US 200701.80574A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2007/0180574 A1 Penner et al. (43) Pub. Date: Aug. 2, 2007
(54) METHODS FOR BREEDING GLYPHOSATE Publication Classification RESISTANT PLANTS AND COMPOSITIONS THEREOF (51) Int. Cl. AOIH 5/00 (2006.01) (76) Inventors: Donald Penner, Williamston, MI (US); CI2N 5/82 (2006.01) Marulak Simarmata, Lansing, MI (52) U.S. Cl...... 800/278; 800/320 (US) (57) ABSTRACT Correspondence Address: A plant comprising SEQ. ID. NO. 2 or a functional portion HARNESS, DICKEY & PIERCE, P.L.C. thereof, wherein SEQ ID NO. 2 is not native to said plant. P.O. BOX 828 A glyphosate resistant grass of economic value comprises a BLOOMFIELD HILLS, MI 48.303 (US) nucleic acid molecule that encodes a EPSPS enzyme. In Some embodiments, the nucleic acid molecule comprises a (21) Appl. No.: 11/656,817 sequence of SEQ. ID. NO. 1, or a functional portion thereof. In some embodiments, the EPSPS enzyme can be a polypep (22) Filed: Jan. 23, 2007 tide molecule comprising an amino acid sequence that is essentially of SEQ. ID. NO. 2, or portion thereof. Embodi Related U.S. Application Data ments include a DNA construct comprising a SEQ. ID. NO. 1 or a functional portion thereof and transgenic methods for (60) Provisional application No. 60/761.216, filed on Jan. inserting the DNA construct into a plant. Some embodi 23, 2006. Provisional application No. 60/761,710, ments include non-transgenic glyphosate resistant turf filed on Jan. 23, 2006. grasses. Patent Application Publication Aug. 2, 2007 Sheet 1 of 4 US 2007/0180574 A1
80
6 O
4 O
2 O
f : ...... K. Control O. lx lx 10x 100X Glyphosate dose (X = 1.12 kgha")
FIG. 1
100
8 O
6 O
4 O
2 O
O Control l 10 100 1000 10,000 Glyphosate (M)
FIG 3 Patent Application Publication Aug. 2, 2007 Sheet 2 of 4 US 2007/0180574 A1
poly A mRNA
CDNA dT-anchor
FP1-> 1- RP1
A-tail a- RP2 --> --- FP2 Anchor primer
dT-anchor RP3
-> 1H Anchor primer RP4
(5' end fragment) (main fragment) (3' end fragment)
Primer Abreviation.
FP1 5'-GAT GCC AAG GAG GAA GTA AAG-3' FP2 5'-TGC TAT CAGAGA TGT TGC GTC CTG-3' RPI 5-TCT CTG GTG GCG TGA TAATG-3 RP2 5'-AAC AGG TGG GCA GTC AGT G-3' RP3 5-ATAGGA CGCTCC CTCATT CTTGGT-3 RP4 5 TTT CCA CCA GCA GCT ACT ACA GCA-3' dT-anchor 5'-GAC CAC GCG TAT COSA TGT CGA CTTTTTTTTTTT-3' Anchor Printer 5'-GAC CAC GCG TAT COGA TGT CGA C-3'
FIG 2 Patent Application Publication Aug. 2, 2007 Sheet 3 of 4 US 2007/0180574 A1
100
80
60
40
20
(S 0.5x) (0.5 - 8x) (R 8x) Resistance Class
FIG. 4
100
8O
60
40
(S 0.25x) (0.5 - 8x) (R 8x) Resistance Class FIG. 5 Patent Application Publication Aug. 2, 2007 Sheet 4 of 4 US 2007/0180574 A1
100
8 O
60
40
O lx 2x 4x 6x 8x 10x 12x Glyphosate(x = 1.12 kg aiha) FIG. 6
0. 3
0. 2
0.1
Glyphosate (mM)
FIG. 7 US 2007/0180574 A1 Aug. 2, 2007
METHODS FOR BREEDING GLYPHOSATE 0006 The present disclosure also provides a glyphosate RESISTANT PLANTS AND COMPOSITIONS resistant plant comprising a non-transgenic glyphosate-re THEREOF sistant Lolium rigidum germplasm. In some embodiments, the present disclosure provides germplasm deposited in the CROSS-REFERENCE TO RELATED ATCC as Penner ryegrass Assession No. XXXX. In some APPLICATIONS embodiments the germplasm comprises a nucleic acid mol ecule of sequence of SEQ. ID. NO. 1, or a functional portion 0001) This application claims the benefit of U.S. Provi thereof. The germplasm can comprise a polypeptide mol sional Application No. 60/761.216 filed on Jan. 23, 2006. ecule of a glyphosate resistant, plant EPSPS enzyme. In This application claims the benefit of U.S. Provisional Some embodiments, the germplasm comprises a polypeptide Application No. 60/761,710 filed on Jan. 23, 2006. The molecule comprising an amino acid sequence of SEQ. ID. disclosures of the above applications are incorporated herein NO. 2, or a functional portion thereof. In some embodi by reference. ments, the germplasm comprises two different glyphosate resistant genes. In some embodiments, the germplasm com INTRODUCTION prises at least one glyphosate resistant protein. The germ plasm can be used in a breeding program or crossed with a 0002 Glyphosate, N-(phosphonomethyl)glycine, is the sexually compatible plant. world's most widely used herbicide. It is sold commercially under such names as RoundUp(R) and Touchdown(R). Gly 0007. In various embodiments, the present invention pro phosate is a foliar non-selective herbicide and has no activity vides grasses or other plants that are in in a golf course in the soil. Glyphosate can be used pre-plant to control fairway, a golf course rough, a golf course tee box, a lawn, emerged weeds in a no-tillage planting system or post an athletic field, a park, a roadside, a right of way for a utility emergence by spot and direct application to control an or a railway, a trail, seed, or Sod. In various embodiments, extensive range of weeds, as well as to control weeds in Such plants are plants of economic value, including glypho glyphosate resistant crops such as, for example, soybeans, sate resistant turfgrass. The turfgrass can be, for example, corn, canola, and cotton. Typically, glyphosate resistant selected from ryegrass, fescue, combinations thereof, and crops are designed using genetic engineering. Naturally hybrids thereof. In some embodiments, the present disclo occurring glyphosate resistant plants are very rare and Such Sure provides glyphosate resistant forage grass. In some rare plants are typically weed varieties. There is a need for embodiments, then present disclosure provides glyphosate more glyphosate resistant crop and ornamental plants and, resistant cereal crops such rye and wheat. especially, glyphosate resistant turf and forage grasses. 0008. The present disclosure also provides seed of gly phosate resistant plants, as well as the mixtures comprising SUMMARY Such seed. The present disclosure further provides progeny, 0003. The present disclosure provides various embodi vegetative sprigs, tillers, tissues cultures, cell protoplast, ments of technology regarding plants having resistance to clones, and/or germplasm of the plants. glyphosate. Various embodiments relate, for example, to grasses having economic value and other plants that com 0009. The present disclosure further provides methods prise genetic material comprising certain amino acid for creating a lawn that is substantially free of a weed variety sequences, comprise certain enzymes, are bred using certain to which the lawn is susceptible. The method includes non-transgenic methods, comprise aspects of certain depos providing a lawn comprising a non-transgenic glyphosate resistant perennial turf grass and applying to the lawn a ited germplasm, or are produced using transgenic methods. herbicidally amount of a glyphosate compound. 0004 For example, the present disclosure provides a plant comprising a polypeptide molecule of a glyphosate DRAWINGS resistant EPSPS enzyme, the polypeptide molecule compris ing an amino acid sequence of SEQ. ID. NO. 2, or a 0010. The skilled artisan will understand that the draw functional portion thereof. In some embodiments, the ings, described herein, are for illustration purposes only. The EPSPS enzyme is not natural to the plant. SEQ. ID. NO. 2 drawings are not intended to limit the scope of the present or functional portion thereof can be encoded by a nucleic disclosure in any way. acid sequence comprising SEQ. ID NO. 1 or a functional portion thereof. In some embodiments, the polypeptide 0011 FIG. 1 is a graph illustrating a dose response curve molecule has about 80% or greater identity with SEQ. ID. for plant injury of resistant, sensitive, and intermediate NO. 2. In some embodiments, the nucleic acid sequence has California rigid ryegrass; about 93% or greater identity with SEQ. ID, NO. 1. 0012 FIG. 2 illustrates a scheme of 5"/3' Random Ampli 0005 The present disclosure also provides a glyphosate fication cDNA End Polymerase Chain Reaction (RACE resistant grass of economic value comprising a nucleic acid PCR) of an EPSPS gene from rigid ryegrass; molecule that encodes a EPSPS enzyme. In some embodi 0013 FIG. 3 is a graph illustrating EPSPS activity of ments, the nucleic acid molecule comprises a sequence of glyphosate resistant (R) and sensitive (S) biotypes of the SEQ. ID. NO. 1, or a functional portion thereof. In various California rigid ryegrass in the presence of glyphosate; embodiments, the nucleic acid molecule has greater than 97% identity with SEQ. ID, NO. 1. In some embodiments, 0014 FIG. 4 is a graph illustrating the distribution of the EPSPS enzyme can be a polypeptide molecule compris glyphosate resistant classes in a F population of plants from ing an amino acid sequence that is essentially of SEQ. ID. a cross between perennial ryegrass and glyphosate resistant NO. 2, or portion thereof. rigid ryegrass; US 2007/0180574 A1 Aug. 2, 2007
0.015 FIG. 5 is a graph illustrating the distribution of the stated features. Specific examples are provided for glyphosate resistant classes in a single Fabc population of illustrative purposes of how to make and use the composi 371 plants derived from a backcross between a glyphosate tions and methods of this technology and, unless explicitly resistant F hybrid plant with a sensitive perennial ryegrass; stated otherwise, are not intended to be a representation that 0016 FIG. 6 is a graph illustrating a glyphosate sensi given embodiments of this technology have, or have not, tivity of the resistant (R) clone from Fabc hybrid 3 and 4 been made or tested. WAT with glyphosate; and 0022. The present technology provides glyphosate-resis tant plants. The term "glyphosate' as used herein refers to 0017 FIG. 7 is a graph illustrating the results of expres N-phosphonomethylglycine and its salts. Glyphosate is the sion Agrobacterium tumefaciens transformed with the gly active ingredient of RoundUp(R) herbicide (Monsanto Co.). phosate-resistant EPSPS clone (O) and wild-type Agrobac The term “resistant as used herein refers to a reduced toxic terium tumefaciens (Q) after growth in the presence of effect of glyphosate on the growth and development of glyphosate for 48 hours. plants. DETAILED DESCRIPTION 0023. In susceptible plant species, glyphosate inhibits biosynthesis of the aromatic amino acids tryptophan, 0018. The following description of technology is merely tyrosine, and phenylalanine. In the shikimate pathway, gly exemplary in nature of the Subject matter, manufacture and phosate competes with Substrate phosphoenol pyruvate, use of one or more inventions, and is not intended to limit PEP for binding site of 5-enolpyruvylshikimate-3-phos the scope, application, or uses of any specific invention phate synthase (EPSPS: E.C. 2.5.1.19). Glyphosate is the claimed in this application or in Such other applications as only herbicide known to inhibit EPSPS. Metabolism of may be filed claiming priority to this application, or patents glyphosate in higher plants is very limited and not well issuing therefrom. The following definitions and non-limit understood. Glyphosate may not be readily metabolized if ing guidelines must be considered in reviewing the descrip applied at phytotoxic rates. It has been reported that gly tion of the technology set forth herein. In particular, phosate metabolism to aminomethylphoSonic acid although the present disclosure will be discussed in some (“AMPA) is slow. embodiments as relating to glyphosate resistance in grasses, as well as plant-derived 5-enolpyruvylshikimate-3-phos 0024. After glyphosate use for more than 30 years, some phate synthase (“EPSPS) enzymes, such discussion should species of weeds resistant to glyphosate have been reported not be regarded as limiting the present disclosure to only in several countries. Glyphosate resistance has been reported Such applications. for rigid ryegrass (Lolium rigidium Gaud.) in Australia and California, USA; for goosegrass (Eleusine indica) in Malay 0019. The headings (such as “Introduction' and “Sum sia; for horseweed (Conyza Canadensis) in Delaware, USA; mary') and Sub-headings used herein are intended only for for Italian ryegrass (Lolium multiflorum) in Chile; for hairy general organization of topics within the present disclosure, fleabane (Conyza bonariensis) and for buckhorn plantain and are not intended to limit the disclosure of the technology (Plantago lanceolata) in South Africa. The inheritance of or any aspect thereof. In particular, Subject matter disclosed glyphosate resistance has been studied in goosegrass from in the “Introduction' may include novel technology and may Malaysia, rigid ryegrass from Australia and horseweed in not constitute a recitation of prior art. Subject matter dis the USA. These studies concluded that the inheritance of closed in the “Summary is not an exhaustive or complete glyphosate resistance was nuclear controlled by a single disclosure of the entire Scope of the technology or any semi-dominant gene. However, it has been reported that embodiments thereof. Classification or discussion of a mate multiple genes are responsible for glyphosate resistance in rial within a section of this specification as having a par another population of rigid ryegrass from Australia. ticular utility is made for convenience, and no inference should be drawn that the material must necessarily or solely 0025 The present disclosure provides various methods function in accordance with its classification herein when it for producing plants having resistance to glyphosate. is used in any given composition. Embodiments include non-transgenic methods, transgenic methods, and methods using certain deposited material as 0020. The citation of references herein does not consti further described herein. tute an admission that those references are prior art or have 0026. The present disclosure provides glyphosate-resis any relevance to the patentability of the technology dis tant plants, including plants comprising a glyphosate resis closed herein. All references cited in the “Description' tant ESPS enzyme that is not naturally occurring in such section of this specification are hereby incorporated by plants or genetic material not naturally occurring Such plants reference in their entirety, for all purposes. In the event that that encodes a glyphosate resistant ESPS enzyme. The term one or more of the incorporated references, literature, and “plant’ as used herein encompasses any higher plant and similar materials differs from or contradicts this application, progeny thereof, including monocots such as, for example, including but not limited to defined terms, term usage, grass, corn, rice, wheat, barley, etc.; dicots Such as, for described techniques, or the like, this application controls. example, soybean, cotton, tomato, potato, Arabidopsis, 0021. The description and specific examples, while indi tobacco, etc.; gymnosperms such as, for example, pines, firs, cating embodiments of the technology, are intended for cedars, etc.; fruit Such as, for example Strawberries, blue purposes of illustration only and are not intended to limit the berries, cherries, apples, pears, peaches, oranges and other scope of the technology. Moreover, recitation of multiple citrus, grapes, etc.; and germplasm and other parts of Such embodiments having stated features is not intended to plants, including reproductive units of a plant Such as, for exclude other embodiments having additional features, or example, seeds, bulbs, tubers, pollen, spores, corms, rhi other embodiments incorporating different combinations of Zomes, cuttings, sprigs, tillers, grafts, buds, cones, seedpods, US 2007/0180574 A1 Aug. 2, 2007 clones, embryos, tissue cultures, endosperm, ovules, of a given method, it is contemplated that Such plants may cuticles, meristems, flowers and other parts or tissues from be made by other methods, and that other plants may be which the plant can be reproduced. In various embodiments, made by Such methods. the plant is an "ornamental plant species or cultivar that is Non Transgenic Glyphosate Resistant Plants and Methods of grown for its beauty in its end use, rather a value at harvest Making or as forage, in for example a garden, a park, or as a feature in a landscape design. For example, a homeowner may grow 0029. The present technology provides in various ornamental plants to beautify a home area, or a flower embodiments, non-transgenic glyphosate-resistant plants. garden for cut flowers or for simple enjoyment. Ornamental As referred to herein, the term “non-transgenic’ refers to plants include houseplants and plants used in outdoor gar plants derived from other plants to obtain glyphosate resis dening or landscaping, such as for example shrubs, flowers, tant characteristics using breeding or similar techniques not evergreens, flowering trees, and grasses. In some embodi including genetic transformation, i.e., such that the plant ments, such plants include cereals, legumes, forage crops, does not containing a transgene. Such plants are generally oilseed crops, fiber crops, vegetable crops, grasses, turf not considered to be a genetically modified organism grasses, Sugarcane, Sugar beet, tobacco, forest trees, fruit (“GMO). It is understood, however, that such plants may trees, fruit bushes, ornamental annuals, ornamental peren have characteristics that are essentially identical to trans nials and the like. genic plants, or may be non-transgenically derived from plants that are transgenically produced for purposes other 0027. In some embodiments, the present technology pro than obtaining glyphosate resistance. In some embodiments, vides grasses of economic value. The term "a grass of such plants may be hybrids. The term “hybrid as used economic value” as used herein refers to a plant from the herein refers to seed or plants produced as the result of family Gramineae having an economic value (typically inter-species fertilization as opposed to seed produced as the measured in monetary units) in a marketplace for at least one result of fertilization of a female gamete by a male gamete of its seed, sod, harvest, or forage. Examples of a grass of from the same species. The term “transformation” as used economic value include but are not limited to turfgrasses, herein refers to a process of introducing an exogenous forage grasses, wheat, rye (the cereal), rice, corn, bamboo, nucleic acid sequence (such as, for example, a vector, and ornamental grasses. In some embodiments, the present recombinant nucleic acid molecule) into a cell or protoplast disclosure provides glyphosate resistant cereal crops such as so that exogenous nucleic acid is incorporated into a chro rye, triticale and wheat. The present disclosure further mosome or plastid genome or is capable of autonomous provides glyphosate resistant forage grass. In some embodi replication. The terms “transformed or “transgenic” as used ments, the plant is a glyphosate resistant turf grass. A herein refer to a cell, tissue, organ, or organism into which “turfgrass” is a grass when regularly mowed forms a dense has been introduced a foreign nucleic acid, such as a growth of leaf blades and roots. Turfgrass is a major recombinant vector. Transformation may be accomplished agricultural crop that covers over 50 million acres annually by a variety of means known to the art including calcium and is the only crop that increases with urban development. phosphate-DNA co-precipitation, DEAE-dextran-mediated Examples of turfgrass include but are not limited to ryegrass, transfection, polybrene-mediated transfection, glass beads, bent grass, Zyosua, fescue, bluegrass, festolium, and ber electroporation, microinjection, liposome fusion, lipofec mudagrass. In various embodiments, the turfgrass is a rye tion, protoplast fusion, viral infection, biolistics (such as, for grass, a blue grass, a fescue, festolium, combinations example, particle bombardment), Agrobacterium infection, thereof, hybrids thereof and derivatives thereof. A glypho and the like. A “transgenic’’ or “transformed cell or organ sate resistant turfgrass may be created by a method of this ism also includes progeny of the cell or organism and invention and then bred into other turfgrass for economi progeny produced from a breeding program employing Such cally desirable traits. Turfgrass can be found on, for example a “transgenic' plant as a parent in a cross and exhibiting an but not limited to, golf courses, on athletic fields, in parks, altered phenotype resulting from the presence of the foreign in lawns, on School grounds, roadsides, right of ways, under nucleic acid. The term “transgene' as used herein refers to power lines, on trails, and maybe sold as seed or as Sod. In any nucleic acid sequence introduced into a cell or organism various embodiments, the present disclosure provides via transformation. The term transgene also encompasses grasses or other plants that are in in a golf course fairway, a the component parts of a native plant gene modified by golf course rough, a golf course tee box, a lawn, an athletic insertion of a nucleic acid sequence by directed recombina field, a park, a roadside, a right of way for a utility or a tion. railway, a trail, seed, or Sod. In various embodiments, the present technology provides a "lawn' comprising a stand of 0030. In various embodiments, such plants are bred or grass having desirable, largely ornamental, features that may otherwise derived from grasses for the genus Lolium, includ be planted by seed, sod or other method or maintained for ing Lolium rigidium. The genus Lolium includes five species commercial, residential or other purposes. In some embodi worldwide. They can be separated into the allogamus (self ments, the lawn may be a golf course fairway, a golf course incompatible) group including Lolium perenne L. (perennial rough, a golf green, an athletic field, a park, a residential ryegrass), Lolium multiflorum Lam. (annual ryegrass), and yard, or a commercial landscape. Lolium rigidun Gaud. (rigid ryegrass) and the autogamus (self-compatible) group including Lolium tunnelentum L. and 0028. It is understood that not all of said plants may be Lolium remotum Schrank. Allogamus plants are self-incom obtained using all methods described herein. The selection patible and naturally out-cross within or between species in of one or more of Such methods for making a given plant of the same genus. Ryegrass is diploid having 14 chromosomes the present technology is, however, within the skill of one of (2n=14), however, forage ryegrass may be a tetraploid ordinary skill in the art. Moreover, while production of a having 28 chromosomes (4n=28). In some embodiments, the given plant may be specifically described herein in context non-transgenic glyphosate resistant grass can be a rye grass US 2007/0180574 A1 Aug. 2, 2007 hybrid and in Some embodiments, a non-transgenic glypho sequences. An alignment of the two sequences is performed sate resistant grass can be a hybrid wherein one parent is a by a suitable computer program. The number of matching glyphosate resistant Lolium rigidium. bases or amino acids is divided by the total number of bases or amino acids, and multiplied by 100 to obtain a percent 0031. The origin of rigid ryegrass has been proposed to identity. For example, if two 580 base pair sequences had be from Europe. Breeding methods used for the first released 145 matched bases, they would be 25 percent identical. If the rigid ryegrass cultivar in the USA are natural selection and two compared sequences are of different lengths, the number rouging. These methods identify and dispose of abnormal of matches is divided by the shorter of the two lengths. For plants and those with desirable characteristics are used as example, if there are 100 matched amino acids between 200 parents to generate the following cycles. Individual plants, and about 400 amino acid proteins, they are 50 percent which have specified phenotypic characteristics, are selected identical with respect to the shorter sequence. If the shorter from the population and used for parents of the new gen sequence is less than 150 bases or 50 amino acids in length, eration. the number of matches are divided by 150 (for nucleic acid 0032. In some embodiments, a non-transgenic glyphosate bases) or 50 (for amino acids), and multiplied by 100 to resistant grass, e.g., turf grass, comprises a nucleic acid obtain a percent identity. In some embodiments, glyphosate molecule that encodes a glyphosate resistant EPSPS resistant grass of economic value comprises a glyphosate enzyme. The term “encode' as used herein refers to chro resistant EPSPS enzyme and the enzyme can be substan mosomal DNA, plasmid DNA, cDNA, or synthetic DNA tially similar to SEQ. ID. NO. 2, or a fragment thereof. The from which a cell, or a complete set of transcription and term "equivalent residue position' as used herein is a translation functions in vitro, may produce any of the position that is functionally equivalent in an EPSPS enzyme proteins discussed herein. Some embodiments include a to a residue position of a different EPSPS enzyme. Examples plant comprising a nucleic acid molecule that encodes the of equivalent residue position include the following: residue glyphosate resistant EPSPS enzyme of SEQID. NO. 2, and position 53 of SEQ. ID. NO. 2 is equivalent to residue glyphosate resistant EPSPS proteins having a 80% identity position 101 of SEQ. ID. NO. 2. The terms “amino-acid thereto, and functional portions thereof. The terms “protein, substitutions' and “amino-acid variants' as used herein refer 'polypeptide.'"peptide,”“encoded product,”“amino acid to preferable substitutions of single amino-acid residue for sequence' as used herein are used interchangeably to refer another amino-acid residue at any position within the pro to compounds comprising amino acids joined via peptide tein. Substitutions, deletions, insertions or any combination bonds. A "protein’ encoded by a gene is not limited to the thereof can be combined to arrive at a final construct. amino acid sequence encoded by the gene, but includes post-translational modifications of the protein. The term 0034. In some embodiments, the non-transgenic glypho “amino acid sequence' as used herein refers to an amino sate resistant grass comprises a functional portion of SEQ. acid sequence of a protein molecule, the term "amino acid ID. N.O. 1. In some embodiments, the non-transgenic gly sequence' and like terms, such as “polypeptide' or “protein’ phosate resistant grass comprises a glyphosate resistant are not meant to limit the amino acid sequence to the EPSPS enzyme that comprises a functional portion of SEQ. complete, native amino acid sequence associated with the ID, NO. 2. recited protein molecule. Furthermore, an "amino acid 0035) In some embodiments, the non-transgenic glypho sequence' can be deduced from the nucleic acid sequence sate resistant grass comprises a portion of a gene that encoding the protein. The deduced amino acid sequence encodes SEQ. ID. NO. 2 as a functional portion thereof. The from a coding nucleic acid sequence includes sequences term "gene' as used herein refers to a nucleic acid sequence which are derived from the deduced amino acid sequence such as, for example, chromosomal DNA, plasmid DNA, and modified by post-translational processing, where modi cDNA, synthetic DNA, or other DNA that encodes a pep fications include but not limited to glycosylation, hydroxy tide, polypeptide, protein, precursor or RNA molecule, and lations, phosphorylations, and amino acid deletions, Substi regions flanking the coding sequence involved in the regu tutions, and additions. Thus, an amino acid sequence lation of expression. The term 'gene' encompasses the comprising a deduced amino acid sequence is understood to regions of a structural gene that encode a protein and include post-translational modifications of the encoded and includes sequences located adjacent to the coding region on deduced amino acid sequence. In some embodiments the both the 5' and 3' ends for a distance of about 1 kb on either glyphosate resistant EPSPS according to the present disclo end Such that the gene corresponds to the length of the sure, can include a chloroplast transit peptide (CTP). The full-length mRNA. A functional polypeptide can be encoded CTP assists in carrying the EPSPS from its site of synthesis by a full-length coding sequence or by any portion of the in the cytoplasm to the chloroplast. The CTP is cleaved from coding sequence as long as the desired activity or functional the EPSPS at the chloroplast to create a functional EPSPS properties of the polypeptide are retained. The term “por enzyme. tion” as used herein in reference to a gene refers to frag 0033. In some embodiments, the nucleic acid molecule ments of that gene. The fragments may range in size from a that encodes a glyphosate resistant EPSPS enzyme can few nucleotides to the entire gene sequence minus one include a sequence that is substantially similar to SEQ. ID. nucleotide. NO. 1, or a fragment thereof. In some embodiments, the 0036) The terms “fragment of an EPSPS gene' or “por nucleic acid molecule has an identity of about 93% or tion of an EPSPS gene' as used herein refer to a portion of greater with the SEQ. ID. NO. 1 and having a serine encoded a full-length EPSPS gene nucleic acid that is of at least a at residue position 101. In some embodiments, the nucleic minimum length capable of expressing a protein with acid molecule has an identity of greater than 97% with SEQ. EPSPS activity. The term “enzyme” as used herein refers to ID, NO. 1. The term “identity” as used herein refers to the molecules or molecule aggregates that are responsible for degree of similarity between two nucleic acid or protein catalyzing chemical and biological reactions. A molecule US 2007/0180574 A1 Aug. 2, 2007
that catalyzes chemical and biological reactions is referred isolated DNA molecule encodes the glyphosate resistant to as “having enzyme activity” or “having catalytic activity.” EPSPS enzyme of SEQ. ID. NO. 2, and the isolated DNA 0037. In some embodiments, a non-transgenic glyphosate molecule can be the nucleic acid sequence of SEQ. ID. NO. resistant grass comprises a polypeptide molecule of glypho 1. sate resistant plant EPSPS enzyme. In some embodiments, 0040 Traditional breeding methods include selecting and the polypeptide molecule comprises an amino acid sequence Sowing the seeds from the strongest, most desirable plants to substantially similar to SEQ. ID. NO. 2, or any functional produce the next generation of crops. The term “selection portion thereof. In some embodiments, a non-transgenic as used herein refers to the process of determining the glyphosate resistant grass comprises a glyphosate resistant relative resistance of a cultivar to glyphosate unless stated EPSPS enzyme which has an identity to any one of SEQ. ID. otherwise. The term “cultivar” as used herein refers to a NO. 2, of greater than about 80%. In some embodiments, a group of plants group of plants that have certain phenotypes glyphosate resistant EPSPS enzyme may be substantially in common and for which those phenotypes show little to no similar to at least one of SEQ. ID. NO. 2, or a functional plant-to-plant variation. The term “cultivated as used portion thereof. In some embodiments, a non-transgenic herein refers to a plant purposely grown under agricultural glyphosate resistant grass comprises a polypeptide molecule conditions, as opposed to a "weed’ which is unintentionally comprising essentially SEQ. ID. NO. 2 that provides a grown under agricultural conditions. glyphosate resistant enzyme. In some embodiments, the non-transgenic glyphosate resistant turf grass comprises a 0041 Traditional plant breeding methods include wide gene substantially similar to SEQ. ID. NO. 1 that operably crosses with related wild and cultivated species for a desired encodes SEQ. ID. NO. 2. In some embodiments, the present trait and may involve a long process of crossing back to the disclosure provides an isolated nucleic acid molecule com commercial parent to remove undesirable genes. The term prising SEQ. ID. NO. 1 that encodes a glyphosate resistant, “trait” as used herein refers to an observable and/or mea plant-derived EPSPS enzyme. In some embodiments, SEQ. Surable characteristics of a plant. The term “wild-type' as ID. NO. 1 is isolated from a ryegrass species. In some used herein in reference to a genotype or a phenotype embodiments, SEQ. ID. NO. 1 is isolated from Lolium common throughout a large population of individuals. A rigidum. In some embodiments, an isolated nucleic acid functional wild-type gene is that which is most frequently molecule comprising a nucleic acid sequence has an identity observed in a population and is thus arbitrarily designated of greater than about 93% to SEQ. ID. NO. 1 and having a the “normal” or “wild-type' form of the gene. In contrast, serine encoded at residue position 101. In some embodi the term “modified’ or “mutant” when made in reference to ments, an isolated nucleic acid molecule comprising a a gene or to a gene product refers, respectively, to a gene or nucleic acid sequence has an identity of greater than about to a gene product which displays modifications in sequence 97% to SEQ. ID, NO. 1. and/or functional properties (such as, for example, altered characteristics) when compared to the wild-type gene or 0038. In some embodiments, SEQ. ID, NO. 1 is isolated gene product. The term “native' as used herein refers to a from germplasm of the ATCC deposit of Penner ryegrass naturally-occurring (“wild-type’) nucleic acid or polypep (Assession No. XXXX). The terms plant 'germplasm' or tide. The term “allele' as used herein refers to a particular “genetic material as used herein refer to the reproductive or variant of a gene when more than one form of the gene vegetative propagating material of plants and includes any occurs within a population. The terms “recessive,”“recessive raw genetic material from plants required by breeders for the gene.” and “recessive phenotype' as used herein refer to an development of hybrids and/or improved cultivars. Plant allele that lacks a phenotype or produces a weakly expressed germplasm or genetic material can be living tissue from phenotype when two alleles for a certain locus are present at which new plants can be grown, for example, seed or the same time as in a "heterozygote.” The terms “dominant, another plant part, Such as, a leaf, a root, a piece of stem, 'dominant gene.” and "dominant phenotype' as used pollen, ovule, a stamen, a pistil, spores, corms, rhizomes, herein refer to an allele that contributes the majority of a cuttings, grafts, buds, cones, seedpods, a cuticle, a crown, a phenotype in the presence of a second allele. meristem, or cells that can be cultured into a whole plant, and can contain the genetic information for the plants 0042. In some embodiments, breeding methods include heredity makeup. The term "isolated as used herein when mutation studies, composite crosses and evolutionary breed referring to an "isolated nucleic acid is one that has been ing, male sterile facilitated recurrent selection and commer Substantially separated or purified away from other nucleic cial hybrids from balanced tertiary trisomics and from acid sequences in the cell of the organism that the nucleic cytoplasmic male sterility. acid naturally occurs such as, for example, other chromo 0043. In various embodiments, through breeding it is somal and extrachromosomal DNA and RNA, by conven possible to combine traits found in two or more individual tional nucleic acid-purification methods. The term also plants and to transmit those traits to the progeny of those embraces recombinant nucleic acids and chemically synthe plants. Hybrid breeding is an advanced form of breeding. sized nucleic acids. Hybrid plants result from crosses between two different 0039. In some embodiments, the present disclosure pro varieties or inbreeds. For example, starting from two inbred vides an isolated polypeptide molecule comprising SEQ. ID. lines with poor yield their crossing results in high yielding NO. 2 that provides a glyphosate resistant EPSPS enzyme. progenies. Hybrids are often superior over non-hybrid vari In some embodiments, SEQ. ID. NO. 2 is encoded by SEQ. eties in vigor, yield, uniformity, as well as in other charac ID. NO. 1. In some embodiments, SEQ. ID. NO. 2 is isolated ters, and this is the main reason for their agricultural value. from Lolium rigidium. In some embodiments, SEQ. ID. NO. In producing hybrid seed, the two varieties are generally 2 is isolated from germplasm of the ATCC deposit of Penner grown in proximity for effective pollination; one variety ryegrass (Assession No. XXXX). In some embodiments, an serves as the female (egg) parent and the other as the male US 2007/0180574 A1 Aug. 2, 2007
(pollen) parent. Natural pollination is brought about by wheatxmaize), there will be a stimulating effect which either wind, insects, or other animals. In the past, crossing causes that the newly developing embryo contains only the two varieties on a large scale is a very difficult task because chromosomes from the female gamete (half the number of the plants of many crop species bear both male and female chromosomes of a normal embryo). The plant regenerated reproductive structures and are self compatible, i.e., they are from that embryo is sterile and, through colchicine treat capable of self-pollination as well as cross-pollination. ment, fertility of this homozygous plant is recovered. The Therefore, in order to prevent self-pollination and obtain term "endogenous” as used herein refers to materials origi pure hybrid seed, it maybe necessary to emasculate the seed nating from within an organism or cell. The term “exog parent. enous” as used herein refers to materials originating from outside of an organism or cell. This typically applies to 0044) The crossing L. rigidium with L. perenne is not nucleic acid molecules used in producing transformed or straight-forward and does not commonly happen in nature, transgenic host cells and plants. as the L. perenne seed requires Vernalization and the flow ering times of L. perenne and L. rigidium are different. 0048 Protoplast fusion can provide a unique tool to Therefore, Vernalization and planting of L. perenne must be combine valuable traits beyond the feasibility of normal controlled so as to synchronize the flowering of L. perenne sexual crossing. Protoplast as used herein is a cell from and L. rigidium. The terms “F-generation' and “filial gen which the cell wall has been removed. Spheroplast as used eration” as used herein refer to any of the consecutive herein is a cell from which most of the cell wall has been generations of cells, tissues or organisms after a biparental removed. Protoplasts may be isolated from leaves or other cross. The generation resulting from a mating of the a plant tissue using cell wall degrading enzymes. Triggered by biparental cross (such as, for example, parents) is the first electric pulses protoplasts of two selected breeding lines can filial generation (designated as "F) in reference to a seed be fused in an electric field. This fusion, known as somatic and its plant, while that resulting from crossing of one F. hybridization, encompasses the combination of all chromo individuals to another F individual or to the F individual somes from both fusion partners. Therefore, the starting itself is the second filial generation (designated as “F) in material should possess twice the number of chromosomes reference to a seed and its plant. For example, an F seed and which can be achieved by specific crosses or through a resulting plant are produced by self-pollination of F, another culture. In another example, non-traditional crossing while later F generations are produced from self-pollination methods include clonal propagation of genetic self-incom of the immediate prior generation patible plants as described in U.S. Pat. No. 4,499,687 (1985) for use in hybrid Brassica seed production. 0045. The term “tissue culture' as used herein is the maintenance or growth of tissues, in vitro, in a way that may 0049. In some embodiments, a method of breeding a allow differentiation and preservation of their architecture glyphosate resistant perennial ryegrass comprises the fol and/or function. In an example of tissue culture, meristems lowing steps: providing germplasm comprising glyphosate can be actively dividing parts (about 0.2 mm to about 1.0 cm resistant Lolium rigidium, crossing the germplasm with a in size), at the top of the shoot tips or root tips as well as in second germplasm comprising a ryegrass to produce an F; the axillary buds. In another example, they can be dissected selecting a resulting germplasm from at least one member of under the microscope and can be regenerated on specific the F generation that is glyphosate resistant, backcrossing a media to complete plants. Also in a third example of tissue selected germplasm from the F generation with a second culture methods, shoot tips and stem cuttings (about 0.2 mm germplasm comprising ryegrass to produce a bc1 generation to about 1 cm in size) can be cultivated in vitro to produce selecting a resulting germplasm from the bc1 generation that complete plantlets. The term “regeneration' as used herein is glyphosate resistant, backcrossing the selected germplasm refers to the process of growing a plant from a plant cell, from the bc generation with the second germplasm com tissue, or organ (such as, for example, plant protoplast or prising ryegrass to produce a bc. selecting a resulting explant). In some embodiments of the present disclosure, germplasm from the bc generation that is glyphosate resis methods include regenerating a non-transgenic glyphosate tant and providing a glyphosate resistant ryegrass. In some resistant plant or portion thereof. In some embodiments, embodiments, backcrossing (bc) can be up to seven genera regeneration can use tissue culture techniques that are tions. In some embodiments, backcrossing can be mixed known to those skilled in the art. with forward crossing. In some embodiments, a method of breeding comprises providing a biomarker which is indica 0046. In embryo genesis, after the pollination of an egg tive of glyphosate resistance. In some embodiments, the cell with pollen a new embryo develops which contains the germplasm comprising glyphosate resistant Lolium rigidum genetic make-up of both parents. However, in interspecific may comprise a nucleic acid which is essentially SEQ. ID. or intergeneric crosses (wide crosses) the hybrid embryo NO. 1 or a functional portion thereof. arises but dies due to the failure of forming a normal endosperm. The embryo can be rescued by early excision 0050. In some embodiments, a glyphosate resistant turf from the caryopsis and Subsequent cultivation in vitro on an grass may be obtained by embryo culture. In some embodi artificial media. Thereafter a complete plantlet can be regen ments, a glyphosate resistant grass may be obtained by use erated from that embryo. Alternatively, plant cells or tissues of protoplast fusion. In some embodiments, the step of (including undifferentiated callus tissue) may be stimulated selecting may include spraying members of a new genera in vitro So as to develop embryos or embryogenic callus tion with a herbicidally effective dose of glyphosate and tissue. Homozygous plants may be produced via embryo Such a step may include a wait period Such as 2, 3, 4 or more culture. weeks to determine Survival of the new generation. In some embodiments, the methods of breeding may include repeat 0047. In a double haploid system, if an egg cell is ing steps of providing, crossing, selecting and backcrossing pollinated with the pollen of an other species (for example at least once. Some embodiments include the seed that is US 2007/0180574 A1 Aug. 2, 2007
created from the breeding method. In some embodiments, of a tetraploid and a second plant comprising a tetraploid. In the breeding method can further comprise selecting for an Some embodiments, additional crossing may be performed agronomically desirable trait. In some embodiments, an with a hybrid tetraploid and another plant. In some embodi agronomically desirable trait may include drought resis ments, a plant that is a tetraploid comprises a polynucleotide tance, salinity resistance, disease resistance, fungus resis molecule of a glyphosate resistant plant EPSPS enzyme and tance, bacteria resistance, blade height, blade width, blade a polypeptide molecule may comprise at least a sequence of color, vigor, seed production, insect resistance and winter at least one of SEQ. ID. NO. 2, or a functional portion hardiness. In some embodiments, a breeding method may thereof. In some embodiments, a method of breeding may include the use of a germplasm comprising a glyphosate include a material that comprises SEQ. ID. NO. 2, or resistant Lolium rigidium that comprises a molecule that is fragments thereof and sequences having an identity of 80% essentially part of SEQ. ID. NO. 2, or a functional portion thereto. In some embodiments, a breeding method may thereof and that encodes a glyphosate resistant EPSPS include the use of a material comprising SEQ. ID. NO. 2, or enzyme. fragments thereof. In some embodiments, a breeding method 0051. In some embodiments, a method of breeding gly may include material comprising a mutation of SEQ. ID. phosate resistant plants comprises the following steps: pro NO. 1, or fragments thereof and sequences having an viding a material comprising a nucleic acid sequence that is identity of 93% thereto that encode a glyphosate resistant essentially one of SEQ. ID. NO. 1, or a functional portion EPSPS enzyme. In some embodiments, a breeding method thereof and sequences having an identity of greater than may include material comprising a mutation of SEQ. ID. 97% thereto, crossing the material with a germplasm com NO. 17, or fragments thereof that is a glyphosate resistant patible with the material and producing a glyphosate resis EPSPS enzyme. In some embodiments, a breeding method tant germplasm. In some embodiments, the material may be may include the use of a fescue or a fescue hybrid. selected from the following: germplasm, cuticle, seed, pol 0053. In some embodiments, a breeding method may len, ovule, root, flour, tissue, meristem, endosperm, seed, include using a glyphosate resistant plant of the present cells, or another plant part. In some embodiments, the disclosure to produce a hybrid of triticale. Techniques and material may be selected from the following: ryegrass, methods of creating a hybrid of triticale from rye and wheat fescue, festolium, combinations thereof and hybrids thereof. is well known to those skilled in the art and may include the In some embodiments, a glyphosate resistant germplasm is use of diploids, tetraploids, hexaploids, octaploids and/or a hybrid comprising of germplasm from a glyphosate resis double haploids. In some embodiments, such techniques and tant Lolium rigidium. In some embodiments, a method of methods may include the use of colchicine to double the producing a glyphosate resistant plant comprises the follow chromosomes. In some techniques and methods useful ing steps: crossing a first grass plant with at least one other herein, the wheat is used as the female parent (cytoplasm) grass plant to produce a progeny of grass plants and Such and rye as the male parent (pollen donor) and the resulting first grass plant may comprise at least one of the following triticale hybrid is sterile. In some case, it may be difficult to SEQ. ID. NO. 2, or a functional portion thereof and see the expression of rye genes in the background of wheat sequences having an identity of 80% thereto, and Screening cytoplasm and the predominant wheat nuclear genome. In the progeny of grass plants to select the progeny of grass Some embodiments, techniques and methods useful herein plants that is resistant to glyphosate. In some embodiments, may produce Secalotricum in which rye cytoplasm and it is a method breeding a plant with enhanced resistance to used with wheat pollen to produce triticale. In some embodi glyphosate comprises the following steps: providing a first ments, a resulting triticale plant or hybrid be used to produce plant, the first plant is a glyphosate resistant Lolium rigidium, a non-transgenic glyphosate resistant wheat plant. Moving a crossing the first plant and the second plant to generate a trait from triticale to wheat is well known to those skilled in hybrid plant, the hybrid plant comprising a glyphosate the art. In some embodiments, a method of breeding can resistant gene and selecting a glyphosate resistant plant or produce glyphosate resistant wheat from a glyphosate resis derivative thereof. In some embodiments, a method of tant Lolium rigidium or hybrid thereof. breeding can further comprise backcrossing the glyphosate 0054. In some embodiments, a method for breeding resis resistant hybrid or a derivative thereof and a second plant to tance to glyphosate into plants comprises the following generate a backcrossed hybrid plant, the backcrossed hybrid steps: selecting a plant material that constitutively expresses plant comprises a naturally resistant gene, a selecting a a glyphosate resistant enzyme, using the plant material and glyphosate resistant crossed hybrid plant. In some embodi a breeding program, and selecting a glyphosate resistant ments, the second plant may be at least one of the following: progeny with agronomically desirable traits. In some ryegrass, fescue, forage ryegrass, festolium, combinations embodiments, a method for breeding glyphosate into plants thereof, hybrids thereof and derivatives thereof. includes using plant material from ryegrass, fescue, festo 0.052 In some embodiments, a method of breeding may lium, combinations thereof, hybrids thereof and derivatives further comprise exposing a first plant to colchicine or other thereof. In some embodiments, a method for breeding gly muted gene to create a tetraploid. Exposing a diploid to phosate resistance into plants may include steps of back tetraploid to create a tetraploid in a ryegrass is well-known crossing and further selecting. In some embodiments, the in the art, see for example, Myers (1939) J. Heredity backcrossing and further selecting may be repeated multiple 30:499-504. In some embodiments, a method of breeding times until agronomically desirable traits are stable. In some may comprise a step that includes crossing a tetraploid with embodiments, a method for breeding resistance to glypho a second plant that is a tetraploid to generate a hybrid plant. sate into plants may include the use of plant material that is Such tetraploid may have value as a forge product. In some Lolium rigidium comprising a glyphosate resistant gene. In embodiments, a tetraploid may be a ryegrass, a hybrid Some embodiments, a method for breeding resistance to thereof, or derivative thereof. In some embodiments, further glyphosate into plants includes the use of a tetraploid and backcrossing may be performed with a selected generation Such tetraploid may be obtained by the use of a mutagen US 2007/0180574 A1 Aug. 2, 2007
Such as colchicine. Methods for breeding turf grass are the allele of the resistant form of EPSPS. As shown in Table well-known to the skilled artisan (see for example Turfgrass 1 and highlighted in the Examples below, a second allele can Biology, Genetics and Breeding ed. Cassler and Duncan contribute to the glyphosate resistance. (2003) and any breeding method, including those known to those skilled in the art, may be used with the glyphosate TABLE 1. resistant material of the present disclosure. Comparison of the occurrence of the SNP and Glyphosate 0055. In some embodiments, the present disclosure pro resistance for a group of backcrossed turfgrass Samples. vides germplasm deposited in the ATCC as Penner Ryegrass (Assession No. XXXX deposited on Jan. 23, 2007). The Sample germplasm is deposited in the form of seed. The germplasm Number SNP Analysis (a) Phenotype (Dead) can be grown into grass plants as known to those skilled in 1 S control No 1X 2 R control Yes 8X the art. In some embodiments, the germplasm is a perennial 3 No 2X ryegrass. In some embodiments the germplasm comprises 4 Yes 2X nucleic acid molecule nucleic acid molecule comprises a 5 Yes 8X sequence of SEQ. ID. NO. 1, or a functional portion thereof 6 No 1X 7 No 4X and sequences having an identity of 93% thereto. In some 8 No 1X embodiments the germplasm comprises a polypeptide mol 9 Yes 4X ecule of a glyphosate resistant, plant EPSPS enzyme. In 10 No 4X Some embodiments, the germplasm comprises polypeptide 11 Yes 4X 12 Yes 4X molecule comprising an amino acid sequence of SEQ. ID. 13 No 1X NO. 2, or a functional portion thereof and sequences having 14 No 2X an identity of 80% thereto. 15 Yes 4X 16 Yes 4X 0056. In some embodiments, the Penner Ryegrass can be 17 Yes 6X used in a breeding program or crossed with a sexually 18 Yes 2X compatible plant to produce a glyphosate resistant plant. In 19 No 4X 2O No 4X Some embodiments, the germplasm is a perennial ryegrass. 21 No 4X Also disclosed is a method of producing a grass plant which 22 S control No 1X includes crossing a grass plant produced from the Penner 23 R control Yes 8X Ryegrass with at least one other grass plant to produce at least one seed, harvesting the seed, and germinating the seed (a)See Example 5 for an example of the SNP analysis. to produce at least one progeny grass plant. Included in the present technology are grass plants produced using this 0.058 Having both the first allele (the SNP) and the method, as well as a vegetative sprig, tiller, or clone of the second allele in a plant such as, for example, a turfgrass, can grass plant. In some embodiments, the Penner Ryegrass can increase resistance to glyphosate. In some embodiments, the be used to produce a glyphosate resistant forage grass as second allele may be attributed to glyphosate oxidoreductase described herein. In some embodiments, the Penner (“GOX”) enzyme encoded by a GOX gene. Only one of the Ryegrass can be used to produce a glyphosate resistant alleles may be needed to produce aglyphosate resistant plant wheat. In some embodiments, the Penner Ryegrass can be Such as for example, a turfgrass. In some embodiments, the crossed with a fescue. In some embodiments, the present second allele can be identified as the Gly-Rest 2 gene. The disclosure provides methods of producing a glyphosate Gly-Rest 2 gene encodes a glyphosate resistant protein that resistant turf grass derived from the Penner Ryegrass. In can be identified as the Gly-Resist Protein (“GRP) which is Some embodiments methods can include preparing a prog different from the glyphosate resistant EPSPS. To identify eny plant derived from the Penner Ryegrass by crossing a which plants have only the GRP protein, the following is an plant of the Penner Ryegrass with a second turfgrass plant, example of an analysis that can be useful. The plants that wherein a sample of the seed of the Penner Ryegrass was have been crossed with a known glyphosate resistant parent deposited under ATCC Accession No. XXXXX: then crossing are grown. A herbicidally effective amount of glyphosate is the progeny plant with itself or a second plant to produce a applied to the plants. The plants that Survive the application seed of a progeny plant of a Subsequent generation and are selected and a part of the plant is then used to determine growing a progeny plant of a Subsequent generation from the if a biomarker for glyphosate resistant EPSPS is present. An seed and crossing the progeny plant of a Subsequent gen example of Such an analysis is discussed in the examples eration with itself or a second plant; and repeating steps of below. If the biomarker is present, then the plant has at least crossing and growing for an additional two to ten genera glyphosate resistant EPSPS and may have GRP. If the tions to produce a glyphosate resistant turf grass derived biomarker is not present, then the plant has the GRP present from the Penner Ryegrass. and does not have a detectable amount of the glyphosate resistant EPSPS present. A biomarker analysis for GRP can 0057. In some embodiments, the germplasm can have be designed and designing such an analysis is well with in more than one glyphosate resistant allele. At least one of the the knowledge of those skilled in the art. glyphosate resistant alleles is the single nucleotide polymor phism (“SNP) for the EPSPS gene at nt301 of SEQ. ID. 0059. In some embodiments, the present technology pro NO. 1. By sequencing of the EPSPS from sensitive and vides a method for creating a lawn that is substantially free resistant ryegrass biotypes the SNP was identified. A change of weeds. In some embodiments, a method of creating a from cytosine to thymine at this position changes the amino lawn that is free of weeds includes the steps of providing a acid from proline to serine. The SNP at nt301 of SEQ. ID. lawn comprising of glyphosate turfgrass and the glyphosate NO. 1 can be used as a marker to identify plants that carry resistant turf grass comprises a DNA molecule that is US 2007/0180574 A1 Aug. 2, 2007
essentially SEQ. ID. NO. 1, or a functional portion thereof, 0063. Through plant genetic engineering methods, it is and applying the lawn herbicidally effective amount of possible to produce glyphosate resistant plants by inserting glyphosate compound. into the plant genome a DNA molecule that causes the 0060. In some embodiments, the present disclosure production of higher levels of wild-type EPSPS. Examples includes a method of obtaining a lawn that is essentially free can be found in Shah et al., Science 233:478-481 (1986). of a weed variety to which the lawn is susceptible. In such Glyphosate resistance can also be achieved by the expres embodiments, the lawn is essentially free of weeds. As sion of EPSPS variants that have lower affinity for glypho referred to herein, a weed variety to which a lawn is sate and therefore retain their catalytic activity in the pres susceptible is a weed that can reasonably be expected to be ence of glyphosate, for example, as disclosed in U.S. Pat. found in a lawn of similar grass composition, Soil type, and Nos. 4,940,835; 5,094,945; and 5,633,435, incorporated geographic region. The term “weed’ refers to undesirable herein by reference. Enzymes that degrade glyphosate in the vegetative matter and may be one of the following: dande plant tissues, for example, as disclosed in U.S. Pat. No. lion, goosegrass, ground ivy, clover, crabgrass, thistle, plan 5,463,175 are also capable of conferring cellular resistance tain, knotweed, quackgrass, nimble weed, tall fescue, creep to glyphosate. Such genes, therefore, allow for the produc ing bent grass, Zoysiagrass, bermudagrass, Dallisgrass, tion of transgenic crops that are resistant to glyphosate, bindweed, black medic, carpetweed, chickenweed, creeping thereby allowing glyphosate to be used for effective weed beggarweed, cudweed, curly dock, English daisy, evening control with minimal concern of crop damage. For example, primrose, false dandelion, filaree, Florida pusley, henbit, glyphosate resistance has been genetically engineered into lambsquarters, mallow, oxalis, pennywort, pigweed, prickly corn as disclosed in U.S. Pat. No. 5,554,798, wheat as lettuce, purslane, ragweed, sheep Sorrel. Shepardspurse, disclosed in Zhou et al., Plant Cell Rep. 15:159-163 (1995), Sowthistle, speedwell, spotted spurge, tansy ragwort, wild soybean as disclosed in PCT Application Publication No. carrot, wild geranium, wild morning-glory, wild onion, wild WO 9200377 and canola as disclosed in PCT Application violet, foxtail, Johnsongrass, nutsedge, bahiagrass, barn Publication No. WO9204449. Other examples of EPSPS yardgrass, poa annua, Sandbur, and combinations thereof. A and methods for preparing transgenic plants resistant to method of obtaining a lawn that is substantially free of glyphosate include those described and/or isolated in accor weeds may include the following steps: providing a lawn dance with Singh, et al. In “Biosynthesis and Molecular comprising a glyphosate resistant turfgrass, and applying to Regulation of Amino Acids in Plants.” Amer Soc Plant Phys. said lawn a herbicidally effective amount of a mixture Pubs (1992); U.S. Pat. Nos. 4,971,908; 5,145,783; 5,188, comprising glyphosate. In some embodiments, a method of 642; 5,310,667: 5,312.910; and 640,497. They can also be obtaining a lawn that is substantially free of weeds further derived from a structurally distinct classes of non-homolo comprises planting a seed capable of growing glyphosate gous EPSPS genes, such as the class II EPSPS genes isolated resistant turf grass, wherein the turfgrass is selected from from Agrobacterium sp. strain CP4. Examples can be found ryegrass, fescue, festolium, combinations thereof, hybrids in U.S. Pat. Nos. 5,633,435 and 5,627,061. thereof and derivatives thereof. In some embodiments, a 0064 Variants of the wild-type EPSPS enzyme are gly method of obtaining a lawn that is substantially free of phosate resistant as a result of alterations in the EPSPS weeds comprises providing a lawn comprising glyphosate amino acid coding sequence and examples can be found in resistant turf grass, wherein the turf grass comprises a Kishore et al., Annu. Rev. Biochem, 57:627-663 (1988); nucleic acid molecule that encodes a glyphosate resistant Schulz et al., Arch. Microbiol. 137:121-123 (1984); Sost et EPSPS enzyme according to the present disclosure. al., FEBS Lett. 173:238-241 (1984); Kishore et al. In “Biotechnology for Crop Protection’ ACS Symposium 0061. In some embodiments, the DNA molecules of the Series No. 379, eds. Hedlin et al., 37-48 (1988). These EPSPS glyphosate resistance gene of SEQ. ID. NO. 1 or variants typically have a higher K for glyphosate than the portions thereof can be used as a probe to identify other like wild-type EPSPS enzyme that confers the glyphosate resis DNA molecules by standard methods. In some embodi tant phenotype, but these variants are also characterized by ments, oligonucleotide DNA molecules homologous or a high K for PEP that makes the enzyme kinetically less complementary to the EPSPS glyphosate resistance gene of efficient. For example, the apparent K, for PEP and the Lolium rigidium can be used in a marker assisted breeding apparent K, for glyphosate for the native EPSPS from E. coli method to assist in the breeding of this gene into related and are 10 uMand 0.5uM while for a glyphosate resistant isolate heterologous crop species. For example a SNP analysis can having a single amino acid Substitution of an alanine for the used in a marker analysis. glycine at position 96 these values are 220 uM and 4.0 mM, Transgenic Glyphosate Resistant Plants and Methods of respectively. A glyphosate resistant plant variant EPSPS Making genes can be constructed by mutagenesis. 0062. In some embodiments, the present disclosure pro 0065 Nucleotide and amino acid sequence variants of vides a DNA construct comprising the nucleic acid molecule EPSPS genes and proteins, respectively, may also be used in comprising SEQ. ID. NO. 1 that encodes a glyphosate the plants and methods of this technology. “Variant DNA resistant, plant-derived EPSPS enzyme and SEQ. ID. NO. 2 molecules are DNA molecules containing minor changes in or a portion thereof is operably linked to a promoter that a native EPSPS gene sequence, such as, for example, drives expression in a host cell. In some embodiments, the changes that one or more nucleotides of a native EPSPS present disclosure provides methods of making and using gene sequence is deleted, added, and/or Substituted. Such such a DNA construct. The term “construct” as used herein that the variant EPSPS gene encodes a protein that retains refers to the heterologous genetic elements operably linked EPSPS activity. Variant DNA molecules can be produced, to each other making up a recombinant DNA molecule. In for example, by standard DNA mutagenesis techniques or by Some embodiments, the present disclosure provides methods chemically synthesizing the variant DNA molecule or a of making and using Such a DNA constructs. portion thereof. Methods for chemical synthesis of nucleic US 2007/0180574 A1 Aug. 2, 2007
acids are discussed, for example, in Beaucage et al., Tetra. polypeptide' as used herein refer to a protein molecule Letts. 22:1859-1862 (1981), and Matteucci et al., J. Am. expressed from a recombinant DNA molecule. In contrast, Chem. Soc. 103:3185- (1981). Chemical synthesis of nucleic the term “native protein’ as used herein refers to indicate a acids can be performed, for example, on automated oligo protein isolated from a (such as, for example, a nonrecom nucleotide synthesizers. Such variants preferably do not binant) source. Molecular biological techniques may be used change the reading frame of the protein-coding region of the to produce a recombinant form of a protein with identical nucleic acid and preferably encode a protein having no properties as compared to the native form of the protein. For amino acid changes. Nucleic acid sequence variants are most example, SEQ. ID. NO. 2 and SEQ. ID. NO. 14 are native often created for the purposes of modification of the proteins. sequence to add or delete restriction endonuclease sites or to 0068. In some embodiments, the present disclosure pro affect transcription or translation of the nucleic acid mol vides a recombinant vector comprising the DNA construct ecule. comprising the nucleic acid molecule comprising SEQ. ID. 0066. In some embodiments, the present disclosure pro NO. 1, or a portion thereof, that encodes a glyphosate vides a recombinant vector comprising the DNA construct resistant EPSPS enzyme and the recombinant vector is comprising the nucleic acid molecule comprising SEQ. ID. selected from the group consisting of plasmids, artificial NO. 1, or a portion thereof, that encodes a glyphosate chromosomes, cosmids, transposons, viruses, and combina resistant EPSPS enzyme and the recombinant vector is tions thereof. In some embodiments, the present disclosure selected from the group consisting of plasmids, artificial provides methods of making and using such a recombinant chromosomes, cosmids, transposons, viruses, and combina Vector. tions thereof. In some embodiments, the present disclosure 0069. In some embodiments, the present disclosure pro provide methods of making and using Such a recombinant vides an isolated polypeptide molecule comprising SEQ. ID. Vector. NO. 2, or a portion thereof, that provides a glyphosate 0067. The term “plant expression vector' as used herein resistant EPSPS enzyme. In some embodiments, SEQ. ID. refers to chimeric DNA molecules comprising the regulatory NO. 2 is encoded by SEQ. ID, NO. 1, or a portion thereof. elements that are operably linked to provide the expression In some embodiments, SEQ. ID. NO. 2 is isolated from of a transgene product in plants. The term "chimericas used Lolium rigidium. In some embodiments, an isolated DNA herein refers to a fusion nucleic acid or protein sequence. A molecule that encodes the glyphosate resistant EPSPS chimeric nucleic acid coding sequence is comprised of two enzyme of SEQ. ID. NO. 2, or a portion thereof, wherein the or more sequences joined in-frame that encode a chimeric DNA molecule has the nucleic acid sequence of SEQ. ID protein. A chimeric gene refers to the multiple genetic NO. 1, or a portion thereof. elements derived from heterologous sources comprising a gene. The terms “in operable combination.”“in operable 0070. In some embodiments, the present disclosure pro order and “operably linked as used herein refer to the vides a recombinant DNA molecule comprising: a promoter linkage of nucleic acid sequences in Such a manner that a that functions in plant cells, operably linked to a structural nucleic acid molecule capable of directing the transcription DNA sequence that encodes an EPSPS enzyme comprising of a given gene and/or the synthesis of a desired protein the sequence of SEQ. ID NO. 2, operably linked to a 3 molecule is produced. The terms as used herein also refer to non-translated region that functions in plant cells to cause the linkage of amino acid sequences in Such a manner so that the addition of polyadenyl nucleotides to the 3' end of the a functional protein is produced. The terms “recombinant RNA sequence. In some embodiments, the present disclo DNA construct” or “recombinant vector” as used herein Sure provides methods of making and using Such a recom refer to any agent such as a plasmid, cosmid, virus, autono binant molecule. mously replicating sequence, phage, or linear or circular 0071. In some embodiments, the present disclosure pro single-stranded or double-stranded DNA or RNA nucleotide vides methods of producing a glyphosate resistant plant sequence, derived from any source, capable of genomic comprising the steps of 1) inserting into the genome of a integration or autonomous replication, comprising a DNA plant cell a recombinant DNA molecule comprising: a molecule that one or more DNA sequences have been linked promoter that functions in said plant cell, operably linked to in a functionally operative manner. Such recombinant DNA a structural DNA sequence that encodes an EPSPS enzyme constructs or vectors are capable of introducing a 5' regu having the sequence of SEQ. ID. NO. 2, operably linked to latory sequence or promoter region and a DNA sequence for a 3' non-translated region that functions in said plant cell to a selected gene product into a cell in Such a manner that the cause the addition of polyadenyl nucleotides to the 3' end of DNA sequence is transcribed into a functional mRNA that is an RNA sequence transcribed therefrom; and 2) regenerating translated and therefore expressed. Recombinant DNA con from the transformed plant cell a genetically transformed structs or recombinant vectors may be constructed to be plant which has increased resistance to glyphosate herbicide capable of expressing antisense RNAs, in order to inhibit as compared to an untransformed plant. translation of a specific RNA of interest. Design of vectors useful herein include methods among those known to those 0072. In some embodiments, exogenous genetic material skilled in the art (Plant Molecular. Biology: A Laboratory may be transferred into a plant by the use of a plant Manual, eds. Clark, Springer, New York (1997)). The term expression vector designed for Such a purpose by methods “plasmid' as used herein refers to a circular, extrachromo that utilize Agrobacterium, particle bombardment or other somal, self-replicating piece of DNA. The term “polypeptide methods known to those skilled in the art. In some embodi fragments' as used herein can refer to fragments of an ments, a subgroup of exogenous material comprises a EPSPS that lacks at least one residue of a native full-length nucleic acid molecule of the present disclosure. EPSPS protein, but that specifically maintains EPSPS activ 0073. In some embodiments, the particular promoters ity. The terms “recombinant protein’ or “recombinant selected for use in the present disclosure should be capable US 2007/0180574 A1 Aug. 2, 2007 of causing the production of Sufficient expression to, in the chloroplast proteins may be targeted to the chloroplast by case of the DNA molecule, generate protein expression in use of protein fusions with a CTP and that a CTP sequence vegetative or reproductive tissues of a transformed plant. A can be sufficient to target a protein to the chloroplast. In promoter is a DNA sequence that regulates RNA synthesis. Some embodiments, incorporation of a Suitable chloroplast Promoters or promoter regions are usually found upstream transit peptide Such as, for example, the Arabidopsis (5') to a coding sequence that controls expression of the thaliana EPSPS CTP and examples of such may be found in coding sequence by controlling production of messenger Klee et al., Mol. Gen. Genet. 210:437-442 (1987) and the RNA (mRNA) by providing the recognition site for RNA Petunia hybrida EPSPS CTP and examples of such may be polymerase and/or other factors necessary for start of tran Scription at the correct site. The location of most promoters found in della-Cioppa et al., Proc. Natl. Acad. Sci. 83:6873 known in nature precedes the transcribed region. The pro 6877 (1986) have been show to target heterologous EPSPS moter functions as a Switch, activating the expression of a protein sequences to chloroplasts in transgenic plants. In gene. If the gene is activated, it is said to be transcribed, or Some embodiments, the production of glyphosate resistant participating in transcription. Transcription involves the plants by expression of a fusion protein comprising an synthesis of mRNA from the gene. The promoter, therefore, amino-terminal CTP with a glyphosate resistant EPSPS serves as a transcriptional regulatory element and also enzyme is well known by those skilled in the art and provides a site for initiation of transcription of the gene into examples of such may be found in U.S. Pat. Nos. 5,312.910; mRNA. As contemplated herein, a promoter or promoter 5,627,061; and 5,633,435, as well as EP Patent Nos. 1897.07; region includes variations of promoters derived by means of 0218571; 508909; and 924299. Those skilled in the art will ligation to various regulatory sequences, random or con recognize that various chimeric constructs can be made that trolled mutagenesis, and addition or duplication of enhancer utilize the functionality of a particular CTP to import gly sequences. The promoter region disclosed herein, and bio phosate resistant EPSPS enzymes into the plant cell chlo logically functional equivalents thereof, are responsible for roplast. driving the transcription of coding sequences under their control when introduced into a host as part of a Suitable 0077. Nucleic acids encoding chloroplast transit peptides recombinant vector, as demonstrated by its ability to pro are readily available from genomic or cDNA of any chlo duce mRNA. roplast-targeted protein, and their sequences are well known and available, e.g., from GenBank. Further such transit 0074) Promoters may be “constitutive” or “inducible.” peptide sequences, and their coding sequences, may be The term "constitutive' as used herein in reference to a identified by algorithm-based searching, e.g., as discussed in promoter means that the promoter is capable of directing A. I. Schein et al., “Chloroplast transit peptide prediction: a transcription of an operably linked nucleic acid sequence in peek inside the blackbox. Nucl. Acids Res. 29(16):6 (2001), the absence of a stimulus (such as, for example, heat shock, and O. Emanuelsson et al., “ChloroP, a neural network chemicals, light, etc.). Typically, constitutive promoters are based method for predicting chloroplast transit peptides and capable of directing expression of a transgene in Substan their cleavage sites.” Prot. Sci. 8:978-984 (1999); alterna tially any cell and any tissue. In contrast, an “inducible' tively, sequence analysis using the ChloroP algorithm may promoter is one that is capable of directing a level of be performed on any sequence submitted to the ChloroP transcription of an operably linked nucleic acid sequence in website of the Center for Biological Sequence Analysis at the presence of a stimulus (such as, for example, heat shock, the Technical University of Denmark, Lyngby, DK, avail chemicals, light, etc.) that is different from the level of able at http://www.cbs.dtu.dk/services/ChloroP/. Any such transcription of the operably linked nucleic acid sequence in transit peptide, or other N-terminal peptide, may be synthe the absence of the stimulus. sized as a fusion with an EPSPS according to some embodi 0075. In some embodiments, the DNA molecule may ments described herein. contain a constitutive promoter, a structural DNA sequence 0078. In some embodiments, the termination of transcrip encoding a herbicide resistant enzyme, and a 3' non-trans tion is accomplished by a 3' non-translated DNA sequence lated region. A number of constitutive promoters that are operably linked in the chimeric vector to the gene of interest. active in plant cells have been described in the art. In some In Some embodiments, the 3' non-translated region of a embodiments, Suitable promoters for constitutive expression recombinant DNA molecule contains a polyadenylation sig in plants of herbicide resistance for the DNA molecule may nal that functions in plants to cause the addition of adenylate include, but are not limited to, the cauliflower mosaic virus nucleotides to the 3' end of the RNA. In some embodiments, (CaMV) 35S promoter (Odell et al., Nature 313:801-812 the 3' non-translated region can be obtained from various (1985), genes that are expressed in plant cells. In some embodi 0076) The glyphosate target in plants, the EPSPS ments, the nopaline synthase 3' untranslated region and enzyme, is located in the chloroplast. In some embodiments, examples of such may be found in Fraley et al., Proc. Natl. many chloroplast-localized proteins, including EPSPS, can Acad. Sci. 80:4803-4807 (1983); the 3' untranslated region be expressed from nuclear genes as precursors and can be from pea Small subunit Rubisco gene and examples of Such targeted to the chloroplast by a chloroplast transit peptide may be found in Coruzzi et al., EMBO J. 3:1671-1679 (CTP) that is removed during the import steps, as described (1994); and the 3' untranslated region from soybean 7S seed above. Examples of suitable such chloroplast proteins storage protein gene and examples of Such may be found in include, but are not limited to, the small subunit (SSU) of Schuler et al., Nuc Acids Res. 10:8225-8244 (1982) may be Ribulose-1,5-bisphosphate carboxylase, Ferredoxin, Ferre used in this capacity. In some embodiments, the 3' tran doxin oxidoreductase, the light-harvesting complex protein scribed, non-translated regions containing the polyadenylate I and protein II, and Thioredoxin F. In some embodiments, signal of Agrobacterium tumor-inducing (Ti) plasmid genes it can be demonstrated in vivo and in vitro that non may be used in this capacity. US 2007/0180574 A1 Aug. 2, 2007
0079 The aforesaid genetic elements and other regula a protoplast. The use of Agrobacterium-mediated plant tory elements of similar function may be substituted when integrating vectors to introduce DNA into plant cells is well appropriate by those skilled in the art of plant molecular known in the art. biology to provide necessary function to the plant expression 0084) Modern Agrobacterium transformation vectors are cassette. DNA constructs for glyphosate tolerance designed capable of replication in E. coli, as well as Agrobacterium. for expression in plasmids will necessarily contain genetic In some embodiments, Agrobacterium containing both elements that function in plasmids. armed and disarmed Tigenes can be used for the transfor mations. In those plant varieties where Agrobacterium 0080. In some embodiments, a vector may also include a mediated transformation is efficient, it is the method of screenable or selectable marker gene. The term “selectable choice because of the facile and defined nature of the gene marker” as used herein refers to a nucleic acid sequence transfer. whose expression confers a phenotype facilitating identifi cation of cells containing the nucleic acid sequence. Select 0085. It is also to be understood that two different trans able markers include those that confer resistance to toxic genic plants can also be mated to produce offspring that chemicals such as, for example, amplicillin resistance, kana contain two independently segregating exogenous genes. In mycin resistance, complement a nutritional deficiency Such Some embodiments, selfing of appropriate progeny can as, for example, uracil, histidine, leucine, or impart a visu produce plants that are homozygous for both exogenous ally distinguishing characteristic Such as, for example, color genes. Back-crossing to a parental plant and out-crossing changes or fluorescence. Useful dominant selectable marker with a non-transgenic plant are also contemplated, as is genes include genes encoding antibiotic resistance genes vegetative propagation. In some embodiments, a transgenic Such as, for example, resistance to hygromycin, kanamycin, plant can be included in breeding methods described herein. bleomycin, G418, Streptomycin or spectinomycin; and her In some embodiments, other methods of cell transformation bicide resistance genes such as, for example, phosphinothri can also be used and include, but are not limited to, cin acetyltransferase. A useful strategy for selection of introduction of DNA into plants by direct DNA transfer into transformants for herbicide resistance is described, such as, pollen by direct injection of DNA into reproductive organs for example, in Vasil, Cell Culture and Somatic Cell Genet of a plant, or by direct injection of DNA into the cells of ics of Plants, Vols. I-III, Laboratory Procedures and Their immature embryos followed by the rehydration of desic Applications, Academic Press, New York (1984). Other cated embryos. possible selectable and/or screenable marker genes will be 0086 The regeneration, development, and cultivation of apparent to those of skill in the art. In some embodiments, plants from single plant protoplast transformants or from a selectable marker may be used to monitor expression. various transformed explants is well known in the art. In Some embodiments, regeneration and growth process 0081. There are many methods for introducing trans includes the steps of selection of transformed cells, culturing forming nucleic acid molecules into plant cells. In some those individualized cells through the usual stages of embry embodiments of the present technology, Suitable methods onic development through the rooted plantlet stage. In some for transforming the nucleic acid sequence encoding EPSPS embodiments, transgenic embryos and seeds can be simi of a plant include virtually any method shown effective in larly regenerated. In some embodiments, the resulting trans introducing the nucleic acid molecules into a plant cell Such genic rooted shoots can be thereafter planted in an appro as, for example, by Agrobacterium infection, micro projec priate plant growth medium such as soil. The development tile bombardment, or direct delivery of nucleic acid mol or regeneration of plants containing the foreign, exogenous ecules. gene is well known in the art. In some embodiments, the 0082 Four general methods for direct delivery of a gene regenerated plants are self-pollinated to provide homozy into cells have been described: (1) chemical methods and gous transgenic plants. Otherwise, pollen obtained from the examples of Such may be found in Graham et al., Virology regenerated plants is crossed to seed-grown plants of agro 54:536-539 (1973); (2) physical methods such as microin nomically important lines. Conversely, pollen from plants of jection and examples of Such may be found in Capecchi, these important lines is used to pollinate regenerated plants. Cell 22:479-488 (1980); electroporation and examples of In some embodiments, a transgenic plant of the present such may be found in Wong et al., Biochem. Biophys. Res. disclosure containing a desired exogenous nucleic acid can Commun. 107:584-587 (1982), Fromm et al., Proc. Natl. be cultivated using methods well known to one skilled in the Acad. Sci. 82:5824-5828 (1985), and U.S. Pat. No. 5,384, art. 253; and the gene gun and examples of Such may be found 0087 Furthermore, those skilled in the art will appreciate in Johnston et al., Methods Cell Biol. 43:353–365 (1994); (3) the methods and compositions related to transformation of viral vectors and examples of Such may be found in Clapp, plants disclosed in U.S. Pat. Nos. 4,971,908; 4,769,061; Clin. Perinatol. 20:155-168 (1993), Lu et al., J. Exp. Med. 5,145,783; 5,188,642; 5,310,667; 5,312.910; 5,352,605; 178:2089-2096 (1993), and Eglitis et al., Biotechniques 5,530, 196; 5,585,742; 5,792,930; 6,204,436; 6,225,114; 6:608-614 (1988); and (4) receptor-mediated mechanisms 6,362,396; 6,426,185; 6,566,587; and 6,825,400. and examples of Such may be found in Curiel et al., Hum. Gen. Ther. 3:147-154 (1992); and Wagner et al., Proc. Natl. 0088 Any type of cell may be used to express an Acad. Sci. 89:6099-6103 (1992). improved, glyphosate-resistant EPSPS described herein from nucleic acid according to an embodiment of the present 0.083 Agrobacterium-mediated transfer is a widely appli disclosure. The cells may be separate, individual cells, or cable system for introducing genes into plant cells because part of a multicellular assemblage. Such as a callus, tissue, the DNA can be introduced into whole plant tissues, thereby or organism. In some embodiments, the cells will be plant bypassing the need for regeneration of an intact plant from cells; in Some embodiments, monocot cells. In some US 2007/0180574 A1 Aug. 2, 2007
embodiments, the plant will be a member of the order Example 2 Poales, preferably of the family Poaceae. Examples of plants from this family include bentgrass (Agrostis spp., e.g., A. 0093. A dose response study is conducted on the R and S canina, A. palustris, A. tenuis), Bermudagrass (Cynodon lines of rigid ryegrass. The rates of glyphosate applied spp., e.g., C. dactylon), bluegrass (Poa spp., e.g., P. prat varied from 0.125x, 0.25x, 0.5.x, 1x, 2x, 4x, 6.x, 8x, 10x, to ensis, P. trivialis), buffalograss (Buchloe spp., e.g., B. dac 12x. The sprayed solutions and application procedures are tyloides), carpetgrass (AxOnopus spp., e.g., A. fissifolius), similar to those described previously. Plants are evaluated centipede grass (Eremochloa spp., e.g., E. Ophiuroides), for visual injury at 4 WAT. Data (4 WAT) from two experi fescue (Festuca spp., e.g., F. arundinacea, F. Ovina, F. rubra, ments with 8 replications of each treatment are analyzed by F, trachyphylla), hairgrass (Deschampsia spp., e.g., D. cae non-linear regression and fitted to a log-logistic model: spitosa), fountaingrass (Pennisetum spp., e.g., P clandesti num, i.e. kikuyugrass), crowngrass (Paspalum spp., e.g., P. notatum, i.e. Bahiagrass; P vaginatum, i.e. seashore 100 paspalum), ryegrass (Lolium spp., e.g., L. multiflorum, L. y = 1 + expb(logx -logX50) perenne, L. rigidum), Saltgrass (Distichlis spp., e.g., D. Spicata), St. Augustine grass (Stenotaphrum spp., e.g., S. Secondatum), and lawngrass (Zoysia spp., e.g., Z. japonica, where y is predictive of plant injury (% of control), Xs= Z. matrella, Z. tenuifolia). Nucleic acid according to some dose required to obtain 50% injury and b is the slope at Xso. embodiments described herein can be transformed into cells, 0094. The collected plants produced seeds in the green or, e.g., protoplasts thereof, by any method known useful in house after 8 to 10 weeks. The seeds are designated as the the art. first generation, harvested and replanted for glyphosate 0089. In some embodiments, the polypeptide, and the resistant evaluation. The percentages of survivors are 89, 59. nucleic acid encoding it, can be isolated, naturally occurring 45, and 9 percent following glyphosate application at 1x, 2x. molecules. In some embodiments, the polypeptide, and the 4x and 8x, respectively, is shown in Table 2. Diverse nucleic acid encoding it, can comprise native sequences. In sensitivity at each glyphosate level indicated that the col Some embodiments, the polypeptide, and the nucleic acid lected plants are genetically heterozygous and that segrega encoding it, can be recombinant, and at least one of the tion occurred in the first generation. residues specified above can be a mutation, which is not naturally occurring in the polypeptide and which is not TABLE 2 naturally encoded by the native coding sequence of that Glyphosate resistance and sensitivity of the first generation of nucleic acid. rigid ryegrass (Lolium rigidium) collected from California, USA.
EXAMPLES Glyphosate Survivors Dead plants kg aiha' percent 0090 The following examples are not limiting the O 1OO O present disclosure in any way. These examples may be used 1.12 (1X) 89 11e by one skilled in the art to better understand the present 2.24 (2x) 59 41 disclosure. 4.48 (4x) 45 55 8.96 (8x) 9b 91 Example 1 Data are the means of two experiments with 90 plants in each. Plants used to generate the resistant plants (R line). 0.091 Rigid ryegrass (Lolium rigidium Gaud.) plants are Seeds from clones used for further selection for the most sensitive plants. collected from an almond orchard intensively treated with glyphosate since 1984. The collected plants are grown and 0095 Dose response curves of the R and S lines are seed produced in greenhouse. The resistant, intermediate shown in FIG. 1. The ratio of glyphosate rates between the and Susceptible biotypes are selected in the first generation Rand S lines for 150 (50% injury) is>100-fold (ratio of 11x using 1.12, 2.24, and 3.36 kg ai ha' rates of glyphosate. to 0.1x). This>100-fold ratio indicated a very high magni Further selection is continued with a high glyphosate rate tude of glyphosate resistance in rigid ryegrass generated (8.96 kg ai ha") to select for the resistant and with the low from the California rigid ryegrass, compared to other weeds rate (0.28 kg aiha') to select for the susceptible individuals. that demonstrated resistance to glyphosate as reported in, for The resistant (R) and susceptible (S) biotypes used in this example, Heap, International Survey of Herbicidal Resistant example are generated from the 5" and 4" cycle, respec Weeds (2004) available at www.weedscience.org. tively. Example 3 0092 R and S biotypes of the California rigid ryegrass are grown individually to the fully vegetatively mature stage 0096 Cross-pollination is arranged in the greenhouse prior to seedhead formation. In one experiment, two fully between one plant each of the R and S lines which have mature leaves of each plant (one R and one S biotypes) are similar maturity. To prevent pollen contamination from treated with three 2 ul drops of glyphosate (glyphosate un-wanted ryegrass, the plants are covered with transparent isopropylamine salt, ROUNDUPULTRATM, Monsanto Co., plastic. The likelihood of selfing is less than 3% as discussed St. Louis, Mo.) solution applied to the upper leaf surface. in, for example, Thorogood, Perennial Ryegrass (Lolium This corresponds to a field rate of 1.12 kg aiha' glyphosate perenne L.) in M. D. Casler and R. R. Duncan, eds. at a volume of 187 L ha' and pressure of 172.5 kPa. One Turfgrass Biology, Genetics, and Breeding, John Wiley & week after treatment, the S biotype is dead, but no injury is Sons, Inc., pp. 75-105 (2003). About 500 seeds from both R observed on the R biotype. and S plants are harvested at maturity and kept separately. F US 2007/0180574 A1 Aug. 2, 2007
plants are grown and maintained similarly as previously 2x glyphosate decreased to 20-30%, 4WAT, and full recov described. The F progeny are evaluated for glyphosate ery is observed after 5 weeks. Glyphosate at 4x and higher sensitivity when the plants are 5 to 8 cm tall. Glyphosate is rates killed the F plants. The data indicated that the inher sprayed at 0.125x, 0.5x, 0.25x, 1x, 2x, 4.x, 6.x, and 8x and itance of glyphosate resistance in California rigid ryegrass is the spray solutions prepared and delivered as described previously. The response of 10 plants in each of two experi partial dominance and pollen transmitted, with no indication ments to glyphosate is recorded 3 and 4 WAT. of maternal inheritance. 0097 Twenty uniform non-sprayed plants of the F prog 0099 Non-sprayed F progeny (20 plants) from RxS are eny (RxS) are grown and pooled to allow intercrossing to intercrossed to produce F. Glyphosate sensitivity evalua generate F. Seeds are harvested at maturity and grown as tion and Chi-square analysis of the F population are shown described previously. Glyphosate sensitivity is further evalu in Table 3. Plants that died from 0.125x and those that ated in the F population. At the tillering stage, as described Survived 8x of glyphosate are designated genotypically previously, 400 plants of the F population are sprayed with similar to the R and S parents, respectively. The rest of the 0.125x glyphosate (the rate used to identify the sensitive plants in the population are identified as intermediate parent). The number of sensitive plants (severely injured and between sensitive and resistant plants. The expected ratio dead) is recorded 3 to 4 WAT. The survivors are re-accli and Chi-square analysis based on Mendelian segregation are mated for another week and re-sprayed with 8x glyphosate shown in Table 3.
TABLE 3 Chi-square analysis of the F2 population generated from hybridization between the resistant (survived 8x glyphosate) and the sensitive (dead from 0.125x glyphosate) bio es of rigid rvegrass (Loium rigidium Gaud.) from California.
Sensitive Intermediate Resistant (0.125x) (0.125x-8x) (8x) Total P value F. (Observed) 27 352 21 400 F2 (Expected)" 100 (1/4) 200 (1/2) 100 (1/4) 400 X. 2 53 116 62 231 na F. (Expected) 25 (1/16) 350 (14/16) 25 (1/16) 400 X. 2 O.2 O.O1 O.6 O8 a.a. O.75 & P & O.9 Model used for the expected ratio of segregation in the F2 population if one gene is involved in the inheritance of glyphosate resistance: Resistant (RR): Intermediate (Rr): Sensitive (rr) = 1f4: 24: 1.f4, na: hypothesis not accepted, aa: hypothesis accepted. Model used for the expected ratio of segregation in the F2 population if two genes are involved in the inheritance of glyphosate resistance: Resistant (RRRR): Intermediate (RRRr + RRrr + Rrrr): Sensitive (rrrr) = 1/16: 14/16: 1/16 na: hypothesis not accepted: aa: hypothesis accepted.
(the rate used to identify the resistant parent). The number of 0100. In the F population of 400 plants intercrossed from survivors is recorded 3 to 4WAT. The remaining plants from RXS, 27 plants are sensitive (died from 0.125x glyphosate), the plant population that showed a response between sensi 352 are intermediate (between R and S), and 21 plants are tive and resistant rates are identified as intermediate. resistant (survived 8x glyphosate). These numbers are tested Expected ratios in the F population between sensitive, against the hypothesized distribution ratio of (1/4): (2/4): intermediate, and the resistant are evaluated with the model (1/4) and (1/16): (14/16): (1/16) associated with inheritance of one or two genes involved in the inheritance of glyphosate by one or two genes, respectively. Values of they (=0.8; resistance as discussed in, for example, Diggle and Neve in 0.75 previously. The methods for RNA isolation are modified template, dT-anchor (SEQ. ID. NO.9) and RP3 as a forward from methods discussed in Chomczynski and Sacchi, Anal. and reverse primers, respectively. Forbetter amplification of Biochem 162-156-159 (1987). Poly A mRNA is isolated 5' end EPSPS gene, nested PCR is generated with the current from total RNA by using Oligotex mRNA Mini Kit PCR product as a template, anchor primer and RP4 as (QIAGEN Inc, Valencia, Calif.), the procedures followed forward and reverse primers, respectively. Temperatures for manufacturer recommendations. The quantity and quality of amplification of PCR mixtures are adjusted as the manufac mRNA is determined spectrometrically. turer recommended. Amplification products from nested PCR are electrophorized, visualized and further processed as 0102) The first strands of cDNA are synthesized from described previously. poly A mRNA using the 5"/3' RACE PCR kit (Roche Applied Science, Penzberg, Germany). Procedures for synthesis of 0105 To confirm the sequences from the PCR products, the first strands cDNA followed the kit recommendation. It the main fragments, 5' end, and 3' end of EPSPS coding started with transcription of the mRNA using dT-anchor and regions are cloned into a plasmid by using the pGEM Easy reverse transcriptase in the reaction buffer provided. The Vector System II (Promega Corp., Madison, Wis.). The first strand of cDNA is used as a template for the PCR to fragments from PCR products are ligated in to the vectors, amplify the main fragment of EPSPS coding region using and then transformed into JM 109 Competent Cells and forward and reverse oligonucleotides (FP1 and reverse RP1 grown on bacto-agar plates which contain antibiotics, IPTG, primers, respectively (Integrated DNA Technologies, Inc., and X-gal. After 24h cultured at 37°C., the growth of white Iowa)). The PCR mixtures including cDNA template, prim colonies indicated successful transformations, while the blue ers, buffer (Promega Corp., Madison, Wis.), dNTP (nucle colonies indicated failure. The white colonies are further otides mix (Promega Corp., Madison, Wis.)), and Taq poly grown in the LB media containing antibiotics with shaking merase (Promega Corp., Madison, Wis.) are developed in at 37°C. for 24 h. The plasmid DNA is then extracted using the thermo-cycle with temperatures adjusted as the manu the extraction kit (QIAGEN Inc., Valencia, Calif.). The facturer recommended for the primers. If annealing tem insert fragments are sequenced at the GTSF, Michigan State perature of the primers are more than 1.0 C apart, the University. reactions are assigned by touch-down PCR as discussed in, for example, Donet al., Nucl. Acid Res. 19(14):408 (1991). Example 5 PCR products are subjected to electrophoresis to identify a Successful amplification by visualization of a clear band 0106 A SNP assay to determine a single nucleic poly under UV light. The band is excised and DNA is gel morphism (“SNP) for the EPSPS geneat int301 of SEQ. ID. extracted using the kit (from 5"/3' RACE PCR kit). The NO. 1 in a target/test plant. By sequencing of the EPSPS extracted DNA from PCR products are sequenced at the from sensitive and resistant ryegrass biotypes the SNP was Genomic Technology and Support Facilities, (“GTSF), identified. A change from cytosine to thymine at this position Michigan State University. changes the amino acid from proline to serine. The SNP at nt301 of SEQ. ID. NO. 1 can be used as a marker to identify 0103) The of 3' end of EPSPS gene is generated by 3' plants that carry the resistant form of EPSPS. RACE PCR using the first strand cDNA as a template as illustrated in FIG. 2. Forward oligonucleotide primers (FP1 DNA Extraction (SEQ. ID, NO. 3); FP2 (SEQ. ID, NO. 4); FP3 (SEQ. ID. 0.107 Leaf tissue is harvested from target/test plants NO. 5)) are constructed from the main fragment of EPSPS growing in the greenhouse. DNA is extracted either by using coding region sequenced previously, and an anchor primer the QIAGEN DNeasy(R) plant mini kit or Whatman(R) FTAR) (SEQ. ID. NO. 10) is provided in the kit and is used as a Elute Micro Cards. Standard protocol is used for purification reverse primer. The PCR mixtures are developed in thermo of total DNA from plant tissue using the manufacturers cycle as mentioned previously, which temperatures adjusted recommendations (QIAGEN Sciences, Maryland, USA or as the manufacturer recommended. Amplification products Whatman Inc. Florham Park, N.J., USA). are electrophorized and further processed, as described previously. 0.108 Starting with a minimum of 10 mg of plant tissue, 5 parts of PBS buffer is added to 1 part of plant tissue. Leaf 0104. The 5' end of EPSPS coding region is generated by material is ground to a homogenate using a micropestle and 5' RACE PCR. Reverse oligonucleotide primers (RP2 (SEQ. microfuge tube. The homogenate is applied to the FTAR ID, NO. 6), RP3 (SEQ. ID. NO. 7), and RP4 (SEQ. ID, NO. Elute Micro Card matrix inside the marked circle. Any 8)) are constructed from the main fragment of the EPSPS remaining semi-homogenized tissue is pressed against the coding region, which are sequenced previously. The Strand card and then discarded. The FTA cards are air dried for two of 5' end cDNA is synthesized from mRNA using primer hours at room temperature. DNA is eluted from the FTA RP2 and reverse transcriptase in the buffer reaction as cards according to the recommended protocol except that mentioned previously. Poly A-tails are attached at the end of instead of a single, 3 mm diameter punch, two punches of 2 5' end cDNA strands in the reaction of dATP nucleotides and mm diameter are processed per sample (2 mm punch tool terminal transferase, which are provided in the same kit as from Roboz, Surgical Instrument Co. Inc. Gaithersburg, Md., mentioned previously. PCR are generated to amplify 5' end USA, catalog # 65-9902). Two punches from unused What EPSPS coding region using the strand of 5' end cDNA as a man FTA paper are used after each sample to minimize US 2007/0180574 A1 Aug. 2, 2007 cross-contamination. Processing of the punches in 1.5 ml (1997). Reaction of shikimate 3-phosphate (S3P) and phos microcentrifuge tubes, the DNA is eluted using sterile water. phoenol pyruvate (PEP) is assayed in micro-tubes using 10 The concentration of DNA is estimated using a spectropho ul enzyme extract in a pH 7.5 buffer. The reaction mixtures tOmeter. contained 50 mM HEPES, 1 mM (NH), Mo.O., 5 mM KF, 1 mM PEP, 1 mM S3P and glyphosate at 0, 5, 50, 500, and SNP Assay 5000 uM. Reaction mixtures are incubated at 25°C. for 20 0109) A Custom TaqMan(R) SNP genotyping assay is min, stopped in water bath at 100° C. for 2 min, and developed based on the manufacturers recommendations centrifuged at 15,000xg for 10 min for sedimenting dena (Applied Biosystems, Foster City, Calif., USA). Five micro tured protein. The reaction of S3P and PEP is quantified by liters DNA of each sample is transferred to wells of a determining the remaining PEP in the mixtures, which is 384-well plate (Applied Biosytems 384-well Optical reac analyzed spectrophotometrically at 340 nm by adding tion plates, catalog #4309849), in duplicate, and are allowed NADH, pyruvate kinase and lactate dehydrogenase (PK/ to air-dry at room temperature. SNP genotyping assays are LDH). Reaction control used denatured plant extract (after performed by adding 5ul of reaction master mix to each well preheated in thermo-cycle at 100° C. for 3 min) in the of the 384-well plate 2.5 ul of Taqman Universal Master reactions. Enzymatic activity of EPSPS is expressed in Mix with no Amperase(R). UNG (2x), 0.125ul of 40x Assay enzyme unit (EU) per mg protein, 1 EU is equal to 1 mole Mix (primers and Taqman probe, 40x), and 2.375 ul Molecu of PEP used per min in the assayed reaction. lar biology grade water. Primers and Taqman probes are 0113 Data from duplicate experiments with three repli designed and synthesized by Applied Biosystems “Assay cations of each treatment are analyzed by non-linear regres by-Design” service (Forward primer: CGGCAGGTTC sion and fitted to a log-logistic model, CCGATTGA (SEQ. ID, NO. 11); Reverse primer: GCATTTCCACCAGCAGCTACTA (SEQ. ID. NO. 12): VIC(R)-labeled Taqman probe: CCGTCAATGGCCGCAT 100 (SEQ. ID. NO. 13); and FAMTMTM-labeled Taqman probe: y = 1 + expb(logx -logX50) CCGTCAATGACCGCAT (SEQ. ID, NO. 14)). The plate is sealed (Applied Biosystems MicroAmp optical adhesive film, catalog # 4311971), is vortexes briefly, and is centri where y is predictive of EPSPS activity (% of control), fuged briefly. Xs=concentration of glyphosate required to obtain 50% inhibition of EPSPS activity, and b is the slope at Xso. 0110 Real-time PCR is performed in an Applied Biosys 0114) Evaluation of the activity of the constitutive EPSPS tems 7900HT Sequence Detection System, using the passive from R and S biotypes of rigid ryegrass showed that the reference dye. ROX, and 9600 emulation off (Cycling EPSPS is significantly inhibited more in S than in R in the parameters: 50° C. for 2 minutes, 95°C. for 10 minutes: 40 presence of glyphosate from 5 to 5000 uM as shown in FIG. cycles of 92° C. for 15 seconds and 60° C. for 1 minute). 3. Decreased sensitivity levels of EPSPS in R plants Allelic discrimination analysis is performed using the appeared to be a major contributor to glyphosate resistance Applied Biosystems SDS software (v2.1). in California rigid ryegrass. This is in contrast to the results reported with Australian rigid ryegrass as discussed in, for Example 6 example, Baerson et al., Weed Sci. 50:721-730 (2002) and 0111) Extraction methods for EPSPS are modified from Lorraine-Colwill et al., Pestic. Sci. 55:486-503 (1999), and methods discussed in Boerboom et al., Weed Sci. 38:463-467 has dramatically and unexpectedly more glyphosate resis (1990). Crown tissue (0.5 gram fresh weight per sample) is tance (about 2 orders of magnitude) than the reports about harvested from California rigid ryegrass plants, frozen in glyphosate resistant goosegrass from Malaysia as discussed liquid nitrogen, and grounded in a cold mortar with 150 mg in, for example, Baerson et al. Plant Physiol. 129:1265-1275 polyvinylpolypyrrolidone (PVPP). The fine powder tissue is (2002). ground further in 0.5 ml extraction buffer (pH 7.5) contain Example 7 ing 10 mM Trizma HCl, 1 mM ethylenediaminetetraacetic acid (EDTA), 10% (v/v) glycerol, 1 mg ml bovine serum 0115 The R biotype of California rigid ryegrass, which albumin (BSA), 10 mM ascorbate, 1 mM benzamidine Survived 8x glyphosate and perennial ryegrass, which died (BAM), and 5 mM dithiothreitol (DTT). The mixture is from 0.25x of glyphosate, are grown individually in 950-ml centrifuged at 15,000xg for 10 min, and the supernatant is pot with professional planting mix media as discussed desalted in 1.0 ml Sephadex G-50 column (7 MICRO above. Plants are maintained in greenhouse with Supplemen SPINS(R) Shephadex G-50 column, Life Science Products tal light, watered daily, and fertilized weekly with NPK Inc., Frederick, Colo.) and further centrifuge at 1,000xg for water soluble fertilizer (20-20-20). At the mature vegetative 3 min. Total protein in the Supernatant is quantified spec stage, perennial ryegrass plants are vernalized in the growth trometrically at 595 nm followed the method discussed in chamber with the temperature 4+1 C., 8 h day and 16 h night. After 4 weeks Vernalization, the plants are removed Bradford, Anal. Biochem 72:248-254 (1976). and maintained in greenhouse until flowering. Glyphosate 0112 Assay of EPSPS activity is modified from methods rigid ryegrass plants does not need Vernalization for onset of discussed in Westwood and Weller, Weed Sci. 45:2-11 flowering. US 2007/0180574 A1 Aug. 2, 2007 0116 Seed heads of perennial ryegrass are designated to be pollinated by California rigid ryegrass also vice-verse TABLE 4 because both of the species are allogamus plants. Both are Hybridization scheme between perennial ryegrass (Lolium perenne) known to be self-incompatible. After the emergence of seed and glyphosate resistant rigid ryegrass (L. rigidium) from California. heads and before the pollen opened, one plant from each Rigid ryegrass (collected from California) species is isolated in one room of greenhouse. To provide conditions for cross-pollination, perennial ryegrass and rigid ryegrass plants are placed next to each other. During the y pollination period, plants are maintained regularly as men Segregation in first generation tioned previously until the seed reached the maturity. The successful hybridization is indicated with the full develop y ment of mature seeds which had brown color. Seeds are Selection to separate resistant and sensitive harvested from both perennial and rigid ryegrass. Seeds from perennial ryegrass hybrids are used for further evalu ation. y 7th generation of Perennial ryegrass X Resistant rigid ryegrass 0117 Seeds of the F hybrid harvested from perennial (Sparent) (Survived 8x glyphosate ryegrass are grown and maintained as individual plants in the greenhouse as described previously. At the tillering stage, 50 plants for each of glyphosate rates (0.25, 0.5, 1.0, 1.5.2.0, 4.0, and 8x, where X=1.12 kgha") are evaluated for F1 hybrid sensitivity or resistance. Glyphosate is delivered in 187 L (Intercrossed) ha spray solutions with 172.5 kPa pressure using a flat fan nozzle. The dead or survivors in each treatment are counted 3 weeks after treatment and the plants with the highest level (S-parent) F2 hybrid of resistance are further maintained and intercrossed to Perennial ryegrass * (R):(I):(S) generate F2. 0118. The population of F is evaluated for glyphosate | sensitivity with 0.5x glyphosate. Severely injured and dead Fibc1 hybrid plants are recorded 3 weeks after treatment (WAT) and are (Intercrossed) designated similar to the sensitive (S) parent. The survivors are re-acclimated for further evaluation at 8x glyphosate. | The Survivors from 8x glyphosate are designated similar to Perennial ryegrass Fbc1 hybrid resistant (R) parent. The rest of the population that (S-parent) (glyphosate R) responded between S and Rare identified as intermediate (I). 0119) The inheritance of glyphosate resistance trait is evaluated based on Mendelian segregation ratio in the F population. Expected ratios between sensitive, intermediate, (Evalute for R, I, and S) and the resistance are hypothesized with one, two, or more than two genes involved. Chi-square analyses are used to determine the most acceptable ratio for F segregation. 0.122 The glyphosate resistant traits are transferred via cross-pollination to perennial ryegrass. Plants of the F 0120) The resistant plant from F. population is back hybrid harvested from perennial ryegrass showed interme crossed to the S parent (perennial ryegrass). Procedures for diate resistant level and 90 percent survived to glyphosate vernalization and pollination are similar to what is described 2x (see Table 5). above. Plants of the F hybrid from the backcross (F. bc.) are allowed to intercross to generate F. (Fabc.). The inheritance TABLE 5 of glyphosate resistance traits is evaluated in the Fabc Glyphosate sensitivity or resistance in the F1 population (hybridization population. Glyphosate sensitivity is evaluated at 0.25x and of perennial rvegrass and glyphosate resistance rigid ryegrass 8x glyphosate. Data collection and genetic evaluation are Severely injured similar to the procedures as described above. Glyphosate and dead Survivors kg ha' Percent) 0121 Hybridization between perennial ryegrass and gly O O 100 phosate resistant rigid ryegrass from California is Success O.25 O 100 fully performed in greenhouse (see Table 4). US 2007/0180574 A1 Aug. 2, 2007 18 construct with kanamycin resistant gene, BAR gene as a TABLE 5-continued selectable marker, and 35S Promoter. The ligation is cloned in pGEM vector and grown in LB broth. The plasmid from Glyphosate sensitivity or resistance in the F1 population (hybridization of perennial rvegrass and glyphosate resistance rigid rvegrass cloned pGEM is confirmed for the inserted EPSPS gene by PCR. Severely injured Glyphosate and dead Survivors 0127. The confirmed plasmid is transformed into Agro bacterium tumefaciens by “freeze thaw technique' using OSO 6 94 1 10 90 liquid nitrogen. The transformed Agrobacterium is grown in 2 10 90**) LB plated and maintained 28°C. for 72 h. Some colonies are 4 100 O grown in LB broth for 24 hand tested for the inserted EPSPS 8 100 O gene by PCR. The confirmed Agrobacterium is grown in 50 mL LB broth for 24 h. The Agrobacterium is centrifuged at *) percent of the total (50 plants per treatment) 5000xg for 10 min, and the pellets are diluted with 2 mL 1.0 **) intercrossed to generate F2 hybrid M CaCl. At the same time, a wild-type Agrobacterium is 0123 Segregation of glyphosate sensitivity in the F. also grown and extracted similar to the transformed Agro population is illustrated in FIG. 4. The percentage of the bacterium. The Agrobacterium solutions (10 uD) are grown sensitive plants in F (16 percent) is higher than expected in 50 mL media containing 1xM-9 salt media (SIGMA), 20 due to the glyphosate rate (0.5x) exceeded the sensitivity mM glucose, 2 mM MgSO and glyphosate at 0, 0.25, 0.5, level of sensitive parents. Further evaluation showed that 0.75, 1.0, 1.5, and 2 mM. sensitivity level of perennial ryegrass is 0.25x glyphosate. 0128. The growth (indicated by Optical Density 600 nm) 0124 Backcrossing between the resistant plants from F2 is measured after 48 hours. Results are shown in Table 6 and to the sensitive parent of perennial ryegrass is designed to FIG. 7. re-capture agronomic characteristics of sensitive parents (perennial ryegrass). The level of glyphosate resistance in TABLE 6 the F1bc1 population appears to be similar to the previous Growth of wild-type and transformed Agrobacterium in M-9 media results in F1 population. Distribution of glyphosate sensi with various glyphosate concentrations. tivity level in the F2bc1 population is illustrated in FIG. 5. Transformed A sample of the resistant plants from the F2bc1 is evaluated Glyphosate Wild-type Agrobacterium Agrobacterium for the level of sensitivity at 0, 1, 2, 4, 6, 8, 10, 12, and 14x glyphosate and data is illustrated in FIG. 6. No injury is mM OD 600 mm Percent OD 600 mm Percent observed up to 6x glyphosate, slight injury is observed at 8x O.OO O.638 99 O.64 100 and 10x, and severe injury is observed at 12x glyphosate. O.25 O.236 37 O.632 98 The growth and development, including inflorescence of the OSO O.OOS O.8 O.185 29 resistant R clones from F2bc1 treated with glyphosate up to 0.75 O.OOS O.8 O.097 15 1.OO O.004 O.8 O.O2S 4 8x is similar to the control plants. 1...SO O.004 O.8 O.O24 4 2.OO O.004 O.8 O.O2 3 Example 8 0125 The level of glyphosate resistance is assayed from resistant rigid ryegrass EPSPS-expressing Agrobacterium 0.129 Embodiments and the examples described herein are exemplary and not intended to be limiting in describing that are transformed with a DNA construct encoding the the full scope of compositions and methods of these disclo resistant EPSPS enzyme (SEQ. ID, NO. 16). Sure. Equivalent changes, modifications and variations of 0126 An EPSPS gene (SEQ. ID. NO. 15) is obtained Some embodiments, materials, compositions and methods from glyphosate resistant rigid ryegrass. The EPSPS gene is can be made within the scope of the present disclosure, with ligated with the binary vector pFGC5941, a 11406 bp Substantially similar results. SEQUENCE LISTING <160> NUMBER OF SEQ ID NOS : 18 SEQ ID NO 1 LENGTH 1320 TYPE DNA ORGANISM: Lolium rigidum FEATURE NAME/KEY: CDS LOCATION: (1) . . (1320) OTHER INFORMATION: Resistant (R) biotype <400 SEQUENCE: 1 US 2007/0180574 A1 Aug. 2, 2007 20 -continued cc.g. cqt cag coc titt goa agg aaa cac citg aaa got gtt gat gtc. aac 96.O Pro Arg Glin Pro Phe Gly Arg Lys His Lieu Lys Ala Val Asp Wall Asn 305 310 315 320 atgaac aaa at g cct gat gtt goc at g act citt gcc gtt gtt gcc citt OO 8 Met Asn Lys Met Pro Asp Val Ala Met Thr Leu Ala Val Val Ala Leu 325 330 335 titt gcc gat ggit coa act gct atc aga gat gtt gcc toc togg aga gtg O56 Phe Ala Asp Gly Pro Thr Ala Ile Arg Asp Val Ala Ser Trp Arg Val 340 345 35 O aag gala acc gag aga atg gtg goa atc toc acg gaa cita aca aag citg 104 Lys Glu Thr Glu Arg Met Val Ala Ile Cys Thr Glu Lieu. Thir Lys Lieu 355 360 365 gga goa acg gta gag gaa gqc cog gac tac toc att atc aca coa coa 152 Gly Ala Thr Val Glu Glu Gly Pro Asp Tyr Cys Ile Ile Thr Pro Pro 370 375 38O gag aag citg aac gtc acg gca atc gac acc tac gat gac cac cqg atg 200 Glu Lys Lieu. Asn Val Thr Ala Ile Asp Thr Tyr Asp Asp His Arg Met 385 390 395 400 gc g at g g cc titc. tcc citc gcc goc toc got gag gtg cct gtc acg atc 248 Ala Met Ala Phe Ser Leu Ala Ala Cys Ala Glu Val Pro Val Thr Ile 405 410 415 agg gaC cct ggg togc acc cqc aag acc titc ccc aac tac titt gac gtg 296 Arg Asp Pro Gly Cys Thr Arg Lys Thr Phe Pro Asn Tyr Phe Asp Val 420 425 43 O Cta agc acc tta gtg aag aac tag 320 Leu Ser Thr Lieu Val Lys Asn 435 <210> SEQ ID NO 2 &2 11s LENGTH 439 &212> TYPE PRT <213> ORGANISM: Lolium rigidum <400 SEQUENCE: 2 Val Lieu Gln Pro Ile Lys Glu Ile Ser Gly Ala Val Glin Leu Pro Gly 1 5 10 15 Ser Lys Ser Lieu Ser Asn Arg Ile Leu Lleu Lleu Ser Ala Leu Ser Glu 2O 25 30 Gly. Thir Thr Val Val Asp Asn Leu Leu Asn Ser Glu Asp Val His Tyr 35 40 45 Met Leu Glu Ala Lieu. Asp Ala Leu Gly Lieu Ser Val Glu Ala Asp Lys 50 55 60 Val Ala Lys Arg Ala Val Val Val Gly Cys Gly Gly Arg Phe Pro Ile 65 70 75 8O Glu Lys Asp Ala Lys Glu Glu Val Lys Lieu Phe Leu Gly Asn Ala Gly 85 90 95 Thr Ala Met Arg Ser Lieu. Thir Ala Ala Val Val Ala Ala Gly Gly Asn 100 105 110 Ala Thr Tyr Val Leu Asp Gly Val Pro Arg Met Arg Glu Arg Pro Ile 115 120 125 Gly Asp Lieu Val Val Gly Lieu Lys Glin Leu Gly Ala Asn. Wall Asp Cys 130 135 1 4 0 Phe Leu Gly Thr Asp Cys Pro Pro Val Arg Ile Asn Gly Ile Gly Gly 145 15 O 155 160 Leu Pro Gly Gly Lys Wall Lys Lieu Ser Gly Ser Ile Ser Ser Glin Tyr 1.65 170 175 US 2007/0180574 A1 Aug. 2, 2007 21 -continued Leu Ser Ser Lieu Lleu Met Ala Ala Pro Leu Ala Leu Gly Asp Val Glu 18O 185 19 O Ile Glu Ile Ile Asp Lys Leu Ile Ser Val Pro Tyr Val Glu Met Thr 195 200 2O5 Leu Arg Lieu Met Glu Arg Phe Gly Val Thr Ala Glu His Ser Asp Ser 210 215 220 Trp Asp Arg Phe Tyr Ile Lys Gly Gly Glin Lys Tyr Lys Ser Pro Gly 225 230 235 240 Asn Ala Tyr Val Glu Gly Asp Ala Ser Ser Ala Ser Tyr Phe Lieu Ala 245 250 255 Gly Ala Ala Ile Thr Gly Gly Thr Val Thr Val Glin Gly Cys Gly. Thr 260 265 27 O Thr Ser Leu Gln Gly Asp Val Lys Phe Ala Glu Val Leu Glu Met Met 275 280 285 Gly Ala Lys Val Thr Trp Thr Asp Thr Ser Val Thr Val Thr Gly Pro 29 O 295 3OO Pro Arg Glin Pro Phe Gly Arg Lys His Lieu Lys Ala Val Asp Wall Asn 305 310 315 320 Met Asn Lys Met Pro Asp Val Ala Met Thr Leu Ala Val Val Ala Leu 325 330 335 Phe Ala Asp Gly Pro Thr Ala Ile Arg Asp Val Ala Ser Trp Arg Val 340 345 35 O Lys Glu Thr Glu Arg Met Val Ala Ile Cys Thr Glu Lieu. Thir Lys Lieu 355 360 365 Gly Ala Thr Val Glu Glu Gly Pro Asp Tyr Cys Ile Ile Thr Pro Pro 370 375 38O Glu Lys Lieu. Asn Val Thr Ala Ile Asp Thr Tyr Asp Asp His Arg Met 385 390 395 400 Ala Met Ala Phe Ser Leu Ala Ala Cys Ala Glu Val Pro Val Thr Ile 405 410 415 Arg Asp Pro Gly Cys Thr Arg Lys Thr Phe Pro Asn Tyr Phe Asp Val 420 425 43 O Leu Ser Thr Lieu Val Lys Asn 435 <210> SEQ ID NO 3 <211& LENGTH 21 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Synthetically derived primer <400 SEQUENCE: 3 gatgcCaagg aggaagta aa g 21 <210> SEQ ID NO 4 <211& LENGTH 24 &212> TYPE DNA <213> ORGANISM: Artificial Sequence &220s FEATURE <223> OTHER INFORMATION: Synthetically derived primer <400 SEQUENCE: 4 tgctatoaga gatgttgcgt cotg 24 US 2007/0180574 A1 Aug. 2, 2007 22 -continued SEQ ID NO 5 LENGTH 24 TYPE DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Synthetically derived primer <400 SEQUENCE: 5 tgctatoaga gatgttgcgt cotg 24 SEQ ID NO 6 LENGTH 19 TYPE DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Synthetically derived primer <400 SEQUENCE: 6 alacaggtggg CagtCagtg 19 SEQ ID NO 7 LENGTH 24 TYPE DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Synthetically derived primer <400 SEQUENCE: 7 ataggacgct coctoattct togt 24 SEQ ID NO 8 LENGTH 24 TYPE DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Synthetically derived primer <400 SEQUENCE: 8 tittccaccag cagotactac agca 24 SEQ ID NO 9 LENGTH 33 TYPE DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Synthetically derived primer <400 SEQUENCE: 9 gaccacgc.gt atcgatgtcg actttitttitt titt 33 SEQ ID NO 10 LENGTH 22 TYPE DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Synthetically derived primer <400 SEQUENCE: 10 gaccacgc.gt atc gatgtcg ac 22 SEQ ID NO 11 LENGTH 18 TYPE DNA US 2007/0180574 A1 Aug. 2, 2007 23 -continued ORGANISM: Artificial FEATURE: OTHER INFORMATION: forward primer sequence for SNP assay <400 SEQUENCE: 11 cggcaggttc cc.gattga 18 SEQ ID NO 12 LENGTH 22 TYPE DNA ORGANISM: Artificial FEATURE: OTHER INFORMATION: reverse primer sequence for SNP assay <400 SEQUENCE: 12 gcatttccac cagoagctac ta 22 SEQ ID NO 13 LENGTH 16 TYPE DNA ORGANISM: Artificial FEATURE: OTHER INFORMATION: WIC labeled probe sequence for SNP assay <400 SEQUENCE: 13 cc.gtcaatgg cc.gcat 16 SEQ ID NO 14 LENGTH 16 TYPE DNA ORGANISM: Artificial FEATURE: OTHER INFORMATION: FAM labeled probe sequence for SNP assay <400 SEQUENCE: 14 cc.gtcaatga cc.gcat 16 SEQ ID NO 15 LENGTH 1176 TYPE DNA ORGANISM: Lolium rigidum FEATURE: NAME/KEY: CDS LOCATION: (1) . . (1173) OTHER INFORMATION: Resistant (R) biotype <400 SEQUENCE: 15 atg citc gag goc citg gac gog citc ggg citc. tcc gtg gaa goa gac aaa 48 Met Leu Glu Ala Lieu. Asp Ala Leu Gly Lieu Ser Val Glu Ala Asp Lys 1 5 10 15 gtt goa aaa aga gct gta gito gtt ggc tdt ggc ggc agg titc cc g att 96 Val Ala Lys Arg Ala Val Val Val Gly Cys Gly Gly Arg Phe Pro Ile 2O 25 30 gala aag gat gcc aaa gag gaa gta aag citc titc titg g g g aac got gga 144 Glu Lys Asp Ala Lys Glu Glu Val Lys Lieu Phe Leu Gly Asn Ala Gly 35 40 45 act gcg at g c go to a titg acg goa gca gta gta gct gct ggt gga aat 192 Thr Ala Met Arg Ser Lieu. Thir Ala Ala Val Val Ala Ala Gly Gly Asn 50 55 60 gca act tat gtt citt gat gga gta coa aga atg agg gag cqa cott atc 240 Ala Thr Tyr Val Leu Asp Gly Val Pro Arg Met Arg Glu Arg Pro Ile 65 70 75 8O US 2007/0180574 A1 Aug. 2, 2007 25 -continued cita agc acc tta gtg aag aac tag 1176 Leu Ser Thr Lieu Val Lys Asn 385 390 SEQ ID NO 16 LENGTH 391 TYPE PRT ORGANISM: Lolium rigidum <400 SEQUENCE: 16 Met Leu Glu Ala Lieu. Asp Ala Lieu Gly Telu Ser Wall Glu Ala Asp 1 5 10 15 Val Ala Lys Arg Ala Val Val Val Gly Cys Gly Gly Phe Pro Ile 25 30 Glu Lys Asp Ala Lys Glu Glu Val Lys Telu Phe Teu Gly Asn Ala Gly 35 40 45 Thr Ala Met Arg Ser Leu Thir Ala Ala Wall Wall Ala Ala Gly Gly Asn 50 55 60 Ala Thr Tyr Val Leu Asp Gly Val Pro Met Arg Glu Arg Pro Ile 65 70 75 8O Gly Asp Lieu Val Val Gly Lieu Lys Glin Telu Gly Ala Asn Wall Asp 85 90 95 Phe Leu Gly Thr Asp Cys Pro Pro Wall Arg Ile Asn Gly Ile Gly 100 105 110 Leu Pro Gly Gly Lys Wall Lys Lieu Ser Gly Ser Ile Ser Ser Glin 115 120 125 Leu Ser Ser Lieu Lleu Met Ala Ala Pro Telu Ala Teu Gly Asp Wall Glu 130 135 1 4 0 Ile Glu Ile Ile Asp Lys Lieu. Ile Ser Wall Pro Wall Glu Met Thr 145 15 O 155 160 Leu Arg Lieu Met Glu Arg Phe Gly Wall Thr Ala His Ser Asp Ser 1.65 170 175 Trp Asp Arg Phe Tyr Ile Lys Gly Gly Glin Ser Pro Gly 18O 185 19 O Asn Ala Tyr Val Glu Gly Asp Ala Ser Ser Ala Ser Tyr Phe Telu Ala 195 200 Gly Ala Ala Ile Thr Gly Gly Thr Wall Thr Wall Glin Gly Cys Gly Thr 210 215 220 Thir Ser Lieu Glin Gly Asp Wall Lys Phe Ala Glu Wall Teu Glu Met Met 225 230 235 240 Gly Ala Lys Val Thr Trp Thr Asp Thr Ser Wall Thr Wall Thr Gly Pro 245 250 255 Pro Arg Glin Pro Phe Gly Arg Lys His Telu Ala Wall Asp Wall Asn 260 265 27 O Met Asn Lys Met Pro Asp Val Ala Met Thr Teu Ala Wall Wall Ala Telu 275 280 285 Phe Ala Asp Gly Pro Thr Ala Ile Arg Asp Wall Ala Ser Trp Arg Wall 29 O 295 Lys Glu Thr Glu Arg Met Val Ala Ile Cys Thr Glu Teu Thr Telu 305 310 315 320 Gly Ala Thr Val Glu Glu Gly Pro Asp Tyr Ile Ile Thr Pro Pro 325 330 335 Glu Lys Lieu. Asn Val Thr Ala Ile Asp Thr Asp Asp His Arg Met US 2007/0180574 A1 Aug. 2, 2007 26 -continued 340 345 35 O Ala Met Ala Phe Ser Leu Ala Ala Cys Ala Glu Val Pro Val Thr Ile 355 360 365 Arg Asp Pro Gly Cys Thr Arg Lys Thr Phe Pro Asn Tyr Phe Asp Val 370 375 38O Leu Ser Thr Lieu Val Lys Asn 385 390 SEQ ID NO 17 LENGTH 1176 TYPE DNA ORGANISM: Lolium rigidum FEATURE: NAME/KEY: CDS LOCATION: (1) . . (1173) OTHER INFORMATION: Sensitive (S) biotype <400 SEQUENCE: 17 atg citc gag goc citg gac gog citc ggg citc. tcc gtg gaa goa gac aaa 48 Met Leu Glu Ala Lieu. Asp Ala Leu Gly Lieu Ser Val Glu Ala Asp Lys 1 5 10 15 gtt goa aaa aga gct gta gito gtc. g.gc tdt ggc ggc agg titc cc g att 96 Val Ala Lys Arg Ala Val Val Val Gly Cys Gly Gly Arg Phe Pro Ile 2O 25 30 gag aag gat gcc aag gag gala gta aag Ct c titC titg ggg aac gCt gga 144 Glu Lys Asp Ala Lys Glu Glu Val Lys Leu Phe Leu Gly Asn Ala Gly 35 40 45 act gcg at g c go coa titg acg goa gct gta gta gct gct ggt gga aat 192 Thr Ala Met Arg Pro Leu Thir Ala Ala Val Val Ala Ala Gly Gly Asn 50 55 60 gc g act tat gtt citt gat gga gta coa aga atg agg gag cqa cott atc 240 Ala Thr Tyr Val Leu Asp Gly Val Pro Arg Met Arg Glu Arg Pro Ile 65 70 75 8O ggit gac tta gtt gtc. g.gt titg aaa caa cita ggit gcg aat gtt gat tdt 288 Gly Asp Lieu Val Val Gly Lieu Lys Glin Leu Gly Ala Asn. Wall Asp Cys 85 90 95 titc citc ggg acc gac toc cca cott gtt cqt atc aac ggc att gga ggg 336 Phe Leu Gly Thr Asp Cys Pro Pro Val Arg Ile Asn Gly Ile Gly Gly 100 105 110 cita cott ggt ggc aag gtt aag citg tot ggit toc atc agc agc caa tac 384 Leu Pro Gly Gly Lys Wall Lys Lieu Ser Gly Ser Ile Ser Ser Glin Tyr 115 120 125 ttg agt to c ttg citg atg gct gct cott ttg got citt gag gat gtc gag 432 Leu Ser Ser Lieu Lleu Met Ala Ala Pro Leu Ala Leu Gly Asp Val Glu 130 135 1 4 0 att gaa atc att gat aaa cita atc tot gtt cot tac gtt gaa atg aca 480 Ile Glu Ile Ile Asp Lys Leu Ile Ser Val Pro Tyr Val Glu Met Thr 145 15 O 155 160 ttg aga titg at g gag cqt titt ggc gtg acg goa gag cat tot gat agc 528 Leu Arg Lieu Met Glu Arg Phe Gly Val Thr Ala Glu His Ser Asp Ser 1.65 170 175 tgg gac aga titc tac att aaa gga gga cag aag tac aag toc cott gga 576 Trp Asp Arg Phe Tyr Ile Lys Gly Gly Glin Lys Tyr Lys Ser Pro Gly 18O 185 19 O aat goc tat gtc. gala gqt gat gcc to g agt gcg agt tat titc ttg got 624 Asn Ala Tyr Val Glu Gly Asp Ala Ser Ser Ala Ser Tyr Phe Lieu Ala 195 200 2O5 ggit gct gca atc act gga gga act gtg act gito caa gqt toc ggc acc 672 US 2007/0180574 A1 Aug. 2, 2007 27 -continued Gly Ala Ala Ile Thr Gly Gly Thr Val Thr Val Glin Gly Cys Gly. Thr 210 215 220 acc agt ttg cag ggit gat gtg aaa titt got gag gta cita gala at g atg 720 Thr Ser Leu Gln Gly Asp Val Lys Phe Ala Glu Val Leu Glu Met Met 225 230 235 240 gga gog aag gtt aca togg acc gac act agt gta act gtt act ggit coa 768 Gly Ala Lys Val Thr Trp Thr Asp Thr Ser Val Thr Val Thr Gly Pro 245 250 255 cc.g. cqt cag coc titt goa agg aaa cac citg aaa got gtt gat gtc. aac 816 Pro Arg Glin Pro Phe Gly Arg Lys His Lieu Lys Ala Val Asp Wall Asn 260 265 27 O atgaac aaa at g cct gat gtt goc at g act cita gcc gtt gtt gcc citt 864 Met Asn Lys Met Pro Asp Val Ala Met Thr Leu Ala Val Val Ala Leu 275 280 285 titt gcc gat ggit coa act gct atc aga gat gtt gcc toc togg aga gtg 912 Phe Ala Asp Gly Pro Thr Ala Ile Arg Asp Val Ala Ser Trp Arg Val 29 O 295 3OO aag gala acc gag aga atg gtg goa atc toc acg gaa cita aca aag citg 96.O Lys Glu Thr Glu Arg Met Val Ala Ile Cys Thr Glu Lieu. Thir Lys Lieu 305 310 315 320 gga goa acg gta gag gaa gqc cog gac tac toc att atc acg cca coa OO 8 Gly Ala Thr Val Glu Glu Gly Pro Asp Tyr Cys Ile Ile Thr Pro Pro 325 330 335 gag aag ttgaac gtc acg gcg atc gac acc tac gat gac cac cqg atg O56 Glu Lys Leu Asn Val Thr Ala Ile Asp Thr Tyr Asp Asp His Arg Met 340 345 35 O gc g at g g cc titc. tcc citt gct gct togc goc gag gtg cct gtc acg atc 104 Ala Met Ala Phe Ser Leu Ala Ala Cys Ala Glu Val Pro Val Thr Ile 355 360 365 agg gaC cct ggg togc acc cqc aag acc titc ccc gac tac titt gac gtg 152 Arg Asp Pro Gly Cys Thr Arg Lys Thr Phe Pro Asp Tyr Phe Asp Val 370 375 38O cita agc acc tta gtg aag aac tag 176 Leu Ser Thr Lieu Val Lys Asn 385 390 <210> SEQ ID NO 18 &2 11s LENGTH 391 &212> TYPE PRT <213> ORGANISM: Lolium rigidum <400 SEQUENCE: 18 Met Leu Glu Ala Lieu. Asp Ala Leu Gly Lieu Ser Val Glu Ala Asp Lys 1 5 10 15 Val Ala Lys Arg Ala Val Val Val Gly Cys Gly Gly Arg Phe Pro Ile 2O 25 30 Glu Lys Asp Ala Lys Glu Glu Val Lys Lieu Phe Leu Gly Asn Ala Gly 35 40 45 Thr Ala Met Arg Pro Leu Thir Ala Ala Val Val Ala Ala Gly Gly Asn 50 55 60 Ala Thr Tyr Val Leu Asp Gly Val Pro Arg Met Arg Glu Arg Pro Ile 65 70 75 8O Gly Asp Lieu Val Val Gly Lieu Lys Glin Leu Gly Ala Asn. Wall Asp Cys 85 90 95 Phe Leu Gly Thr Asp Cys Pro Pro Val Arg Ile Asn Gly Ile Gly Gly 100 105 110 US 2007/0180574 A1 Aug. 2, 2007 28 -continued Leu Pro Gly Gly Lys Wall Teu Ser Gly Ser Ile Ser Ser Glin Tyr 115 120 125 Teu Ser Ser Lieu Lleu. Met Ala Ala Pro Leu Ala Leu Gly Asp Wall Glu 130 135 1 4 0 Ile Glu Ile Ile Lys Lieu Ile Ser Wall Pro Wall Glu Met Thr 145 15 O 155 160 Leu Arg Lieu Met Glu Arg Phe Gly Wall Thr Ala His Ser Asp Ser 1.65 170 175 Trp Asp Phe Tyr Ile Gly Gly Glin Lys Ser Pro Gly 18O 185 19 O Asn Ala Tyr Wall Glu Gly Asp Ala Ser Ser Ala Ser Tyr Phe Leu Ala 195 200 Gly Ala Ala Ile Thr Gly Gly Thr Wall Thr Wall Glin Gly Cys Gly Thr 210 215 220 Thr Ser Lieu Glin Gly Asp Wall Phe Ala Glu Wall Leu Glu Met Met 225 230 235 240 Gly Ala Lys Wall Thr Trp Thr Thir Ser Wall. Thir Wall Thr Gly Pro 245 250 255 Pro Arg Glin Pro Phe Gly His Lieu Ala Wall Asp Wall Asn 260 265 27 O Met Asn Lys Met Pro Asp Wall Ala Met Thr Teu Ala Wall Wall Ala Leu 275 280 285 Phe Ala Asp Gly Pro Thir Ala Ile Arg Asp Wall Ala Ser Trp Wall 29 O 295 Lys Glu Thr Glu Met Wall Ala Ile Thr Glu Lieu Thr Telu 305 310 315 320 Gly Ala Thr Wall Glu Glu Gly Pro Asp Tyr Ile Ile Thr Pro Pro 325 330 335 Glu Telu Asn Wall Thir Ala Ile Asp Thr Asp Asp His Arg Met 340 345 35 O Ala Met Ala Phe Ser Leu Ala Ala Ala Glu Wall Pro Wall Thir Ile 355 360 365 Arg Asp Pro Gly Cys Thr Arg Thr Phe Pro Asp Tyr Phe Asp Wall 370 375 38O Leu Ser Thr Leu Wall Lys Asn 385 390 What is claimed is: 7. The glyphosate resistant plant according to claim 6. 1. A glyphosate resistant plant comprising a non-trans wherein the plant is a turfgrass. genic glyphosate resistant Lolium rigidium germplasm. 8. The glyphosate resistant plant according to claim 7. 2. The glyphosate resistant plant according to claim 1 wherein said turfgrass is selected from the group consisting comprising SEQ. ID. NO. 2 or a functional portion thereof. of a glyphosate resistant ryegrass, a glyphosate resistant 3. The glyphosate resistant plant according to claim 2, fescue, combinations thereof, and hybrids thereof. wherein wherein said SEQ. ID. NO. 2 or a functional portion thereof is a glyphosate resistant EPSPS protein. 9. The glyphosate resistant plant according to claim 7. 4. The glyphosate resistant plant according to claim 1 wherein said turf grass is in a golf course fairway, a golf comprising a nucleic acid sequence of SEQ. ID. NO. 1 or a course rough, a golf course tee box, a lawn, an athletic field, functional portion thereof. a park, a school yard, a roadside, a right of way, a trail, or 5. The glyphosate resistant plant according to claim 4. a Sod. wherein said nucleic acid sequence encodes a glyphosate 10. The seed of the glyphosate resistant plant according to resistant EPSPS protein. claim 1. 6. The glyphosate resistant plant according to claim 1, 11. A seed mixture comprising said seed according to wherein the plant is from the family Gramineae. claim 10. US 2007/0180574 A1 Aug. 2, 2007 29 12. A plant comprising SEQ. ID. NO. 2 or a functional 33. The glyphosate resistant grass of economic value portion thereof, wherein said SEQ. ID. NO. 2 is not native according to claim 30, wherein said grass is selected from to said plant. the group consisting of a glyphosate resistant ryegrass, a 13. The plant according to claim 12, wherein said SEQ. glyphosate resistant fescue, a glyphosate resistant forage ID. NO. 2 or a functional portion thereof is a glyphosate grass, a glyphosate resistant wheat, combinations thereof, resistant EPSPS protein. and hybrids thereof. 14. The plant according to claim 13, wherein said gly 34. The glyphosate resistant grass of economic value phosate resistant EPSPS protein is encoded by SEQ. ID. NO. according to claim 30, wherein said grass is a hybrid 1 or a functional portion thereof. comprising germplasm from a non-transgenic glyphosate 15. The plant according to claim 12, wherein the plant is resistant Lolium rigidum. from the family Gramineae. 35. A seed of a glyphosate resistant grass of economic 16. The plant according to claim 12, wherein the plant is value according to claim 30. not a transgenic. 36. A seed mixture comprising said seed according to 17. The plant according to claim 12, wherein the plant is claim 35. a perennial turfgrass. 37. A progeny of a non-transgenic glyphosate resistant 18. The seed of the plant according to claim 12. grass of economic value according to claim 30. 19. A seed mixture comprising said seed according to 38. A vegetative sprig or clone of a glyphosate resistant claim 18. grass of economic value according to claim 30. 20. A non-transgenic glyphosate resistant turfgrass com 39. The glyphosate resistant grass of economic value prising a nucleic acid molecule that encodes a glyphosate according to claim 30, wherein said turfgrass is in a golf resistant EPSPS enzyme. course fairway, a golf course rough, a golf course tee box, a 21. The non-transgenic glyphosate resistant turf grass lawn, an athletic field, a park, a school yard, a roadside, a according to claim 20, wherein said nucleic acid molecule right of way, a trail, or a Sod. comprises a sequence of SEQ. ID. NO. 1, or a functional 40. A glyphosate resistant gene obtained from the germ portion thereof. plasm deposited under American Type Cultural Collection 22. The non-transgenic glyphosate resistant turf grass as Penner Ryegrass deposited on Jan. 23, 2007. according to claim 20, wherein said glyphosate resistant 41. The gene according to claim 40 comprising SEQ. ID EPSPS enzyme comprises SEQ. ID. NO. 2, or a functional NO. 1 or a functional portion thereof. portion thereof. 42. The gene according to claim 40 encoding at least one 23. The non-transgenic glyphosate resistant turf grass of a glyphosate resistant EPSPS and a glyphosate resistant according to claim 20, wherein said turf grass is selected GRP. from the group consisting of a glyphosate resistant ryegrass, 43. The gene according to claim 40 encoding a glyphosate a glyphosate resistant fescue, combinations thereof, and resistant EPSPS comprising SEQ. ID. NO. 2 or a functional hybrids thereof. portion thereof. 24. The non-transgenic glyphosate resistant turf grass 44. The gene according to claim 40 encoding a glyphosate according to claim 20, wherein said turf grass is a hybrid resistant GRP identified by applying a herbicidally effective comprising germplasm from a non-transgenic glyphosate amount of glyphosate to the germplasm and then analyzing resistant Lolium rigidum. any Surviving germplasm for at least one biomarker. 25. A seed of a non-transgenic glyphosate resistant turf 45. A DNA construct comprising said at least one gene grass according to claim 20. according to claim 40. 26. A seed mixture comprising said seed according to 46. A method of transforming a plant, the method com claim 25. prising: 27. A progeny of a non-transgenic glyphosate resistant transforming a plant with the DNA construct according to turfgrass according to claim 20. claim 45. 28. A vegetative sprig or clone of a non-transgenic gly 47. The germplasm deposited under American Type Cul phosate resistant turfgrass according to claim 20. tural Collection as Penner Ryegrass deposited on Jan. 23. 29. The non-transgenic glyphosate resistant turf grass 2007. according to claim 20, wherein said turfgrass is in a golf 48. A glyphosate resistant EPSPS obtained from said course fairway, a golf course rough, a golf course tee box, a germplasm according to claim 47. lawn, an athletic field, a park, a school yard, a roadside, a 49. A gene encoding said glyphosate resistant EPSPS right of way, a trail, or a Sod. according to claim 48. 30. A glyphosate resistant grass of economic value com 50. A glyphosate resistant GRP protein obtained from said prising a nucleic acid molecule that encodes a glyphosate germplasm according to claim 47. resistant EPSPS enzyme, wherein said nucleic acid molecule comprises a sequence of SEQ. ID. NO. 1, or a functional 51. A gene encoding said glyphosate resistant GRP portion thereof. according to claim 50. 31. The glyphosate resistant grass of economic value 52. A method of obtaining a cultivated field that is according to claim 30, wherein the glyphosate resistant grass substantially free of a weed variety to which said field is of economic value is non-transgenic. Susceptible, the method comprising: 32. The glyphosate resistant grass of economic value providing a cultivated field comprising a glyphosate resis according to claim 30, wherein said glyphosate resistant tant grass of economic value, wherein said glyphosate EPSPS enzyme comprises SEQ. ID. NO. 2, or a functional resistant grass of economic value is not created by a portion thereof. genetic transformation; and US 2007/0180574 A1 Aug. 2, 2007 30 applying to said lawn a herbicidally effective amount of a 65. The method according to claim 52, wherein said mixture comprising glyphosate. glyphosate resistant grass of economic value is a perennial 53. The method according to claim 52, wherein said glyphosate resistant turfgrass. providing comprises planting seed capable of growing said 66. An isolated nucleic acid molecule comprising the base glyphosate resistant grass of economic value. sequence of SEQ. ID. NO. 1, or a functional portion thereof. 54. The method according to claim 52, wherein said 67. A DNA construct comprising a polynucleotide seg glyphosate resistant grass of economic value comprises ment that has a base sequence of SEQ. ID. NO. 1, or a germplasm from a non-transgenic glyphosate resistant functional portion thereof, and that encodes SEQ. ID. NO. 2, Lolium rigidium. said polynucleotide segment being operably attached to 55. The method according to claim 52, wherein said expression regulatory elements that can be used by a host glyphosate resistant grass of economic value comprises cell to express an EPSPS polypeptide encoded by said germplasm deposited under American Type Cultural Col polynucleotide segment. lection as Penner Ryegrass deposited on Jan. 23, 2007. 68. A recombinant DNA molecule comprising a structural 56. The method according to claim 52, wherein said DNA segment that encodes an EPSPS polypeptide compris glyphosate resistant grass of economic value is a turfgrass ing sequence of SEQ. ID. NO. 2, or a functional portion selected from the group consisting of ryegrass, fescue, thereof, operably linked to expression regulatory elements combinations thereof, and hybrids thereof. that can be used by a host cell to express said EPSPS 57. The method according to claim 52, wherein said polypeptide or peptide encoded by said structural DNA cultivated field is a lawn. Segment. 58. The method according to claim 57, wherein said lawn 69. The recombinant DNA molecule according to claim is selected from a group consisting of a golf course fairway, 68, wherein said expression regulatory elements are those a golf course rough, a golf course tee box, a lawn, an athletic that can be used by a plant cell to achieve expression of said field, a park, a School yard, a roadside, a right of way, a trail, structural DNA sequence. or a Sod. 70. The recombinant DNA molecule according to claim 59. The method according to claim 52, wherein said 68, wherein said expression regulatory elements include a glyphosate resistant grass of economic value is wheat. plant promoter that is heterologous to said structural DNA 60. The method according to claim 52, wherein said glyphosate resistant grass of economic value comprises a Sequence. nucleic acid molecule that is substantially similar to SEQ. 71. The recombinant DNA molecule of claim 68 further ID. NO. 1, or a functional portion thereof. comprising a DNA sequence that is operably linked to said 61. The method according to claim 52, wherein said structural DNA segment and that encodes an amino-terminal glyphosate resistant grass of economic value comprises a chloroplast transit peptide. protein substantially similar to SEQ. ID. NO. 2 or a func 72. A method of producing a glyphosate resistant plant, tional portion thereof. the method comprising: 62. The method according to claim 52, wherein said inserting into the genome of a plant cell a recombinant glyphosate resistant grass of economic value is naturally DNA molecule comprising: a promoter that functions bred. in plant cells, operably linked to a structural DNA 63. The method according to claim 52, wherein said weed sequence that encodes an EPSPS enzyme having the variety is selected from the group consisting of a dandelion, sequence of SEQ. ID. NO. 2, operably linked to a 3' goosegrass, ground ivy, clover, crabgrass, thistle, plantain, non-translated region that functions in plant cells to knotweed, quackgrass, nimble weed, tall fescue, creeping cause the addition of polyadenyl nucleotides to the 3' bent grass, Zoysiagrass, Bermudagrass, Dallisgrass, bind end of a RNA sequence; and weed, black medic, carpetweed, chickenweed, creeping beg garweed, cudweed, curly dock, English daisy, evening prim regenerating from the transformed plant cell a genetically rose, false dandelion, filaree, Florida pusley, henbit, transformed plant which has increased tolerance to lambsquarters, mallow, oxalis, pennywort, pigweed, prickly glyphosate herbicide as compared to an untransformed lettuce, purslane, ragweed, sheep Sorrel. Shepardspurse, plant. Sowthistle, speedwell, spotted spurge, tansy ragwort, wild 73. The method according to claim 73, wherein said carrot, wild geranium, wild morning-glory, wild onion, wild recombinant DNA molecule further comprises a DNA violet, foxtail, Johnsongrass, nutsedge, bahiagrass, barn sequence operably linked to said structural DNA sequence yardgrass, poa annua, Sandbur, and combinations thereof. encoding an amino-terminal chloroplast transit peptide. 64. The method according to claim 52, wherein said cultivated field is substantially free of weeds. k k k k k