬂects the full invasion process trial carcinoma [82,83]. Over 80% of patients in vivo, as it addresses mainly matrix degrada- diagnosed with Cowden’s syndrome carry mutation and chemo-attraction/repulsion in vitro. tions in the PTEN gene [84]. The most common During the establishment of the melanocyte symptom associated with Cowden’s syndrome is lineage, embryologists refer to migration and the presence of multiple hamartomas in various not to colonization. This is because the loss of organs [83]. Patients with Lhermitte–Duclos syn- cell–cell adhesion, loss of cell–matrix adhesion drome present obstructive hydrocephalus and and matrix degradation do not seem to be impor- mass effects, characterized by focal enlarge- tant at this stage: the tissues are very ‘loose’ until ments of the cerebellar folia [85]. Similarly, the end of organogenesis (~E14.5) and become patients with Bannayan–Zonana syndrome tighter during fetal development. Consequently, exhibit cephalic abnormalities, mainly mac- migration remains the main cellular mechanism rocephaly, as well as vascular malformations, for melanoblast movements until that period. subcutaneous and visceral lipoma, and intestinal hamartomas [86]. The most frequently mutated PTEN in the establishment of the site (in ~30% of cases) in the PTEN gene is melanocyte lineage exon 5, which encodes the phosphatase domain The exact role of PTEN in embryonic develop- [82]. Somatic mutations have been reported in a ment has not been clearly elucidated, but experi- large number of cases of endometrial carcinoma ments in mice showed that it is clearly important and glioblastomas, and with varying degrees of as homozygous loss leads to embryonic lethality frequency in prostate, breast, ovarian and skin at the time of gastrulation. The role of PTEN cancers [82]. in the establishment of the melanocyte lineage is also not known, but the absence of this pro- Involvement of PTEN in melanocyte tein does not lead to major coat color phenotype transformation in mice [92], and PTEN is produced in murine The knowledge acquired regarding the develop- melanoblasts [93]. Interestingly, after backcross- ment and the establishment of the melanocyte ing the mice more than ten-times on C57BL/6 lineage is very informative about melanoma- the hyperpigmentation in the tail, pinna, paws, genesis, although it only provides a deforming skin and olfactory bulb in HM mice disappeared mirror image [87]. At the molecular level, this [Puig I et al., Unpublished Data]. At this point, the cumulative knowledge is certainly true for any involved modiﬁer gene(s) remain unknown.

1114 Future Oncol. (2012) 8(9) future science group PTEN & melanomagenesis Review

PTEN is absent in a large proportion of better expression in transgenic mice [101,102]. melanomas Subsequently, a combinatorial approach of TYR Various mutations in the PTEN gene have been enhancer and Tyr promoter sequence was used identified in cutaneous melanoma: the frequency to generate transgenic mouse lines enabling a of their occurrence is reported to be approxi- melanocyte-specific expression of CRE recom- mately 10% for primary melanoma and 40% binase (TYR::CRE, spatial control) [103,104] and for melanoma cell lines [57]. Several groups have tamoxifen-inducible expression of CRE recombi- identified somatic mutations occurring at the nase (TYR::CREERt2, spatio-temporal control) PTEN locus in primary and metastatic mela- [105,106]. The expression of CRE recombinase was noma with a higher frequency in metastatic sam- also successful in the melanocyte lineage after ples [94,95]. Mutations can occur all throughout insertion of CRE into the Dct locus, although the PTEN coding region. The most common expression is weaker than that from TYR::CRE genetic alteration of PTEN in melanoma, associ- constructs [107]. ated with loss of function and melanoma devel- The inactivation of Pten in the melanocyte opment, is loss of heterozygosity [96]. Recently, lineage, and some neural crest derivatives, using three independent deep-sequencing studies were the DCT::CRE mice led to 50% lethality after performed, two in melanoma cell lines and one birth with the remaining population having on melanoma metastasis [78,97,98]. Besides the increased melanocyte counts in the skin and frequent chromosomal rearrangement, loss displaying susceptibility to carcinogen-induced of heterozygosity of the region and the classi- melanomagenesis [108]. Even though DCT::CRE cal PTEN deletion, PTEN can present some mice are not efficiently recombining floxed genes point mutations (THR167ALA, CYS136TYR present in melanocytes, the specific inactivation and TYR155CYS) in which phosphorylation of of PTEN in the melanocyte lineage leads to a PTEN can be potentially affected. resistance to hair graying [108]. These results suggest that PTEN is important in the renewal of Role of PTEN in melanomagenesis melanocytes. Several explanations can be given. To elucidate the role of PTEN in melanoma initi- In the absence of PTEN the number of melano- ation and progression, various in vitro and in vivo cyte stem cells in each bulge is more important; models have been established and characterized. melanocyte stem cells overcome natural senes- Such models can also be used to screen drugs cence or transit amplifying cells divide more and new therapies. The constitutive inactivation than normal for each cycle. of the Pten gene in mice leads to death at embry- It is widely accepted that NRAS activates onic day 9.5 when homozygous. Heterozygous both MAPK and PI3K pathways, but BRAF mice are viable and fertile but develop a large activates only the MAPK pathway. Conditional range of tumor types, except melanoma. The inactivation of PTEN and activation of BRAF importance of PTEN in melanomagenesis was in mice after birth has been used to evaluate assessed using constitutively heterozygous mice synergy between the MAPK and PI3K sig- and conditionally mutated mice for this gene. naling pathways. These mutant mice formed Early on, mice mutated for Pten, as heterozy- melanoma with short latency and 100% pen- gous, and Ink4A/Arf, as homozygous, produced etrance. Metastasis to distal organs, lung and cutaneous melanoma [99]. These results provided lymph nodes was observed [109]. The conditional the first evidence that PTEN was a cause of mel- expression of a stabilized form of b-catenin in a anoma initiation. However, this mouse model BRAFV600E, PTEN-null context led to the accel- was far from optimal for the study of melanoma; eration of melanoma initiation and increased the penetrance was low (three out of 46), the metastasis [42,110]. It has also been shown that latency period was long (~7 months) and, more PTEN ceRNA cooperates with BRAFV600E to importantly, many other types of tumor arose promote melanomagenesis, providing further earlier (from 7 weeks of age) and more frequently evidence of the importance of PTEN regulation (in ~75%). Mouse molecular genetic technology in melanoma formation [111]. At the molecular has allowed the generation of conditional mouse level, it is important to note that PTEN defi- mutants for Pten using the CRE–LoxP system ciency can cooperate with HRASV12G hyperac- [6]. To generate melanocyte-specific transgenic tivation to promote murine melanomagenesis expression, regulatory sequences of tyrosinase [112]. The relevance for human melanoma is family genes, such as those from Tyr itself, Dct questionable as HRAS mutations are found in and Tyrp1 are used by many laboratories [100]. only 1% of cases, and concomitant mutation of The Tyr promoter has been manipulated for RAS (N, K or H) has not been found associated

future science group www.futuremedicine.com 1115 Review Conde-Perez & Larue

with PTEN deficiency in melanoma biopsies. function; such inhibitors, used in combination However, it has to be noted that NRAS and with other small-molecule inhibitors, may confer PTEN deficiency were reported in melanoma a survival advantage for patients. Further studies cells in culture [38]. Efforts are currently being are needed to fully appreciate the role of PTEN made to generate mice that accurately mimic in melanoma genesis and the importance of its human melanoma formation to allow further numerous downstream effectors, which may or characterization of the effects of PTEN func- may not be post-translationally modified dur- tion and its role in the disease. One potential ing the process. Work in this area should lead to approach could be the generation of mice that an evaluation of the usefulness of some of these can be conditionally and temporally repressed effectors both as biomarkers and therapeutic for PTEN at different periods of melanoma targets. initiation and progression using, for instance, the tetracyclin system. The strict comparison Future perspective of these different mouse melanoma models is The better knowledge of the structure and func- difficult because they present many differences tion of PTEN will allow discovery of its numer- including the genetic background. This last ous interactors, and the functions of these various parameter was shown to be very important for complexes. Such knowledge will lead to the better melanoma initiation [113]. Unfortunately, there control of such interactions. Affecting these inter- are no available data concerning progression in actions will modulate the function of the specific which invasion and metastasis are involved. complex. Another challenge will certainly be to understand the temporal importance of these Conclusion different complexes. The temporal repression The available evidence suggests that PTEN of PTEN at different periods of melanoma ini- exerts its tumor-suppressive effects via several tiation and progression using, for instance, the mechanisms. Whether it is through senescence tetra cyclin system would certainly inform us on bypass, downregulating survival kinases or by the role of this protein during melanomagenesis.u interacting with chromatin, it is clear that PTEN is an important tumor suppressor in melanoma. Financial & competing interests disclosure Premalignant lesions contain PTEN but often A Conde-Perez was supported by a fellowship from also carry a hyperproliferative mutation in the Institut Curie. This work was supported by the Ligue form of BRAFV600E. The exact mechanism of Nationale Contre le Cancer (Equipe labellisée), Institut tumorigenic induction is not known but the National sur le Cancer and Association de la Recherche evidence implicating PTEN is increasing. As a sur le Cancer. The authors have no other relevant affili-affi li- therapeutic target, PTEN seems an unlikely can- ations or financial involvement with any organization didate due to its propensity to be lost in malig- or entity with a financial interest in or financial conflict nant melanoma. However, developing strate- with the subject matter or materials discussed in the gies to target downstream components, such as manuscript apart from those disclosed. mTOR, with small-molecule inhibitors may be No writing assistance was utilized in the production an option to compensate for the loss of PTEN of this manuscript.

Executive summary Structure & function n PTEN is a phosphatase (lipid and protein) primarily found in the cytoplasm, although it can also be found in the nucleus. PTEN regulates its own phosphatase activity by appropriate folding of the protein, when it is properly post-translationally modiﬁed. Molecular biology n In melanoma, PTEN is found to be mutated (most frequently on exon 5) in 17% of melanoma cases. PTEN is deleted in 13% of melanoma cases. Human genetic diseases n PTEN may be altered in various syndromes including Cowden’s, Lhermitte–Duclos and Bannayan–Zonana, resulting in increased susceptibility to developing breast and nonmedullary thyroid carcinoma, dysplastic gliocytoma and endometrial carcinoma, but not melanoma. PTEN mouse models n Constitutive and conditional PTEN mutations have revealed the importance of this protein during homeostasis and melanomagenesis. The lack of PTEN in melanocyte stem cells renders them more resistant to hair graying. The presence of BRAF (V600E) as well as HRAS(G12V) mutations along with the absence of PTEN in melanocytes is sufﬁcient to initiate melanomagenesis.

1116 Future Oncol. (2012) 8(9) future science group PTEN & melanomagenesis Review

References suppression of BIM expression. Cancer Res. Australia. Cancer Epidemiol. Biomarkers Papers of special note have been highlighted as: 71(7), 2750–2760 (2011). Prev. 15(3), 524–526 (2006). n of interest 14. Heidorn SJ, Milagre C, Whittaker S et al. 24. Mcpherson M, Elwood M, English DR, nn of considerable interest Kinase-dead BRAF and oncogenic RAS Baade PD, Youl PH, Aitken JF. Presentation 1. Gymnopoulos M, Elsliger MA, Vogt PK. cooperate to drive tumor progression and detection of invasive melanoma in a Rare cancer-specific mutations in PIK3CA through CRAF. Cell 140(2), 209–221 high-risk population. J. Am. Acad. Dermatol. show gain of function. Proc. Natl Acad. Sci. (2010). 54(5), 783–792 (2006). 104(13), 5569–5574 (2007). USA n Shows that the action of a specific 25. Tournillac I, Picot MC, Dereure O, Guilhou 2. Samuels Y, Wang Z, Bardelli A et al. High inhibitor of a mutated form of BRAF JJ, Guillot B. [Dubreuilh melanoma: and frequency of mutations of the PIK3CA gene (BRAFV600E) leads to a resistance mediated epidemiologic and prognostic study]. Ann. in human cancers. Science 304(5670), 554 by the activation of proteins of the same Dermatol. Venereol. 126(10), 676–680 (2004). signaling pathway. (1999). 3. Stahl JM, Cheung M, Sharma A, Trivedi 15. Wagle N, Emery C, Berger MF et al. 26. Saxe N, Hoffman M, Krige JE, Sayed R, NR, Shanmugam S, Robertson GP. Loss of Dissecting therapeutic resistance to RAF King HS, Hounsell K. Malignant melanoma PTEN promotes tumor development in inhibition in melanoma by tumor genomic in Cape Town, South Africa. Br. J. Dermatol. malignant melanoma. Cancer Res. 63(11), profiling. J. Clin. Oncol. 29(22), 3085–3096 138(6), 998–1002 (1998). 2881–2890 (2003). (2011). 27. Chang AE, Karnell LH, Menck HR. 4. Elder DE, Guerry DT, Epstein MN et al. 16. Greger JG, Eastman SD, Zhang V et al. The National Cancer Data Base report on Invasive malignant melanomas lacking Combinations of BRAF, MEK, and cutaneous and noncutaneous melanoma. competence for metastasis. Am. J. PI3K/mTOR inhibitors overcome acquired A summary of 84,836 cases from the past Dermatopathol. 6(Suppl. 1), 55–61 (1984). resistance to the BRAF inhibitor decade. The American College of Surgeons 5. Herlyn M, Thurin J, Balaban G et al. GSK2118436 dabrafenib, mediated by Commission on Cancer and the American Characteristics of cultured human NRAS or MEK mutations. Mol. Cancer Cancer Society. Cancer 83(8), 1664–1678 melanocytes isolated from different stages of Ther. 11(4), 909–920 (2012). (1998). tumor progression. Cancer Res. 45(11 Pt 2), 17. Martí RM, Sorolla A, Yeramian A. New 28. Moloney FJ, Menzies SW. Key points in the 5670–5676 (1985). therapeutic targets in melanoma. Actas dermoscopic diagnosis of hypomelanotic 6. Larue L, Beermann F. Cutaneous melanoma Dermosifiliogr. 103(7), 579–590 (2012). melanoma and nodular melanoma. J. Dermatol. 38(1), 10–15 (2011). in genetically modified animals. Pigment Cell 18. Robert C, Mateus C. Anti-CTLA-4 Res. 20(6), 485–497 (2007). monoclonal antibody: a major step in the 29. Clark WH Jr, From L, Bernardino EA, 7. Friedman RJ, Rigel DS, Kopf AW. Early treatment of metastatic melanoma. Med. Sci. Mihm MC. The histogenesis and biologic detection of malignant melanoma: the role of (Paris) 27(10), 850–858 (2011). behavior of primary human malignant melanomas of the skin. Cancer Res. 29(3), physician examination and self-examination 19. Yang Z, Lei Z, Li B et al. Rapamycin inhibits 705–727 (1969). of the skin. CA Cancer J. Clin. 35(3), lung metastasis of B16 melanoma cells 130–151 (1985). through down-regulating alphav integrin 30. Situm M, Bolanca Z, Buljan M. Lentigo 8. Aldridge RB, Zanotto M, Ballerini L, Fisher expression and up-regulating apoptosis maligna melanoma – the review. Coll. RB, Rees JL. Novice identification of signaling. Cancer Sci. 101(2), 494–500 Antropol. 34(Suppl. 2), 299–301 (2010). melanoma: not quite as straightforward as (2010). 31. Bradford PT, Goldstein AM, McMaster ML, the ABCDs. Acta Derm. Venereol. 91(2), 20. Espona-Fiedler M, Soto-Cerrato V, Hosseini Tucker MA. Acral lentiginous melanoma: 125–130 (2011). A et al. Identification of dual mTORC1 and incidence and survival patterns in the United 9. Salerni G, Lovatto L, Carrera C, Puig S, mTORC2 inhibitors in melanoma cells: States, 1986–2005. Arch. Dermatol. 145(4), Malvehy J. Melanomas detected in a prodigiosin vs. obatoclax. Biochem. 427–434 (2009). follow-up program compared with Pharmacol. 83(4), 489–496 (2012). 32. Swan MC, Hudson DA. Malignant melanomas referred to a melanoma unit. 21. Deng W, Gopal YN, Scott A, Chen G, melanoma in South Africans of mixed Arch. Dermatol. 147(5), 549–555 (2011). Woodman SE, Davies MA. Role and ancestry: a retrospective analysis. Melanoma 10. Rigel DS, Russak J, Friedman R. The therapeutic potential of PI3K-mTOR Res. 13(4), 415–419 (2003). evolution of melanoma diagnosis: 25 years signaling in de novo resistance to BRAF 33. Bellows CF, Belafsky P, Fortgang IS, Beech beyond the ABCDs. CA Cancer J. Clin. inhibition. Pigment Cell Melanoma Res. 2, DJ. Melanoma in African–Americans: trends 60(5), 301–316 (2010). 248–258 (2012). in biological behavior and clinical 11. Shenenberger DW. Cutaneous malignant 22. Atefi M, Von Euw E, Attar N et al. Reversing characteristics over two decades. J. Surg. melanoma: a primary care perspective. melanoma cross-resistance to BRAF and Oncol. 78(1), 10–16 (2001).t Am. Fam. Physician 85(2), 161–168 (2012). MEK inhibitors by co-targeting the AKT/ 34. Miranda BH, Haughton DN, Fahmy FS. 12. Djordjevic B, Hennessy BT, Li J et al. mTOR pathway. PLoS ONE 6(12), e28973 Subungual melanoma: an important tip. Clinical assessment of PTEN loss in (2011) J. Plast. Reconstr. Aesthet. Surg. doi:10.1016/j. bjps.2012.03.001 (2012) (Epub ahead of endometrial carcinoma: n Shows the importance of targeting several print). immunohistochemistry outperforms gene signaling pathways in order to bypass sequencing. Mod. Pathol. 25, 699–708 some resistance associated with one single 35. Piliang MP. Acral lentiginous melanoma. (2012). signaling pathway. Clin. Lab. Med. 31(2), 281–288 (2011). 13. Paraiso KH, Xiang Y, Rebecca VW et al. 23. Boniol M, Armstrong BK, Doré JF. Variation 36. Bastian BC, Kashani-Sabet M, Hamm H PTEN loss confers BRAF inhibitor in incidence and fatality of melanoma by et al. Gene amplifications characterize acral resistance to melanoma cells through the season of diagnosis in New South Wales, melanoma and permit the detection of occult

future science group www.futuremedicine.com 1117 Review Conde-Perez & Larue

tumor cells in the surrounding skin. Cancer 49. Simpson L, Parsons R. PTEN: life as a 61. Fridberg M, Servin A, Anagnostaki L et al. Res. 60(7), 1968–1973 (2000). tumor suppressor. Exp. Cell Res. 264(1), Protein expression and cellular localization 37. Delmas V, Beermann F, Martinozzi S et al. 29–41 (2001). in two prognostic subgroups of diffuse large Beta-catenin induces immortalization of 50. Lee JO, Yang H, Georgescu MM et al. B-cell lymphoma: higher expression of melanocytes by suppressing p16INK4a Crystal structure of the PTEN tumor ZAP70 and PKC-beta II in the non-germinal expression and cooperates with N-Ras in suppressor: implications for its center group and poor survival in patients melanoma development. Genes Dev. 21(22), phosphoinositide phosphatase activity and deficient in nuclear PTEN. Leuk. Lymphoma 2923–2935 (2007). membrane association. Cell 99(3), 323–334 48(11), 2221–2232 (2007). (1999). 62. Planchon SM, Waite KA, Eng C. The n Shows that the cooperation of NRAS and nuclear affairs of PTEN. J. Cell Sci. 121(Pt b-catenin induces melanoma formation 51. Rahdar M, Inoue T, Meyer T, Zhang J, 3), 249–253 (2008). from cells located in the bulge of the hair Vazquez F, Devreotes PN. A phosphorylation-dependent intramolecular 63. Chung JH, Ostrowski MC, Romigh T, follicle containing normal melanocyte interaction regulates the membrane Minaguchi T, Waite KA, Eng C. The stem cells and transit amplifying cells. It association and activity of the tumor ERK1/2 pathway modulates nuclear also reveals that the PI3K pathway is suppressor PTEN. Proc. Natl Acad. Sci. USA PTEN-mediated cell cycle arrest by cyclin induced. 106(2), 480–485 (2009). D1 transcriptional regulation. Hum. Mol. 38. Tsao H, Zhang X, Fowlkes K, Haluska FG. 52. Wu X, Hepner K, Castelino-Prabhu S et al. Genet. 15(17), 2553–2559 (2006). Relative reciprocity of NRAS and PTEN/ Evidence for regulation of the PTEN tumor 64. Shen WH, Balajee AS, Wang J et al. MMAC1 alterations in cutaneous melanoma suppressor by a membrane-localized Essential role for nuclear PTEN in cell lines. Cancer Res. 60(7), 1800–1804 multi-PDZ domain containing scaffold maintaining chromosomal integrity. Cell (2000). protein MAGI-2. Proc. Natl Acad. Sci. USA 128(1), 157–170 (2007). 39. Hayward NK. Genetics of melanoma 97(8), 4233–4238 (2000). n Demonstrates that PTEN interacts predisposition. Oncogene 22(20), 3053–3062 53. Knobbe CB, Lapin V, Suzuki A, Mak TW. directly with chromatin-related protein (2003). The roles of PTEN in development, CENAP, which is present in the nucleus 40. Ackermann J, Frutschi M, Kaloulis K, physiology and tumorigenesis in mouse and important in the regulation of Mckee T, Trumpp A, Beermann F. models: a tissue-by-tissue survey. Oncogene chromosomal integrity. Metastasizing melanoma formation caused 27(41), 5398–5415 (2008). by expression of activated N-RasQ61K on an 65. Freeman DJ, Li AG, Wei G et al. PTEN 54. Sarbassov DD, Guertin DA, Ali SM, INK4a-deficient background. Cancer Res. tumor suppressor regulates p53 protein levels Sabatini DM. Phosphorylation and 65(10), 4005–4011 (2005). and activity through phosphatase-dependent regulation of Akt/PKB by the rictor–mTOR and -independent mechanisms. Cancer Cell 41. Gray-Schopfer VC, Cheong SC, Chong H complex. Science 307(5712), 1098–1101 3(2), 117–130 (2003). et al. Cellular senescence in naevi and (2005). immortalisation in melanoma: a role for p16? 66. Chen Z, Trotman LC, Shaffer D et al. 55. Hresko RC, Mueckler M. mTOR.RICTOR Br. J. Cancer 95(4), 496–505 (2006). Crucial role of p53-dependent cellular is the Ser473 kinase for Akt/protein kinase B senescence in suppression of PTEN-deficient 42. Halaban R. Growth factors and melanomas. in 3T3-L1 adipocytes. J. Biol. Chem. tumorigenesis. Nature 436(7051), 725–730 Semin. Oncol. 23(6), 673–681 (1996). 280(49), 40406–40416 (2005). (2005). 43. Garnett MJ, Marais R. Guilty as charged: 56. Salmena L, Carracedo A, Pandolfi PP. Tenets 67. Song MS, Carracedo A, Salmena L et al. B-RAF is a human oncogene. Cancer Cell of PTEN tumor suppression. Cell 133(3), Nuclear PTEN regulates the APC-CDH1 6(4), 313–319 (2004). 403–414 (2008). tumor-suppressive complex in a phosphatase- 44. Michaloglou C, Vredeveld LC, Soengas MS 57. Aguissa-Toure AH, Li G. Genetic alterations independent manner. Cell 144(2), 187–199 et al. BRAFE600-associated senescence-like of PTEN in human melanoma. Cell. Mol. (2011). cell cycle arrest of human naevi. Nature Life Sci. 69(9), 1475–1491 (2012). nn Shows that PTEN interacts with APC/C 436(7051), 720–724 (2005). 58. Whiteman DC, Zhou XP, Cummings MC, and promotes the formation of this 45. Chin L, Tam A, Pomerantz J et al. Essential Pavey S, Hayward NK, Eng C. Nuclear complex with CDH1 (Fzr1 and not role for oncogenic Ras in tumour PTEN expression and clinicopathologic E-cadherin), which is a haploinsufficient maintenance. Nature 400(6743), 468–472 features in a population-based series of tumor suppressor. This interaction leads (1999). primary cutaneous melanoma. Int. J. Cancer. to cell cycle division. 46. Ha L, Merlino G, Sviderskaya EV. 99(1), 63–67 (2002). 68. Garcia-Cao I, Song MS, Hobbs RM et al. Melanomagenesis: overcoming the barrier of 59. Zhou XP, Loukola A, Salovaara R et al. Systemic elevation of PTEN induces a melanocyte senescence. Cell Cycle 7(13), PTEN mutational spectra, expression levels, tumor-suppressive metabolic state. Cell 1944–1948 (2008). and subcellular localization in microsatellite 149(1), 49–62 (2012). 47. Li J, Yen C, Liaw D et al. PTEN, a putative stable and unstable colorectal cancers. Am. 69. Okumura K, Mendoza M, Bachoo RM, protein tyrosine phosphatase gene mutated in J. Pathol. 161(2), 439–447 (2002). Depinho RA, Cavenee WK, Furnari FB. human brain, breast, and prostate cancer. 60. Perren A, Komminoth P, Saremaslani P et al. PCAF modulates PTEN activity. J. Biol. Science 275(5308), 1943–1947 (1997). Mutation and expression analyses reveal Chem. 281(36), 26562–26568 (2006). 48. Steck PA, Pershouse MA, Jasser SA et al. differential subcellular 70. Kwon J, Lee SR, Yang KS et al. Reversible Identification of a candidate tumour compartmentalization of PTEN in oxidation and inactivation of the tumor suppressor gene, MMAC1, at chromosome endocrine pancreatic tumors compared with suppressor PTEN in cells stimulated with 10q233 that is mutated in multiple advanced normal islet cells. Am. J. Pathol. 157(4), peptide growth factors. Proc. Natl Acad. Sci. cancers. Nat. Genet. 15(4), 356–362 (1997). 1097–1103 (2000). USA 101(47), 16419–16424 (2004).

1118 Future Oncol. (2012) 8(9) future science group PTEN & melanomagenesis Review

71. Leslie NR, Bennett D, Lindsay YE, Stewart 82. Bonneau D, Longy M. Mutations of the and its importance for tumor progression. H, Gray A, Downes CP. Redox regulation of human PTEN gene. Hum. Mutat. 16(2), Cancer Genet. Cytogenet. 125(1), 21–26 PI3-kinase signalling via inactivation of 109–122 (2000). (2001). PTEN. EMBO J. 22(20), 5501–5510 83. Farooq A, Walker LJ, Bowling J, Audisio 96. Guldberg P, Thor Straten P, Birck A, (2003). RA. Cowden syndrome. Cancer Treat. Rev. Ahrenkiel V, Kirkin AF, Zeuthen J. 72. Lee SR, Yang KS, Kwon J, Lee C, Jeong W, 36(8), 577–583 (2010). Disruption of the MMAC1/PTEN gene by Rhee SG. Reversible inactivation of the 84. Liaw D, Marsh DJ, Li J et al. Germline deletion or mutation is a frequent event in tumor suppressor PTEN by H O . malignant melanoma 57(17), 2 2 J. Biol. mutations of the PTEN gene in Cowden . Cancer Res. Chem. 277(23), 20336–20342 (2002). disease, an inherited breast and thyroid cancer 3660–3663 (1997). 73. Chappell WH, Green TD, Spengeman JD, syndrome. Nat. Genet. 16(1), 64–67 (1997). 97. Furney SJ, Turajlic S, Fenwick K et al. McCubrey JA, Akula SM, Bertrand FE. 85. Yang MS, Kim CH, Cheong JH, Kim JM. Genomic characterisation of acral melanoma Increased protein expression of the PTEN Lhermitte–Duclos disease presenting with cell lines. Pigment Cell Melanoma Res. 25(4), tumor suppressor in the presence of hydrocephalus. Acta. Neurochir. Suppl. 113, 488–492 (2012). constitutively active Notch-1 Cell Cycle 161–165 (2012). 98. Nikolaev SI, Rimoldi D, Iseli C et al. Exome 4(10), 1389–1395 (2005). 86. Tok Celebi J, Chen FF, Zhang H, Ping XL, sequencing identifies recurrent somatic 74. Trotman LC, Wang X, Alimonti A et al. Tsou HC, Peacocke M. Identification of MAP2K1 and MAP2K2 mutations in Ubiquitination regulates PTEN nuclear PTEN mutations in five families with melanoma. Nat. Genet. 44(2), 133–139 import and tumor suppression. Cell 128(1), Bannayan–Zonana syndrome. Exp. (2012). 141–156 (2007). Dermatol. 8(2), 134–139 (1999). 99. You MJ, Castrillon DH, Bastian BC et al. 75. Wang X, Trotman LC, Koppie T et al. 87. Virchow RLK. Cellular Pathology. John Genetic analysis of Pten and Ink4a/Arf NEDD4-1 is a proto-oncogenic ubiquitin Churchill, London, UK (1859). interactions in the suppression of ligase for PTEN. Cell 128(1), 129–139 tumorigenesis in mice. Proc. Natl Acad. Sci. 88. Grille SJ, Bellacosa A, Upson J et al. The (2007). USA 99(3), 1455–1460 (2002). protein kinase Akt induces epithelial 76. Fouladkou F, Landry T, Kawabe H et al. mesenchymal transition and promotes 100. Murisier F, Guichard S, Beermann F. The ubiquitin ligase Nedd4-1 is dispensable enhanced motility and invasiveness of A conserved transcriptional enhancer that for the regulation of PTEN stability and squamous cell carcinoma lines. Cancer Res. specifies Tyrp1 expression to melanocytes. localization. Proc. Natl Acad. Sci. USA 63(9), 2172–2178 (2003). Dev. Biol. 298(2), 644–655 (2006). 105(25), 8585–8590 (2008). 89. Larue L, Bellacosa A. Epithelial– 101. Porter S, Larue L, Mintz B. Mosaicism of 77. Poliseno L, Salmena L, Zhang J, Carver B, mesenchymal transition in development and tyrosinase-locus transcription and Haveman WJ, Pandolfi PP. A coding- cancer. role of phosphatidylinositol 3´ chromatin structure in dark vs. light independent function of gene and kinase/AKT pathways. Oncogene 24(50), melanocyte clones of homozygous pseudogene mRNAs regulates tumour 7443–7454 (2005). chinchilla-mottled mice. Dev. Genet. 12(6), biology. Nature 465(7301), 1033–1038 393–402 (1991). 90. Kim D, Kim S, Koh H et al. Akt/PKB (2010). promotes cancer cell invasion via increased 102. Porter SD, Hu J, Gilks CB. Distal upstream nn Identifies a pseudogene for PTEN, which motility and metalloproteinase production. tyrosinase S/MAR-containing sequence has is actively transcribed, and consequently FASEB J. 15(11), 1953–1962 (2001). regulatory properties specific to subsets of competes with the miRNA that are melanocytes. Dev. Genet. 25(1), 40–48 91. Henle SJ, Wang G, Liang E, Wu M, Poo (1999). targeting the PTEN mRNA. It induces MM, Henley JR. Asymmetric PI(3,4,5)P3 another level of regulation for PTEN by and Akt signaling mediates chemotaxis of 103. Delmas V, Martinozzi S, Bourgeois Y, stabilizing the PTEN transcript. axonal growth cones. J. Neurosci. 31(19), Holzenberger M, Larue L. Cre-mediated recombination in the skin melanocyte 78. Berger MF, Hodis E, Heffernan TP et al. 7016–7027 (2011). lineage. Genesis 36(2), 73–80 (2003). Melanoma genome sequencing reveals 92. Puig I, Champeval D, De Santa Barbara P, frequent PREX2 mutations. Nature Jaubert F, Lyonnet S, Larue L. Deletion of 104. Tonks ID, Nurcombe V, Paterson C et al. 485(7399), 502–506 (2012). PTEN in the mouse enteric nervous system Tyrosinase-Cre mice for tissue-specific gene 79. Miller SJ, Lou DY, Seldin DC, Lane WS, induces ganglioneuromatosis and mimics ablation in neural crest and neuroepithelial- Nee LBG. Direct identification of PTEN intestinal pseudoobstruction. J. Clin. Invest. derived tissues. Genesis 37(3), 131–138 phosphorylation sites. FEBS Lett. 528(1–3), 119(12), 3586–3596 (2009). (2003). 145–153 (2002). 93. Colombo S, Champeval D, Rambow F, 105. Bosenberg M, Muthusamy V, Curley DP 80. Torres J, Pulido R. The tumor suppressor Larue L. Transcriptomic analysis of mouse et al. Characterization of melanocyte-specific PTEN is phosphorylated by the protein embryonic skin cells reveals previously inducible Cre recombinase transgenic mice. kinase CK2 at its C terminus: implications unreported genes expressed in melanoblasts. Genesis 44(5), 262–267 (2006). for PTEN stability to proteasome-mediated J. Invest. Dermatol. 132(1), 170–178 (2012). 106. Yajima I, Belloir E, Bourgeois Y, Kumasaka degradation. J. Biol. Chem. 276(2), 993–998 94. Reifenberger J, Wolter M, Boström J et al. M, Delmas V, Larue L. Spatiotemporal gene (2001). Allelic losses on chromosome arm 10q and control by the Cre-ERT2 system in 81. Al-Khouri AM, Ma Y, Togo SH, Williams mutation of the PTEN (MMAC1) tumour melanocytes. Genesis 44(1), 34–43 (2006). S, Mustelin T. Cooperative phosphorylation suppressor gene in primary and metastatic 107. Guyonneau L, Murisier F, Rossier A, Moulin of the tumor suppressor phosphatase and malignant melanomas. Virchows Arch. A, Beermann F. Melanocytes and tensin homologue (PTEN) by casein kinases 436(5), 487–493 (2000). pigmentation are affected in dopachrome and glycogen synthase kinase 3beta. J. Biol. 95. Poetsch M, Dittberner T, Woenckhaus C. tautomerase knockout mice. Mol. Cell. Biol. Chem. 280(42), 35195–35202 (2005). PTEN/MMAC1 in malignant melanoma 24(8), 3396–3403 (2004).

future science group www.futuremedicine.com 1119 Review Conde-Perez & Larue

108. Inoue-Narita T, Hamada K, Sasaki T et al. 110. Damsky WE, Curley DP, Santhanakrishnan 112. Nogueira C, Kim KH, Sung H et al. Pten deficiency in melanocytes results in M et al. Beta-catenin signaling controls Cooperative interactions of PTEN deficiency resistance to hair graying and susceptibility metastasis in Braf-activated Pten-deficient and RAS activation in melanoma metastasis. to carcinogen-induced melanomagenesis. melanomas. Cancer Cell 20(6), 741–754 Oncogene 29(47), 6222–6232 (2010). Cancer Res. 68(14), 5760–5768 (2008). (2011). 113. Longvert C, Gros G, Beermann F, Marais R, 109. Dankort D, Curley DP, Cartlidge RA et al. 111. Karreth FA, Tay Y, Perna D et al. In vivo Delmas V, Larue L. Murine cutaneous Braf(V600E) cooperates with Pten loss to identification of tumor-suppressive PTEN melanoma models. Importance of the genetic induce metastatic melanoma. Nat. Genet. ceRNAs in an oncogenic BRAF-induced background. Ann. Pathol. 31(5 Suppl.), 41(5), 544–552 (2009). mouse model of melanoma. Cell 147(2), S70–S73 (2011). 382–395 (2011). n Shows that BRAF and PTEN may cooperate to induce melanoma in vivo n Complementary study to [77] in which the ive summary using a relevant mouse model. authors demonstrate that ceRNA is regulating the PTEN mRNA.

1120 Future Oncol. (2012) 8(9) future science group