Coupling Activators for the Oligonucleotide Synthesis Via Phosphoramidite Approach

Tetrahedron 69 (2013) 3615e3637

Contents lists available at SciVerse ScienceDirect

Tetrahedron

journal homepage: www.elsevier.com/locate/tet

Tetrahedron report number 1002 Coupling activators for the oligonucleotide synthesis via phosphoramidite approach

Xia Wei a,b,* a AM Biotechnologies, LLC., 12521 Gulf Freeway, Houston, TX 77034, USA b University of Houston-Clear Lake, 2700 Bay Area Boulevard, Houston, TX 77058, USA article info

Article history: Received 4 August 2012 Available online 7 March 2013

Contents

1. Introduction ...... 3616 1.1. Nucleoside phosphoramidites ...... 3616 1.2. Typical oligonucleotide synthesis via nucleoside phosphoramidite approach ...... 3617 2. Azole coupling activators ...... 3619 2.1. 1H-Tetrazole and its activation mechanism ...... 3619 2.2. Modified tetrazole coupling activators ...... 3620 2.2.1. 5-Nitrophenyl-1H-tetrazole (NPT) ...... 3620 2.2.2. 5-(Bis-3,5-trifluoromethylphenyl)-1H-tetrazole (Activator 42) ...... 3622 2.2.3. 5-Ethylthio-1H-tetrazole (ETT) ...... 3622 2.2.4. 5-Benzylthio-1H-tetrazole (BTT) ...... 3623 2.2.5. 5-Methylthio-1H-tetrazole (MTT) ...... 3624 2.2.6. 5-Mercapto-tetrazole (MCT) ...... 3624 2.2.7. Chiral tetrazoles for stereocontrolled synthesis ...... 3624 2.3. Other azole coupling activators ...... 3625 2.3.1. Imidazole activators ...... 3625 2.3.2. 1-Hydroxy-benzotriazole activators ...... 3626 2.3.3. 3-Nitrotriazole activators ...... 3626 3. Salt complex coupling activators ...... 3626 3.1. Pyridinium salt complexes ...... 3627 3.2. Azolium salt complexes ...... 3628 3.3. Saccharin salt complexes ...... 3630 3.4. Ammonium salt complexes ...... 3630 4. Other coupling activators for phosphoramidite approach ...... 3631 4.1. Carboxylic acid coupling activators ...... 3631 4.2. Lewis acid coupling activators ...... 3632 4.3. Trimethylchlorosilane (TMCS) ...... 3632 4.4. 2,4-Dinitrophenol (DNP) ...... 3632 5. Summary ...... 3633 Acknowledgements ...... 3634 6. Abbreviations ...... 3634 References and notes ...... 3635 Biographical sketch ...... 3637

* Tel.: þ1 806 252 8398; e-mail address: [email protected].

1. Introduction A:

DMTrO Chemical synthesis of oligonucleotides has paved the way for N B e DMTrO O fi 1 4 B the advancement of many elds in life sciences. The comple- O Cl OR1 mentary base paring property of oligonucleotides enables them to + P NR2 O be a fundamental tool for biological research. They are used as 2 1 OH R O P primers for polymerase chain reaction to amplify a particular DNA 2 NR 2 sequence and serve as probes for detecting RNA or DNA by hy- bridizing to their counterparts in a sequence specific manner. 1 2 3 Oligonucleotides are also of great interest in biomedical research B: and drug development. For antisense therapy, a single strand DNA, RNA, or a chemical analog can be designed to bind to a gene and RN N DMTrO OR3 B inhibit the expression of the corresponding protein that is known N O OR3 P to be causative of a particular disease.5 Small interfering RNA, N N P N N + a class of double strand RNA molecules, interferes with the Cl Cl R = H, TMS N N OH expression of a specific gene via the RNA interference pathway.6 4 5 1 Aptamers, also referred as chemical antibodies, are nucleic acid binding species for biomarker discovery and as diagnostic and DMTrO R4 therapeutic isolated by in vitro selection. They are able to bind to B O DMTrO TMS N B a wide range of targets with high affinity and have shown great O R4 potential reagents.7,8 O The increased interests require the preparation of oligonucleo- R3O P O tide in ever larger amounts. Previously, the oligonucleotide could be N R3O P N 4 synthesized through H-phosphonate, phosphodiester, phosphor- NR 2 e N triester, or phosphite triester method.9 12 After being discovered e 67 and modified in early 1980s,13 21 phosphoramidite method has become dominant in the oligonucleotide synthesis due to its high C: fi H Cl coupling ef ciency and rapid turnaround time. N DMTrO B DMTrO O B N 1.1. Nucleoside phosphoramidites O OMe Cl + P N N O fi MeO P Nucleoside phosphoramidites, the key building blocks, rst in- OH troduced by Beaucage and Caruthers in 1981,13 act as phosphity- N lating agents in this synthetic strategy. They are relatively stable under mild basic and neutral conditions, while are very sensitive in 18 9 the presence of even mild acids. Several pathways can be used to Scheme 1. Preparation pathways to phosphoramidites. prepare phosphoramidites (Scheme 1). In the method A, the protected nucleoside 1 reacts with phosphorochloridite 2 in the presence of base, most commonly diisopropylethylamine, pro- e ducing phosphoramidite 3.14 17,21 But the phosphorochloridite is suggested that both N-morpholino and N,N-diisopropylmethoxy hard to handle due to the poor stability, and the side formation of phosphoramidites can be reagents of choice for the oligonucleo- amine hydrochloride in the process causes isolation and purifica- tide synthesis (Fig. 1). tion problems, which precludes the pathway A as a reliable method The key feature of nucleotide phosphoramidites lies in the for automatic synthesis.19 To improve the synthesis, Fourrey and ability to rapidly react with nucleophilic groups in the mediation Varenne developed another approach outlined in method B. The in of mild acids, resulting in products with the replacement of an situ prepared bistriazolophosphine 5 reacts with protected nucle- amino moiety by an incoming nucleophile.10 In order to avoid side oside 1, yielding intermediate 6, which then transfers to phos- reactions, all other active functionalities in nucleosides, such as phoramidite 7 by treating with N,N-dialkyltrimethylsilylamine.17,19 the phosphite moiety, exocyclic amino groups on nucleobases, Almost at the same time, Beaucage discovered method C by means and hydroxyl groups at the 50-and20-positions, have to be of a phosphitylation between bispyrrolidinomethoxyphosphine 8 selectively protected by proper groups that can also be easily re- and nucleoside 1 under the activation of weak acid, such as 4,5- moved after the completion of the oligonucleotide synthesis. The dichloroimidazole.20 Compared with other two routes, method C most commonly used protecting groups are briefly introduced represents as a simpler and more economical approach to prepare herein. phosphoramidites. Methyl group and 2-cyanoethyl group are often employed to In an attempt to select proper phosphoramidite building blocks, protect the phosphite site of phosphoramidites. The deprotection various deoxynucleoside N,N-dialkylaminomethoxy phosphor- of methyl group by a treatment of either a mixture of thiophenol/ amidites were examined for their stabilities and reactivities in the triethylamine/dioxane or a mixture of tert-butylamine/methanol oligonucleotide synthesis.14 The 31P NMR analysis indicated that takes a long time to react. But 2-cyanoethyl group can be essentially pure N-morpholino and N,N-diisopropylmethoxy removed very easily using concentrated aqueous ammonia, phosphoramidites could be isolated, but N,N-dimethyl, N-pyroli- which is compatible with other deprotection conditions for dino, and 2,2,6,6-tetra-methyl-N-piperidino phosphoramidites oligomers and therefore can be performed in a single depro- were quite heterogeneous and subject to 5e20% hydrolysis tection step (Fig. 1).15,21,22 during the work-up procedure. Furthermore, both N-morpholino The most popular way to protect the 50-hydroxyl site of and N,N-diisopropylmethoxy phosphoramidites were very stable a phosphoramidite is tritylation, by which acid labile trityl ether 23 even after 40 days storage in a sealed tube of CD3CN. The derivatives can be formed. The stronger the electron-donating following reactivity examination by the activation of 1H-tetrazole property of a specific trityl ether linkage, the more sensitive the X. Wei / Tetrahedron 69 (2013) 3615e3637 3617

3 O O R O B O NH NH T: U: N O N O O OR2 P R1

NHR NHR' O

Me i-Pr N N N CR: AR': N GR'': NH R1 = N , N N O N N Me i-Pr N N NHR''

N O , N , N Exocyclic amino protecting groups:

O O O 2 Me , CH CH CN R = 2 2 Me

Bz Ac IBu R'

O O Tr: R' = R'' = R''' = H H MMTr: O R3 = C R'' R' = R'' = H; R''' = OMe O DMTr: Me R' = H; R'' = R''' = OMe N Me TMTr: R' = R'' = R''' = OMe Me

PAC MAC dmf R''' Fig. 2. Typical protecting groups for nucleobases. Fig. 1. Representative phosphoramidites. tert-butyldithiomethyl (DTM),32 2-cyanoethoxymethyl (CEM),33 pivaloyloxymethyl (PivOM),34 and bis(2-acetoxyethyloxy)methyl 35 trityl group is to the acidic cleavage conditions.10,24 The in- (ACE), have also been developed. The recent effort reported by corporation of electron-donating p-methoxy substituents can en- Dellinger and co-workers provides a remarkable strategy in the 0 hance the acid labilities of trityl derivatives, and the order of 2 -hydroxyl protection. The thionocarbamate (TC) group they sensitivity to acid is tri-p-methoxytrityl (TMTr)>di-p-methoxy- introduced can be cleaved under the same conditions used for the trityl (DMTr)>mono-p-methoxytrityl (MMTr)>trityl (Tr).10,24,25 typical nucleobase deprotection, which truly simplifies the RNA 36 The DMTr group is now widely used and the resulting orange- synthesis and elevates the synthetic efficiency (Fig. 3). colored carbocation acts as an important synthetic indicator, the absorbance or the conductivity measurement of which can be used DMTrO to monitor the coupling yield in the automatic oligonucleotide B O synthesis (Fig. 1). The exocyclic amino groups have to be prior protected to prevent from being tritylated during the 50-hydroxyl tritylation O O O P R NC step and from reacting with the activated phosphoramidites un- N der coupling conditions.22 Thymidine and uridine do not possess exocyclic amino groups and hence require no protection. But alkali-labile protections for exocyclic amino groups of adenine, cytosine, and guanine are essential. The acylation reaction using S acetyl (Ac), benzoyl (Bz), or iso-butyryl (IBu) groups are routine protecting method for nucleobases.22 Mild protecting groups, R = Si O Si N such as phenoxyacetyl (PAC),26 methoxyacetyl (MAC),26 dimethylformamidine (dmf),27 have also been introduced as they are S O O more readily to be moved and can therefore fulfill specific synthetic demands (Fig. 2). TBDMS TOM TC In RNA synthesis, the protection of the 20-hydroxyl group is Fig. 3. Representative protecting groups for 20-hydroxyl site. critical to avoid RNA degradation in basic media or in the presence of RNases.28 From the chemistry angle, the selected protecting groups should be stable enough under the synthetic conditions, for example, the acidic condition for the removal of DMTr group. 1.2. Typical oligonucleotide synthesis via nucleoside phos- The most extensively used protecting groups are fluoride-labile phoramidite approach ones, specifically, tert-butyldimethylsilyl (TBDMS)29 and tri-iso- propylsilyloxymethyl (TOM)30 groups, which can be cleaved The oligonucleotide synthesis using phosphoramidites can be upon the treatment with fluoride sources, such as tetra-n-buty- conducted either in a solution or on a solid phase. Now, most of the l-ammonium fluoride (TBAF) and triethylamine trihydrofluoride syntheses are reacting on a solid support such as controlled e e (TEA$3HF).31 Other 20-hydroxyl protecting methods, such as pore glass (CPG)37 39 or polystyrene40 42 for advantages of easy 3618 X. Wei / Tetrahedron 69 (2013) 3615e3637 operation and simple separation of end products.9 Through solid capped by undergoing acetylation using acetic anhydride and N- phase synthesis, an oligonucleotide sequence can be stepwise as- methylimidazole (NMI). sembled in the direction from 30-to50-terminus by following When synthesizing oligonucleotides with a phosphorothioate a routine procedure referred to a synthetic cycle. Completion of backbone, a sulfurization reaction is pursued instead of a capping a single synthetic cycle results in the addition of one nucleotide reaction in this step. Several reagents, including 3H-1,2-benzodithiol- residue to the growing chain. Each addition cycle consists of four 3-one 1,1-dioxide (Beaucage Reagent),48 3-((dimethylaminomethy- chemical reactions including deblocking, coupling, capping/sulfu- lidene)amino)-3H-1,2,4-dithiazole-3-thione (DDTT),49 and 3-ethoxy- e e rization, and/or oxidation/capping (Scheme 2).43 45 1,2,4-dithiazoline-5-one (EDITH),50 52 can be utilized to sulfurize the

DMTrO B O n-1 Next Synthetic Cycle RO DMTrO B O n 1. Deblocking

O O P CN X O HO Bn-1 B O O n-1 Synthetic RO Cycle RO

3. Capping 4. Oxidation (X = O) DMTrO B or O n 3. Sulfurization (X = S) 4. Capping O O DMTrO 2. Coupling P CN Bn O N

O O P CN

O B O n-1

Scheme 2. Typical oligonucleotide synthetic cycle via phosphoramidite method.

Step 1: deblocking. The DMTr protecting group at the 50-termi- unstable phosphite triester linkage. The sulfurization is performed nus must be removed to release a free 50-hydroxyl group on the prior to the capping step in the phosphorothioate preparation be- oligonucleotide precursor. This can be achieved by adding a acid cause the residue of the capping agents interferes with the sulfur 44 solution, such as 2% trichloroacetic acid (TCA) (pKa¼0.70) or 3% transfer reaction, resulting in the extensive formation of phosphate 44 dichloroacetic acid (DCA) (pKa¼1.48) solution in dichloro- triester linkage instead of the desired phosphorothioate triester methane. The use of stronger acids or an extended reaction time in linkage.49 the deblocking step may lead to depurination and thus reduce final yields.46,47 Step 4: oxidation (or capping if step 3 is sulfurization). The phosphite triester (P(III)) linkage formed in the coupling step is Step 2: coupling. Following the detritylation, the resulting unstable and has to be transferred to a phosphate triester (P(V)) nucleoside is ready to react with the incoming nucleoside linkage by treating the growing oligonucleotide chain with oxida- phosphoramidite monomer. By adding a coupling activator tion agents, typically, iodine in presence of pyridine.53 This oxida- such as 1H-tetrazole, the amino group of the nucleoside phos- tion step switches to the capping reaction if synthesizing phoramidite is protonated and then rapidly replaced by the a phosphorothioate triester linkage. 50-hydroxyl group of the existing precursor, creating an unstable By repeating the synthetic cycle the chain grows to the desired phosphite triester linkage. The presence of water should be dis- oligonucleotide, which can be released from the solid support and tinctly avoided during this process to prevent an unwanted re- deprotected with the help of concentrated ammonium hydroxide. action between water and the activated phosphoramidite from Other fast cleavages using ammonia/methylamine (AMA),54 and 55 occurring. ammonia-free conditions using ethylenediamine (EDA) or K2CO3 (0.05 M)/MeOH54,56 can also be employed according to different Step 3: capping (or sulfurization). In spite of many efficiency synthetic demands. Typically, the pure oligonucleotide is collected measures, a small percentage of the unreacted 50-hydroxyl sites via anion-exchange HPLC followed by desalting or polyacrylamide remain active after the completion of the coupling step. In order to gel electrophoresis (PAGE). prevent it from reacting with the later phosphoramidites to result In the whole synthetic process, the coupling step is critical and in (n1)-shortmers, the unbound active 50-hydroxyl groups are the successful synthesis depends on the coupling reaction being X. Wei / Tetrahedron 69 (2013) 3615e3637 3619 fast and near quantitative, without serious side reactions. This re- DMTrO B quires phosphoramidites being highly activated by an efficient O coupling activator. To this end, a large number of coupling activa- DMTrO tors have been developed and studied. 1H-Tetrazole is the first re- O B O ported coupling activator. It was used to successfully activate P CH3 H3CO N deoxynucleoside phosphoramidites in early 1980s.13 Later on, CH3 O many efforts were made to modify 1H-tetrazole by incorporating N N P OCH versatile electron-withdrawing groups at the 5-C position to gen- 10 HN 3 N O fi T erate more acidic activators. These modi ed tetrazoles, such as 5- O (4-nitrophenyl)-1H-tetrazole (4-NPT), 5-(bis-3,5-trifluoromethyl- + O phenyl)-1H-tetrazole (Activator-42), 5-methylthio-1H-tetrazole HO T O (MTT), 5-(ethylthio)-1H-tetrazole (ETT), and 5-benzylthio-1H-tet- O CH3 O razole (BTT), sometimes serve better as coupling activators in the O fi oligoribonucleotide synthesis, which is more dif cult due to the O 12 0 steric hindrance caused by neighboring 2 -O-protection groups, CH3 and in the large scale or specific oligonucleotide synthesis, pro- O B = T, CBz, ABz, GiBu viding higher coupling yields, shorter reaction time, and/or less 11 reagent consuming. In late 1990s other types of coupling activators Scheme 3. The coupling of deoxynucleoside phosphoramidites 10 using 1H-tetrazole appeared. Different from 1H-tetrazole and its derivatives, 4,5- activator. dicyanoimidazole (DCI) represents as a less acidic but more nu- 62 cleophilic coupling activator.57 Salt complexes, easily gained from either a 2 or 20 mmol scale using 1H-tetrazole activator. The cou- the various combination of bases with proper acidic species, are pling time for the pseudonucleoside phosphoramidites was extended a innovative activator catalog that gives chances to accomplish to 5 min using 5e10 equiv of monomer (0.1 M in acetonitrile). In the some special synthetic tasks that sometimes are very hard to be oxidation step, the use of iodine reagent led to strand cleavage at the achieved using azole type activators. For example pyridinium hy- North pseudosugar sites and hence caused very low yields, which was drochloride (Py$HCl) is particularly effective to activate sterically not observed in the South pseudosugars, and this issue was overcome hindered phosphoramidites such as LNA;58 benzimidazolium tri- by employing tert-butylhydroperoxide as an oxidant in place of io- flate (BIT) can be an efficient activator for normally weakly reactive dine. Several modified oligonucleotides were successfully synthe- 0 0 phosphoramidites with electron-withdrawing substituents;59,60 sized, for instance, 5 -CGCGYATTCGCG-3 was obtained in 20.4% and imidazolium triflate (IMT) can promote the coupling of phos- (Y¼North mechanocarba dA) and 19.3% (Y¼South mechanocarba dA) phoramidites without base protection.61 Furthermore, concomi- isolated yields after HPLC and desalting, and isolated yields of se- 0 0 tantly, new technologies were developed in recent years using quences 5 -CTACGCYYYCCACGCACAG-3 (Y¼North mechanocarba T) 0 0 solid-bonded salt complex activators, which can lead to more and 5 -ATTGCGCATTCYGGATCCGCGATC-3 (Y¼South mechanocarba 62 economical and more environmental friendly synthesis. In addi- abasic) were 30.7% and 18.9%, respectively (Fig. 4). tion, other kinds of activators, such as carboxylic acids, Lewis acids, trimethylchlorosilane (TMCS), and 2,4-dinitrophenol (DNP), have H H also been reported. In this paper, the commonly used activators, DMTrO DMTrO B B such as 1H-tetrazole, ETT, BTT, Activator-42, DCI, and imidazolium/ benzoimidazolium and pyridinium salt complex activators, etc. will be reviewed and discussed. Besides, the alternative activators, such O O as 1-hydroxy-benzotriazole, carboxylic acids, Lewis acids, TMCS, P P CN(CH2)2O N(i-Pr)2 CN(CH2)2O N(i-Pr)2 DNP, chiral activators, etc., although have not yet been detailed reported, will also be introduced as to include the diverse contri- 13 14 bution in this field. B = H, T, ABz 2. Azole coupling activators Fig. 4. Chemical structures of North (13) and South (14) methanocarba pseudonucleoside phosphoramidites. 2.1. 1H-Tetrazole and its activation mechanism

1H-Tetrazole was ﬁrstly employed in the oligodeoxyribo- 1H-Tetrazole was utilized by Gryaznov’s group to activate mo- nucleotide synthesis using phosphoramidites by Beaucage and nomeric units, 20-O-TBDMS-30-monomethoxyltritylamino nucleo- Caruthers in 1981.13 The 31P NMR analysis indicated an immediate side-50-O-(cyanoethyl-N,N-diisopropylamino)-phosphoramidites coupling reaction occurring between phosphoramidites 10 15, to build up RNA analogs containing oligoribonucleotide (0.5 mmol) and 30-O-levulinyl-thymidine 11 (0.6 mmol) under the N30/P50 phosphoramidite internucleotide linkage 16, which 0 0 63,64 activation of 1H-tetrazole (1.5 mmol in 2.5 mL dry CD3CN), resulting replaced the natural RNA O3 /P5 phosphodiester groups. in phosphite triesters 12 in 93e100% yields after the following Several mixed base 9e13-mer oligoribonucleotides were synthe- oxidation and deprotection procedures (Scheme 3).13 1H-Tetrazole sized through this pathway using 0.45 M 1H-tetrazole as an acti- has up to 0.5 M solubility in acetonitrile. However, a 0.45 M 1H- vator for 10 min, and the coupling reaction offered 96e98% tetrazole solution in acetonitrile is generally used in coupling re- stepwise coupling yields (Fig. 5).63 actions so as to avoid precipitation in transit. 1H-Tetrazole is by far In another example, a series of functionalized carbocyclic locked one of the most widely used phosphoramidite coupling activators nucleic acid (LNA) analogs were assembled in good overall yields on and can be applied to synthesis different kinds of oligonucleotides. 0.2 mmol scale solid supports by using 20e40 bridged phosphor- Marquez and co-workers investigated the synthesis of oligo- amidites 17e20 as well as commercially available 20-deoxynucleo- deoxyribonucleotides containing carbocyclic pseudosugars derived side-30-O-phosphoramidites.65 The synthesis was in accordance from adenosine, thymidine, and abasic versions of North and South- with the regular protocol using 1H-tetrazole as an activator, but methanocarba pseudonucleoside phosphoramidites 13 and 14 in a prolonged coupling time of 30 minwas used to ensure the coupling 3620 X. Wei / Tetrahedron 69 (2013) 3615e3637

to generate 21, a slow displacement of the amino group from the O B O protonated amidite by a nucleophilic activator to generate the key NC tetrazolide intermediate 23 (rate determining step), and the fol- O lowing rapid reaction with an alcohol to produce phosphite triesters. P O HN OH i B -Pr N O P O i-Pr O B O O H NH OTBDMS Nuc O P NR2 MMTr N ' NH OH HN N R O N 15 16 Nuc O 21 P NR2 R'O B = ABz, CBz, GiBu, T, U, 2,6-DAP Fast H Nuc O P NR2 0 0 Fig. 5. Chemical structures of N3 /P5 phosphoramidite monomers 15 and the oli- R'O gonucleotide N30/P50 phosphoramidite internucleotide linkage 16. 22 efﬁciency. It has to be mentioned that for more sterically crowded phosphoramidites 19 and 20, pyridinium hydrochloride (Py$HCl) Slow R''OH N was employed in place of 1H-tetrazole. Coupling yields for all Nuc O N Nuc O b-cyanoethyl phosphoramidites were >98% (Fig. 6).65 P N P OR'' R'O N Fast R'O

23 DMTrO DMTrO U U Scheme 4. The mechanism of the coupling reaction activated by 1H-tetrazole. O O As a widely used activator, 1H-tetrazole is suitable for both DNA O O and RNA syntheses. However, it is not efﬁcient enough in some

P P cases such as the synthesis of very sterically hindered oligonucle- CN(CH ) O i CN(CH ) O i 2 2 N( -Pr)2 2 2 N( -Pr)2 otides. In addition, 1H-tetrazole is toxic and explosive, which is a driving force from another aspect for the discovery of new potent 17 18 coupling activators.

DMTrO DMTrO ﬁ U U 2.2. Modi ed tetrazole coupling activators O O

BzO AcO By introducing electron-withdrawing functionalities at the 5-C O O position,71,72 a series of more acidic modiﬁed tetrazoles were de- OAc P P veloped to for the oligonucleotide synthesis via phosphoramidite CN(CH ) O i CN(CH ) O i 2 2 N( -Pr)2 2 2 N( -Pr)2 approach. 19 20 2.2.1. 5-Nitrophenyl-1H-tetrazole (NPT). In 1983, Froehler and 0e 0 e Fig. 6. Chemical structures of 2 4 bridged phosphoramidites 17 20. Matteucci demonstrated their work of using substituted 5-phenyl- 1H-tetrazoles as more acidic activators to prompt the phosphity- The mechanism of the condensation activated by 1H-tetrazole lation of deoxynucleoside N-morpholino-phosphoramidite 24 was investigated through well-designed experiments. Kinetic study (Scheme 5).73 They observed that the order of the reactivity is of a series of 1H-tetrazole activated reactions initially conducted by HO Dahl and co-workers indicated that the coupling rate depends very T much on when 1H-tetrazole is added to the reaction mixtures. Re- O R actions by premixing phosphoramidites with 1H-tetrazole before 1) N NH DMTrO O T adding the corresponding nucleoside possess very high initial rates, NN O whereas reactions by adding 1H-tetrazole to the mixture of phosphoramidites with the nucleoside have a more gradual formation of 2) oxidation O OCH3 products.66 Thus, a reactive tetrazolide intermediate was proposed. P + O 31 The P NMR study proved its formation and also suggested that an 25 R = H O T equilibrium is established in the tetrazolide forming step.66,67 O DMTrO Moreover, in order to verify whether the formation of tetrazolide T O 26 R = NO2 is just a nucleophilic substitution or whether the acidic strength of O ¼ 1H-tetrazole (pKa 4.8) plays a role in the process, less acidic azoles NO2 O OCH3 were utilized as alternative reactants, and the 31P NMR in- P vestigations of which showed that 1H-tetrazole is also active as N 27 R = 67 a proton donor. Moreover, the molecular modeling of H2PeNH2 indicated that the PeN bond is lengthened and weakened with ni- O Br 24 trogen protonation (21), but gets shortened and strengthened with 28 R = phosphorous protonation (22).69,70 From above evidences, 1H-tetrazole was believed to play a dual role in the phosphitylation process, a proton donor and a subsequent nucleophile. As shown in 29 R = CO2Et Scheme 4, the widely accepted mechanism consists of three steps: a fast protonation of the trivalent phosphorus by acidic 1H-tetrazole Scheme 5. Coupling reactions using 5-phenyl-1H-tetrazole activators. X. Wei / Tetrahedron 69 (2013) 3615e3637 3621

26>27>28>29>25. The further kinetic study demonstrated subjected to the oxidation condition using TMSOOTMS/TMSOTf. that the more acidic 5-(4-nitrophenyl)-1H-tetrazole (4-NPT) The isolated yields of 33 were 95e99% (Scheme 8). Comparatively, 68,74 (pKa¼3.7) is, compared with 1H-tetrazole (pKa¼4.8), a superior only little of the coupling products were observed to be obtained by activator with enhanced rate of activation.73 the use of other activators including 1H-tetrazole, 5-(ethylthio)-1H- 5-(4-Nitrophenyl)-1H-tetrazole (4-NPT) represents as an effi- tetrazole (ETT), pyridinium chloride (Py$HCl), benzimidazolium cient activator in the synthesis of 20-O-methyl oligoribonucleotide. triflate (BIT), and N-methylanilinium trifluoroacetate in catalytic The coupling reaction on a 0.5 mmol solid support completed in amounts. The method using a catalytic amount of 4-NPT could be 6 min using 0.1 M 4-NPT, achieving >99% coupling yields. Com- applied in the synthesis of oligodeoxyribonucleotides such as 50- paratively, the coupling employing 0.5 M 1H-tetrazole for 5 min CTACCTG T-30 in 95% coupling yield, and 20e50 or 30e50 linked dimer was not effective.75 Moreover, it was found that the addition of ribonucleotides in 96% and 95% isolated yields, respectively.77 a catalytic amount of 4-dimethylamino pyridine (DMAP) can ex- tremely improve the coupling efficiency of 4-NPT. The use of an DMTrO B acetonitrile mixture of 0.12 M 4-NPT and 0.01 M DMAP to activate O 20-O-TBDMS-phosphoramidite achieved 96.5% coupling yield in 15 min, which was better than utilizing only 0.12 M 4-NPT (92.1%) DMTrO O B O or 0.5 M 1H-tetrazole with 0.1 M DMAP (93.5%) under the same P Et conditions (Scheme 6).76 AllO N Et O DMTrO 31 O P OAll U 1) 4-NPT O O + T 2) oxidation O HO T O O OTBDMS O P OAOC DMTrO H CO O 3 U U O O OAOC 33

4-NPT 32 O OTBDMS O O OTBDMS AOC AOC All, AOC H3CO P P B = T, C , A , G H3CO O U N(i-Pr)2 O O 30 AOC = O O OTBDMS

All =

0 Scheme 6. RNA synthesis using 2 -O-TBDMS-phosphoramidite 30 and 4-NPT activator. Scheme 8. The synthesis of dinucleoside phosphates 33 using 4-NPT in a catalytic amount. Generally, the acidic tetrazole is used in excess to ensure high coupling efﬁciency. But Hayakawa and co-workers demonstrated Rao and Reese employed 5-(3-nitrophenyl)-1H-tetrazole (3-NPT) 0 that a catalytic amount of 4-NPT is still efﬁcient to prompt a cou- to accelerate the condensation between 2 -O-Fpmp-phosphor- 78 pling reaction in the presence of molecular sieves 13 (10 A pore amidites 34 and nucleosides 35 on a CPG solid support (Scheme 9). size; ca. 2 mm particle size), which acts as an amine scavenger It took 6 min for the coupling reaction using 0.1 M 3-NPT to (Scheme 7), and this method is particularly useful for a large-scale get completion. The application of this protocol in the syntheses 0 0 0 0 synthesis of short oligonucleotides in a solution phase.77 For ex- of 3 -terminal decamer 5 -r(UCGUCCACCA)-3 , nonadecamer 5 - 0 0 ample, dinucleoside phosphates 33 were prepared in a multigram r(AUUCCGGACUCGUCCACCA)-3 , and heptatriacontamer 5 -r(GGA- 0 scale from the condensation between 1.05 equiv of 30-O-(allyl-N,N- GAGGUCUCCGGUUCGAUUCCGGACUCGUCCACCA)-3 sequences re- diethyl)-phosphoramidites 31 and 1 equiv of nucleosides 32 under ceived 97%, 98%, and 98% average coupling yields, respectively. the activation of 0.05 equiv of 4-NPT in the presence of molecular sieves 13 in acetonitrile solution. The coupling reaction was PxO maintained at 40 C for 60 min before the reaction mixture was B O

OR1 N OR1 HN N PxO P P O O(Fpmp) B 1 1 2 O Nuc O NR2 N Nuc O ONuc CN(CH2)2O P R2 N(i-Pr)2

34 O O O(Fpmp) 1) 3-NPT P NC(CH ) O O 2 2 B + O 1 2) oxidation OR 2 R2NH Nuc OH P N PxO O O(Fpmp) Nuc1O B N N O N R2 R NH SV O O(Fpmp) 2 SV B = U, CBz, APiv, GPA

O 35 Px =

2 SV = amine scavenger, NucOH = protected nucleoside, R = NO2 Ph

Scheme 7. The catalytic process using 4-NPT activator. Scheme 9. The coupling of 20-O-Fpmp-phosphoramidites using 3-NPT as an activator. 3622 X. Wei / Tetrahedron 69 (2013) 3615e3637

2.2.2. 5-(Bis-3,5-trifluoromethylphenyl)-1H-tetrazole (Activator 42). DMTrO B Derived from aryl-substituted 5-phenyl-1H-tetrazoles, a non- O explosive and low hygroscopic compound, 5-(bis-3,5-trifluoro- O methylphenyl)-1H-tetrazole (Activator-42), was developed by O OMe DMTrO B O SigmaeAldrich by introducing trifluoroalkyl functionalities on the DMCEO P N(i-Pr) phenyl group. The higher solubility in acetonitrile (0.94 M)79 and 2 O the more acidic character (pKa¼3.4) make Activator-42 a better 38 O OMe 1) Activation-42 phosphitylating agent than 1H-tetrazole. Practices indicated that DMCEO P X + the usage of 0.1 M Activator-42 preferably achieved 99% coupling 2) oxidation O or T sulfurization O yields for regular DNA synthesis in less than 15 s, and preferably HO gave 98% coupling yields for regular RNA synthesis in 6 min.79 In O B addition, Activator-42 is very efficient to promote the synthesis of X = O, S O OMe longer DNA sequences and the coupling of very sterically hindered O OMe R 0 2 -O-TBDMS-phosphoramidites. For example, 103-mer hetero- R B = U, CAc, ABz, GIBu sequence DNA oligonucleotides could be obtained in 65.4% purity as measured by anion exchange HPLC. For the coupling reaction 39 0 0 DMCE = between 2 -O-TBDMS-rA(t-Bu-PAC)-phosphoramidite 36 and 3 -O- CN TBDMS-thymidine 37, the use of 0.9 M Activator-42 afforded the 0 reaction to accomplish in 5 min, while the reaction using 0.9 M ETT Scheme 11. The coupling of 2 -O-methyl-phosphinoamidites 38 using Activator-42 as an activator. required 17 min to get completion under the identical conditions (Scheme 10).79 DMTrO U O DMTrO At-Bu-PAC O HO T O O N + NC(CH2)2O P R Me O OTBDMS N(i-Pr)2 CN(CH2)2O P OTBDMS N(i-Pr)2

40: R = CH2PY

36 37 41: R = COPY PY =

42: R = COCH2PY

CF 3 DMTrO At-Bu-PAC O 0 N Fig. 7. Chemical structures of 2 -N-pyrenyl-phosphoramidites 40e42. N CF N NH 3 O OTBDMS phosphodiester and phosphorothioate oligodeoxyribonucleotides CN(CH2)2O P O T on a TentaGel support, giving about 1e2% higher average yield per O cycle (Scheme 12).41 A600mmol scale synthesis of oligonucleotide 50-GCGTCACAGTCTGATTTCGAC-30 using ETT as a activator was ob- OTBDMS tained in 2.188 g and the average coupling yield was 97.2%.41 Phosphorothioamidites are now commercially available from AM O Biotechnologies, LLC. t-Bu-PAC = O

Scheme 10. The coupling of 20-O-TBDMS-phosphoramidites using Activator-42 as an DMTrO activator. B O

DMTrO Activator-42 is also effective to motivate some special phos- O B O phoramidites. For instance, oligoribonucleotides with phospho- NC(CH2)2O P SEt i noacetate (PACE; X¼O) or thiophosphonoacetate (thioPACE; X¼S) N( -Pr)2 ﬁ 0 N NH X O modi cation were prepared by incorporating 2 -O-methyl-phos- P 1) NN NC(CH2)2O O phinoamidites 38 (Scheme 11). Activator-42 stood out in the group + B O of four activators, ETT, DCI, Activator-42, and 1H-tetrazole, gave 2) oxidation highest coupling yields and fewest side products as accessed by or sulfurization HO O HPLC, and the optimal coupling condition was using 0.25 M B O Activator-42 for 16 min.80 In the synthesis of modiﬁed oligodeoxyribonucleotides using phosphoramidites with pyrene moiety at 20- X = O, S B = ABz, GiBu, CBz, T N-sites, the activation of 20-N-pyrenyl-phosphoramidite monomers O 40e42 utilizing 0.01 M Activatior-42 resulted in 95%, 89%, and 99% coupling yields, respectively, in 15 min on 0.02 mmol scale solid Scheme 12. The syntheses of phosphorodiester and phosphorothioate oligodeoxyr- 81 supports (Fig. 7). ibonucleotides using ETT activator.

2.2.3. 5-Ethylthio-1H-tetrazole (ETT). In 1993, Wright and co- Wincott and co-workers demonstrated that ETT was a great ac- workers discovered that a 0.6 M acetonitrile solution of 5- tivator for RNA synthesis.82 When using 0.25 M ETT as an activator, ethylthio-1H-tetrazole (ETT) (pKa¼4.3) was more efﬁcient than the syntheses of oligoribonucleotides in a 2.5 mmol scale called for a 0.5 M solution of 1H-tetrazole in the automatic syntheses of a 5 min coupling for 20-O-TBDMS-phosphoramidites and a 2.5 min X. Wei / Tetrahedron 69 (2013) 3615e3637 3623

0 coupling for 2 -O-methylated-phosphoramidites, and the average DMTrO B coupling yields were 97.5e99%. When preparing oligoribonucleo- O tide in a 25 mmol scale, a 0.5 M ETT solution was employed and the 0 coupling time was prolonged to 10e15 min for 2 -O-TBDMS-phos- O OTBDMS DMTrO 0 NC(CH ) O P B phoramidites and 5e15 min for 2 -O-methylated-phosphor- 2 2 O N(i-Pr) amidites, achieving 97.5e99% average coupling yields82 (Fig. 8). 2 48 SCH2Ph O OTBDMS DMTrO NC(CH2)2O P T O B O O MMTrO N NH B + O NN O N P i O OTBDMS P ( -Pr)2N OCEt HO (i-Pr) N O(CH ) CN B 2 2 2 B = T, ABz O

43 44 O OTBDMS

Fig. 8. Chemical structures of morpholino phosphoramidite 43 and oxepane chimeric phosphoramidites 44. B = APAC, Gi-Pr-PAC, CAc, U 5-Ethylthio-1H-tetrazole (ETT) could also be utilized in the synthesis of oligomers with different modified sugar ring skeletons. It took 5 min for the coupling reaction of morphomino phosphor- i-Pr-PAC = amidite 43 using ETT activator to give satisfactory yields.83 Oxepane O O nucleic acids (ONAs), such as the homopolymeric oT15 and oA15 strands, could be assembled from oxepane chimeric phosphor- Scheme 13. The coupling of 20-O-TBDMS-phosphoramidite using BTT as an activator. amidites 44 on a CPG solid support. A 0.5 mmol scale synthesis using 0.25 M ETT and 0.05 M 44 led to 98e99% coupling yields in an ex- 0 and/or 2 -O-(R)-Npeom protected phosphoramidites 49 and 50 gave tended coupling time of 30 min.84 The application of 0.25 M ETT in 99% average coupling yield by using 0.25 M BTT and 0.1 M phos- the synthesis of tricycle DNA oligonucleotides 45 on a 1.3 mmol scale phoramidites in 2.5 min,88 and a 15 mmol scale synthesis using 0.35 M CPG support gave >95% stepwise coupling efficiency in 10 min85 In BTT received >99% coupling yields in 7 min.89 In the synthesis of addition, Leumann and Haziri synthesized a series of oligonucleo- a 20-mer RNA oligomer on a 0.2 mmol scale solid phase, 99% coupling tide dodecamers containing the bicycle-RNA (46) or bicycle-ANA 0 yield could be achieved through the activation of 0.2 M 2 -O-(4-(N- (47) linkage using ETT as an activator. In the step of introducing methylamino)benzyloxy)methyl-phosphoramidites 51 by 0.25 M the modified building blocks, lower coupling efficiencies of w90% BTT in 3 min.90 Short oligo-U sequences were synthesized in 1 mmol were achieved using an extended coupling time of 12 min and an 86 scales using a 0.1 M acetonitrile solution of phosphoramidites 52 increased phosphoramidite concentration of 0.2 M (Fig. 9). 0 0 containing biolabile 2 -O-acyloxymethyl or 2 -O-acythiomethyl groups, and the coupling yields were >93% when using 0.3 M BTT activator and an extended coupling time of 18 min.91 A long RNA P O P O P O O O O oligonucleotide, 110-mer, could be chemically prepared by means of O H O H O H automatic synthesis using 0.075 M 20-O-CEM-phosphoramidites 53 O O O B B B and 0.25 M BTT activator. The coupling time was 2.5 min and the overall isolated yield of the highly pure 110-mer was 5.5%92 (Fig. 10). O O OH O OH The BTT activator was also applied by Huang et al. in the synthesis of DNA by incorporating a synthetic 6-Se-deoxygaunosine phosphoramidite 54 to investigate nucleic acid base pairing and Tricyclo-DNA Bicyclo-RNA Bicyclo-ANA stacking activities (Scheme 14). The 6-Se-G derivative oligonucleotides were prepared by using 0.325 M. 45 46 47 BTT activator and 0.1 M phosphoramidites. In order to measure 0 Fig. 9. Chemical structures of tricyclo-DNA 45, bicycle-RNA46, and bicycle-ANA 47. the coupling efficiency of the 6-Se-G phosphoramidite 54,a5-O- DMTr-SeGG dinucleotide was prepared under the above conditions 2.2.4. 5-Benzylthio-1H-tetrazole (BTT). 5-Benzylthio-1H-tetrazole and received >97% coupling yield.93 (BTT) (also known as 5-benzyl mercapto-1H-tetrazole; BMT) was One method to improve the efficiency of activation is to provide discovered as an efficient activator in the synthesis of oligor- an activator solution with a higher concentration. It was discovered ibonucleotides. The application of 0.25 M BTT in the activation of 20- that the solubility of BTT in acetonitrile can be increased with the O-TBDMS-phosphoramidites 48 achieved >99% average coupling addition of N-methylimidazole (NMI), which allows BTT to stay in yields in 3 min for the syntheses of RNA 25, 29, and 42-mers (Scheme a solution even at very low temperature. For example, the addition 12).87 The comparison of BTT to other activators in the activation of of 0.5% of NMI into a 0.35 M acetonitrile solution of BTT can make it 20-O-TBDMS-phosphoramidites shows that the order of coupling stay at 1 C without precipitation after 16 h.94 More importantly, efficiency is BTT>ETT>DCI>1H-tetrazole. The high activation po- the addition of NMI (<10%) has no interference with the oligonu- tential of BTT possibly results from its higher acidity (pKa¼4.08), cleotide synthesis. For example, in a 0.2 mmol scale synthesis of RNA which makes it more readily to protonate the trivalent phosphorus sequence 50-r(GCCCAUAUCGUUUCAUAGCUU)-30 from 0.1 M 20-O- in the first step of activation and therefore to accelerate the coupling TBDMS-30-O-phosphoramidites, by adding 0.5% of NMI into a 0.3 M reaction. Additionally, the introduction of the aromatic substituent BTT solution, the yield of the 2 min coupling could be improved decreases the hydrophilicity of BTT, which helps to preclude side from 96.3% to 97.2%, and the further test with the extended reactions caused by the hydrolysis of the activator87 (Scheme 13). coupling time of 5 min could elevate the coupling yield to 98.1% BTT can be utilized to activate other types of RNA phosphor- (Table 1).94 In addition, although both 0.3 M BTT and the 0.3 M BTT amidites. A 1.5 mmol scale automatic synthesis of RNA from 20-O-TOM in combination with 0.5% NMI could promote the synthesis of DNA 3624 X. Wei / Tetrahedron 69 (2013) 3615e3637

DMTrO Table 1 DMTrO B Syntheses of RNA sequences using BTT and BTTþNMI B O O Entry Activator Coupling Avg. full length Avg. coupling O O time (min) product (%) yield (%) O O R O P 1 0.3 M BTT 2 47.35 96.3 O P NC O NC N(i-Pr)2 2 0.3 M BTTþ0.5% NMI 2 56.86 97.2 i O N( -Pr)2 Si 3 0.3 M BTTþ0.5% NMI 5 68.79 98.1 O2N

2.2.5. 5-Methylthio-1H-tetrazole (MTT). The higher acidity (pKa¼4.15) and the good solubility in acetonitrile (>2M)of5- B = CAc, AAc, GAc, U B = CAc, AAc, GAc, U methylthio-1H-tetrazole (MTT) make it suitable for a large scale synthesis of oligonucleotides on high loading supports.95 The ap- 49 50 plication of MTT in a 1 mmol scale synthesis of oligodeoxyribonucleotide 50-TCACAGTCTGATCTCGAC-30 achieved 96.6% average coupling yield on TentaGel support.95 According to Ber- DMTrO B O Cl ressem and Engels, the incorporation of 6-oxocytidine phosphor- N amidites 55 into the 15-mer oligonucleotides was achieved using Cl 0.3 M MTT activator, and the coupling efﬁciency was 93% in a cou- O O O O 96 O P pling time of 15 min. In addition, in Pitsch study of the synthesis NC 0 0 i of RNA using 2 -O-TOM-3 -O-phosphoramidites, MTT was found as N( -Pr)2 efﬁcient as ETT as a coupling activator to give 99% coupling yields30 (Fig. 11). B = CBz, ABz, Gi-Bu, U

51 N CH NMe2 R NH

DMTrO DMTrO DMTrO O N O U B O O O

O O X R O O O O OCH3 O P O P CN NC(CH2)2O P Si NC O N(i-Pr)2 N(i-Pr)2 N(i-Pr)2

R = H, Me X = O or S Ac Ac PAC R = Me or t-Bu B = C , A , G , U 55 52 53 Fig. 11. The chemical structure of 6-oxocytidine phosphoramidites 55. Fig. 10. Chemical structures of ribonucleoside phosphoramidites 49e53 that can be activated by BTT activator. 2.2.6. 5-Mercapto-tetrazole (MCT). 1-Methyl-5-mercapto-tetrazole 56 (pKa¼3.86) and 1-phenyl-5-mercapto-tetrazole 57 (pKa¼3.65) were studied by Eﬁmov et al. as coupling activators due to their DMTrO N HO 97 B greater acidity than 1H-tetrazole (Fig. 12). In the syntheses of O N Se O e m CN oligodeoxyribonucleotides in 0.2 1 mol scales, both 1-methyl-5- mercapto-tetrazole (0.5 M) and 1-phenyl-5-mercapto-tetrazole N N O + O (0.5 M) could promote the condensation in >98% coupling yields, NC(CH2)2O P NHR which were equal efﬁcient to the use of 0.5 M 1H-tetrazole under N(i-Pr) 2 the same conditions. But in a 10 mmol scale synthesis, the coupling yields were 2e3% higher with 1-methyl-5-mercapto-tetrazole and 54 1-phenyl-5-mercapto-tetrazole than with 1H-tetrazole. Moreover, the RNA oligonucleotide synthesis using MCT provided 96% coupling yields in 5 min, while 1H-tetrazole gave less than 90% coupling yields under the same conditions97. O Oligonucleotide-5' P O O N BTT N N N NH O N Se N N SH S N NH N N O R R O P O NH2 56 R = Me Oligonucleotide-3' 57 R = Ph

Scheme 14. The coupling reaction activated by BTT in 6-Se-G DNA synthesis. Fig. 12. The chemical structure of 1-methyl-5-mercapto-tetrazole 56 and 1-phenyl-5- mercapto-tetrazole 57. sequence 50-GGCTAAATCGCTCCACCAAG-30 in >99% average coupling yield in 1 min, the concentrated 0.3 M solution of BTT alone is 2.2.7. Chiral tetrazoles for stereocontrolled synthesis. Stereocon- not practical for industrial applications because BTT rapidly pre- trolled synthesis of oligonucleotides containing chiral inter- cipitates out of the solution and leads to a clogging of transfer nucleotidic phosphorus atoms is an active research topic in nucleic lines.94 acid chemistry. Several methods have been developed for this X. Wei / Tetrahedron 69 (2013) 3615e3637 3625 purpose,98 and the approach using chiral activators is discussed pharmacological study showed that oligonucleotides made with herein as this review focuses on the introduction of coupling acti- DCI and 1H-tetrazole are chemically and biologically equivalent100 vators. Although this strategy is considered useful and convenient, (Fig. 13). only a few relevant works with low diastereoselectivity have been reported. Hayakawa et al. synthesized optically pure tetrazoles with O (R)-binaphthyl chirality (60) and planar ferrocenyl chirality (61), by B O which the syntheses of nucleoside phosphorothioates via the DMTrO T phosphoramidite chemistry were examined. However, little dia- O stereoselectivity was observed. For example, a 62:38 mixture of O S R P phosphorothioates 58 and 59 was obtained in 70% overall yield O O S 99 B (Scheme 15). O NC(CH2)2O P N(i-Pr)2 R = H, OH O R DMTrO T O 62 HO T O 61 + 3'-S-Phosphorothiolate linkage O OCH2CH CH2 P 0 OTBDMS Fig. 13. Chemical structures of 3 -S-phosphorothiolate linkage and phosphor- N(i-Pr)2 othioamidite 62.

The DCI activator was applied by Cosstick in the synthesis of HO 0 T HO T oligodeoxyribonucleotides containing 3 -S-phosphorothiolate O O linkage.101 They ﬁrst prepared thioamidite 62 from 30-deoxy-30- thiothymidine and then developed a fully automated synthesis for O O O O P + P the incorporation of this thioamidite. In an attempt to introduce S O phosphorothioamidite 62, the standard protocol gave only 10% O T S T O O coupling yield due to the low reactivity of 62. The optimized protocol using 1 M DCI and a double 15 min coupling cycle led to OH OH 65e75% coupling yields. By increasing the concentration of thio- 58 59 amidites to 100 mg/mL, the coupling reaction could be further improved and give 85e90% coupling yields using DCI activator and a single 15 min coupling procedure101 (Fig. 13). Activators: The synthesis of oligomer 50-r(GCUUGAAGUCUUUAAUUAA)- 0 0 0 N N d(TT)-3 using 0.1 M 2 -O-Lev-3 -phosphoramidites 63 and 0.25 M N DCI activator was carried out on a 1 mmol scale solid support, re- N OCH3 H ceiving 97.7% average coupling yield and 61.8% purity in 1 min and TMS 102 0 N 98.7% average coupling yield and 76.2% purity in 10 min. The 2 - N Fe ﬂuoro cyclohexenyl nucleic acid pyrimidine phosphoramidite 64 N N H could be incorporated in the oligonucleotide synthesis by using DCI as an activator, and the average coupling yield was >95% in 5 min. 103 60 61 (Fig. 14) Scheme 15. Stereocontrolled synthesis using chiral tetrazoles.

DMTrO B O DMTrO T 2.3. Other azole coupling activators O O O O O F O P 2.3.1. Imidazole activators. Based on the mechanism of the cou- NC P NC i O O N( -Pr)2 pling reaction, the activation of phosphoramidites can be improved N(i-Pr)2 either by faster protonation or by accelerating the nucleophilic displacement step, which is the rate determining step. With in- B = CLev, ALev, Gdmf, U creasing acidities, modified tetrazole activators are more potent than 1H-tetrazole. However, the tetrazole type activators are suf- 63 64 ficiently acidic to deprotect a small extent the trityl group and lead to unexpected side reactions at the longer coupling time. It was Fig. 14. Chemical structures of 20-O-Lev phosphorothioamidites 63 and FCeNA phos- observed that an increase of coupling yields was made by adding phoramidite 64. 0.1 M NMI as a buffer into a 0.45 M 1H-tetrazole solution.57 4,5-Dicyanoimidazole (DCI) was investigated by Pieken et al. as In addition, it has been reported that the modified DCI compounds a less acidic (pKa¼5.2) but more nucleophilic activator. It is soluble can be used as efficient activators for the stereoselective synthesis. up to 1.1 M in acetonitrile, which allows for higher effective con- Phosphoramidite 66, derived from a chiral auxiliary 1,2-O-cyclo- centrations of activated phosphoramidite during the coupling step. pentylidene-5-deoxy-4-isopropylamino-a-D-xylo-furanose 65,un- Compared with 1H-tetrazole, the more nucleophilic DCI affords derwent the coupling reactionpromoted by 1.5equiv of 2-bromo-4,5- higher coupling rates for 20-substituted nucleoside phosphor- dicyano-imidazole (2-Br-DCI) and the following sulfurization using amidites. For example, the coupling time for 20-TBDMS ribogua- Beaucage’s reagent, generating phosphorothioate dinucleoside 67 nosine phosphoramidite decreased from 25 to 10 min when (Sp) in 98% diastereomeric excess (Scheme 16, A). The attempts uti- using DCI to replace 1H-tetrazole as a phosphitylating reagent. lizing other activators including 1H-tetrazole (pKa¼4.8), less acidic Besides, the more efficient DCI requires a lower monomer excess activators DCI (pKa¼5.2), 2-benzyl-4,5-dicyanoimidazole (pKa¼5.3), 57 during the large scale synthesis. The synthetic, analytical, and 2-bromo-4,5-diethyl-carboxylimidazole (pKa6.4), and more acidic 3626 X. Wei / Tetrahedron 69 (2013) 3615e3637 activators BIT (pKa¼4.5) and p-nitrophenyl-tetrazole (pKa¼3.7) phosphorus atom and the azole ring is intrinsically long due to the were slow and failed to give good stereoselectivities.104 The stereo- inserted oxygen atom.106 selective coupling reaction for phosphoramidite 68 was also conducted in the same research group. The application of 2-mesityl-4,5- OMe dicyanoimidazole displayed 15:1 diastereoselectivity ratio, while a 6:1 diastereoselectivity ratio was obtained when 2-Br-DCI was used (Scheme 16,B).105

MeO O T HO T O O + O O N O OTBDMS H P* N HO O O O S O chiral auxiliary

65 70

OMe OT ' H 3 N O N P 1) 1.1 equiv. T5'OH, O O 1.5 equiv. 2-Br-DCI O A: O O 1) 2.2 equiv. activators O 2) Beaucage's reagent T 'O P S MeO O T O 3 O OT5' 3.3 equiv.

major 2) S O S P (Et)2NC S 2 O O T * O 66 67 O S O

OTBDMS 71 OT5' OT ' 3 S P OT3' N P 1) 1.1 equiv. T5'OH, 1.5 equiv. activator H O O O N O Activators and results: B: O 2) Beaucage's reagent O OH O O OH OH F3C N F C N 3 N N N N N 68 69 N N NO2 72 73 74

Activators: Rp-38:Sp-38 74:26 82:18 82:18

Br Yield: 52% 92% 92% e N NH Scheme 17. Stereoselective syntheses using 1-hydroxy-benzotriazole activators72 74.

N NH NC CN 2.3.3. 3-Nitrotriazole activators. 3-Nitrotriazole was utilized by NC CN Tang and Zhang to react with chloro(2-cyanoethy)-N,N-diisopro-

2-Br-DCI 2-Mesityl-DCI pylaminophosphine in the presence of triethylamine, yielding a novel phosphitylating reagent 75, which can quickly react with 50- Scheme 16. Stereoselective syntheses using modified DCI activators. O-DMTr-nucleosides in the presence of diisopropylethylamine without additional activation, and the resulting phosphoramidites > 2.3.2. 1-Hydroxy-benzotriazole activators. In Sekine’s study of the gave 98% stepwise coupling yield in the further DNA synthesis 107 ’ stereoselective synthesis of internucleotidic bond by employing (Scheme 18). In Sekine s stereoselective synthesis study, 3- thymidine with a chiral ribose moiety, various activators were in- nitrotriazole was directly used as an activator and gave a coupling vestigated, among which 1-hydroxyl benzotriazole 72, 1-hydroxy- yield of 91% without any diastereoselectivity for the condensation 0 106 6-trifluoromethyl benzotriazole 73, and 4-nitro-1-hydroxy-6- between phosphoramidite 70 and 3 -O-TBDMS-thymidine. trifluoromethyl benzotriazole 74 were examined in consideration of their acidity, steric bulk, and nucleophilicity.106 As shown in 3. Salt complex coupling activators Scheme 17, phosphoramidite 70 was allowed to react with 30-O- TBDMS-thymidine under the activation of 2.2 equiv of 72e74 in An effective coupling activator for oligonucleotide synthesis via a solution phase. After the subsequent sulfurization, the dimer phosphoramidite approach should first be an acid to protonate the product 71 was produced. The 31P NMR analysis indicated that 73 amine moiety of the phosphoramidite; and second be a good nucle- and 74 gave higher diastereoselectivity of 82:18 and much better ophile to attack the phosphine, releasing the protonated amino moi- overall coupling yield of 92% than 72. Moreover, no trend of the etyand resulting in an active intermediate; and third be a good leaving increasing of diastereoselectivity with enhancing acidity was ob- group in the step of reacting with ROH. Considering all of these re- served for 1-hydroxybenzotrizole activators, probably because in quirements, salt complexes are designed and serve as efficient cou- the resulting phosphite intermediates, the distance between the pling activators. They are easy to prepare, safe, and relatively cheap. X. Wei / Tetrahedron 69 (2013) 3615e3637 3627

N N NO NO DMTrO DMTrO NC Cl 2 2 B B HN NC N O O OP N N OP N X N H N H Et3N, THF, r.t. O O NC P N protonation NC P N O O 75

DMTrO in situ B O DNA Synthesis

EtN(i-Pr)2 O DMTrO DMTrO P NC nucleophilic B B N(i-Pr) O O O 2 attack ROH X Scheme 18. DNA synthesis using phosphitylating reagent 75. O O NC P N NC P OR O O

3.1. Pyridinium salt complexes 76

Combinations of pyridine and various acids were examined for over the ability to activate the coupling step of the oligonucleotide e synthesis via phosphoramidite approach.108 110 According to Beier fl DMTrO and P eiderer, different acids, such as hydrochloride, hydro- B bromide, 3-nitrobenzenesulfonic acid, and 4-methyl-benzene- O sulfonic acid, have little effects on the activation properties of the corresponding pyridine/acid complex activators, but on the other O NC P Cl hand, pyridines with different nucleophilic substitutions, such as 4- O chloropyridine, 1-(4-pyridyl)pyridine, 2,6-di(tert-butyl)pyridine, and 2-(tert-butyl)-pyridine, influence the ability of pyridine/acid 77 108 complexes to serve as activators. This observation that the acti- Scheme 19. Proposed mechanism of the condensation promoted by pyridine/acid vation property depends on the nucleophilic substitution in pyr- complexes. idinium cation but not the acid anion provides valuable information DMTO T on the mechanism study, by which a mechanism involving a highly O reactive pyridinium-ion type intermediate 76 generated from O a nucleophilic attack of a pyridine moiety on protonated phos- O phoramidite was proposed by Beier and Pfleiderer (Scheme 19). In P NC(H C) O N(i-Pr) order to verify this assumption, the activation reactions using 2 2 2 pyridinium chloride, bromide, and 4-methylbenzenesulfonate, and 2,6-di(tert-butyl)pyridinium chloride as activators were monitored 78 by 31P NMR. Although there was no direct detection of the forma- Fig. 15. The chemical structure of xylo-LNA 78. tion of 76, the researchers supported their opinion by the facts that no signal supporting the generation of a competitive phosphoro- automatic synthesis of 20-mer phosphorothioate oligodeoxyr- chloridite intermediate 77111 was observed, and the activation was ibonucleotide (ISIS 5132) 50-d(TCCCGCCTGTGACATGCATT)-30 on slower when 2,6-di-(tert-butyl)pyridinium chloride, an activator a30mmol scale polystyrene support. The coupling time was with steric hindrance by the bulky pyridine moiety, was used.108 maintained as 3 min, and 2.5 equiv of phosphoramidites was used. As a remarkably efficient coupling activator, pyridinium chloride It was observed that the crude yield was higher when using more (Py$HCl) is cheap, easy to handle, and able to speed up the coupling concentrated Py$TFA, and it could be further improved when using step significantly without sacrificing the purity and homogeneity of a unity of Py$TFA/NMI (Table 2). Moreover, the addition of NMI oligonucleotides. Compared with 1H-tetrazole, Py$HCl requires helped to decrease the formation of (nþ1)-mer from 3.9% to 0.5%. In shorter coupling time for both DNA and RNA synthesis. The cou- order to determine the active species involved in the coupling re- pling time can be reduced from 60 s to 6e12 s for DNA synthesis action, N-methyl-imidazolium trifluoroacetate was prepared and and from 700e1200 s to 70e280 s for RNA synthesis if used as a coupling activator in the synthesis of ISIS 5132, but only 0.5 M Py$HCl, instead of 1H-tetrazole, is used in the activation re- poor results were obtained. The test results mentioned above and action. Average stepwise yields of 98.8e99.9% can be achieved for shown in Table 2 support the conclusion that Py$TFA acts as the the synthesis of 18e22nt oligodeoxyribonucleotides using Py$HCl activator, and the function of NMI is to increase the basicity of the activator.108 Moreover, Py$HCl is particularly useful to activate medium for the coupling reaction to reduce undesired detritylation sterically hindered phosphoramidite building blocks, for example, 0 L xylo-LNA 78. The synthesis of 5 -X T6 using xylo-LNA 78 under the activation of 0.5 M Py$HCl afforded >99% coupling yield in 10 min. Table 2 $ In contrast, the coupling using 0.45 M 1H-tetrazole gave only 15% The synthesis of ISIS 5132 using Py TFA activator yield in 10 min or 31% in 30 min, and the coupling yield was 71% Entry Activator % Full length %(nþ1)-mer Crude yield when using 0.5 M DCI for 30 min58 (Fig. 15). by CGE (OD/mmol) Pyridinium trifluoroacetate (Py$TFA), in combination with N- 1 0.11 M Py$TFA 73.2 0.5 96 $ methylimidazole (NMI), can serve as an efficient activator in the 2 0.22 M Py TFA 68.0 3.9 119 $ þ 112 3 0.22 M Py TFA 0.11 M 75.6 0.5 127 synthesis of oligonucleotides via phosphoramidite chemistry. In NMI order to investigate its activation ability, Py$TFA was applied in the 3628 X. Wei / Tetrahedron 69 (2013) 3615e3637

112 and attendant longmer formation. In another example, the DMTrO HO B B combination of 0.22 M Py$TFA and 0.11 M NMI was used in O O step 1 a30mmol scale synthesis of phosphorothioate 19-mer U19T where 0 U represents 2 -O-methoxyethyl-5-methyluridine and gave a crude O O yield of 87 OD/mmol after 6 min.112 3% TCA in DCM Vasseur and co-workers reported a new phosphoramidite approach using recyclable solid-supported polyvinyl pyridinium tosylate as an activator, by which a large scale (1e10 mmol) syn- N N HN NH thesis could be carried out in a solution phase without complicated CCl3CO2 CCl3CO2 puriﬁcation steps. The syntheses of dinucleoside 50-OH-30eO-Lev oxo- and thiono-phosphotriesters were achieved in 81e96% overall 79 80 yields and in 90e96% purities (Scheme 20). In the coupling step, 1.5 equiv of phosphoramidite and 10 equiv of polyvinyl pyridinium tosylate were used, and the typical coupling time was 1e2h. DMTrO B Polystyrene-bound trimethylammonium periodiate or tetrathio- O nate was used as an oxidizing or sulfurizing agent. In this method, step 2 all polymer-supported reagents are ionic interacted with the or- O ganic supports and therefore can be regenerated and reused, which NC(CH2)2O P 113 O reduces the costs and the impact on the environment. DMTrO B B O O

DMTrO O B O O HO NC(CH ) O P B 2 2 O N(i-Pr)2 O + NC(CH ) O P 2 2 OLev N NH N(i-Pr)2 CCl3CO2

Scheme 21. The general description of nucleic acid synthesis on a pyridine-bound solid support. DMTrO B O azoles with acids. Hayakawa’s group devoted lots of attention to this e e research.59 61,115 120 A variety of azole/acid promoters that have 1) PV NH O S 3 X O good solubility in acetonitrile (0.4 mol/L) were screened for their P NC(H2C)O O reactivities on the basis of the yield of deoxyribonucleotide dimer B 31 2 O 82, which was detected by the P NMR assay, from the coupling 2) PS NMe3 S4O6, or IO4 reaction between deoxyribonucleoside phosphoramidite 81 0 OLev (0.02 mmol) and 3 -O-TBDMS-thymidine (0.02 mmol) in a 0.02 M acetonitrile solution.59 The coupling time was setup as 1 min. As X = S, or O shown in Scheme 22, the order of the coupling efficiency is N- Scheme 20. New solution-phase synthesis using polyvinyl pyridinium tosylate as an (phenyl)imidazolium triflate (N-PhIMT)>N-(phenyl)-imidazolium activator. perchlorate (N-PhIMP)>N-(methyl)benzimidazolium triflate (N- > fl > In recent years, a new technology utilizing the activator-bound MeBIT) N-(p-acetylphenyl)imidazolium tri ate (N-AcPhIMT) N- fl > solid supports was developed for nucleic acid synthesis. Through (phenyl)imidazolium tetra uoroborate (N-PhIMTFB) imidazolium this method, the oligomer can grow on the solid support without 114 DMTrO using external activators in each synthetic cycle. It is required T O HO e T that the covalently bound activators have pKa value of 4 7, pref- O 1) activators, 1 min erentially in the 5e6 range. Pyridinium salts with pKa value of + 5.2e5.5 can therefore be a choice of activators in this technology. O 2) oxidation P OTBDMS The solid supports can either be polystyrene or CPG possessing pre- O N(i-Pr)2 attached nucleosides or pre-attached universal linkers to provide sites for oligonucleotide construction. As described in Scheme 21, 81 the general process starts with the treatment of the pyridine-bound solid support 79 by 3% TCA in DCM (pKa¼0.65), which results in the 50-dimethoxytrityl deblocking at the nucleoside site and the (re) N-PhIMT protonation at the pyridine sites, yielding 80, which possesses DMTrO N T -PhIMP O N-MeBIT pyridinium trichloroacetate that acts as the sole coupling activator N-AcPhIMT 0 N-PhIMTFB for the condensation between the 5 -OH of 80 and the incoming IMP phosphoramidite. This optimized strategy of the internucleotide O O 4-PhIMT P BITFB bond formation via phosphoramidite approach offers entries to the O O IMTFB T IMT 114 O BIT synthesis of nucleic acids in very small scales. 2-PhIMT N-MeIMT 4-MeIMT OTBDMS 1H-tetrazole 3.2. Azolium salt complexes 050100 82 reactivity

The utilities of azole/acid, in particular benzimidazole/acid and Scheme 22. Reactivities of azole/acid complex promoters in the synthesis of de- imidazole/acid complexes, can be simply prepared by combining oxyribonucleotide dimer 82.59 X. Wei / Tetrahedron 69 (2013) 3615e3637 3629 perchlorate (IMP)>4-(phenyl)-imidazolium triflate (4-PhIMT)> which then reacts with the hydroxyl group in a nucleotide (NucOH) benzimidazolium tetrafluoroborate (BITFB)>imidazolium tetra- to form dinucleoside phosphate 88. Similar to the mechanism of the fluoroborate (IMTFB)>imidazolium triflate (IMT)>benzimidazo- coupling reactionpromoted by 1H-tetrazole, the rate-limiting step in lium triflate (BIT)>2-(phenyl)imidazolium triflate (2-PhIMT)>N- this pathway is the conversion of protonated intermediate 86 to (methyl)imidazolium triflate (N-MeIMT)>4-(methyl)imidazolium phosphorazolidite 87. Azole is suggested to be more reactive than the triflate (4-MeIMT), and overall, the azole/acid promoters were much tetrazolide anion toward the protonated phosphoramidite, which more effective than 1H-tetrazole in this oligodeoxyribonucleotide can explain the higher reactivity of azole/acid complexes than 1H- synthesis.59 Notable efficiencies of the azolium promoters were also tetrazole. To elucidate the mechanism, the condensation assisted by observed in the formation of interribonucleotide linkage. Several IMP was monitored by 31P NMR, and the formation of the key azolium reagents including IMP, N-PhIMT, N-PhIMP, N-AcPhIMT, BIT, phosphorimidazolidite was verified by the appearance of a new and N-MeBIT were examined by the condensation between 20-O- broad singlet peak at d 125.8 ppm.59 TBDMS-30-phosphoramidite 83 (0.02 mmol) and 84 (0.02 mmol) in As a commonly used azolium promoter, BIT is very efficient for a 0.1 M acetonitrile solution for 5 min. The reactivity was estimated oligonucleotide synthesis via phosphoramidite approach, even for from the yield of the dinucleoside phosphate 85. Among the pro- normally weakly reactive amidites such as arylated deoxy- moters, N-PhIMT was most reactive, followed by N-MeBIT, which ribonucleoside phosphoramidites 89. The condensation between 89 was slightly better than BIT, and another three activators IMP, N- and 30-O-TBDMS-thymidine was accomplished in 1 min using PhIMP, and N-AcPhIMT were similar, showing less reactivity a slightly excess of 89 (1.2 equiv) and 0.4 M BIT (1.2 equiv) to the (Scheme 23). All selected azole/acid complex activators were more nucleoside (1 equiv), and the average coupling yields were 97e98%. reactive than ETT, which is among the best invented so far for RNA In contrast, the application of 0.1 M 4-NPT and 0.5 M 1H-tetrazole synthesis.59 Moreover, short-length oligonucleotides could be effi- could only give low to mediate yields even after 30e60 min.60 Under ciently synthesized in a solution phase by using stoichiometric the same condition, the coupling reactions between 84 and ribo- amounts of reactants and an azolium promoter in the presence of nucleoside phosphoramidites 83 and 90 using BIT promoter gave MS 3A or 4A.116 99% coupling yield.59,60 In addition, the coupling reaction of ribonucleoside phosphoramidite 91 was prompted by 1.2 equiv of BIT in

DMTrO a solution phase and generated diribonucleotide in 81% overall CAOC 121 O HO separation yield after the following oxidation procedure. In an- AAOC O 1) activators,1 min other example, BIT acted as an effective activator for the synthesis of + oligonucleotides containing the pyrimidine(6-4) pyrimidone pho- O OTBDMS 2) oxidation P AOCO OAOC toproduct. In the step of incorporating photoproduct, phosphor- i O N( -Pr)2 amidite 92 was used as a 0.13 M acetonitrile solution, and the

83 84 coupling reaction by using 0.2 M BIT for 20 min received comparable yield to that employing 0.5 M 1H-tetrazole for 20 min, but less of by- products were generated when using BIT activator based on the HPLC analysis. The formation of the by-products was prevented to some extent when using 0.1 M IMT as activator for 30 min, but the DMTrO 117 CAOC coupling yield was not satisfactory (Fig. 16). O N-PhIMT N-MeBIT BIT N-PhIMP DMTrO O O OTBDMS IMP B MMTrO P N-AcPhIMTT O CAOC O O ETT O AAOC O 0 50 100 Cl O reactivity TBDMSO O P AOCO OAOC O N P i O O N( -Pr)2 85

Scheme 23. Reactivities of azole/acid complex promoters in the synthesis of ribonu- B = ABZ, CBZ,GIBu, T cleotide linkage.59 89 90 Hayakawa and co-workers proposed a mechanism for the phosphitylation using azole/acid complex as described in Scheme 24.The O azole/acid complex ﬁrst acts as an acid to protonate phosphor- Me OH amidite, generating intermediate 86 and a free azole. The in- DODO HN CDMTr N O termediate 86 is then attacked by azole, not the less reactive O O N ɵ H conjugate base X of the acid, and results in phosphorazolidite 87, Me N MeO O OAcE O P O O O 1 1 i O ONuc ONuc N( -Pr)2 DMTrO P N(i-Pr) O P 2 P + AzH X P X + Az O RO NR' RO NHR' O CN CN

86 91 92

ONuc1 Nuc2OH ONuc1 Fig. 16. Chemical structures of phosporamidites 89e92 that can be activated by BIT X + NHR' + R NH X + Az P 2 P 2 2 promoter. RO Az RO ONuc2 IMT can be utilized as a promoter for a facile synthesis of oligo- 87 88 deoxyribonucleotides via the phosphoramidite approach without Scheme 24. Proposed mechanism of the coupling reaction activated by azole/acid base protection of building blocks. The use of IMT allows a conden- complexes. sation to proceed in a rapid and highly O-selective manner between 3630 X. Wei / Tetrahedron 69 (2013) 3615e3637 a phosphoramidite and an N-free nucleoside when equimolar on a solid support using 20 equiv of NBT promoter with 20 equiv of amounts of substrates are employed in a solution phase, giving dG or T phosphoramidite unit, or using 40 equiv of NBT with a dinucleoside phosphate in >95% yield after the oxidation pro- 20 equiv of the dC or dA phosphoramidite unit. This protocol is very cedure.61,118 The solid phase synthesis requires an excess amount of simple so that the total time required for the three reaction steps the phosphoramidite for the condensation because deoxyadenosine including detritylation, condensation, and oxidation was 3.5 min. and deoxycytidine undergo N-phosphitylation and generate undesired compound 94 to some extent, fortunately, which can be 3.3. Saccharin salt complexes converted to N-free derivative 95 by treating with a 0.5 M BIT solution in methanol (Scheme 25). This N-unprotected synthetic Organic bases with a tendency to accept protons at pKa¼7.0, strategy could be successfully applied in the 1 mmol scale prepara- such as pyridine, collidine, lutidine, picoline, N-methylimidazole, tion of oligomers, such as 50-GTCACGACGTTGTAAAACGAC-30 (21- and triethylamine, can react with saccharin to form salt complexes e mer), 50-CA AGTTGATGAACAATACTTCATACCTAAACT-30 (32-mer), in acetonitrile.123 125 Saccharin-1-methylimidazole (SMI), one of and 50-TATGGGCCTTTTGATAGGATGCTCACCGAGCAAAACCAAGAA- the resulting salts, is used as an activator for both DNA and RNA CAACCAGGAGATTTTATT-30 (60-mer), and the average coupling synthesis. The investigation of Sinha’s group indicated that sac- yields were >99.8% for all the syntheses using 0.1 M IMT in 1 min.61 charin-1-methylimidazole is as effective as 1H-tetrazole in the synthesis of oligodeoxyribonucleotides. The general coupling time is 4e5 min for deoxynucleoside phosphoramidites and 10 min for OR' ribonucleoside phosphoramidites.123 For instance, in the prepara- P HN OR tion of oligodeoxyribonucleotide on a CPG solid support, the synthesis using 0.25 M SMI gave similar purity and yield to that using N 125 DMTrO 1H-tetrazole under the same conditions. BNH2 O OR' O N O Page and co-workers conducted the corresponding mechanism O P 126 1 IMT HN OR research. The H NMR study in deuterated acetonitrile indicated that the basicity in acetonitrile is in the order of saccharin anion99:1), which was better than the pKa values lower than 2.8. In this ‘proton-block’ method, 5- synthesis employing activator 102 (Rp/Sp¼98:2), but the use of 122 127 nitrobenzimidazolium triflate (NBT) (pKa¼2.76) was found to activator 103 led to Rp-100 in 28:72 diastereoselectivity. be most efficient, and THF is superior to CH3CN as the solvent be- Moreover, N-(cyanomethyl)pyrrolidinium triflate (CMPT) can be cause the concomitant detritylation due to the inherent acidity of employed as a promoter for the synthesis of PS-ODNs and PS-ORNs the promoter can be greatly suppressed. This approach could be in very high diastereoselectivities (99%) using nucleoside 30-O- successfully applied in the synthesis of short nucleotides without bicyclic oxazapholidine derivatives such as 104 and 105 as mono- introducing significant side reactions. Excellent coupling yields mer units on a solid support.129,130 For example, the synthesis of of >99% could be achieved in the synthesis of dideoxynucleotides stereoregular PS-ODNs, 50-all-(Rp)-TsTsTsTs TsTsTsTsTsTs-30, and 50- X. Wei / Tetrahedron 69 (2013) 3615e3637 3631

0 O O all-(Sp)-CsAsGsTsCsAsGsTsCsAsGsTs-3 , achieved 99% and 95% av- RO S 129 HN N Me erage coupling yields, respectively, and the synthesis of PS-ORNs, i + N PN(-Pr)2 50-all-(Sp)-UsUsUsU-30, gave 94% average coupling yield130 (Fig. 17). R'O O

DMTrO B DMTrO B O O

O O OTBDMS

O O P P RO S ON ON PNH(i-Pr) + N + NN Me 2 Ph Ph R'O O B = T, CAc, Admf, GCE, PAC B = U, CAc, Admf, GCE, PAC

104 105

O Fig. 17. Chemical structures of nucleoside 30-O-bicyclic oxazapholidine derivatives 104 RO and 105. P N R'O S 4. Other coupling activators for phosphoramidite approach O O RO P-N-Saccharin 4.1. Carboxylic acid coupling activators PO O S N R'O O over 97 P-O-Saccharin A number of carboxylic acids with different substitution groups are screened as activators for the formation of an internal nucleo- RO e tidic phosphityl bond through phosphoramidite method.131 133 PN N Me 96 R'O Compared with 1H-tetrazole and its derivatives, carboxylic acids are of low cost and high solubility in acetonitrile. Among the car- P-N-methylimidazole boxylic acids being explored, trichloroacetic acid (TCA), triﬂuoro- acetic acid (TFA), dichloroacetic acid (DCA), and 2,4-dinitrobenzoic R''OH 98 acids (2,4-DNBA) exhibit comparable activity to that of 1H-tetrazole. For example, in the synthesis of oligodeoxyribonucleotide 50- GACTCTCTTAGCTAAT-30 on a CPG support, a 0.1 M phosphor- O O amidites solution in acetonitrile and a 0.08 M TCA solution in RO S acetonitrile are mixed and delivered over 15 s or 30 s into the re- POR'' + H N(i-Pr) + N 2 2 action column in the coupling step. The target oligonucleotide was R'O 131 O produced in 88% overall yield and 99% average coupling yield. A 0.05 M acetonitrile solution of 2,4-dinitrobenzoic acid can also be Scheme 26. Proposed mechanism of the coupling reaction activated by SMI. used as a coupling reagent for the synthesis of oligodeoxyribonucleotide.132,133 For example, the coupling yield for the synthesis of 21-mer 50-CTGGACACTAGTCCGACTGCT-30 was 98e99% in 132 HO T 4 min (Scheme 28). O TBDPSO TBDPSO T T O O DMTrO OTBDMS B O O O activators 101~103 P P * O COOH O ON O T H CO P N * O 3 NO2 DMTrO N(i-Pr) B H 2 1) O Ph Ph OTBDMS NO 2 O O 99 100 P + H CO O 3 B O 2) oxidation HO B Activators and results: O O

O NC HBF4 BF4 NC H BF4 NC H N N N Scheme 28. Oligodeoxyribonucleotide synthesis using 2,4-dinitrobenzoic acid as an activator. 101 102 103 One concern of using TCA, TFA, and DCA as activators is that they

Rp Sp can remove the DMTr group in dichloromethane. Therefore, it is -100: -100 >99:1 98:2 28:72 crucial to use them in an equal molar amount or less to phos- Scheme 27. Diastereoselective condensation using ammonium activators 101e103. phoramidites to avoid detritylation. However, it is worth noting 3632 X. Wei / Tetrahedron 69 (2013) 3615e3637 that 0.05 M TCA or 0.05 M DCA can remove 0.2% or 0.1% of the coupling yield, which could be separated and purified by chroma- DMTr groups when using a acetonitrile solution of phosphor- tography and transformed in a stereospecific way into the corre- amidite in 0.1 M concentration, which would not be acceptable in sponding oxidized compounds 111 (Scheme 30).136,137 an oligonucleotide synthesis as observed elsewhere. In contrast, 2,4-DNBA only removes 0.01% of the DMTr group.131,132 DMTrO B O HO B TMCS 4.2. Lewis acid coupling activators O + O F P The invention of utilizing Lewis acids in the phosphoramidite ODMTr i coupling reaction indicates that Lewis acids play not only as activa- N( -Pr)2 tors, but also as moisture scavengers to decrease the competing reaction of water with the activated phosphoramidite intermediates.134 109 Various Lewis acids were evaluated through the solution phase synthesis of dinucleoside phosphate 108 from the condensation between 1 equiv of phosphoramidite 106 and 1 equiv of nucleoside 107. DMTrO DMTrO B B O O Lewis acids including iron chloride (FeCl3), aluminum chloride (AlCl3), trifluoroboron etherate (BF3$OEt2), zirconium(IV) chloride [x] F (ZrCl4), and bismuth(III) chloride (BiCl3) were observed to promote F O O P P the condensation in >99% coupling yields in <5min(Scheme 29).134 X O X = S, Se O B B However, the addition of Lewis acids can lower the pKa of the reaction O O mixture and then cause the removal of N-andO-protecting groups on the phosphoramidites. Therefore pyridine can be introduced to in- ODMTr ODMTr crease the pKa to a level that the phosphoramidites protecting groups 134 can tolerate without decreasing the coupling efficiency. 110 111 Scheme 30. The coupling reaction promoted by TMCS.

DMTrO ABz The presumed mechanism of activation by TMCS is described in O Scheme 31. In this hypothetical reaction cycle, the ﬁrst step is the

DMTrO generation of salt-like species 112 or 113 from the reaction between O ABz 00 O TMCS and phosphoramides, and the product R2POR is then gen- NC(CH ) O P 2 2 erated through the direct reaction of 112 or 113 with alcohol or via N(i-Pr)2 the formation of intermediate R2PCl, and TMCS is regenerated in 106 1~2 equiv. O 31 Lewis acid NC(CH2)2O P both cases. The attempts using P NMR analysis to verify the for- O U + O mation of salt-like intermediates failed, but the generation of R3PCl was conﬁrmed by 31P NMR spectroscopy.136,137 HO U O O O Reaction Cycle 108 O O

R2PNR'2 Me3SiCl R2POR'' 107

R' NH Salt-like 2 intermediate R''OH Activators and results:

Lewis Acid Coupling Coupling Amount Activator Time Yield Salt-like intermediate:

FeCl3 1 equiv. <5min >99% R SiMe AlCl3 1 equiv. <5min >99% 3 R R' P Cl P N Cl R NR'2 R R' BF3 OEt2 1 equiv. <5min >99% SiMe3 ZrCl 1 equiv. <5min >99% 4 112 113

BiCl3 2 equiv. <5min >99% Scheme 31. Proposed reaction mechanism catalyzed by TMCS. Scheme 29. The condensation promoted by Lewis acid activators.

4.3. Trimethylchlorosilane (TMCS) 4.4. 2,4-Dinitrophenol (DNP)

Inspired by the results from the earlier work that phosphor- As a strongly acidic phenol, 2,4-dinitrophenol (DNP) 137 amidites could react with alcohols using trimethylchlorosilane (pKa¼4.1) can be used as an activator for phosphate synthesis via (TMCS) as a catalyst,135 Michalski group demonstrated that phos- the phosphoramidite approach. In general, DNP is superior to 1H- phitylations using TMCS proceeded at comparable or higher rates tetrazole to activate phosphoramidites bearing a strongly electron- than those using 1H-tetrazole activator.136 Under the catalyzation withdrawing group at the phosphorus center. On average the op- of 0.3 equiv of TMCS, the condensation between phosphoro- timal amount of DNP activator required for an efficient coupling in fluoroamidite 109 and 30-O-protected nucleoside produced phos- a solution phase is 1.5 equiv of the stoichiometrical ratio. For ex- phorofluoridite 110 as a 1:1 mixture of diastereomers in 99% ample, the phosphoramidite 115 with an electronegative leaving X. Wei / Tetrahedron 69 (2013) 3615e3637 3633 group eOCH(CF3)2, prepared in very good yield from 114, hydroxyl site of nucleoside has to be fast and nearly quantitative, could react with 30-O-Pix-thymidine under the activation of DNP which requires the phosphoramidite being highly activated by an to generate product 116 in >95% overall yield in THF solution efficient coupling activator. The study of the coupling mechanism (Scheme 32).137,138 indicates that a coupling activator plays dual roles: a sufficient acid to initiate the protonation of the amine moiety in the phosphoramidite and a later good nucleophile to attack the phosphine to DMTrO T generate the key reactive intermediate. This becomes to be a prin- O DMTrO ciple in most design of activators. The derivative tetrazole type T O activators are more potent than 1H-tetrazole due to their highly (i-Pr) N 2 OH acidities (Table 3). The DCI activator is designed to be a more nu- p OCH(CF3)2 i O OCH(CF3)2 cleophilic activator to accelerate the rate of the nucleophilic dis- ( -Pr)2N DNP P placement step, which is the rate-determine step in the coupling N(i-Pr) 2 process. The salt complex type activators have flexibility to balance 114 115 the acidity and the nucleophility due to the advantage of easy preparation. Along with the development of coupling activators, versatile synthetic tasks of oligonucleotides can be magnificently DMTrO T accomplished through the phosphoramidite approach. HO O T O Table 3 O OCH(CF3)2 Summary of pK values and solubilities in acetonitrile of selected coupling activators P a OPx Ref O Entry Activators Abbrevations pKa Solubility T Ref O in ACN DNP 11H-Tetrazole d 4.868 0.5 M79 2 5-(4-Nitrophenyl)-1H-tetrazole 4-NPT 3.768,74 0.12 M79 OPx 3 5-(Bis-3,5-trifluoromethylphenyl)- Activator-42 3.479 0.94 M79 116 1H-tetrazole 80,82 79 Scheme 32. The coupling reaction using DNP activator. 4 5-(Ethylthio)-1H-tetrazole ETT 4.3 1.52 M 5 5-Benzylthio-1H-tetrazole BTT 4.0887 0.44 M79 6 5-(Methylthio)-1H-tetrazole MTT 4.1595 >2.0 M95 The mechanism using DNP is presumed in a similar manner to 97 97 138 7 1-Methyl-5-mercapto-tetrazole 1-Me-MCT 3.86 0.5 M that accepted for the activation by 1H-tetrazole. The key in- 8 1-Phenyl-5-mercaptotetrazole 1-Ph-MCT 3.6597 0.5 M97 termediate 117 with a 2,4-dinitrophenoxy group attached to the 9 4,5-Dicyanoimidazole DCI 5.278,80 1.157 P(III) center is assumed to be formed in the process, which is 10 Pyridinium hydrochloride Py$HCl 5.161 0.5 M108 61 120 confirmed by 31P NMR analysis of the model reaction between 11 Imidazolium triflate IMT 6.9 >1.0 M 12 Benzimidazolium triflate BIT 4.561 0.4 M59 bis(2-cyanoethyl)-N,N-diisopropyl-phosphoramidite and benzyl 13 5-Nitrobenzimidazolium triflate NBT 2.76122 d alcohol in the presence of 1.5 equiv of DNP (Scheme 33), showing 14 2,4-Dinitrobenzoic acids 2,4-DNBA 3.7139 d a chemical shift at 140.1 ppm. The structure of intermediate 117 is 15 2,4-Dinitrophenol DNP 4.1137 d further verified through the 31P NMR analysis of the product obtained from the independent reaction of the corresponding phosphorochloridite with trimethylsilyl 2,4-dinitrophenol. Moreover, Many activators can be used in the oligonucleotide synthesis fi the observation that the rate of formation of the phosphite 118 is and the selection of coupling activator for a speci c task should dramatically reduced with the addition of triethylamine provides consider many issues, such as cost, the solubility of activator in another evidence for the reversible acid catalysis in this proposed acetonitrile, and the reactivity of activator, and toxicity, etc. The mechanism. activators such as 1H-tetrazole, ETT, BTT, Activator-42, DCI, and SMI are commercially available and suitable for the automatic synthesis on the solid support. The solubility in acetonitrile is an important RO RO H parameter for the coupling activator selection because the activator P PN + ArOH RO N +ArO with low solubility has a high tendency to crystallize if used as RO fast concentrated solution in acetonitrile, which impacts the stability of such solution. The solubilities of selected activators in acetonitrile are summarized in Table 3. Activator such as 1H-tetrazole is toxic and explosive, which is a big disadvantage, but as the first discov- slow ArOH ered and the wonderful phosphorylating agent, 1H-tetrazole is still widely used to fulfill different synthetic tasks. The study shows that modified tetrazole activators with higher acidities, such as ETT, 4-

PhCH2OH RO NPT, Activator-42, and MCT are superior to 1H-tetrazole in the RO 41,77,79,97 P OAr + H N DNA synthesis. But it has to be noted that the high acidity POCH2Ph 2 RO ArOH RO of activator may increase the formation of undesired by-products due to the removal of DMTr or other acid-liable protecting groups 118 117 by the acidic activator during the synthesis and therefore impairs Scheme 33. Proposed reaction mechanism prompted by DNP. the entire coupling yield. Sometimes, the addition of proper neu- tralizer can overcome the problem and improve the effectivity of 5. Summary the acidic activator, for example, the addition of DMAP into 4-NPT76 and the addition of NMI into 1H-tetrazole,57 BTT94 or Py$TFA112 can The oligonucleotide synthesis via phosphoramidite approach serve better in the synthesis of nucleic acids. Phosphitylating re- represents as a very convenient and highly effective strategy. In agents, such as azolium salt complexes, are very efficient in the order to ensure a successful synthesis in high efficiency, the critical activation of 30-O-allyl-N,N-diisopropyl phosphoramidites,59 and coupling reaction between the phosphoramidite and the free BIT performs very well in the activation of normally weakly reactive 3634 X. Wei / Tetrahedron 69 (2013) 3615e3637 arylated deoxynucleoside phosphoramidites.60 The synthesis of t-Bu tert-butyl oligodeoxyribonucleotide with modified skeletons generally re- Bz benzoyl quires longer reaction time.62,81,84,93 CE cyanoethyl The RNA synthesis is normally more difficult than the DNA CEM 2-cyanoethoxymethyl synthesis due to the steric hindrance of the 20-O-protecting group, CGE capillary gel electrophoresis and hence calls for the phosphitylating reagent with high effi- CMPT N-(cyanomethyl)pyrrolidinium triflate ciency. Coupling activators, such as BTT and ETT, are eligible for the CPG controlled pore glass e condensation of versatile ribonucleoside phosphoramidites.82,87 92 2,6-DAP 2,6-diaminopyridine In the coupling of 20-O-methyl-phosphoramidites, it has been re- DCA dichloroacetic acid ported that 4-NPT is a much better activator than 1H-tetrazole75 DCI 4,5-dicyanoimidazole and Activator-42 is superior to ETT.79 In the coupling of 20-O- DCM dichloromethane TBDMS-phosphoramidites, the order of coupling efficiency is DDTT 3-((dimethylaminomethylidene)amino)-3H-1,2,4- BTT>ETT>DCI>1H-tetrazole,87 and BIT is more potent than ETT.59 dithiazole-3-thione In the coupling of 20-O-TOM-phosphoramidites, MTT is as effi- DMAP 4-dimethylaminopyridine cient as ETT.30 Furthermore, Py$HCl is particularly useful to activate DMCE 1,1-dimethyl-2-cyanoethyl sterically hindered LNA phosphoramidite building blocks.58 dmf dimethylformamidine With the help of chiral auxiliaries, the oligonucleotides with in- DMTr di-p-methoxytrityl ternal phosphorothioate linkage can be synthesized in a stereo- DNA deoxyribonucleic acid controlled manner by utilizing activators, such as 2-bromo-4,5- 2,4-DNBA dicyanoimidazole,104 2-mesityl-4,5-dicyanoimidazole,105 1-hy- 2,4-dinitrobenzoic acids droxy-6-trifluoromethyl benzotriazole,106 4-nitro-1-hydroxy-6- DNP 2,4-dinitrophenol trifluoromethyl benzotriazole,106 and dialkyl(cyanomethyl)-ammo- DOD bis(trimethylsiloxy)cyclododecyloxylsilyl nium tetrafluoroborates.127 Although have not been thoroughly DTM tert-butyldithiomethyl studied, chiral coupling activators represent as another option for EDA ethylenediamine the stereoselective preparation of nucleic acids.99 EDITH 3-ethoxy-1,2,4-dithiazoline-5-one In addition, the investigation of salt complex activators provides Et ethyl chances for the development of new strategies, such as novel so- ETT 5-(ethylthio)-1H-tetrazole lution phase synthesis using polyvinyl pyridinium tosylate,113 F-CeNA 20-fluoro-cyclohexenyl nucleic acid nucleic acid synthesis on activator-bound solid support,114 and Fpmp 1-(2-fluorophenyl)-4-methoxypiperidin-4-yl N-unprotected phosphoramidite method.61,122 HF hydrofluoride The study indicates that carboxylic acids and Lewis acids have HPLC high pressure liquid chromatography potential to be good activators, but they have to be played carefully IBu iso-butyl in the consideration of their acidities. Other activators like trime- IMP imidazolium perchlorate thylsilyl chloride (TMCS) and 2,4-dinitrophenol (DNP) have also IMT imidazolium triflate been studied and shows good activation properties for the specific IMTFB imidazolium tetrafluoroborate nucleic acid syntheses. i-Pr iso-propyl Although lots of efficient coupling activators have been de- Lev levulinyl veloped and are available to fulfill different synthetic tasks of oli- LNA locked nucleic acid gonucleotides, challenges like raising the efficiency of the synthesis MAC methoxyacetyl of very long oligomers and improving the diastereoselectivity of the MCT 5-mercapto-tetrazole stereocontrolled synthesis remain, and efforts of developing new Me methyl efficient, cheap, and safe activators and the innovative synthetic 4-MeIMT4-(methyl)imidazolium triflate technologies are continued. MMTr mono-p-methoxytrityl MOE methoxyethyl Acknowledgements MTT 5-methylthio-1H-tetrazole N-AcPhIMT The author would like to thank Dr. Xianbin Yang and Dr. Na Li for N-(p-acetylphenyl)imidazolium triflate their support and valuable suggestion. NBT 5-nitrobenzimidazolium triflate N-MeBIT N-(methyl)benzimidazolium triflate Abbreviations N-MeIMT N-(methyl)imidazolium triflate NMI N-methylimidazole Ac acetyl NMR nuclear magnetic resonance ACE bis(2-acetoxyethyloxy)methyl N-PhIMP N-(phenyl)imidazolium perchlorate ACN acetonitrile N-PhIMT N-(phenyl)-imidazolium triflate Activator-42 N-PhIMTFB 5-(bis-3,5-trifluoromethylphenyl)-1H-tetrazole N-(phenyl)imidazolium tetrafluoroborate All allyl NPT 5-nitrophenyl-1H-tetrazole AMA ammonia methylamine ONA oxepane nucleic acid ANA arabino nucleic acid PA 2-phenylacetyl AOC allyloxycarbonyl PAC phenoxyacetyl Az azole PACE phosphonoacetate BIT benzimidazolium triflate PAGE polyacrylamide gel electrophoresis BITFB benzimidazolium tetrafluoroborate PhIMT (phenyl)imidazolium triflate BMT 5-benzyl mercapto-1H-tetrazole Piv pivaloyl BTT 5-benzylthio-1H-tetrazole PivOM pivaloyloxymethyl X. Wei / Tetrahedron 69 (2013) 3615e3637 3635

PS-ODNs oligodeoxyribonucleoside phosphorothioates 34. Lavergne, T.; Bertrand, J.-R.; Vasseur, J.-J.; Debart, F. Chem.dEur. J. 2008, 14, e PS-ORNs oligoribonucleoside phosphorothioates 9135 9138. 35. Scaringe, S. A.; Wincott, F. E.; Caruthers, M. H. J. Am. Chem. Soc. 1998, 120, Px 9-(9-phenyl)xanthenyl 11820e11821. Py pyridinium 36. Dellinger, D. J.; Timar, Z.; Myerson, J.; Sierzchala, A. B.; Turner, J.; Ferreira, F.; PY pyrene Kupihar, Z.; Dellinger, G.; Hill, K. W.; Powell, J. A.; Sampson, J. R.; Caruthers, M. H. J. Am. Chem. Soc. 2011, 133, 11540e11556. RNA ribonucleic acid 37. Nelson, P. S.; Frye, R. A.; Liu, E. Nucleic Acids Res. 1989, 17,7187e7194. (R)-Npeom 38. Damha, M. J.; Giannaris, P. A.; Zabarylo, S. V. Nucleic Acids Res. 1990, 18, (R)-1-(2-nitrophenyl)ethoxymethyl 3813e3821. 39. Alul, R. H.; Singman, C. N.; Zhang, G.; Letsinger, R. L. Nucleic Acids Res. 1991, 19, SMI saccharin 1-methylimidazole 1527e1532. SV scavenger 40. McCollum, C.; Andrus, A. Tetrahedron Lett. 1991, 32, 4069e4072. TBAF tetra-n-butylammonium fluoride 41. Wright, P.; Lloyd, D.; Rapp, W.; Andrus, A. Tetrahedron Lett. 1993, 34, 3373e3376. TBDMS tert-butyldimethylsilyl 42. Tsou, D.; Hampel, A.; Andrus, A.; Vinayak, R. Nucleosides Nucleotides 1995, 14, TBDPS tert-butyldiphenylsilyl 1481e1492. TBS tributylsilyl 43. Caruthers, M. H. Acc. Chem. Res. 1991, 24,278e284. ӧ TC 1,1-dioxo-1l6-thiomorpholine-4-carbothioate 44. K ster, H.; Sinha, N. D. U.S. Patent 4,725,677, 1988. 45. Beaucage, S. L.; Bergstrom, D. E.; Glick, G. D.; Jones, R. A. Current Protocols in TCA trichloroacetic acid Nucleic Acid Chemistry; John Wiley & Sons: New York, 2003. TEA triethylamine 46. Septak, M. Nucleic Acids Res. 1996, 24, 3053e3058. e TFA trifluoroacetic acid 47. Paul, C. H.; Royappa, A. T. Nucleic Acids Res. 1996, 24, 3048 3052. 48. Iyer, R. P.; Egan, W.; Regan, J. B.; Beaucage, S. L. J. Am. Chem. Soc. 1990, 112, THF tetrahydrofuran 1253e1254. thioPACE thiophosphonoacetate 49. Guzaev, A. P. Tetrahedron Lett. 2011, 52, 434e437. TMCS trimethylchlorosilane 50. Xu, Q.; Musier-Forsyth, K.; Hammer, R. P.; Barany, G. Nucleic Acids Res. 1996, 24, 1602e1607. TMS trimethylsilyl 51. Xu, Q.; Barany, G.; Haammer, R. P.; Musier-Forsyth, K. Nucleic Acids Res. 1996, TMSOOTMS 24, 3643e3644. bis(trimethylsilyl)peroxide 52. Ma, M. Y.-X.; Dignam, J. C.; Fong, G. W.; Li, L.; Gray, S. H.; Jacob-Samuel, B.; George, S. T. Nucleic Acids Res. 1997, 25, 3590e3593. TMTr tri-p-methoxytrityl 53. Matteucci, M. D.; Caruthers, M. H. J. Am. Chem. Soc. 1981, 103,3185e3191. TOM tri-iso-propylsilyloxymethyl 54. Reddy, M. P.; Hanna, N. B.; Farooqui, F. Tetrahedron Lett. 1994, 35,4311e4314. Tr trityl 55. Hogrefe, R. I.; Vaghefi, M. M.; Reynolds, M. A.; Young, K. M.; Arnold, L. J., Jr. Nucleic Acids Res. 1993, 21, 2031e2038. UV ultraviolet 56. Zhu, Q.; Delaney, M. O.; Greenberg, M. M. Bioorg. Med. Chem. Lett. 2001, 11, 1105e1107. 57. Vargeese, C.; Carter, J.; Yegge, J.; Krivjansky, S.; Settle, A.; Kropp, E.; Peterson, References and notes K.; Pieken, W. Nucleic Acids Res. 1998, 26,1046e1050. 58. Rajwanshi, V. K.; Hakansson, A. E.; Dahl, B. M.; Wengel, J. Chem. Commun. 1. Uhlmann, E.; Peyman, A. Chem. Rev. 1990, 90, 543e584. 1999, 1395e1396. 2. Mesmaeker, A. D.; Hӓner, R.; Martin, P.; Moser, H. E. Acc. Chem. Res. 1995, 28, 59. Hayakawa, Y.; Kawai, R.; Hirata, A.; Sugimoto, J.; Kataoka, M.; Sakakura, A.; 366e374. Hirose, M.; Noyori, R. J. Am. Chem. Soc. 2001, 123,8165e8176. 3. Beaucage, S. L.; Iyer, R. P. Tetrahedron 1993, 49,6123e6194. 60. Hayakawa, Y.; Kataoka, M.; Noyori, R. J. Org. Chem. 1996, 61, 7996e7997. 4. Sanghvi, Y. S. Org. Process Res. Dev. 2000, 4,168e169. 61. Hayakawa, Y.; Kataoka, M. J. Am. Chem. Soc. 1998, 120, 12395e12401. 5. Crooke, S. T. Curr. Mol. Med. 2004, 4, 465e487. 62. Matray, T. J.; Gryaznov, S. M. Nucleic Acids Res. 1999, 27,3976e3985. 6. Dorsett, Y.; Tuschl, T. Nat. Rev. Drug Discov. 2004, 3,318e329. 63. Gryaznov, S. M.; Winter, H. Nucleic Acids Res. 1998, 26,4160e4167. 7. Gold, L.; Walker, J. J.; Wilcox, S. K.; Williams, S. New Biotechnol. 2012, 29, 64. Maier, M. A.; Choi, Y.; Gaus, H.; Barchi, J. J., Jr.; Marquez, V. E.; Manoharan, M. 543e549. Nucleic Acids Res. 2004, 32,3642e3650. 8. Keefe, A. D.; Pai, S.; Ellington, A. Nat. Rev. Drug Discov. 2010, 9,537e550. 65. Kumar, S.; Hansen, M. H.; Albӕk, N.; Steffansen, S. I.; Petersen, M.; Nielsen, P. J. 9. Amarnath, V.; Broom, A. D. Chem. Rev. 1977, 77,183e217. Org. Chem. 2009, 74, 6756e6769. 10. Beaucage, S. L.; Iyer, R. P. Tetrahedron 1992, 48, 2223e2311. 66. Dahl, B. H.; Nielsen, J.; Dahl, O. Nucleic Acids Res. 1987, 15,1729e1743. 11. Reese, C. B. Tetrahedron 2002, 58, 8893e8920. 67. Berner, S.; Muhlegger,€ K.; Seliger, H. Nucleic Acids Res. 1989, 17, 853e864. 12. Reese, C. B. Org. Biomol. Chem. 2005, 3, 3851e3868. 68. Nurminen, E. J.; Mattinen, J. K.; Lӧnnberg, H. Helv. Chim. Acta 2003, 86, 13. Beaucage, S. L.; Caruthers, M. H. Tetrahedron Lett. 1981, 22, 1859e1862. 2005e2008. 14. McBride, L. J.; Caruthers, M. H. Tetrahedron Lett. 1983, 24, 245e248. 69. Korkin, A. A.; Tsvetkov, E. N. Bull. Soc. Chim. Fr. 1988,335e338. 15. Sinha, N. D.; Biernat, J.; Kӧster, H. Tetrahedron Lett. 1983, 24, 5843e5846. 70. Korkin, A. A.; Tsvetkov, E. N. Russ. J. Gen. Chem. 1987, 57, 1929e1932. 16. Dӧrper, T.; Winnacker, E. Nucleic Acids Res. 1983, 11,2575e2584. 71. Finnegan, W. G.; Henry, R. A.; Lofquist, R. J. Am. Chem. Soc. 1958, 80, 17. Adams, S. P.; Kavka, K. S.; Wykes, E. J.; Holder, S. B.; Galluppi, G. R. J. Am. Chem. 3908e3911. Soc. 1983, 105,661e663. 72. Demko, Z. P.; Sharpless, K. B. J. Org. Chem. 2001, 66, 7945e7950. 18. Fourrey, J.-L.; Varenne, J. Tetrahedron Lett. 1983, 24, 1963e1966. 73. Froehler, B. C.; Matteucci, M. D. Tetrahedron Lett. 1983, 24,3171e3174. 19. Fourrey, J.-L.; Varenne, J. Tetrahedron Lett. 1984, 25,4511e4514. 74. Kaczmarek, J.; Smagowski, H.; Grzonka, Z. J. Chem. Soc., Perkin Trans. 2 1979, 20. Beaucage, S. L. Tetrahedron Lett. 1984, 25,375e378. 1670e1674. 21. Sinha, N. D.; Biernat, J.; McManus, J.; Kӧster, H. Nucleic Acids Res. 1984, 12, 75. Sproat, B. S.; Lamond, A. I.; Beijer, B.; Neuner, P.; Ryder, U. Nucleic Acids Res. 4539e4557. 1989, 17, 3373e3386. 22. Scaringe, S. A.; Francklyn, C.; Usman, N. Nucleic Acids Res. 1990, 18, 5433e5441. 76. Pon, R. T. Tetrahedron Lett. 1987, 28,3643e3646. 23. Fisher, E. F.; Caruthers, M. H. Nucleic Acids Res. 1983, 11, 1589e1599. 77. Hayakawa, Y.; Kataoka, M. J. Am. Chem. Soc. 1997, 119, 11758e11762. 24. Taunton-Rigby, A.; Kim, Y. H.; Crosscup, C. J.; Starkovsky, N. A. J. Org. Chem. 78. Rao, M. V.; Reese, C. B.; Schehlmann, V.; Yu, P. S. J. Chem. Soc., Perkin Trans. 1 1972, 37, 956e964. 1993,43e55. 25. Smith, M.; Rammler, D. H.; Goldberg, I. H.; Khorana, H. G. J. Am. Chem. Soc. 79. Wolter, A.; Leuck, M. U.S. Patent 0,247,431, 2006. 1962, 84, 430e440. 80. Threlfall, R. N.; Torres, A. G.; Krivenko, A.; Gait, M. J.; Caruthers, M. H. Org. 26. Schulhof, J. C.; Molko, D.; Teoule, R. Nucleic Acids Res. 1987, 15,397e416. Biomol. Chem. 2012, 10,746e754. 27. McBride, L. J.; Kierzek, R.; Beaucage, S. L.; Caruthers, M. H. J. Am. Chem. Soc. 81. Karmakar, S.; Anderson, B. A.; Rathje, R. L.; Andersen, S.; Jensen, T. B.; Nielsen, P.; 1986, 108, 2040e2048. Hrdlicka, P. J. J. Org. Chem. 2011, 76,7119e7131. 28. Oivanen, M.; Kuusela, S.; Lӧnnberg, H. Chem. Rev. 1998, 98,961e990. 82. Wincott, F.; DiRenzo, A.; Shaffer, C.; Grimm, S.; Tracz, D.; Workman, C.; 29. Usman, N.; Ogilvie, K. K.; Jiang, M. Y.; Cedergren, R. J. J. Am. Chem. Soc. 1987, Sweedler, D.; Gonzalez, C.; Scaringe, S.; Usman, N. Nucleic Acids Res. 1995, 23, 109, 7845e7854. 2677e2684. 30. Pitsch, S.; Weiss, P. A.; Jenny, L.; Stutz, A.; Wu, X. Helv. Chim. Acta 2001, 84, 83. Zhang, N.; Tan, C.; Cai, P.; Jiang, Y.; Zhang, P.; Zhao, Y. Tetrahedron Lett. 2008, 3773e3795. 49,3570e3573. 31. Westman, E.; Strӧmberg, R. Nucleic Acids Res. 1994, 22,2430e2431. 84. Sabatino, D.; Damha, M. J. J. Am. Chem. Soc. 2007, 129, 8259e8270. 32. Semenyuk, A.; Fӧldesi, A.; Johansson, T.; Estmer-Nilsson, C.; Bolmgren, P.; 85. Ittig, D.; Liu, S.; Renneberg, D.; Schumperli,€ D.; Leumann, C. J. Nucleic Acids Res. Brӓnnvall, M.; Kirsebom, L. A.; Kwiatkowski, M. J. Am. Chem. Soc. 2006, 128, 2004, 32, 346e353. 12356e12357. 86. Haziri, A. H.; Leumann, C. J. J. Org. Chem. 2012, 77, 5861e5869. 33. Ohgi, T.; Masutomi, Y.; Ishiyama, K.; Kitagawa, H.; Shiba, Y.; Yano, J. Org. Lett. 87. Welz, R.; Muller,€ S. Tetrahedron Lett. 2002, 43, 795e797. 2005, 7,3477e3480. 88. Wu, X.; Pitsch, S. Nucleic Acids Res. 1998, 26,4315e4323. 3636 X. Wei / Tetrahedron 69 (2013) 3615e3637

89. Pitsch, S.; Weiss, P. A.; Wu, X.; Ackermann, D.; Honegger, T. Helv. Chim. Acta 115. Tsukamoto, M.; Hayakawa, Y. In Frontiers in Organic Chemistry; Atta-ur-Rahman, 1999, 82, 1753e1761. Ed.; Bentham Science: Karachi, 2005; Vol. 1, pp 3e40. 90. Cieslak, J.; Grajkowski, A.; Kauffman, J. S.; Duff, R. J.; Beaucage, S. L. J. Org. 116. Hayakawa, Y.; Hirata, A.; Sugimoto, J.; Kawai, R.; Sakakura, A.; Kataoka, M. Chem. 2008, 73, 2774e2783. Tetrahedron 2001, 57, 8823e8826. 91. Parey, N.; Baraguey, C.; Vasseur, J.-J.; Debart, F. Org. Lett. 2006, 8, 3869e3872. 117. Iwai, S.; Mizukoshi, T.; Fujiwara, Y.; Masutani, C.; Hanaoka, F.; Hayakawa, Y. 92. Shiba, Y.; Masuda, H.; Watanabe, N.; Ego, T.; Takagaki, K.; Ishiyama, K.; Ohgi, T.; Nucleic Acids Res. 1999, 27, 2299e2303. Yano, J. Nucleic Acids Res. 2007, 35, 3287e3296. 118. Kataoka, M.; Kawai, R.; Hayakawa, Y. Nucleic Acids Symp. Ser. 1999, 42, 93. Salon, J.; Jiang, J.; Sheng, J.; Gerlits, O. O.; Huang, Z. Nucleic Acids Res. 2008, 36, 105e106. 7009e7018. 119. Sakakura, A.; Kataoka, M.; Kawai, R.; Hayakawa, Y. Nucleic Acids Symp. Ser. 94. Reddy, K. S. U.S. Patent 7,339,052 B2, 2008. 2000, 44,137e138. 95. Yao, O. 50-Methylthio-1H-tetrazole. Encyclopedia of Reagents for Organic 120. Hirata, A.; Sugimoto, J.; Kawai, R.; Kataoka, M.; Hayakawa, Y. Nucleic Acids Res. Synthesis; John Wiley & Sons, 2003. Suppl. 2001, 1,215e216. 96. Berressem, R.; Engels, J. W. Nucleic Acids Res. 1995, 23, 3465e3472. 121. Zhong, M.; Strobel, S. A. Org. Lett. 2006, 8,55e58. 97. Eﬁmov, V. A.; Kalinkina, A. L.; Chakhmakhcheva, O. G. Russ. J. Bioorg. Chem. 122. Sekine, M.; Ohkubo, A.; Seio, K. J. Org. Chem. 2003, 68,5478e5492. 1996, 22,128e130. 123. Sinha, N. D.; Foster, P.; Kuchimanchi, S. N.; Miranda, G.; Shaikh, S.; Michaud, D. 98. Oka, N.; Wada, T. Chem. Soc. Rev. 2011, 40, 5829e5843. Nucleosides, Nucleotides, Nucleic Acids 2007, 26,1615e1618. 99. Hirose, M.; Kawai, R.; Hayakawa, Y. Synlett 1997, 495e497. 124. McCormac, P. U.S. Patent 0,149,052, 2006. 100. Wang, Z.; Siwkowski, A.; Lima, W. F.; Olsen, P.; Ravikumar, V. T. Bioorg. Med. 125. Sinha, N.; Zedalis, W. E.; Miranda, G. K. U.S. Patent 0,041,114 A1, 2006. Chem. 2006, 14, 5049e5060. 126. Russell, M. A.; Laws, A. P.; Atherton, J. H.; Page, M. I. Org. Biomol. Chem. 2008, 6, 101. Sabbagh, G.; Fettes, K. J.; Gosain, R.; O’Neil, I. A.; Cosstick, R. Nucleic Acids Res. 3270e3275. 2004, 32, 495e501. 127. Oka, N.; Wada, T.; Saigo, K. J. Am. Chem. Soc. 2002, 124, 4962e4963. 102. Lackey, J. G.; Mitra, D.; Somoza, M. M.; Gerrina, F.; Damha, M. J. J. Am. Chem. 128. Oka, N.; Wada, T.; Saigo, K. J. Am. Chem. Soc. 2003, 125, 8307e8317. Soc. 2009, 131, 8496e8502. 129. Oka, N.; Yamamoto, M.; Sato, T.; Wada, T. J. Am. Chem. Soc. 2008, 130, 103. Seth, P. P.; Yu, J.; Jazayeri, A.; Pallan, P. S.; Allerson, C. R.; éstergaars, M. E.; Liu, F.; 16031e16037. Herdewijin, P.; Egli, M.; Swayze, E. E. J. Org. Chem. 2012, 77,5074e5085. 130. Oka, N.; Kondo, T.; Fujiwara, S.; Maizuru, Y.; Wada, T. Org. Lett. 2009, 11, 104. Jin, Y.; Just, G. J. Org. Chem. 1998, 63, 3647e3654. 967e970. 105. Lu, Y.; Just, G. Tetrahedron Lett. 2000, 41, 9223e9227. 131. Hayakawa, Y.; Iwase, T.; Nurminen, E. J.; Tsukamoto, M.; Kataoka, M. Tetrahe- 106. Seio, K.; Kumura, K.; Bologna, J.-C.; Sekine, M. J. Org. Chem. 2003, 68, dron 2005, 61, 2203e2209. 3849e3859. 132. Reddy, M. P.; Farooqui, F. U.S. Patent 5,574,146, 1996. 107. Zhang, Z.; Tang, J. Y. Tetrahedron Lett. 1996, 37,331e334. 133. Tsukamoto, M.; Nurminen, E. J.; Iwase, T.; Kataoka, M.; Hayakawa, Y. Nucleic 108. Beier, M.; Pﬂeiderer, W. Helv. Chim. Acta 1999, 82, 879e887. Acids Symp. Ser. 2004, 48,25e26. 109. Sanghvi, Y. S.; Guo, Z.; Pfundheller, H. M.; Converso, A. Org. Process Res. Dev. 134. Wang, C. X. Canadian Patent 2,376,016, 2000. 2000, 4,175e181. 135. Cypryk, M.; Chojnowski, J.; Michalski, J. Tetrahedron 1985, 41,2471e2477. 110. Manoharan, M.; Ravikumar, V. T. U.S. Patent 6,642,373, B2, 2003. 136. Dabkowski, W.; Tworowska, I.; Michalski, J.; Cramer, F. Chem. Commun. 1997, 111. Gryaznov, S. M.; Letsinger, R. L. J. Am. Chem. Soc. 1991, 113, 5876e5877. 877e878. 112. Eleuteri, A.; Capaldi, D. C.; Krotz, A. H.; Cole, D. L.; Ravikumar, V. T. Org. Process 137. Dabkowski, W.; Michalski, J. Heterocycles 2009, 79, 265e276. Res. Dev. 2000, 4,182e189. 138. Dabkowski, W.; Tworowska, I.; Michalski, J.; Cramer, F. Tetrahedron Lett. 2000, 113. Dueymes, C.; Schonberger,€ A.; Adamo, I.; Navarro, A.-E.; Meyer, A.; Lange, M.; 41, 7535e7539. Imbach, J.-L.; Link, F.; Morvan, F.; Vasseur, J.-J. Org. Lett. 2005, 7, 3485e3488. 139. Smith, G.; Bott, R. C.; Wermuth, U. D. Acta Crystallogr., Sect. C: Cryst. Struct. 114. Ngo, N. Q.; Jaquinod, L. U.S. Patent 7,579,459, B2, 2009. Commun. 2000, C56, 1505e1506. X. Wei / Tetrahedron 69 (2013) 3615e3637 3637

Biographical sketch

Xia Wei received her B.S. and M.S degrees in chemistry from Sichuan University, China in 1998 and 2002. She completed her Ph.D. degree in Chemistry under the guidance of Dr. Michael J. Fuertes from Texas Tech University in 2010. She then became a joint Re- search Associate at AM Biotechnologies, LLC and the University of Houston-Clear Lake from 2011 to 2012. She is presently working as a Research Scientist at Ebonite Interna- tional Inc. 本文献由“学霸图书馆-文献云下载”收集自网络，仅供学习交流使用。

学霸图书馆（www.xuebalib.com）是一个“整合众多图书馆数据库资源，

提供一站式文献检索和下载服务”的24 小时在线不限IP 图书馆。图书馆致力于便利、促进学习与科研，提供最强文献下载服务。

图书馆导航：

图书馆首页文献云下载图书馆入口外文数据库大全疑难文献辅助工具