CD4 T Cell Interaction with Intestinal Microbes Under Homeostasis and Inflammation Jiani Chai Washington University in St

Washington University in St. Louis Washington University Open Scholarship

Arts & Sciences Electronic Theses and Dissertations Arts & Sciences

Summer 8-15-2018 CD4 T Cell Interaction with Intestinal Microbes under Homeostasis and Inflammation Jiani Chai Washington University in St. Louis

Follow this and additional works at: https://openscholarship.wustl.edu/art_sci_etds Part of the Allergy and Immunology Commons, Immunology and Infectious Disease Commons, and the Medical Immunology Commons

Recommended Citation Chai, Jiani, "CD4 T Cell Interaction with Intestinal Microbes under Homeostasis and Inflammation" (2018). Arts & Sciences Electronic Theses and Dissertations. 1613. https://openscholarship.wustl.edu/art_sci_etds/1613

This Dissertation is brought to you for free and open access by the Arts & Sciences at Washington University Open Scholarship. It has been accepted for inclusion in Arts & Sciences Electronic Theses and Dissertations by an authorized administrator of Washington University Open Scholarship. For more information, please contact [email protected]. WASHINGTON UNIVERSITY IN ST. LOUIS

Division of Biology and Biomedical Sciences Immunology

Dissertation Examination Committee: Chyi-Song Hsieh, Chair Paul Allen Marco Colonna Takeshi Egawa Thaddeus Stappenbeck

CD4 T Cell Interaction with Intestinal Microbes under Homeostasis and Inflammation by Jiani Chai

A dissertation presented to The Graduate School of Washington University in partial fulfillment of the requirements for the degree of Doctor of Philosophy

August 2018 St. Louis, Missouri

Table of Contents List of Figures ...... iii

List of Tables ...... iv

List of Abbreviations ...... v

Acknowledgments ...... vii

Abstract of the dissertation...... ix

Chapter 1: Introduction ...... 1

Chapter 2: Helicobacter species induce pTreg cell differentiation during homeostasis ...... 14

2.1 Abstract ...... 14

2.2 Introduction ...... 15

2.3 Materials and Methods ...... 18

2.4 Results ...... 24

2.5 Discussion ...... 28

2.6 Figures ...... 30

Chapter 3: Characterization of T cell response to gut microbes in inflammation ...... 41

3.1 Abstract ...... 41

3.2 Introduction ...... 42

3.3 Materials and Methods ...... 44

3.4 Results ...... 53

3.5 Discussion ...... 60

3.6 Figures ...... 63

3.7 Tables ...... 85

Chapter 4: Concluding Remarks and Future Directions ...... 88

References ...... 91

List of Figures Figure 2.1 Colonic Treg TCRs react to mucosal-associated Helicobacter species...... 31 Figure 2.2 Reactivity of colonic Treg TCRs to mucosal-associated Helicobacter species is MHCII dependent...... 32 Figure 2.3 CT2/CT6/CT9/T7-1 TCRs do not react to other bacterial isolates tested...... 35 Figure 2.4 Helicobacter species induce peripheral Treg cell differentiation during homeostasis...... 37 Figure 2.5 Gating strategy and confirmation of Helicobacter spp. inoculation in Figure 2.4B...... 39 Figure 2.6 Relative expansion of pTregs in Helicobacter-colonized mice...... 40 Figure 3.1 Colonic Treg TCRs (CT2 and CT6) drive effector T cell development in inflammation...... 63 Figure 3.2 DSS+IL10R treatment induces colitis and effector T cell responses...... 66 Figure 3.3 Effects of DSS+IL10R-mediated colitis on the TCR repertoire...... 68 Figure 3.4 Treg and Teff subsets show increased TCR overlap during colitis...... 70 Figure 3.5 CBir1 TCR Tg cells become Teff, and not Treg, cells during DSS+IL10R colitis. 71 Figure 3.6 DSS+αIL10R colitis is associated with differential changes of bacterial composition in the lumen and mucosa...... 74 Figure 3.7 Quantification of 16S rRNA gene abundance in the lumen or MA preparation.... 75 Figure 3.8 Expansion of Bacteroides species during colitis does not enhance TCR-specific T cell responses...... 76 Figure 3.9 Specificity of DP1/NT2/CT7 TCRs for Bacteroides spp...... 78 Figure 3.10 Pathogenic potential of naive Helicobacter-reactive CT6 cells in lymphopenic mice...... 79 Figure 3.11 Bacterial-specific induction of colitis by CT2 in lymphopenic mice...... 81 Figure 3.12 Helicobacter spp are detected in fecal and colonoscopy samples from IBD patients...... 83

iii

List of Tables Table 3.1 TRAV Multiplex primer sequences...... 86

Table 3.2 TRAV designation, CDR3 amino acid (a.a.) sequences, and in vitro bacterial reactivity of indicated TCR clones...... 87

List of Abbreviations

Altered Schaedler flora (ASF)

Antigen-presenting cells (APCs)

Anti-IL-10R antibody (αIL10R)

Bacteroides (B.)

Brain-heart-infusion (BHI)

Cell Trace Violet (CTV)

Colon lamina propria (cLP)

Conserved noncoding sequence-1 (CNS-1)

Crohn’s disease (CD)

Dendritic cells (DCs)

Dextran sodium sulfate (DSS)

Distal mesenteric lymph node (dMLN)

Effector T (Teff) cells

Fluorescence-activated cell sorting (FACS)

Germ-free (GF)

Helicobacter (H.)

Inflammatory bowel disease (IBD)

Myeloid differentiation primary response gene 88 (MyD88)

Mucosal-associated (MA)

Neuropilin-1 (Nrp-1)

Operational Taxonomic Units (OTUs)

Phosphate-buffered saline (PBS)

Polysaccharide A (PSA)

Regulatory T (Treg) cells

Retinal dehydrogenase (RALDH)

Retinoic acid (RA)

Ribosomal RNA (rRNA)

Segmented filamentous bacteria (SFB)

Short-chain fatty acids (SCFAs)

Specific-pathogen-free (SPF)

T cell receptor (TCR)

TCR alpha joining (TRAJ)

TCR alpha variable (TRAV)

Toll-like receptors (TLRs)

Toxoplasma gondii (T. gondii)

Transgenic (Tg)

Ubiquitin-like, with pleckstrin-homology and RING-finger domains 1 (Uhrf1)

Ulcerative colitis (UC)

Acknowledgments

I would first like to thank my mentor, Chyi Hsieh, for his guidance throughout my time in graduate school. He trained me to think independently, to design experiments to test hypothesis, to troubleshoot and find alternative solutions, and to interpret and present data, all of which are important for me to become an independent researcher. I greatly appreciate his patience and enthusiasm in teaching, as well as the unique resources in his lab for me to pursue interesting scientific questions.

I would also like to thank the Hsieh lab members, both present and past. Every one of them has helped me, either through direct technical help or through sharing ideas. I greatly appreciate their support, and would not have enjoyed graduate school nearly as much without their company.

I would additionally like to thank our collaborators who made this work possible by sharing their expertise and knowledge, especially the Fox, Stappenbeck,

Kau, and Newberry labs.

Many thanks are also due to my thesis committee members. They offered very thoughtful advice and questions that helped to make this work better. They also gave their time and advice outside of committee meetings whenever I had questions.

vii

Last, but not least, I would like to thank my friends and family. I am grateful for

their love and support. I wound not be able to finish this whole journey without

them.

Jiani Chai

Washington University in St. Louis

August 2018

viii

ABSTRACT OF THE DISSERTATION

CD4 T Cell Interaction with Intestinal Microbes under Homeostasis and Inflammation

Jiani Chai

Doctor of Philosophy in Biology and Biomedical Sciences

Immunology

Washington University in St. Louis, 2018

Professor Chyi-Song Hsieh, Chair

Specific gut commensal bacteria improve host health by eliciting mutualistic regulatory T

(Treg) cells responses. However, the bacteria that induce effector T (Teff) cells during inflammation are unclear. Here, we addressed this by analyzing bacterial-reactive T cell receptor

(TCR) transgenic cells and TCR repertoires in a murine colitis model. Unexpectedly, we found that mucosal-associated Helicobacter species triggered both Treg responses during homeostasis and Teff responses during colitis, as suggested by an increased overlap between the Teff/Treg

TCR repertoires with colitis. In fact, 4/6 Treg TCRs tested recognized mucosal-associated

Helicobacter species in vitro and in vivo. By contrast, the marked expansion of luminal

Bacteroides species seen during colitis did not trigger a commensurate Teff response. Unlike other

Treg cell-inducing bacteria, Helicobacter species are known pathobionts and cause disease in

immunodeficient mice. Thus, our study suggests a model in which mucosal bacteria elicit context-dependent Treg or effector cell responses to facilitate intestinal tolerance or inflammation.

Chapter 1: Introduction

Trillions of commensal bacteria cohabit our bodies to mutual benefit. In the past several years, it has become clear that the adaptive immune system is not ignorant of intestinal commensal bacteria, but is constantly interacting with them. For T cells, the response to commensal bacteria does not appear uniform, as certain commensal bacterial species appear to trigger Teff cells to reject and control them, whereas other species elicit Foxp3+ Treg cells to accept and be tolerant of them. However, the specificity of intestinal Treg and Teff cells, and how these T cells respond to gut bacteria under different microenvironment remain largely unclear. In this thesis, we analyzed the antigen-specificity of colonic Treg and Teff TCR repertoire in mouse model, identified Helicobacter-reactive TCRs, and studied the differentiation of bacterial-specific T cell during homeostasis and under colonic inflammation.

Regulatory T cells play a crucial role in maintaining tolerance to commensal bacteria

The intestines are home to hundreds of commensal bacterial species that provide many benefits to the host, including important contributions to the metabolism of food1. However, as commensal bacteria are foreign to the host, they can trigger unwanted immune responses such as inflammatory bowel disease (IBD)2. Yet, the gastrointestinal tract is also an important portal for

bacterial infections. Thus, the immune system must protect against pathogenic bacteria while avoiding inappropriate immune responses to commensal bacteria.

Although the mucosal lining of the intestine provides an important protective barrier against commensal bacteria, it has become clear that this barrier is imperfect, resulting in a need for immune tolerance to gut antigens. One of the first clues came from early studies showing that a subset of CD4+ T cells3, now known to be Foxp3+ Treg cells, is required to prevent other CD4+

T cells from inducing colitis upon transfer into lymphopenic hosts (reviewed in 4,5). Subsequent studies showed that commensal bacteria are important for driving intestinal pathology in the context of Treg cell deficiency. For example, ablation of IL-2 leads to a loss of Treg cell number and function, which results in a variety of immunopathology6. However, only colitis is markedly reduced in germ-free (GF) IL-2-deficient mice7–9. Similarly, GF conditions limit colitis, but not other inflammatory manifestations, that arise with depletion of Foxp3+ cells in Foxp3DTR mice10, or with T cell deletion of Uhrf1 (Ubiquitin-like, with pleckstrin-homology and RING-finger domains 1), an epigenetic regulator that facilitates colonic Treg proliferation and maturation11.

As memory T cells from conventionally housed mice are more efficient at inducing colitis12, these data suggest that Treg cells act to restrain normal effector responses to commensal bacteria.

Thus, Treg cells are important in establishing a tolerogenic environment to maintain immune homeostasis to commensal bacteria in the intestine.

Substantial progress has been made in the past several years regarding the origin and specificity of Treg cells involved in intestinal tolerance. Although it is still debated13, several lines of evidence suggest that colonic Treg cells arise primarily from peripheral Treg cell differentiation from naïve T cells (pTreg,14,15), as opposed to arising from the thymus during T cell development (tTreg,16,17). First, adoptive transfer of naïve T cells into normal hosts suggested that the intestines are sites that facilitate peripheral Treg cell selection18. Second, markers that may distinguish thymic Treg cells such as high expression of Helios or Neuropilin-1

(Nrp-1) imply that ~80% of colonic Treg cells arise from peripheral selection19–21. Third, one T cell receptor (TCR) repertoire study suggested that most colonic Treg TCRs do not facilitate thymic Treg cell selection22. Fourth, a study of Foxp3-deficient mice devoid of Treg cells revealed that adoptive transfer of natural Treg cells was not sufficient to restore immune homeostasis, and required transfer of Foxp3– cells capable of undergoing peripheral Treg cell selection23. Finally, studies of the Foxp3 locus revealed that mice deficient in conserved noncoding sequence-1 (CNS-1) had fewer Treg cells in the intestine, which was correlated with a defect in peripheral Treg cell selection24,25. Taken together, these data support an important role for peripheral Treg cell selection in the gut.

However, other reports have argued against this interpretation. For example, the sensitivity and specificity of markers of thymic versus peripheral Treg cell selection such as

Helios has been called into question26–28. Moreover, a different TCR repertoire study suggested

that most colonic Treg cells are of thymic origin based on cross-referencing TCR sequences29.

While future experiments are required to determine the exact proportions of pTreg versus tTreg in the colon, it is clear that the intestines are enriched in pTreg cells relative to other tissues in the body.

In regards to the antigen specificity of colonic Treg cells, recent studies suggest that they are often reactive to commensal bacteria. First, several studies reported that some, but not all, bacterial species can increase the frequency of Treg cells in the gut. For example,

Clostridium clusters XIVa and IV30,31 or altered Schaedler flora (ASF)32 introduced into GF mice markedly increased the frequency of colonic Treg cells. Lactobacillus reuteri 33 has also been associated with increased Treg cell percentage in the intestines. Second, analyses of TCR repertoires suggested that a substantial fraction and perhaps the majority of colonic Treg TCRs recognize commensal bacterial antigens. Since the TCR repertoire is extremely complex, mice with limited TCR repertoires were used to assess the colonic Treg TCR repertoire22,34. In these studies, it was observed that colonic Treg cells utilized TCRs that were different than those used by Treg cells in other tissues or secondary lymphoid organs22,34. Further analysis of colonic Treg

TCRs revealed direct recognition of antigens present in colonic contents, or in several cases, individual bacterial isolates22,34. Consistent with TCR recognition of commensal bacterial antigens, antibiotic treatment could markedly change the colonic Treg repertoire34, Taken

together, this body of evidence strongly suggests that commensal bacteria routinely trigger antigen specific Treg cell responses.

Effector cell generation to commensal bacteria

Despite the plethora of intestinal factors that favor Treg cell differentiation or expansion,

Treg cells represent only 20-40% of CD4+ T cells in the colon. Effector cells therefore represent the dominant T cell population within the intestine during homeostasis35,36. The generation of effecter T cell subsets in the intestine has been associated with signals derived from commensal bacteria, as GF mice harbor fewer Th1 and Th17 cells compared to conventionally housed mice12,37. Also, DNA from gut bacteria plays an important role in the induction of gut resident

Th1 and Th17 cells at steady state through the engagement of TLR938. Thus, the generation of intestinal effector T cell population is clearly influenced by the commensal bacteria.

It is less clear, however, whether intestinal effector T cells recognize commensal bacterial antigens. Indirect support comes from the observation that effector T cells induced in the presence of commensal bacteria are more efficient at inducing colitis than cells from GF mice12.

However, this does not necessarily mean that effector cells are specific to commensal bacteria, as bacterial products may also cause antigen-non-specific changes in the environment that affect T cell trafficking, differentiation, and function. Direct support for commensal-specific effector cell generation comes from murine studies of Th17 cells, which were shown to be critically

dependent on a single bacterial species–segmented filamentous bacteria (SFB)39. SFB is a spore-forming Gram-positive anaerobe residing primarily in the terminal ileum that makes intimate interaction with the mucosal barrier through tight attachments to epithelial cells. This interaction is a unique feature of SFB compared with other commensal bacteria that may underlie its ability to elicit Th17 cells. Recently, it was shown that the majority of Th17 cells are specific to SFB antigens40,41, suggesting that SFB provides both the dominant T cell epitopes as well as signals that facilitate Th17 differentiation. Thus, both Treg and effector cells can be elicited to commensal bacteria.

Effector versus regulatory T cell selection

The induction of both Treg and effector cells by commensal bacteria raises a fundamental question as to how the immune system determines Treg versus effector cell selection to bacterial antigens. Available data suggests that this is not a stochastic process, but may be instructed by specific bacterial species. For example, Th17 selection to SFB is not accompanied by Treg selection, as SFB-specific TCR transgenic cells become mostly RORt+ and not Foxp3+ cells40.

Similarly, it has been reported that CD44hi effector T cells utilize different TCRs than Treg cells22, indicating cell-fate determination based on TCR specificity.

The usage of different TCRs between Treg and effector cells could suggest that a biophysical property of TCR interaction with peptide:MHC, such as affinity or the amount of

antigen, may determine peripheral T cell selection42,43. In addition, recent studies indicate that environmental factors contribute to peripheral T cell differentiation to commensal bacteria. For example, SFB-specific TCR transgenic cells undergo Th1, and not Th17, development when their cognate antigen is expressed by Listeria and not SFB40. Moreover, TCR transgenic cells specific for the commensal CBir1 flagellin antigen adopt a Th1 phenotype upon infection with

Toxoplasma gondii (T. gondii), but a Th17 phenotype after dextran sodium sulfate (DSS) injury44.

Although studies of Treg versus effector cell differentiation to commensal bacteria are currently unavailable, OT-II TCR transgenic cells undergo peripheral Treg cell development in response to oral feeding of cognate antigen18,45, whereas they undergo effector cell generation in the context of infection46. Therefore, TCR affinity for antigen, antigen dose, and the cytokine milieu may all contribute to the signals that direct T cell lineage commitment.

Innate stimulators from commensal bacteria may direct T cell differentiation via selective activation of cytokine production from antigen-presenting cells (APCs) by Toll-like receptors

(TLRs), which are important sensors that recognize conserved molecular motifs on bacteria.

TLRs have been suggested to promote pro-inflammatory effector responses. For instance, mice deficient in MyD88 (Myeloid differentiation primary response gene 88), an important signaling component for many TLRs, are relatively resistant to intestinal inflammation resulting from Treg cell47 or IL-1048 deficiency. Consistent with these observations, TLR9 sensing of commensal

DNA has been suggested to favor intestinal effector (Th1/Th17) rather than Treg development49.

However, a role for TLRs in Treg selection has also been suggested. TLR2 signaling has been reported to induce IL-10 and RA to promote Treg cell selection50. DNA of the probiotic

Lactobacillus species is enriched in suppressive motifs that signal through TLR9 to prevent dendritic cell (DC) activation and maintain Treg-cell conversion during inflammation51.

Moreover, Bacteroides fragilis (B. fragilis) polysaccharide A (PSA) can trigger TLR2 signaling on Treg cells to induce IL-10 expression and promote tolerance52. One explanation for some of these contrasting reports is that TLRs are found on many cell types and contribute to facets of intestinal homeostasis not directly related to T cell differentiation signals, including epithelial integrity53. Thus, while it is likely that TLRs play an important role in T cell responses to commensal bacteria, their precise function in determining peripheral T cell differentiation to specific bacterial species remains to be determined.

APC subsets have also been implicated in Treg versus effecter cell determination54,55.

Lamina propria DC subsets may provide different cytokine environments that favor Treg versus

Th17 selection. As discussed above, CD103+ DCs have been suggested to favor Treg cell selection via production of retinoic acid (RA) and transforming growth factor β (TGFβ).

Interestingly, the CD11b+ subset of CD103+ DCs have been found to be potent producers of IL-6 and IL-23 that favor Th17 differentiation49,58,59. Consistent with these observations, genetic depletion of the CD103+CD11b+ DC subset showed a decrease in Th17 cells59–61, whereas depletion of both CD11b+ and CD11b– subsets of CD103+ DCs were required to see a decrease in

the number of Treg cells62. However, it is unclear whether the impact on the number of Th17 versus Treg cells is related to specific response to bacteria species or global effects on the overall cytokine environment, as the decreased number of Th17 cells was independent of MHC II expression on the CD103+CD11b+ cells62.

Other types of APC have also been described to be involved in gut homeostasis63.

Macrophages, perhaps via cytokine production, can affect the regulatory to effector cell balance in the gut64,65. Recently, another cell type in addition to the traditional APCs (DCs and macrophages) has been suggested to perform an antigen presenting role in the gut. Innate lymphoid cells (ILCs) were recently shown to express MHC II and negatively regulate CD4+ T cell responses66. However, instead of inducing Treg cells, it was suggested that ILC antigen presentation inhibits the differentiation of effector T cells via an unknown mechanism.

In summary, there are many parameters that can control T cell differentiation to commensal bacteria. There are local factors such as TLR ligands, access to mucus, and different

APC subsets that differentially favor Treg versus effector cell selection. Moreover, it is possible that some global factors are also modulated at the local level, and vice versa. Anatomic factors, such as small intestine versus colon may also play a role by affecting the resident bacterial constituents (e.g. SFB is mostly ileal), mucus amount and composition, mucosal barrier function, and APC types. Thus, much remains to be discovered regarding how individual commensal

bacterial species trigger the specific mechanisms that determine Treg versus effector T cell differentiation.

How is tolerance to commensal bacteria broken?

For most individuals, tolerance to commensal bacteria remains intact throughout their lifetime. However, approximately 0.44 % of individuals break tolerance and develop IBD67.

Genome wide association studies (GWAS) have clearly identified a number of genetic risk factors for IBD that affect intestinal epithelial function, general immune regulation, and innate immune function68,69. Defects in non-T cell related genes may increase bacterial translocation or outgrowth, triggering an inflammatory response from otherwise normal T cells. Defects in T cell related genes, such as HLA, suggest that T cell interactions with commensal bacteria may also be abnormal in IBD70. Thus, breakage in T cell tolerance to commensal bacteria could include a primary T cell defect or arise secondary to other perturbations of intestinal immune homeostasis.

In addition to genetic factors, an intriguing question is whether environmental insults can break tolerance. This is suggested by the observation that IBD is increasing in geographic areas such as North America71. An increased risk of IBD has also been associated with recent gastrointestinal infections72. While commensal bacterial exposure during mucosal breaches may be reduced by a containment structure referred to as intraluminal cast comprised of monocytes and neutrophils73, intestinal infections can expose the immune system to a variety of commensal

bacteria74. Moreover, gut infections are associated with dysbiosis with significant shifts in microbiota composition. For example, -proteobacteria can become dominant due to their ability to thrive under inflammatory condition75,76. Thus, infection may result in the exposure to the immune system of previously encountered commensals as well as those that typically do not have access during homeostasis.

A recent study convincingly showed that exposure of commensals to the immune system can occur during mucosal breaches44. They used CBir TCR transgenic T cells that recognize flagellin expressed by certain commensals including the Clostridium cluster XIV class of bacteria. Interestingly, these T cells typically possess a naïve phenotype during homeostasis, suggesting that they are not routinely exposed to antigen. However, barrier breach results in their development into Th1 cells during a highly Th1 polarizing T. gondii infection, or Th17 cells after

DSS administration. These T cells persist long term in both the intestinal and secondary lymphoid tissues, and respond like memory T cells upon rechallenge. Although physical segregation between the microbiota and immune system is rapidly restored after resolution of infection, the long-term presence of commensal-specific memory T cells may fundamentally alter the balance of tolerance. One could speculate that over time, multiple infections may lead to the expansion of commensal-bacteria reactive effector T cells, potentially leading to a feed-forward loop in which these T cells can themselves overwhelm Treg cells and cause enough

inflammation to lead to barrier breach and further antigen presentation77. This could create a chronic and self-sustaining inflammatory state, perhaps culminating in IBD.

And yet, intestinal infections associated with diarrhea are common and often do not trigger IBD78,79. Nor do other intestinal disorders such as diverticulitis or appendicitis that might be predicted to result in increased exposure to commensal bacteria. Perhaps the experience with

CBir is not representative of most T cell responses during infection as its antigen is not constitutively presented to the immune system. Antigens that are constitutively presented may have already triggered the appropriate effector or regulatory T cell response. Additionally, the

CBir antigen is flagellin, a TLR5 ligand, and may not be representative of most commensal bacterial ligands. Thus, it remains unclear the extent that infection or other injuries that result in mucosal barrier breakdown affects the balance between effector and regulatory T cell responses to commensal bacteria.

Summary

Recent work has demonstrated that the adaptive immune system has continuous interactions with commensal bacteria to induce both regulatory and effector T cells that promote tolerance and immunity, respectively. The differences in the Treg versus effector cell TCR repertoires suggest that these T cell populations perform unique functions to maintain host health.

However, many questions remain. What are the mechanisms by which the immune system

determines regulatory versus effector cell differentiation? How is this affected by infections or other diseases of the intestinal tract? Addressing these questions is of considerable interest to understanding the fundamental immunologic question of how we establish immune tolerance to foreign antigens, but also raises the possibility that such knowledge may be useful for the treatment or prevention of IBD or other allergic and autoimmune diseases of the intestines.

Chapter 2: Helicobacter species induce pTreg cell differentiation during homeostasis

2.1 Abstract

Our previous analysis of colonic Treg TCRs revealed direct recognition of antigens present in colonic contents. Studies using two TCR transgenic (Tg) lines that express naturally occurring Treg TCRs (CT2 and CT6) suggested that these bacterial antigens are continually presented to the adaptive immune system, as we saw continuous pTreg induction from Tg cells.

However, specific bacterial species that elicit these T cell activations remain unknow. Here, using an in vitro antigen presentation system, we analyzed the reactivity of previously identified colonic Treg TCRs against the luminal and mucosal bacteria. Interestingly, we found that several of the colonic Treg TCRs are specific to Helicobacter spp., and we further confirmed that these

Helicobacter spp. are sufficient to induce pTreg differentiation in vivo.

2.2 Introduction

In the past several years, it has become clear that certain commensal bacterial species can elicit Treg cells which is important for maintaining gut tolerance. For example, several studies reported that some, but not all, bacterial species can increase the frequency of Treg cells in the gut. Clostridium clusters XIVa and IV30,31 or altered Schaedler flora (ASF)80 introduced into GF mice markedly increased the frequency of colonic Treg cells. Lactobacillus reuteri 81 has also been associated with increased Treg cell percentage in the intestines.

The enhancement in peripheral Treg cell selection to commensal bacteria may result from a number of mechanisms. First, APC subsets in the intestine such as CD103+ DCs have been reported to favor Treg cell selection, as they express higher levels of retinal dehydrogenase

(RALDH) to produce the vitamin A metabolite RA18,82,83. RA may inhibit effector cell cytokine production84, as well as act directly on T cells85 to promote Treg cell selection. Moreover,

CD103+ DCs can generate TGFβ that acts in concert with RA to induce Treg cells86. Finally, it has been reported that these DC functions may be related to WNT/β-catenin signals that are delivered to intestinal, but not splenic DCs87.

What might be the signals localized to the gut that promote these DCs to facilitate Treg cell selection? One recent report suggested that mucus from the intestinal lumen itself can activate tolerogenic pathways in DCs by triggering WNT signaling via β-catenin88. Mucus triggered WNT-signaling might be predicted to affect only the subset of DCs close to the

mucosal surface. However, a TCF reporter of WNT signaling suggests that intestinal DCs receive a fairly uniform degree of WNT signaling88. Future studies are required to address the relative contributions of mucus versus other sources of WNT signaling in intestinal DCs.

Another potential intestinal signal for Treg cell selection may come from the microbiota itself. Short-chain fatty acids (SCFAs) arising from bacterial fermentation can act on DCs to promote tolerance89–91. SCFAs may also act directly on T cells themselves to promote colonic

Treg cell expansion92. Another bacterial product that can affect Treg cells is PSA from B. fragilis, which triggers TLR2 on Treg cells to induce IL-10 production93. Thus, commensal bacteria themselves provide potent signals that are interpreted by the intestinal immune system to facilitate tolerance.

Less is known as regards to the antigen specificity of colonic Treg cells. Previous analyses of TCR repertoires suggested that a substantial fraction and perhaps the majority of colonic Treg TCRs recognize commensal bacterial antigens. In these studies, mice with limited

TCR repertoires were used to assess the colonic Treg TCR repertoire22,34. It was observed that colonic Treg cells utilized TCRs that were different than those used by Treg cells in other tissues or secondary lymphoid organs22,34. Further analysis of colonic Treg TCRs revealed direct recognition of antigens present in colonic contents22,34. Consistent with TCR recognition of commensal bacterial antigens, antibiotic treatment could markedly change the colonic Treg

repertoire34. Therefore, these data suggest that commensal bacteria routinely trigger antigen specific Treg cell responses, yet more efforts are needed to identify these bacteria.

Intestinal bacteria can be divided into two compartments based on geographic locations: the luminal bacteria and bacteria residing in the mucus layer. There has been evidence of differences between the composition of microbial communities in the outer layer of mucus of the large intestine and the luminal intestinal contents. Mucus consists of mucin glycoproteins sheets secreted by intestinal goblet cells. Only certain bacterial species have sufficient catabolic glycosidic enzymes to utilize mucus glycans as a sufficient carbon source94–96, therefore, the mucus layer can be considered as a distinct bacterial niche as compared to the luminal content.

Indeed, a recent study showed quite interesting differences between the composition of microbial communities in the large intestine lumen and the mucus layer97.

Here, using an in vitro antigen presentation system, we analyzed the reactivity of previously identified colonic Treg TCRs against the luminal and mucosal bacteria. Interestingly, we found that several of the colonic Treg TCRs are specific to Helicobacter spp. residing in the mucosa, and we further confirmed that these Helicobacter spp. are sufficient to induce pTreg differentiation in vivo.

2.3 Materials and Methods

Study design

Animal experiments were performed in an specific-pathogen-free (SPF) facility in accordance with the guidelines of the Institutional Animal Care and Use Committee at the

Washington University. Host mice were housed together and interbred to maintain microbial integrity. Gender-matched littermate host mice were used for all comparisons. Cages were randomly assigned into different treatment groups. Both male and female mice were used. All in vivo and in vitro experiments were performed independently at least two times unless otherwise stated.

Mice

CT2, CT6 Tg mice22,98 were generated as described99 and bred to Rag1−/− [the Jackson

Laboratory (JAX) #002216], Foxp3IRES-GFP (JAX #006772) or Foxp3IRES-Thy1.1 100. Foxp3IRES-Thy1.1 mice were a gift from A. Rudensky (Memorial Sloan Kettering Cancer Center). Experiments in

Figure 2.4B and 2.6 used Ly5.1 mice from Charles River Laboratories as hosts; all other in vivo experiments used Foxp3IRES-GFP CD45.1 (JAX #006772) mice. All mice were on a C57BL/6 genetic background.

Reagents, antibodies, and flow cytometry

Fluorescently conjugated antibodies were purchased from BioLegend, eBioscience, and

Becton Dickinson. Samples were analyzed using a FACSAria IIu (Becton Dickinson), and data were processed with FlowJo (Treestar).

Cell isolation from the colon lamina propria (cLP)

Cells were isolated as described101. Colonic segments were treated with RPMI containing

3% fetal bovine serum and 20 mM Hepes (HyClone) with dithiothreitol (DTT) (Sigma) and

EDTA (Thermo Fisher) for 20 min at 37°C with constant stirring. Tissue was further digested with Liberase TL (28.3 µg/ml) (Roche) and deoxyribonuclease I (200 µg/ml) (Roche), with continuous stirring at 37°C for 30 min. Digested tissue was forced through a Cellector tissue sieve (Bellco Glass) and passed through a 40-µm cell strainer.

T cell hybridoma stimulation assay

T cell hybridoma cells expressing GFP under NFAT promoter102 were retrovirally transduced with TCRα chains of interest, as previously described103. Hybridoma cells (1.5 × 104) were cultured with flt3 ligand–elicited CD11c+ DCs (5 × 104) with and without the indicated antigen preparations (20 µg per well) in flat-bottomed 96-well plates. CD4+TCRα+ cells were analyzed for GFP expression after 1.5 days by flow cytometry.

Antigen preparations

Total colonic lumen contents were collected from longitudinally opened colon and cecum, diluted with phosphate-buffered saline (PBS) (HyClone), vortexed, filtered through a 40-µm strainer, and autoclaved. For mucosal-associated (MA) antigen preparation, lumen contents were removed with forceps, and the remaining tissue was rinsed with PBS. MA particles were released from colonic tissues using PBS with DTT (1 µM/ml) and EDTA (5 µM/ml) for 20 min at 37°C with constant stirring, followed by PBS with EDTA (2 µM/ml) for three times. From each of these steps, MA particles were filtered through a 40-µm strainer. Larger particles such as cells were removed by centrifugation at 1500 rpm for 10 min. The remaining particles in suspension were pelleted at 2500 rpm for 15 min, resuspended in PBS, and then autoclaved. For bacterial isolates, in vitro cultures were pelleted at 2500 rpm for 15 min, washed twice with PBS, resuspended in PBS, and autoclaved for 45 min.

Adoptive transfer experiments

For experiments with CT2, CT6 Tg cells, Tnaïve cells were fluorescence-activated cell sorting (FACS)–purified (CD4+ Foxp3− CD25− CD44lo CD62Lhi) from peripheral lymph nodes and spleen of CD45.2 Foxp3IRES-GFP Rag1−/− TCR Tg mice. Naïve TCR Tg cells (105) were injected retro-orbitally into congenic CD45.1 Foxp3IRES-GFP mice. In some experiments, cells were first labeled with Cell Trace Violet (CTV) (Thermo Fisher) before injection.

For experiments using CT9, T7-1 TCR, naïve T cells (CD4+ Foxp3− CD25− CD44lo

CD62Lhi Vα2–) were FACS purified from CD45.2 Tcli TCRαβ Foxp3IRES-Thy1.1 Tg mice (Rag1+/– or Rag1–/–), and activated in vitro with soluble anti-CD3 (0.1 μg/ml; 145-2C11; Bio X Cell) and anti-CD28 (1 μg/ml; 37.51; Bio X Cell) in tissue culture plates coated with rabbit antibody to hamster IgG (127-005-099; Jackson ImmunoResearch) in the presence of anti-cytokine antibodies from Bio X Cell (Cat #): anti-TGF-β (20 μg/ml, BE0057), anti-IFN-γ (5 μg/ml,

BE0054) anti-IL-4 (5 μg/ml, BE0045), and anti-IL-12 (5 μg/ml, BE0052). One day after activation, cells were retrovirally transduced with individual TCRα chain of interest103. 2×105 total cells (both transduced and non-transduced) were transferred into congenic CD45.1

Foxp3IRES-GFP mice.

The colon lamina propria and distal mesenteric lymph node (dMLN) were harvested at indicated times after transfer and analyzed by flow cytometry. Transferred TCR+ cells were identified as CD4+CD45.2+CD45.1–Vβ6+Vα2+ (CT2/CT6/CT9/T7-1).

Antibiotic treatment

Littermates were divided and treated at 3 weeks of age. Vancomycin (0.5 mg/ml), ampicillin (1 mg/ml), and neomycin (1 mg/ml) were administrated ad libitum via drinking water continuously for the time indicated. Metronidazole (1 mg/ml) was administrated by oral gavage every day for 1 week followed by gavage every other day104.

Bacterial culture and inoculation

H. typhlonius (MIT 97-6810) and H. apodemus (MIT 03-7007) strains were cultured on

Columbia agar (Oxoid) plate supplemented with 7% (v/v) defibrinated horse blood at 37°C under microaerobic conditions in a vented jar (Becton Dickinson) containing N2, H2 and CO2 (75:5:20) for 5 days; bacteria were collected into Brucella broth (BD Difco) and used for T-cell hybridoma assay or mice inoculation. For Helicobacter spp. inoculation studies, approximately 2×108 CFU bacteria were gavaged into indicated mice every other day for a total of 3 times.

For culturing bacterial isolates used in Figure 2.3, strains 1B5PYG, 1E9PYG, 1B1MRS,

1A6PYG, 1G6PYG, and 2F5PYG were grown in Peptone Yeast Glucose (PYG) medium

(Anaerobe Systems) for 3 days at 37°C under anaerobic conditions in a Coy chamber. All other strains listed were cultured in Eggerth-Gagnon (EG) medium for 3 days at 37°C under anaerobic conditions in a Coy chamber as previously described30. Bacteria culture were collected and used for T-cell hybridoma assay.

16S rRNA gene sequencing

Colonic lumen contents or MA preparations were processed for DNA isolation using the

ISOLATE Fecal DNA kit (Bioline). The V4 region of 16S rRNA gene was PCR amplified using barcoded primer described previously105, and sequenced using the Illumina Miseq Platform

(2×250bp paired-end reads). OTU picking was performed using UPARSE (usearch v.8.0.162)106, and taxonomy assigned using the uclust method with the Greengenes 13.8 database (QIIME v1.9107).

PCR detection of Helicobacter spp. DNA

Colonic lumen contents were processed for DNA isolation using the ISOLATE Fecal

DNA kit. DNA samples (5 ng per sample in 20 μL reaction) were amplified using Helicobacter genus-specific primers C97 and C98108 generating a ~400bp product. PCR conditions: initial denaturation at 94°C for 2 min; followed by 32 cycles of: denaturation at 94°C for 30 sec, annealing at 55°C for 30 sec, and extension at 72°C for 30 sec; and a final extension at 72°C for

7 min.

Statistical analysis

GraphPad Prism v7, R v3.3.0, and Qiime v1.9 were used for statistical and graphical analysis. Student’s t test, Mann-Whitney U test, one-way ANOVA, and two-way repeated-measures ANOVA were used for between-subjects analyses. Benjamini-Hochberg false discovery rate correction was used on Mann-Whitney U calculations for OTU comparisons.

2.4 Results

Colonic Treg TCRs react to mucosal-associated bacterial antigens in vitro

Our previous analysis of colonic Treg TCRs revealed direct recognition of antigens present in colonic contents103. Studies using two TCR Tg lines that express naturally occurring

Treg TCRs (CT2 and CT6) suggested that these bacterial antigens are continually presented to the adaptive immune system, as we saw continuous pTreg induction from Tg cells101. However, specific bacterial species that elicit these T cell activations remain unknow. To address this, we assessed the in vitro reactivity of these TCRs to fecal antigen preparations presented on CD11c+ dendritic cells (DCs). Consistent with previous work, we saw limited but detectable activation by fecal antigen prepared from luminal content (Figure 2.1A). We therefore asked whether these

TCRs show more reactivity to MA antigens, which might be predicted to have greater access to the immune system via DC uptake109, goblet associated passages110, or outer membrane vesicles111. Both CT2 and CT6 showed marked enhancement of TCR stimulation with MA compared with luminal antigen (Figure 2.1A). We then tested additional Treg TCRs, CT1, CT7,

CT9 and T7-1, which we previously found to react to fecal antigens or commensal isolates in vitro103. Amongst these 6 colonic Treg TCRs, 4 showed high level reactivity in vitro to MA compared with luminal antigen.

Colonic Treg TCRs react to Helicobacter spp. in vitro

To confirm that the reactivity in the MA antigen preparation was dependent on the microbiota, we treated SPF mice with a broad spectrum antibiotic combination of vancomycin, ampicillin, metronidazole, and neomycin (VAMN), and found that MA antigen no longer stimulated our 4 MA antigen reactive-Treg TCR panel (CT2, CT6, CT9, T7-1; Figure2.2A). This antibiotic cocktail includes vancomycin, which has been reported to decrease Treg cell numbers and Clostridium spp.31. We then tested the individual antibiotics to attempt to identify the bacterial spp. recognized by these TCRs by correlating in vitro TCR reactivity to MA antigen with changes in the bacteria composition.

Unexpectedly, these data suggested that Helicobacter spp., and not the predicted

Clostridium spp., were being recognized by the TCR panel. First, of the individual antibiotics, ampicillin and neomycin, but not vancomycin or metronidazole, markedly decreased the ability of MA antigen to stimulate the TCR panel compared with untreated controls (Figure 2.1B).

Second, 16S ribosomal RNA (rRNA) gene sequences from the MA antigen preparations revealed that the two most frequent Operational Taxonomic Units (OTUs) lost with ampicillin or neomycin were Helicobacter typhlonius (H. typhlonius) and H. apodemus (Figure 2.1C, 2.2B).

To determine if Helicobacter spp. were being directly recognized by these TCRs, we tested cultured isolates that matched the 16S rRNA sequence (Figure 2.1D). Notably, there were specific patterns of TCR reactivity, with CT9 and T7-1 recognizing both spp., whereas CT2 reacted only to H. typhlonius, and CT6 to H. apodemus. Recognition of Helicobacter spp. in

vitro appeared to be TCR specific and not via a superantigen or other antigen-independent mechanism. First, each Helicobacter isolate stimulated only some, but not all, TCRs. Second, addition of anti-MHC II blocked TCR activation (Figure 2.2C). Third, testing of these TCRs against multiple bacterial isolates in vitro from different genera including Clostridium,

Bifidobacterium, and Lactobacillus failed to activate our TCR panel to the same degree as

Helicobacter (Figure 2.3). However, these TCRs could still show cross-reactivity to different bacterial species due to shared epitopes. CT6 may recognize other bacterial species as vancomycin reduced CT6 response to MA antigen without a corresponding decrease in H. apodemus frequency by 16S (Figure 2.1B and C). We have also shown previously that CT6 reacted to an uncharacterized Clostridium spp.103. While the extent of bacterial cross-reactivity remains to be defined, these data clearly demonstrate that 4 of our 6 colonic Treg TCRs recognize Helicobacter spp. in vitro.

Helicobacter spp. drives peripheral Treg cell development during homeostasis

We then asked whether these Helicobacter spp. could induce TCR-specific Treg cell responses in vivo. As expected, transfer of CT2/CT6/CT9/T7-1 TCR+ cells into ampicillin-treated mice to eliminate pre-existing Helicobacter spp. (Figure 2.1C) resulted in little proliferation or differentiation (Figure 2.4A). However, inoculation of ampicillin-treated mice with a single

Helicobacter spp. elicited robust expansion and Foxp3 upregulation in appropriate TCR+ Tg cells

(Figure 2.4A). Similarly, Helicobacter-free mice obtained from Charles River Laboratories showed little ability to induce TCR-dependent proliferation or Treg cell generation, unless the appropriate Helicobacter spp. identified in vitro (Figure 2.1D) was subsequently inoculated in vivo (Figure 2.4B and 2.5). Notably, as CT2 and CT6 Tg cells were co-transferred into the same host, it appears that these TCR clones show a high degree of specificity for individual

Helicobacter strains (Figure 2.1D). To confirm that Treg induction occurs at polyclonal level, we analyzed the polyclonal CD4 T cells and observed a significant increase in Tregs in the cLP, specifically the Helioslo and Neuropilin-1 (Nrp1)lo Tregs which indicate pTreg cells112–114, as well as RORγT+ Tregs which represent bacterial-induced Treg cells115,116(Figure 2.6). Thus, these data demonstrate that Helicobacter spp. are a major driver of bacterial-specific Treg cell responses during homeostasis.

2.5 Discussion

Our previous analysis of colonic Treg TCRs revealed direct recognition of antigens present in colonic contents103. Studies using two TCR Tg lines that express naturally occurring

Helicobacter spp. residing in the mucosa. Additionally, colonization of SPF mice with these

Helicobacter spp. induced efficient pTreg differentiation under homeostasis.

The recognition that Helicobacter spp. are important inducers of antigen-specific Treg cells during homeostasis is consistent with a previous study117. Using a T cell transfer model of colitis, this study showed that CD45RBlow CD4+ cells from Helicobacter hepaticus-infected but not uninfected mice prevented colitis in Rag-/- hosts, suggesting that H. hepaticus infection resulted in the induction of Treg cells that prevented bacteria-induced colitis.

A more recent study also showed that H. hepaticus selectively induces antigen-specific

RORγt+Foxp3+ pTreg cells in the colon during homeostasis through c-Maf-dependent mechanism118.

Helicobacter spp. are widely prevalent in mice colonies around the world119, and have often been thought of as pathobionts based on their ability to induce or enhance colitis in

lymphopenic mice120–122 or mice deficient in critical immuno-regulators such as IL-10123–125. The notion that Helicobacer spp. induce tolerogenic cells under steady state suggests that Treg cells play important roles in tolerance against gut pathobionts. Disruption of pTreg response by c-MAF deletion leads to accumulation of Th17 cells that potentiate colonic inflammation126.

Clostridium clusters XIVa and IV are well known for increasing the frequency of Treg cell in the gut after introducing into GF mice. One potential mechanism for Clostridium-induced

Treg selection may be mediated through the production of SCFAs. Clostridium spp. ferment dietary fiber to generate SCFAs which can act on DCs to promote tolerance127–129. Additionally,

SCFAs can act directly on T cells themselves to promote colonic Treg cell expansion130.

Hundreds of gut bacterial species form a complex ecosystem, it is reasonable to hypothesize that the effect of Helicobacter spp. on T cells could be affected by Clostridium or other microbial species. Therefore, future studies are needed to investigate whether the presence of other microbes could modulate Helicobacter-induced Treg response.

2.6 Figures

A B TCR stimulation in vitro: TCR stimulation in vitro:

2 5 2 0 C T 2 C T 9 2 0 1 5

1 5 1 0 1 0

(%) 5

5 +

0 0 GFP

- 8 0 5 0 C T 6 T 7 - 1 4 0 6 0

NFAT 3 0 4 0 2 0 2 0 1 0

0 0

Ampicillin Ampicillin

Neomycin Neomycin

Untreated Untreated

No No antigen No No antigen

Vancomycin Vancomycin

Metronidazole Metronidazole

MA Ag after: MA Ag after:

C D Abundance of OTU in MA prep: TCR stimulation in vitro by isolates: H. typhlonius H. apodemus H. typhlonius H. apodemus

4 0 8 0 6 0 1 0 0

3 0 6 0 (%) 8 0 + 4 0 6 0

2 0 4 0 GFP

- 4 0 2 0 1 0 2 0

2 0 16S reads (%) reads 16S

0 0 NFAT 0 0

2 9 6

T T T

C C C C C C

T T

TCR

Ampicilin

Neomycin

Untreated

Vancomycin

Metronidaxole Metronidaxole

MA Ag after: MA Ag after:

Figure 2.1 Colonic Treg TCRs react to mucosal-associated Helicobacter species.

(A) Treg TCRs preferentially react to mucosal-associated antigens (Ag). Hybridoma cells expressing different TCRs were cultured with CD11c+ dendritic cells and the indicated Ag.

NFAT-GFP upregulation was assessed by flow cytometry 1.5 days later. (B) Selective elimination of MA Ag using individual antibiotics. TCRs from (A) that react to MA Ag were stimulated with colonic MA Ags isolated from antibiotic-treated or untreated mice as per (A). (C)

Changes in H. typhlonius and H. apodemus OTUs correlate with in vitro reactivity to MA Ag in

(B). Data shown are the percentage of 16S OTUs from the MA preparations of individual antibiotic-treated or untreated mice. (D) In vitro recognition of H. typhlonius or apodemus.

Cultured isolates were tested for TCR reactivity in vitro as per (A). 2-3 independent experiments.

Bars indicate mean.

A B 1 0 C T 2 1 0 C T 9 8 8

6 6

Untreated Vancomycin Neomycin Ampicillin Metronidazole 4 4 Helicobacter apodemus (%) 2 2 + Helicobacter mastomyrinus 0 0

Helicobacter typhlonius GFP

- 5 0 C T 6 3 0 T 7 -1 Unc Clostridium 4 0 2 0 Unc Mucispirillum

NFAT 3 0 Unc Prevotella 2 0 1 0 Bacteroides vulgatus 1 0

0 0 Unc Mycoplasma Unc Bacteroidales

Unc Prevotella

VAMN VAMN

0 0 0

2 4 6

Untreated Untreated No antigen No antigen 16S reads in untreated mice (%) Row: min max C

1 0 0 C T 2 2 0 C T 9 5 0 T 7 - 1 1 0 0 C T 6 1 5 C T 9 3 0 T 7 - 1 (%) (%) 8 0 4 0

1 5 + + 1 0 2 0 6 0 3 0

1 0 5 0

GFP

GFP - - 4 0 2 0 5 1 0 5

2 0 1 0 NFAT NFAT 0 0 0 0 0 0 H. typhlonius: – + + – + + – + + H. apodemus: – + + – + + – + + αMHC II – – + – – + – – + αMHC II – – + – – + – – +

Figure 2.2 Reactivity of colonic Treg TCRs to mucosal-associated Helicobacter species is

MHCII dependent.

(A) Broad spectrum antibiotics in vivo abrogate in vitro stimulation of indicated TCRs by MA Ag.

As per Figure 2.1A, NFAT-GFP induction in hybridoma cells was assessed by flow cytometry after stimulating with MA Ags isolated from VAMN-treated or untreated mice. (B) Use of individual antibiotics to narrow down the bacterial stimulators in MA Ag. Shown are the

percentages of the top 10 most frequent 16S rRNA OTUs in the MA preparations from untreated mice (left) and their relative abundance in the MA preparations from individual antibiotic-treated mice (right). n=6, 5, 5, 3, 4. Unc, unclassified below taxonomy level. (C) Reactivity of

CT2/CT6/CT9/T7-1 TCRs to Helicobacter spp. are blocked by antibody to MHC II. As per

Figure 2.1D, NFAT-GFP induction in hybridoma cells was assessed after stimulating with cultured isolates with or without αMHC II. 2 independent experiments. Bars indicate mean ±

SEM.

A B 1 0 ID Genus C T 2 8 1E8 EG Bifidobacterium 1B5PYG Unclassified porphyromonadaceae 6 1A11 EG Akkermansia 4 1E9PYG Allobaculum 1B1MRS Lactobacillus 2

1A6PYG Olsenella 0 1G6PYG Akkermansia 1 0 2F5PYG Parabacteroides C T 6 B2 Pseudoflavonifractor 8

F3 Unclassified_Lachnospiraceae 6 E4 Clostridium XVIII F2 Clostridium XVIII 4

ma2-1C2-1 Streptococcus 2 (%)

ma2-3B5-4 Bifidobacterium +

2E4Sch Escherichia/Shigella 0 GFP S5 Clostridium IV - 1 0 C T 9 A3 Unclassified_Lachnospiraceae 8 F4 Clostridium XlVb NFAT H8 Unclassified_Ruminococcaceae 6

H5 Unclassified_Lachnospiraceae 4 A2 Clostridium XlVa 2 A1 Clostridium XlVa

1 0 T 7 - 1 8

4 5

3 2 4

2 3 5 2 1

G G

F F F

E S

B A H A A

Y Y

P P

5 6

B A

1 1

m m N

Figure 2.3 CT2/CT6/CT9/T7-1 TCRs do not react to other bacterial isolates tested.

(A) Identification ID and Genus of bacterial isolates. (B) Hybridoma cells were stimulated with bacterial isolates indicated in (A), and assessed for NFAT-GFP as per Figure 2.1A. 1-2 independent experiments. Bars indicate mean.

A T cells i.v. Ampicillin analysis 3 wk old 2wk 2d 7d SPF gavage some mice with H. spp.(qod) cLP Ampicillin Ampicillin Amp + H. typhlonius Amp + H. apodemus

* * * * * * * 1 0 0 1 0 0 * *

8 0 * * 8 0

6 0 6 0

cells (%) cells +

4 0 4 0

of TCR of 2 0 2 0

Treg 0 0

2 9

T T

p = 0 . 17 2 C

1 . 0 C 2 . 5 T

0 . 8 p = 0 . 0 7 2 . 0 0 . 6

* cells cells (%)

0 . 4 1 . 5 + 0 . 2 1 . 0

0 . 1 * of CD4 of

+ 0 . 5 TCR

0 . 0 0 . 0

2 9

T T

CT2 CT9 T7-7 1 CT6

C C T CT2 CT6 * * * * * * * * 1 0 0 1 0 0 100 100 Ampicillin Ampicillin

80 (%) cells

Amp+ Amp+ + 60 H. apodemus H. typhlonius 505 0 5 0 40

20 Relative Count Relative 0 00 0 Divided of TCR of Divided CT2 CT6 Cell Trace Violet B 0 .2 5 Charles River CD45.1 hosts (dMLN) C T 2 0 .2 0 0 .2 5 1 0 0 6 0 C T 6 0 .1 5 0 .2 0

cells (%) cells 0 .1 0 4 0

cells (%) cells +

0 .1 5 (%) cells

+ + 05.00 5 0 .1 0 2 0

of CD4 of 0 .0 0 of TCR of

+ 0 .0 5 Treg

TCR 0 .0 0 0 0

Divided of TCR of Divided

. . .

typh typh typh

None None None

H. apo. H. H.apo. H.apo.

H. H. H. H.

gavage gavage gavage

Figure 2.4 Helicobacter species induce peripheral Treg cell differentiation during homeostasis.

(A) In vivo validation of TCR reactivity to Helicobacter species. 3 week old SPF mice were treated with ampicillin (amp) for 2 weeks via drinking water. Two days after the last treatment, H. typhlonius or H. apodemus were gavaged 3 times total every other day. With the last gavage, congenically marked naïve CT2/CT6 Tg cells or retrovirally expressed CT9/T7-1 cells were transferred. Seven days post transfer, cLP cells were analyzed by flow cytometry for (top) development of Treg (Foxp3+) cells (p=0.000003; 0.001; 0.0002; 0.0046; n=4, 5 for CT2; n=6,

7 for CT9; n=5 for T7-1; n=3, 5 for CT6; Student’s t-test); (middle) frequency of transferred

TCR-expressing cells amongst the host CD4+ T cells (p=0.0442; 0.021; 0.0046;0.0705; n=4, 5 for CT2; n=6, 7 for CT9; n=5 for T7-1; n=3, 5 for CT6; Student’s t-test); or (bottom) CTV dilution (p=0.00000002; 0.0000007; n=4, 5 for CT2; n=3, 5 for CT6; Student’s t-test). (B) T cell response to Helicobacter in vivo is species-specific. Three week old SPF mice obtained from

Charles River Laboratories were gavaged with H. typhlonius or H. apodemus (3 times total every other day). With the last gavage, congenically marked naïve CT2 and CT6 Tg cells (105 each) were co-transferred. One week post-transfer, cells from the dMLN were analyzed by flow cytometry for the frequency of transferred TCR-expressing cells amongst the host CD4+ T cells

(left); CTV dilution (middle); or development of Treg (Foxp3+) cells (right) (n=4, 6, 6). Bars indicate mean ± SEM. *p < .05, **p < .01, ***p < .001, ****p < .0001.

n=4, 5 for CT2; n=3, 5 for CT6; Student’s t-test). (B) T cell response to Helicobacter in vivo is species-specific. Three week old SPF mice obtained from Charles River Laboratories were gavaged with H. typhlonius or H. apodemus (3 times total every other day). With the last gavage, congenically marked naïve CT2 and CT6 Tg cells (105 each) were co-transferred. One week post-transfer, cells from the dMLN were analyzed by flow cytometry for the frequency of transferred TCR-expressing cells amongst the host CD4+ T cells (left); CTV dilution (middle); or development of Treg (Foxp3+) cells (right) (n=4, 6, 6). Bars indicate mean ± SEM. *p < .05, **p

< .01, ***p < .001, ****p < .0001.

W W

- -

SSC

Dump

FSC SSC

FSC-A FSC-H SSC-H CD4

Treg

CT2

Foxp3

CD45.2

2 α CD44 V CD45.1

Divided

Vβ6 CD45.2

CT6 Relative Count Relative

CTV CD45.1 B 400bp

No bacteria H. typhlonius H. apodemus

Figure 2.5 Gating strategy and confirmation of Helicobacter spp. inoculation in Figure 2.4B.

(A) Gating strategy for Figure 2.4B. (B) Confirmation of Helicobacter spp. inoculation in Figure

2.4B. Helicobacter genus-specific primers were used to PCR colonic lumen contents of Charles

River host mice gavaged with: no bacteria (lanes 1-4), H. typhlonius (lanes 5-10), and H. apodemus (lanes 11-16). 39

A B C D g

5 0 * g 7 0 1 0 0 8 0 * g

+ * e

e * * *

T T

D 4 0

6 0 f 7 0

o 8 0

3 0 o

o l

5 0 T 6 0

 1

2 0 o

R l

r 6 0

e O T 4 0 5 0

1 0 N

% % 0 3 0 4 0 % 4 0 l o s l 2 l 2 l 2 r u tr 2 tr 2 tr 2 t c s c s c s n m o e

Control Control c Control o Control p

apodemus apodemus apodemus . apodemus

H. H. H. H. H. H. H.

Figure 2.6 Relative expansion of pTregs in Helicobacter-colonized mice.

Three week old SPF mice obtained from Charles River Laboratories were gavaged with H.

apodemus (3 times total every other day). Two weeks after the last gavage, cells from the cLP

were analyzed by flow cytometry for the frequency of Foxp3+ Tregs amongst the host CD4+ T

cells (A); Helioslo Foxp3+ cells (B); Nrp1lo Foxp3+ cells (C); or RORγT+ Foxp3+ cells (D)

amongst total Treg cells (n=9 each). Bars indicate mean ± SEM. *p < .05, **p < .01, ***p <

.001, ****p < .0001.

Chapter 3: Characterization of T cell response to gut microbes in inflammation

3.1 Abstract

Specific gut commensal bacteria improve host health by eliciting mutualistic Treg cells responses. However, the bacteria that induce Teff cells during inflammation are unclear. Here, we addressed this by analyzing bacterial-reactive TCR transgenic cells and TCR repertoires in a murine colitis model. Unexpectedly, we found that mucosal-associated Helicobacter species triggered both Treg responses during homeostasis and Teff responses during colitis, as suggested by an increased overlap between the Teff/Treg TCR repertoires with colitis. By contrast, the marked expansion of luminal Bacteroides species seen during colitis did not trigger a commensurate Teff response. Unlike other Treg cell-inducing bacteria, Helicobacter species are known pathobionts and cause disease in immunodeficient mice. Thus, our study suggests a model in which mucosal bacteria elicit context-dependent Treg or effector cell responses to facilitate intestinal tolerance or inflammation.

3.2 Introduction

We cohabitate with trillions of bacteria that reside within our intestines and provide important beneficial metabolic and immunologic functions131. However, inappropriate immune responses against these bacteria have been implicated in the pathogenesis of IBD132–134, as GF mice are highly resistant to many murine colitis models. Moreover, monocolonization studies of germ-free animals revealed that IBD development may be driven by specific commensal bacterial species135.

Tolerance to commensal bacteria is thought to depend on Treg cells31,103,136, which we have recently shown can arise via pTreg cell development from naïve T cells in response to commensal antigens during homeostasis101. However, intestinal inflammation can result in the exposure of new antigens to the immune system. In murine models, Teff cell generation to a commensal bacterial antigen was seen during intestinal inflammation, but not homeostasis44.

Thus, it remains unknown whether effector responses during intestinal inflammation are driven by newly exposed antigens versus the commensal antigens that normally drive Treg cell development during homeostasis.

IBD is associated with marked changes in the gut microbiota, a.k.a. dysbiosis137.

Dysbiosis has been hypothesized to contribute to disease pathogenesis, as it is well established that different commensal bacterial species have distinct effects on the intestinal T cell population.

For example, SFB strongly induces Th17 cells in the small intestine138, which has now been

confirmed by TCR transgenic studies139. By contrast, introduction of Clostridium clusters XIVa and IV30,31 or ASF140 markedly increased the frequency of colonic Treg cells in germ-free mice.

Thus, changes in the microbiome may also affect the intestinal effector vs regulatory T cell population.

Here, we used TCR repertoire analysis coupled with in vivo studies of commensal-specific TCRs to address the influence of colitis-mediated dysbiosis on bacteria-specific Treg cell development. We also examined the interaction of T cells with luminal versus mucosal associated antigens during homeostasis and colonic inflammation. Finally, we assessed the impact of commensal-specific T cells during lymphopenic conditions. In summary, our data suggest that the mucosal-associated pathobionts, Helicobacter spp., elicit context-dependent T cell responses during homeostasis and colitis.

3.3 Materials and Methods Study design

Animal experiments were performed in a SPF facility in accordance with the guidelines of the Institutional Animal Care and Use Committee at Washington University. Host mice were housed together and interbred to maintain microbial integrity. Gender-matched littermate host mice were used for all comparisons. Cages were randomly assigned into different treatment groups. Both male and female mice were used. All in vivo and in vitro experiments were performed independently at least two times unless otherwise stated.

Mice

CT2, CT6 Tg mice22,101 were generated as described141 and bred to Rag1−/− [the Jackson

Laboratory (JAX) #002216], Foxp3IRES-GFP (JAX #006772) or Foxp3IRES-Thy1.1 102, and/or

IL-17AIRES-GFP (JAX #18472), and IFNγIRES-YFP(GREAT)142. TCli TCRβ Foxp3IRES-Thy1.1 TCRα+/–

143 and TCli TCRβ144 Foxp3IRES-Thy1.1 Rag1–/– mice were previously described. IFNγIRES-YFP mice were a gift from Richard Locksley (UCSF); Foxp3IRES-Thy1.1 mice were a gift from

Alexander Rudensky (MSKCC). Experiments in Figure 3.5 used Ly5.2 mice inbred in our colony as hosts; all other in vivo experiments used Foxp3IRES-GFP CD45.1 (JAX #006772) mice.

All mice were on a C57BL/6 genetic background.

Reagents, antibodies, and flow cytometry

Anti-IL-10R blocking antibody (BE0050) and isotype IgG1 (BE0088), anti-MHC II antibody (BE0108) were purchased from BioXCell. Fluorescently conjugated antibodies were purchased from Biolegend, eBioscience, and Becton Dickinson. Samples were analyzed using a

FACSAria IIu (Becton Dickinson) and data were processed with FlowJo (Treestar).

Cell isolation from the colonic lamina propria

Cells were isolated as described101. Colonic segments were treated with RPMI medium containing 3% FBS and 20 mM HEPES (HyClone) with DTT (Sigma) and EDTA (Thermo

Fisher) for 20 mins at 37°C with constant stirring. Tissue was further digested with 28.3 μg/ml liberase TL (Roche) and 200 μg/ml DNase I (Roche), with continuous stirring at 37°C for 30 min. Digested tissue was forced through a Cellector tissue sieve (Bellco Glass) and passed through a 40 μm cell strainer.

T-cell hybridoma stimulation assay

Antigen preparations

Total colonic lumen contents were collected from longitudinally opened colon and caecum, diluted with PBS (HyClone), vortexed, filtered through a 40 μm strainer, and autoclaved. For MA preparation, lumen contents were removed with forceps and the remaining tissue rinsed with PBS. Mucosal associated particles were released from colonic tissues using

PBS with DTT (1 μM/ml) and EDTA (5 μM/ml) for 20 min at 37°C with constant stirring, followed by PBS with EDTA (2 μM/ml) for 3 times. From each of these steps, mucosal associate particles were filtered through a 40 μm strainer. Larger particles such as cells were removed by centrifugation at 1500 rpm for 10 min. The remaining particles in suspension were pelleted at

2500 rpm for 15 min, resuspended in PBS, then autoclaved. For bacterial isolates, in vitro cultures were pelleted at 2500 rpm for 15min, washed twice with PBS, resuspended in PBS, and autoclaved for 45 min.

Adoptive transfer experiments

For experiments with CT2, CT6, or DP1 Tg cells, naïve T cells were FACS purified

(CD4+ Foxp3− CD25− CD44lo CD62Lhi) from peripheral lymph nodes and spleen of CD45.2

Foxp3IRES-GFP Rag1−/− or Foxp3IRES-Thy1.1 IL-17AIRES-GFP IFNγIRES-YFP Rag1−/− TCR Tg mice. 105 naïve TCR Tg were injected retro-orbitally into congenic CD45.1 Foxp3IRES-GFP mice. In some experiments, cells were first labeled with CTV (Thermo Fisher) before injection.

For experiments using TCRs CT7, CT9, NT2, or T7-1, naïve T cells (CD4+ Foxp3− CD25−

CD44lo CD62Lhi Vα2–) were FACS purified from CD45.2 Tcli TCRβ Foxp3IRES-Thy1.1 Tg mice

(Rag1+/– or Rag1–/–), and activated in vitro with soluble anti-CD3 (0.1 μg/ml; 145-2C11; Bio X

Cell) and anti-CD28 (1 μg/ml; 37.51; Bio X Cell) in tissue culture plates coated with rabbit antibody to hamster IgG (127-005-099; Jackson ImmunoResearch) in the presence of anti-cytokine antibodies from Bio X Cell (Cat #): anti-TGF-β (20 μg/ml, BE0057), anti-IFN-γ (5

μg/ml, BE0054) anti-IL-4 (5 μg/ml, BE0045), and anti-IL-12 (5 μg/ml, BE0052). One day after activation, cells were retrovirally transduced with individual TCRα chain of interest (8). 2×105 total cells (both transduced and non-transduced) were transferred into congenic CD45.1

Foxp3IRES-GFP mice.

The colon lamina propria and distal mesenteric lymph node were harvested at indicated times after transfer and analyzed by flow cytometry. Transferred TCR+ cells were identified as

CD4+CD45.2+CD45.1–Vβ6+Vα2+ (CT2/CT6/CT7/ DP1/NT2) or CD4+CD45.2+CD45.1–

Vβ6+GFP+ (T7-1).

Adoptive transfer of CBir1 Tg cells

FACS purified (CD4+ CD25− CD44lo CD62Lhi) naïve T cells (2×105) from the spleens of

CD45.1 CBir1 TCR Tg mice were injected retro-orbitally into congenic CD45.2 mice. Cells were first labeled with CTV before injection. The distal mesenteric lymph node was harvested

one week after transfer and analyzed by flow cytometry. Transferred TCR+ cells were identified as CD4+CD45.1+CD45.2–Vβ8.3+.

Bacterial isolation, culture, and inoculation

Colonic lumen contents from DSS+αIL10R treated mice were homogenized and serial dilutions were plated on brain-heart-infusion (BHI, BD Difco) agar supplemented with 10%

(v/v) defibrinated horse blood (Colorado Serum Co.). Plates were grown for 3 days at 37°C under anaerobic conditions (5% H2, 20% CO2, and 75% N2) in a Coy chamber. 20 colonies were picked and 16S rRNA gene was sequenced. Colonies matched to B. vulgatus, B. acidifaciens, B. uniformis were cultured in BHI medium (EMD) supplemented with 5 g/L yeast extract, 0.5 g/L L-cysteine-HCl, 1 mg/L Vitamin K3, 1.2 mg/L Hematin (all Sigma), and used for T-cell hybridoma assay. H. typhlonius (MIT 97-6810) and H. apodemus (MIT 03-7007) strains were cultured on Columbia agar (Oxoid) plate supplemented with 7% (v/v) defibrinated horse blood at 37°C under microaerobic conditions in a vented jar (Becton Dickinson) containing

N2, H2 and CO2 (75:5:20) for 5 days; bacteria were collected into Brucella broth (BD Difco) and used for T-cell hybridoma assay or mice inoculation.

TCR sequencing

Tnaive (CD44lo CD62hi), Treg (Foxp3+), and Teff (CD44hi CD62Llo) CD4 T cells were sorted from TCli TCRβ Foxp3IRES-Thy1.1 TCRα+/- mice using BD FACSAria IIu. TCRα cDNA synthesis from purified cells was performed as described145. A two-step PCR was used to amplify multiple TRAV genes146 (multiplex PCR, table 3.1). Amplicons were purified after each

PCR reaction using the Agencourt AMPure XP magnetic purification system. The ~200-600 bp amplicons were quantified using Qubit dsDNA BR assay kit (Invitrogen) and pooled in equimolar ratios for 250 bp paired end sequencing using Illumina MiSeq at the Washington

University Genome Sequencing Center. Sequences were demultiplexed and analyzed using blastn to identify the TCR alpha variable (TRAV) and TCR alpha joining (TRAJ) gene segments using the IMGT database147. This information was then used to determine the CDR3 sequence. A unique TCR is identified by its TRAV and CDR3 amino acid sequence. Frequency filtering was applied to keep TCRs >0.1% of raw data in at least one sample. TRAVs with a frequency below

1% of the total population in multiplex PCR were excluded to limit variability from low read numbers due to low primer efficiency. The filtered TRAVs accounted for more than

76.2%±8.8% of the total TRAV repertoire. TRAV_CDR3 species frequencies were then multiplied by a correction factor determined by the ratio of TRAV sequences obtained using multiplex versus template switch PCR (Figure 3.3B)148.

16S rRNA gene sequencing

Colonic lumen contents or MA preparations were processed for DNA isolation using the

ISOLATE Fecal DNA kit (Bioline). For Figure 3.2E, terminal pellets were homogenized with

PBS and prepared for Bacteria FACS sorting and 16S rRNA sequencing as in104. The V4 region of 16S rRNA gene was PCR amplified using barcoded primer described previously149, and sequenced using the Illumina Miseq Platform (2×250bp paired-end reads). OTU picking was performed using UPARSE (usearch v.8.0.162)150, and taxonomy assigned using the uclust method with the Greengenes 13.8 database (QIIME v1.9151).

Colon histology

Mouse colons were collected, luminal contents removed, cut open longitudinally, and pinned and fixed with 10% (vol/vol) formalin. Fixed samples were paraffin-embedded, cut into

5μm sections, and stained with Hematoxylin and Eosin (H&E) by standard procedures. Crypt height was measured from digital photographs of H&E stained colon sections taken with a Nikon

ECLIPSE 50i microscope.

Bacteria quantification by qRT-PCR

Colonic lumen contents or MA preparations were processed for DNA isolation using the

ISOLATE Fecal DNA kit. DNA samples (10 ng per sample in 10 μL reaction) were amplified using 16S universal primers 63F and 355R152 to yield a ~290bp product. PCR conditions: initial denaturation at 95°C for 10 min; followed by 40 cycles of: denaturation at 95°C for 15 sec, annealing at 55°C for 30 sec, and extension at 72°C for 30 sec; and a final extension at 72°C for

7 min. qRT-PCR was done using DyNAmo ColorFlash SYBR green qPCR mix (Thermofisher) and Light Cycler 480 (Roche). Relative gene expression between groups were calculated using the ΔCt method.

Human sample collection and preparation

The human study protocol was approved by the Washington University Institutional

Review Board. The healthy controls, Crohn’s disease (CD) or ulcerative colitis (UC) patients were recruited through participant registries and physician's clinics. Fresh fecal samples were collected at home, stored at −20°C in an insulated shipper, mailed to or brought in person to

Washington University in St. Louis either the same day or overnight and then stored at −80°C until further analysis. Colonoscopy samples were collected by aspirating mucosal fluid during the colonoscopy from the specified intestinal locations. A short questionnaire was administrated

to collect participants’ health information. Informed consent was obtained from all subjects.

Fecal samples or colonoscopy samples were homogenized with PBS and prepared for Bacteria

FACS sorting and 16S rRNA sequencing as in153.

Statistical analysis

Morisita-Horn statistical test was used for TCR repertoire comparison. TCR Renyi diversity profiles were generated as previously indicated154, using Renyi entropy values with α/order values ranging from 0 (natural logarithm of species richness) through 2 (natural logarithm of the inverse Simpson index). This includes α= 1, which represents the commonly used Shannon entropy.

3.4 Results

Overlap of effector and Treg TCR antigen-specificity during colitis.

To address the effect of colitis on T cell responses to commensal bacteria, we examined induced models as we wanted to compare mice that started with the same microbiota. We settled on a murine model of inflammatory colitis (Figure 3.1A)155 that incorporates 1% DSS induced mucosal injury along with anti-IL-10R antibody (αIL10R)80,156, which blocks an important immune regulatory pathway implicated in human IBD in genome-wide association studies157.

DSS+IL10R treatment induced colitis as evidenced by weight loss, increased colon weight/length ratio, and a marked enhancement of Teff (CD44hiCD62Llo) and Treg cells (Figure

3.2). As the combination showed a greater effect on the microbiota than DSS or αIL10R alone

(Figure 3.2E), we used DSS+aIL10R for subsequent experiments.

Consistent with previous reports, naïve T cells from CT2 and CT6 TCR Tg lines, which express TCRs isolated from colonic Treg cells and recognize commensal antigens103, showed substantial induction of Foxp3, the canonical Treg cell transcription factor, by 1 week after transfer into control IgG treated mice (Figure 3.1A and B)98. However, in mice undergoing

DSS+IL-10R mediated colitis, they skewed towards Teff cell generation (Figure 3.1B). Teff cell differentiation was primarily to the Th17 phenotype based on IL-17AGFP and IFNYFP reporters (Figure 3.1C), consistent with observations in human Crohn’s disease158. In addition,

CT2 and CT6 cells underwent extensive proliferation as assessed by CTV dilution and expanded 53

as a fraction of total CD4+ cells (Figure 3.1D and E). Thus, the normal tolerogenic Treg cell developmental response to commensal bacterial antigens can be re-directed to a Th17 effector response during experimental colitis.

Shared TCR usage between Treg and Teff during colitis

To assess whether the responses of CT2 and CT6 TCR Tg cells were representative of the

T cell population, we analyzed the effect of colitis on the TCR repertoire (Figure 3.3A and B, table 3.1). Because the great diversity in polyclonal T cells precludes experimental analysis at the individual TCR level, we utilized mice in which TCR diversity is limited by a transgenic fixed

TCRβ chain158. Although TCR diversity is diminished, this approach allows high-throughput analysis of the TCR repertoire at the individual TCR level via sequencing of the variable TCRα chains. With colitis, both Treg and Teff repertoires showed increased clonal expansion compared to controls (Figure 3.3C), consistent with a T cell response. Notably, we saw a marked increase in similarity between the Treg and Teff TCR repertoires within the cLP of individual mice during colitis compared with controls (Figure 3.3D and 3.4A). Examination of the top 25 Teff

TCRs per mouse showed that many of these TCRs are also found in the Treg cell subset during colitis (Figure 3.4B), consistent with our TCR transgenic studies (Figure 3.1). In control mice, the relatively low degree of overlap between the Teff and Treg cell subset within individual mice

(Figure 3.4A and B, 3.3D) is consistent with our previous studies103,159. As before, we also observed mouse-to-mouse variability of Teff and Treg TCR repertoires between mice (Figure

3.4A, 3.3D and E). To confirm the TCR repertoire analysis, we cloned T7-1 (Figure 3.4C), the most abundant TCR found in the Teff subset of colitic mice by mean percentage (Figure 3.3E).

As predicted by the TCR repertoire study, analysis of adoptively transferred peripheral TCli-

TCR Tg cells expressing T7-1 showed that this TCR facilitated Foxp3 induction during homeostasis, but skewed towards Teff cell generation with colitis (Figure 3.4D). Thus, these data demonstrate an increased overlap between the Teff and Treg TCRs repertoires during colitis that does not occur at homeostasis.

Our TCR Tg data suggest that the overlap in Treg and Teff TCR usage during colitis is due to enhanced Teff generation by clones that might normally differentiate into Treg cells

(Figure 3.1). Alternatively, the overlap may arise from increased Treg cell generation by Teff

TCRs during colitis. However, transfer of CBir1 Tg cells158 into DSS+αIL10R hosts showed increased Teff but not Treg generation (Figure 3.5), consistent with a previous report in the DSS model44. Although it remains possible that the CBir1 result in the DSS+αIL10R model is not generalizable to other model systems, in conjunction with the TCR repertoire analysis, these

TCR Tg studies suggest that colitis skews T cell development such that pro-inflammatory Teff cells often use the same TCRs as anti-inflammatory Treg cells.

Marked changes in bacterial composition with colitis

The observation that colitis increased the proliferation of adoptively transferred CT2 and

CT6 TCR Tg cells (Figure 3.1B) suggested that there might be alterations in the colonic microbiota. We therefore analyzed the changes in the MA and luminal 16S rRNA profile with colitis. Consistent with previous reports, the bacterial composition in the lumen versus mucosa is quite distinct (Figure 3.6A-C)160,161. In the MA preparation, we noted a high frequency of

Helicobacter spp. in both control and colitic mice (Figure 3.6B), consistent with the activation and differentiation of CT2 and CT6 Tg cells in vivo under both conditions (Figure 3.1). The frequency of H. typhlonius was further increased in colitic mice (Figure 3.6D and E), which may suggest enhanced antigen stimulation for H. typhlonius-reactive TCRs. In the lumen, besides the increase in H. typhlonius (Figure 3.6D and E), we noted that colitis induced a marked expansion of Bacteroides (B.) spp., particularly B. vulgatus, which represented over 20% of 16S reads in some mice (Figure 3.6D and F). As there was no obvious decrease in bacterial density (Figure

3.7), these data suggest that DSS+αIL10R colitis is associated with a major bloom of

Bacteroides spp. in the lumen.

Lack of T cell responses to the bloom of luminal Bacteroides species during colitis

As Bacteroides species have been suggested to be important triggers of intestinal inflammation in other murine models162,163, we asked whether the dramatic expansion of

Bacteroides species in DSS+IL10R treated mice induced strong anti-microbial effector T cell responses. We assessed the in vivo responses of several TCRs that recognize Bacteroides strains isolated from DSS+IL10R mice in vitro, including the B. vulgatus-reactive TCR DP1 (Figure

3.8A, table 3.2). These TCRs recognized Bacteroides strains through MHC II and did not respond in vitro to the Helicobacter strains tested (Figure 3.9A and B). To our surprise, adoptively transferred T cells expressing these Bacteroides-reactive TCRs did not show increased proliferation, expansion, or Teff cell development in DSS+IL10R treated mice compared with controls (Figure 3.8B and C). Consistent with the poor expansion, very few transferred cells were recovered from the colon. In fact, the percentage of the transferred

TCR-expressing cells amongst total CD4+ T cells was reduced during DSS+IL10R colitis

(Figure 3.8C), implying that these antigens are relatively less important during colitis despite their bloom in the lumen. We confirmed in vitro that the luminal antigens for DP1 and NT2 increased with colitis (Figure 3.8D), as predicted based on 16S rRNA sequencing (Figure 3.6F).

By contrast, MA antigen showed lower stimulatory ability than luminal antigen for DP1 and

NT2 even during colitis (Figure 3.8D). We also checked that the Helicobacter spp.-reactive

TCRs (Figure 2.1) did not respond to these Bacteroides strains (Figure 3.9B). Although it remains possible that these Bacteroides-reactive TCR clones do not compete well in the gut or

are not representative of polyclonal T cell responses to Bacteroides, these data suggest that the marked expansion of luminal Bacteroides spp. in this model of colitis does not elicit a corresponding increase in antigen-specific T cell responses.

Pathogenic potential of Helicobacter-reactive TCRs

The differentiation of colonic Treg TCRs into Teff cells during colitis (Figure 3.1) suggests that the altered T cell response to bacterial antigens may contribute to colonic inflammation. To test the pathogenic potential of these Helicobacter spp.-reactive TCRs, we adoptively transferred naïve CT6 Tg cells into Rag1–/– hosts with or without H. apodemus inoculation. In contrast with wild-type hosts, H. apodemus drove antigen-specific Teff generation of CT6 Tg cells (Figure 3.10A) in Rag1–/– hosts likely due to expansion in a lymphopenic environment. In line with a Teff response, we observed colonic inflammation in

CT6-transferred hosts only in the presence of H. apodemus as evidenced by increased colon weight/length ratio and crypt dropout in histology (Figure 3.10B and C). Similarly, Teff response of CT2 Tg cells to H. typhlonius lead to colonic inflammation in Rag1–/– hosts (Figure 3.11). We did not note major weight loss induced by these TCR Tg cells and/or Helicobacter spp. during the time frame of this experiment (Figure 3.11Dand E), in contrast with polyclonal T cell transfer models164. This could be due to limited systemic effects from a single TCR clone or differences

in gut microbiota composition. Although Helicobacter spp. without T cell transfers have been reported to induce colitis in Rag-deficient mice165–168, we did not observe inflammation caused by these two strains during the period of the experiment (Figure 3.10 and 3.11). Thus, these data demonstrate the potential pathological consequences of antigen-specific Teff expansion against gut bacteria.

Finally, mucosal associated enterohepatic Helicobacter spp. in humans have been suggested to be associated with IBD169. We have also detected the presence of Helicobacter spp. in patients with CD or UC by 16S rRNA sequencing of fecal or colonoscopy samples (Figure

3.12). However, it remains to be established whether these Helicobacter spp. play a similar immunomodulatory role in humans as seen in our mouse studies.

3.5 Discussion

Based on this study of T cell responses to commensal antigens during experimental colitis, we make the following observations: First, effector T cell responses during colitis are often to commensal antigens normally presented to the immune system during homeostasis, and not to antigens normally excluded by the mucosal barrier. Second, commensal bacterial species vary widely in their ability to induce T cell responses due in part to their anatomic location relative to the mucosal surfaces. Third, constitutively presented antigens appear to primarily elicit Treg cell responses during homeostasis, implying that tolerance to these antigens is important to preventing colitis. Finally, Helicobacter spp. are important inducers of T cell responses during homeostasis and colitis. Thus, these data suggest a model whereby Treg cell-mediated tolerance, and not effector cell mediated immunity, is required against commensal bacteria such as Helicobacter spp. that routinely interact with the host immune system.

Our initial goal was to study the T cell response to alterations in gut microbiota structure, a.k.a dysbiosis, that occurs with colitis and IBD and has been proposed to be involved in disease pathogenesis133,135,136. However, rather than observing a dominant effector T cell response to

Bacteroides spp. that bloom during colitis, the major stimulators were Helicobacter spp. that routinely interact with T cells during homeostasis. These data do not exclude the possibility that dysbiosis of Bacteroides spp. may exert non-antigen dependent effects on T cell immunity through changes in short chain fatty acids170–172, polysaccharides173, and aryl hydrocarbon

receptor ligands173. Furthermore, as our studies were done in specific-pathogen-free mice, variability in gut flora composition as well as strain-level differences could affect the functional outcome of specific bacteria. Nonetheless, these data suggest that dysbiosis during intestinal inflammation may not provide an important antigen-specific trigger of effector responses that contribute to colitis.

The relative inefficiency of Bacteroides spp. to induce T cell activation is correlated with their bacterial distribution, as they are preferentially found in the lumen. By contrast, mucosal associated Helicobacter spp. were potent stimulators of T cell response. This is consistent with a recent study of SFB showing that tight attachment to the intestinal epithelium plays an important role in eliciting Th17 cells173. Thus, understanding the adaptive immune response to commensal bacteria may be facilitated by analysis of mucosal- or epithelial-associated, and not luminal, bacteria.

Our observation that the normal pTreg development to Helicobacter spp. is skewed towards Th17 effector response during colitis is also consistent with a recent paper studying T cell response to H. hepaticus126. Considering that Helicobacter spp. are pathobionts that can induce or enhance colitis in several mice models, these data therefore argue that our current notion of Treg inducing bacteria as being “good bacteria” that are protective against colitis may be incomplete21,174. In fact, T cell development to gut bacteria may be context-dependent, being tolerogenic during homeostasis, and inflammatory during lymphopenia or experimental colitis. 61

A final implication of this study is that T cell-mediated intestinal inflammation may be driven by bacteria that are always in contact with the adaptive immune system, rather than species that are mostly excluded from being presented to T cells during homeostasis. This contrasts with a previous study of CBir1 TCR Tg cells, which recognize a commensal bacteria-expressed flagellin173 that is presented to the immune system primarily during inflammation175. In this case, the CBir1 antigen is normally not seen by the immune system and might be considered a pathogen when seen in the context of inflammation. However, in the

DSS+IL10R model of colitis, this type of immune response to commensal antigens appears to be less relevant. Thus, our studies bring up an interesting question, that is, to what extent is the human intestinal inflammatory T cell response directed towards commensal antigens that the host is commonly in contact with, i.e. akin to “self” antigens, or commensal antigens that are only presented during injury, i.e. “foreign” antigens.

3.6 Figures

A B cLP

1 0 0 8 0 T cell * * * * * * * 8 0 * * *

4d 7d 6 0 cells (%) cells

cells cells (%) 6 0

+ + IgG 4 0

DSS 4 0 of TCR of of TCR of 2 0

7d 2 0 Teff IL10R Treg

0 0

2 6

T T T

CT2 CT6T CT2 CT6

C C C C CT2 C IgG DSS+αIL10R cLP 6 0 3 0 * * * *

cells (%) cells 4 0 2 0

cells (%) cells

+ +

GFP

+ + 17A

- n s of TCR of

IL 2 0 1 0

of TCR of

+ +

A * * * * *



- IFN

IL17 0 0

6 6

2 2

T T T

CT2T CT6 CT2 CT6

C C

C C IFNYFP D cLP E cLP CT2 CT6 * * * * * * * * 1 0 0 1 . 0

IgG * * * * 0 . 8

DSS+IL10R (%) cells +

cells cells (%) 0 . 6 + 5 0

0 . 4 *

of CD4 of +

Relative Count Relative 0 . 2 TCR

divisions of TCR of divisions 0 0 . 0

2 6

6 2

T T T

CT2T CT6 CT2 CT6

C C C Cell Trace Violet C

Figure 3.1 Colonic Treg TCRs (CT2 and CT6) drive effector T cell development in inflammation.

(A) Experimental model. CD45.1 4-5 week old SPF mice were administered αIL10R (1 mg/mouse) on day 0 and kept on 1% DSS water for 7 days to initiate colitis. Control mice were given isotype IgG (1 mg/mouse) on day 0. Four days after initiation of colitis, congenically marked naïve CT2/CT6 Tg cells (105) were intravenously transferred and analyzed 7 days later.

(B to D) Effector cell induction and expansion with colitis. Transferred TCR Tg cells from the colon lamina propria (cLP) were analyzed by flow cytometry for (B) development of Teff

(CD44hi CD62Llo Foxp3–) and Treg (Foxp3+) makers (p=0.000003; 0.0007; 0.0024; 0.0157; n=10; Student’s t-test); (C) upregulation of cytokines using IL-17AGFP and IFNγYFP

(p=0.000001; 0.0007; 0.0029; n=10 for CT2; n=7 for CT6; Student’s t-test); (D) proliferation indicated by Cell Trace Violet (CTV) dilution (p=0.000002; 0.00002; n=10 for CT2; n=7, 8 for

CT6; Student’s t-test); and (E) expansion indicated by the in vivo frequency amongst the host

CD4+ T cells (p=0.00005; 0.0275; n=10 for CT2; n=10, 11 for CT6; Student’s t-test). Bars indicate mean ± SEM. *p < .05, **p < .01, ***p < .001, ****p < .0001.

A B * * 1 2 0 IgG 6 0 * * D S S + Ig G 1 1 5 D S S +  IL 1 0 R n s 4 0 1 1 0 * 1 0 5

(mg/cm) 2 0

1 0 0 % of initial ofinitial % weight

9 5 Colonweight/length 0

G G

d0 d7 d14 IgG

IL10R



DSS+IgG

DSS+ D C cLP

n s 8 0 5 0 * * * * 6 * * * 5 * * * * n s * * * * * * * n s * * * *

4 0 ) 4

)

5 5

6 0 4 10

(%) 3 0 3

(%) n s

(х10 (

2 0 2 Teff

4 0 Treg 2

n s Teff Treg n s 1 0 1

2 0 0 0 0

IgG IgG IgG

IgG

IL10R IL10R IL10R

IL10R

α α α

DSS+IgG DSS+IgG DSS+IgG

DSS+IgG

DSS+ DSS+ DSS+ DSS+ D

A E

- -

1 0 0

SSC

SSC FSC

(%) 8 0

FSC-A FSC-H SSC-H 6 0

Treg 4 0 P h y lu m B a c te ro id e te s

2 0 F ir m ic u te s

CD3 Foxp3

Dump P ro te o b a c te r ia Relative Relative abundance

IgG

IL10R IL10R α

CD44 CD4 CD45 α

DSS+IgG DSS+

Teff CD62L

CD44

Figure 3.2 DSS+IL10R treatment induces colitis and effector T cell responses.

DSS or DSS+IL10R mediated colitis was induced per Figure 3.1A, and assessed for: (A) Body weight change (two-way repeated measures ANOVA with Tukey’s post-hoc test: p=0.0163; n=13, 14, 14). (B) Colon weight/length ratio at 2 weeks (one-way ANOVA with Tukey’s post-hoc test: p=0.0015 IgG vs DSS+αIL10R; 0.0082 DSS+IgG vs DSS+αIL10R; n=6). (C)

Percentage and number of Teff (CD44hi CD62Llo) or Treg (Foxp3+) cells by flow cytometry from cLP of IgG, DSS+IgG, or DSS+αIL10R-treated mice at 2 weeks (one-way ANOVA with

Tukey’s post-hoc test: Treg%: p=0.0000005 IgG vs DSS+αIL10R; 0.00002 DSS+IgG vs

DSS+αIL10R; Teff number: 0.0002 IgG vs DSS+αIL10R; 0.0002 DSS+IgG vs DSS+αIL10R;

Treg number: 0.00003 IgG vs DSS+αIL10R; 0.00005 DSS+IgG vs DSS+αIL10R; n=8). (D)

Gating strategy for (C). (E) Bacterial composition changes with colitis. Mean relative bacterial frequencies at the phyla level by 16S rRNA sequencing of terminal fecal samples at 2 weeks are shown (n=8, 8, 4, 8). Bars indicate mean ± SEM. *p < .05, **p < .01, ***p < .001, ****p <

.0001.

A IgG (n=5) DSS+αIL10R (n=6) 3 3 Tissue Population Cells (х10 ) Reads Unique TCRs Cells (х10 ) Reads Unique TCRs Tnaive 18 ±2 10025 ±779 505 ±57 43 ±16 9592 ±804 370 ±49 cLP Treg 15 ±4 11433 ±1824 336 ±48 32 ±5 10303 ±1181 332 ±24 Teff 24 ±7 11831 ±2144 270 ±27 53 ±17 7836 ±532 236 ±20 Tnaive 246 ±83 10647 ±829 454 ±26 847 ±66 11772 ±1871 519 ±31 dMLN Treg 32 ±9 9107 ±928 391 ±32 151 ±26 8496 ±1035 449 ±17 Teff 25 ±7 10795 ±1241 297 ±26 158 ±53 11384 ±1199 317 ±21 B C cLP IgG Template Switch Multiplex 4 0 DSS+αIL10R 2 0

1 0

Percentage in datasetin Percentage 0

TRAV1

TRAV3 TRAV4 TRAV5 TRAV6 TRAV7 TRAV8 TRAV9

TRAV21

TRAV10 TRAV11 TRAV12 TRAV13 TRAV14 TRAV16 TRAV17 TRAV19

Top 25 Teff TCRs found in DSS+αIL10R D dMLN E mouse Teff Comparisons of TCR repertoires 5 Treg within individuals between individuals Teff 4 Treg 1 . 0 1 . 0 n s n s Teff 3 0 . 8 0 . 8 IgG Treg Teff 2 0 . 6 0 . 6 Treg Teff 1 0 . 4 0 . 4 Treg Teff

n s n s 6 Horn similarity index similarity Horn

- 0 . 2 0 . 2 Treg n s n s Teff 5 0 . 0 0 . 0 Treg Treg Teff Teff Tnaive Treg Teff Teff % in cLP

4 IL10R Morisita vs. vs. vs. vs. vs. vs. Treg [0-0.2) α Teff Tnaive Tnaive Treg Tnaive Treg Teff 3 [0.2-0.4) Treg [0.4-1)

DSS+ Teff 2 [1-2) Treg [2-5) Teff 1 [5-10) Treg [10-100) TCR T7-1

Figure 3.3 Effects of DSS+IL10R-mediated colitis on the TCR repertoire.

Colitis was induced in TCR Tg mice as per Figure 3.1A. (A) Summary of cell number, sequencing reads, and unique TCRαs (TRAV_CDR3) for each of the sorted T cell populations in the cLP or dMLN used for the TCR repertoire analysis with multiplex PCR. (B) Correction factor for individual TRAVs. Two biologic, each with 2 technical, replicates were sequenced using multiplex or template switch PCR. The mean TRAV percentages are shown. Correction factor = TRAV percentage in template switch divided by percentage in multiplex sequences. (C)

Increased colonic Treg and Teff clonality with inflammation. Shown are the mean Renyi entropy

(y-axis), a measure of diversity in the TCR repertoires, versus order (x-axis), i.e. the weight of high-frequency clones in the analysis. A more rapid drop in entropy with increasing order indicates greater dominance by higher frequency clones. (D) Morisita-Horn similarity comparison of TCRα sequences from the dMLN between two different T cell subsets within each mouse (left) or between mice comparison of each T cell subset (right). Bars indicate mean ±

SEM. Student’s t-test. (E) Heatmap showing the percentage of top 25 Teff TCRs by mean frequency (right to left) from DSS+αIL10R mice, and their corresponding percentages in

IgG-treated control mice.

A Comparisons of cLP TCR repertoires within individuals between individuals

0 . 8 0 . 8 *

* * n s 0 . 6 0 . 6 n s n s *

0 . 4 0 . 4 Horn similarity Horn similarity index

- 0 . 2 0 . 2

0 . 0 0 . 0

Morisita Treg Teff Teff Tnaive Treg Teff vs. vs. vs. vs. vs. vs. Tnaive Tnaive Treg Tnaive Treg Teff B Teff Treg 1 2

3 IgG 4

5 Mouse #

1 2 Percentage in cLP [0-0.006)

3 [0.006-0.09) IL10R

 [0.09-0.36) 4 [0.36-0.9)

DSS+ [0.9-1) 5 [1-1.6) [1.6-2.3) 6 [2.3-4) [4-100) Top 25 Teff TCRs for each mouse C D T7-1 in cLP TCR repertoire T7-1+ cells in cLP after in vivo transfer

2 5 IgG 2 0 D S S +  IL 1 0 R

1 5

1 0 1 1 in (%) subset

- 5 T7

Teff

Treg Tnaive

Figure 3.4 Treg and Teff subsets show increased TCR overlap during colitis.

(A to C) Analysis of TCRα repertoires from Tnaive (CD44lo CD62hi), Treg (Foxp3+), and Teff

(CD44hi CD62Llo) cells in the cLP of TCli TCRβ Foxp3IRES-Thy1.1 Tcra+/− mice 2 weeks after initiation of IgG or DSS+αIL10R. n=5, 6. (A) Morisita–Horn similarity comparison between two different T cell subsets within each mouse (left) or between different mice within each T cell subset (right). An index value of 1 indicates that the two samples are completely similar and an index value of 0 means they are completely dissimilar (left: p=0.009; n=5,6; right: p=0.033;

0.014; n=10,15; Student’s t-test). (B) Heatmap showing the top 25 Teff TCRs in one mouse per row and their corresponding percentage in the Treg subset. Note that each column does not represent one TCR across all mice. (C) Percentage of T7-1 TCR in repertoire of Tnaive, Treg, and Teff subsets. Each dot represents data from an individual mouse. (D) In vivo analysis of T7-1

TCR. T7-1 was retrovirally transduced into in vitro activated naïve TCliβ Rag1–/– Tg cells and

2x105 cells were transferred into IgG or DSS+αIL10R hosts as indicated in Fig. 1A. Seven days post-transfer, cells from the cLP were analyzed by flow cytometry for Teff and Treg cells, and the in vivo frequency amongst the host CD4+ T cells (p=0.029; n=4; Student’s t-test). Bars indicate mean ± SEM. *p < .05, **p < .01, ***p < .001, ****p < .0001.

A dMLN

0 .0 1 5 n s 4 0 * 2 0 p = 0 .0 5 6 8 3 0 3 0 1 5

cells cells (%) 0 .0 1 0 2 0 + 2 0 1 0

0 .0 0 5 1 0 n s

1 0 5 of Cbir1 cells (%) cells Cbir1 of

Cbir1 CD4 of 0 .0 0 0 0 0 0

Teff

Treg of Cbir1 cells (%) cells Cbir1 of Treg

Divided Divided of Cbir1 cells (%)

IgG IgG IgG IgG

IL10R IL10R IL10R IL10R

α α α α

DSS+ DSS+ DSS+ DSS+

W W

- -

SSC

Dump

FSC SSC

FSC-A FSC-H SSC-H CD4

CBir1 Tg Treg

Teff

8.3

CD25

CD62L CD45.2

CD44 CD44 CD45.1 CD45.1

Divided RelativeCount

Cell Trace Violet

Figure 3.5 CBir1 TCR Tg cells become Teff, and not Treg, cells during DSS+IL10R colitis.

Congenically marked naïve CBir1 Tg cells (2х105) were intravenously transferred into IgG or

DSS+αIL10R mice and analyzed 7 days later as indicated in Figure 3.1A. (A) Transferred CBir1

Tg cells from dMLN were analyzed by flow cytometry for expansion based on the frequency of

CBir1 cells amongst the host CD4+ T cells; proliferation reported by CTV dilution; and the development of Teff (CD44hi CD62Llo Foxp3–) and Treg (CD25+) markers (p=0.0353; n=5;

Student’s t-test). Bars indicate mean ± SEM. *p < .05, **p < .01, ***p < .001, ****p < .0001.

(B) Gating strategy for (A).

A B

1 0 0 1 0 0 F a m i l y

H e l i c o b a c t e r a c e a e B a c t e r o i d a c e a e 8 0 8 0

(%) S 2 4 - 7 (%) U n c C l o s t r i d i a l e s P r e v o t e l l a c e a e 6 0 6 0 M y c o p l a s m a t a c e a e

P h y l u m P a r a p r e v o t e l l a c e a e R u m i n o c o c c a c e a e 4 0 B a c t e r o i d e t e s 4 0 L a c h n o s p i r a c e a e F i r m i c u t e s P o r p h y r o m o n a d a c e a e P r o t e o b a c t e r i a L a c t o b a c i l l a c e a e 2 0 T e n e r i c u t e s 2 0

Relative abundance Relative E r y s i p e l o t r i c h a c e a e Relative abundance Relative c y a n o b a c t e r i a o t h e r

O t h e r U n c Y S 2 0 0 D e f e r r i b a c t e r a c e a e

R i k e n e l l a c e a e

IgG IgG IgG

IgG O d o r i b a c t e r a c e a e

IL10R IL10R IL10R IL10R

α α α α

DSS+ DSS+ DSS+ DSS+ Lumen MA Lumen MA

C D OTUs enriched during colitis

U n c A l l o b a c u l u m

U n c B a c t e r o i d a l e s I g G L u m e n U n c P a r a b a c t e r o i d e s D S S +  L 1 0 R

U n c B a c t e r o i d a l e s

U n c B a c t e r o i d e s

B a c t e r o i d e s a c i d i f a c i e n s PC2 21.3% PC2

U n c A l l o b a c u l u m

U n c P r e v o t e l l a c e a e

H e l i c o b a c t e r t y p h l o n i u s

B a c t e r o i d e s v u l g a t u s

0 5

1 2 PC1 66.1% 1

IgG U n c B a c t e r o i d a l e s Lumen B a c t e r o i d e s a c i d i f a c i e n s I g G DSS+αIL10R M A D S S +  L 1 0 R IgG U n c B a c t e r o i d e s MA B a c t e r o i d e s v u l g a t u s DSS+αIL10R U n c P r e v o t e l l a c e a e

H e l i c o b a c t e r t y p h l o n i u s

0 0 0

1 2 3 16S reads (%)

E Abundance of OTU: F Abundance of OTU: H. typhlonius H. apodemus B. vulgatus B. acidifaciens B. uniformis

4 0 8 0 4 0 6 1 . 0 * * * * * * * * * * * * 0 . 8 3 0 6 0 3 0 4 0 . 6 * * * 2 0 4 0 2 0 0 . 4 n s 2

1 0 2 0 1 0 * * 16S reads (%) reads 16S 16S reads (%) reads 16S n s 0 . 2

0 0 0 0 0 . 0

IgG IgG IgG IgG

IgG IgG IgG IgG IgG IgG

IL10R IL10R IL10R IL10R

IL10R IL10R IL10R IL10R IL10R IL10R

α α α α

α α α α α α

DSS+ DSS+ DSS+ DSS+

DSS+ DSS+ DSS+ DSS+ DSS+ DSS+ Lumen MA Lumen MA Lumen MA Lumen MA Lumen MA

Figure 3.6 DSS+αIL10R colitis is associated with differential changes of bacterial composition in the lumen and mucosa.

(A to D)16S rRNA sequencing of colonic lumen contents or MA preparations 2 weeks after initiation of IgG or DSS+αIL10R. n=8. Data shown are mean bacterial changes at the phyla (A) or family (B) level, and principal coordinates analysis on unweighted UniFrac distances (C). (D)

Bacteria enriched during colitis. Shown are OTUs enriched in DSS+αIL10R mice with average percentage >1% and Benjamini-Hochberg adjusted p value <0.05 (Mann-Whitney U) from lumen contents or MA preparations. (E) Increase of H. typhlonius in the mucosa with colitis.

Percentages of H. typhlonius and H. apodemus OTUs are shown (Benjamini-Hochberg adjusted p value: p=0.0009; 0.0023; 0.0277; n=8; Mann-Whitney U test). (F) Marked expansion of

Bacteroides species in the lumen with colitis. Percentages of B. vulgatus, B. acidifaciens, and B. uniformis OTUs are shown (Benjamini-Hochberg p=0.0009; 0.0086; 0.0009; 0.0086; 0.0266; n=8;

Mann-Whitney U test). Bars indicate mean ± SEM. *p < .05, **p < .01, ***p < .001, ****p <

.0001.

lumen MA 4 n s 3 n s

3 2 2 1

1 (to average in IgG)in average (to

Relative 16S amount 16S Relative 0 0

IgG IgG

IL10R IL10R

α α

DSS+ DSS+

Figure 3.7 Quantification of 16S rRNA gene abundance in the lumen or MA preparation.

The relative amount of 16S rRNA is estimated based on 1/(2^Ct from real-time PCR) × DNA amount/mg of fecal or MA sample. Values are then normalized to the average in the IgG condition, and therefore indicate the relative 16S rRNA fold change compared to controls (IgG). n=6. Bars indicate mean ± SEM. Student’s t-test.

A B TCR stimulation in vitro by isolates: in vivo transfer of DP1 cells (dMLN) 4 0 8 0 2 0 D P 1 N T 2 C T 7 6 0 n s

3 0 6 0 1 5

(%) IgG +

2 0 4 0 1 0 DSS+αIL10R 4 0

GFP

cells (%) cells

- +

1 0 2 0 5 NFAT 2 0

0 0 0

Relative Count Relative Divided DP1 Divided

vulgatus vulgatus

vulgatus IgG DSS

uniformis uniformis uniformis

No antigen No antigen No antigen No

B. B. B.

acidifaciens acidifaciens acidifaciens

B. B.

B. Cell Trace Violet +αIL10R

B. B. B. C D in vivo transfer of TCR+ cells (dMLN) TCR stimulation in vitro 0 .1 0 * IgG * n s 4 0 6 0 0 . 1 0 3 0 D P 1 N T 2 0 .0 8 D S S +  IL 1 0 R n s ns 3 0

0 .0 6 0 . 0 8 (%)

4 0 +

0 .0 4 * * 2 0 cells cells (%)

cells cells (%) 0 . 0 6 n s n s 2 0

+ GFP

0 .0 2 - 2 0

0 .0 0 0 . 0 4 * * 1 0

1 7

2 1 0

NFAT

of TCR of

of CD4 of

C D

+ 0 . 0 2 0 0

Teff

TCR

IgG IgG IgG

0 . 0 0 0 IgG

1 2

1 2 7

IL10R IL10R IL10R IL10R

P T

P T T

α α α α

D N

D N C TCR

TCR source: Ag

No Antigen No Antigen No

DSS+ DSS+ DSS+ DSS+ Lumen MA Lumen MA

Figure 3.8 Expansion of Bacteroides species during colitis does not enhance TCR-specific T

cell responses.

(A) Antigenic reactivity of Bacterioides-reactive TCRs used. In vitro stimulation by the

Bacteroides isolates are shown as per Figure 2.1A. 2-3 independent experiments. (B and C) In vivo

expansion and effector cell development of Bacteroides-reactive T cells. Congenically marked

naïve DP1 Tg cells (105) were transferred into CD45.1 hosts as indicated in Figure 3.1A, and

analyzed 7 days post-transfer by flow cytometry for (B) CTV dilution in the dMLN (n=7), (C, left)

frequency amongst the host CD4+ T cells (p=0.0005; 0.047; n=7 for DP1 and NT2; n=9 for CT7;

Student’s t-test), and (C, right) development of Teff (CD44hi CD62Llo Foxp3–) (n=7 for DP1 and

NT2; n=11 for CT7; Student’s t-test). NT2 and CT7 (C) were retrovirally transduced into in vitro

activated naïve Vα2– TCliβ Tg cells from Rag1+/– (black) or Rag1–/– (blue) mice before transfer of

2x105 cells. (D) In vitro reactivity to in vivo Ag preparations is consistent with Bacteroides expansion by 16S rRNA analysis. Colonic lumen contents or MA preparations from IgG or

DSS+αIL10R mice were tested as per Figure 2.1A. 2 independent experiments. Bars indicate mean

± SEM. *p < .05, **p < .01, ***p < .001, ****p < .0001.

A 5 0 D P 1 6 0 D P 1 1 0 0 N T 2 1 0 0 N T 2 2 0 C T 7

(%) (%)

(%) 4 0 8 0 8 0 +

+ 1 5 + 4 0 3 0 6 0 6 0

1 0

GFP

- - - 2 0 4 0 4 0 2 0 5

1 0 2 0 2 0

NFAT NFAT NFAT 0 0 0 0 0 B. vulgatus: – + + B. acidifaciens: – + + – + + B. uniformis: – + + – + + αMHC II – – + αMHC II – – + – – + αMHC II – – + – – +

B C TCR stimulation in vitro by isolates: TCR stimulation in vitro by isolates: 1 0 1 0 1 0 1 0 1 0 1 0 1 0

D P 1 N T 2 C T 7 C T 2 C T 6 C T 9 T 7 - 1 (%)

(%) 8 8 8 8 8 8 8

+ +

6 6 6 6 6 6 6

GFP GFP - - 4 4 4 4 4 4 4

2 2 2 2 2 2 2 NFAT

NFAT 0 0 0 0 0 0 0

vulgatus vulgatus vulgatus vulgatus

uniformis uniformis uniformis uniformis

apodemus apodemus apodemus

typhlonius typhlonius typhlonius

Noantigen Noantigen Noantigen Noantigen Noantigen Noantigen Noantigen

B. B. B. B.

acidifaciens acidifaciens acidifaciens acidifaciens

B. B. B. B.

H. H. H. H.

B. B. B. B.

Figure 3.9 Specificity of DP1/NT2/CT7 TCRs for Bacteroides spp.

(A) Reactivity of DP1/NT2/CT7 TCRs to Bacteroides spp. are blocked by antibody to MHC II as per Figure 2.2C. (B) DP1/NT2/CT7 TCRs do not react to Helicobacter spp. in vitro using the assay described in Figure 2.1A. (C) CT2/CT6/CT9/T7-1 TCRs do not react to Bacteroides spp. in vitro using the assay described in Figure 2.1A. 2-3 independent experiments. Bars indicate mean ± SEM.

A B dMLN * * *

2 0 1 0 0 6 0 * * * * s

l * * * l

e * * *

+ n

1 5 e

cells (%) cells

cells )

/ 4 0

f i

1 0 6 5 0

(

T n

of CD45 of 2 0

5 l

% of CT6 CT6 of %

CT6 CT6 0 0 0

. .

Colon weight/length (mg/cm) weight/length Colon

o o

p p

CT6

a a

Teff

Treg

. .

H H

H. apo. H. apo. H.

t CT6 + H. apo.

CT6 + + CT6

No treatment No No treatment No C No treatment

**** 4

m **** m ** CT6 3

2 number/100 1

H. apo. Crypt

CT6

H. apo. H. apo. H. CT6 + + CT6

CT6 + H. apo. treatment No

Figure 3.10 Pathogenic potential of naive Helicobacter-reactive CT6 cells in lymphopenic mice.

Six week old Rag1–/– mice were given H. apo. with or without naïve CT6 T cell transfer. H. apo. was gavaged 3 times total every other day. Naïve CT6 cells (105) was transferred at the time of last gavage. (A) Flow cytometry analysis for the frequency of Tg cells amongst the host CD45+ cells

(one-way ANOVA, Turkey’s post-hoc test: p=0.0002 CT6 vs CT6+H. apo.; n=3, 5, 5, 5), and development of Treg (Foxp3+) and Teff (CD44hi CD62Llo Foxp3–) markers (n=5) in dMLN at 6

weeks. (B) Colon weight/length ratio at 6 weeks (one-way ANOVA with Turkey’s post-hoc test: p=0.0003 No treatment vs CT6+H. apo.; 0.00002 CT6 vs CT6+H. apo.; 0.0005 H. apo. vs

CT6+H. apo.; n=3, 5, 5, 5). (C) Representative haematoxylin/eosin-stained section of the ascending colon at 6 weeks (original magnification ×10), and quantification of crypt number

(one-way ANOVA with Tukey’s post-hoc test: p=0.00007 No treatment vs CT6+H. apo.;

0.00005 CT6 vs CT6+H. apo.; 0.0003 H. apo. vs CT6+H. apo.; n=3). The number of crypts observed per 100μm of ascending colon was averaged from five fields. Decreased crypt number reflect crypt dropout due to inflammation. Bars indicate mean ± SEM. *p < .05, **p < .01, ***p

< .001, ****p < .0001.

A B

s l

l dMLN dMLN * * *

e t

c 3 0 8 0 * * * *

1 0 0 g l

+ *

Cells

4 )

+ 8 0

cells 6 0

D g

2 0 m

6 0

f 2

g 4 0

4 0 m

ofCD45

g (

1 0

f T

n 2 0

o 2 0

% % % ofCT2

C 0 0 0

% % CT2

CT2 + H. typh.

C C C D N o t r e a t m e n t t 1 6 0

h C T 6 g

i H . a p o . e 1 4 0

w C T 6 + H . a p o .

CT2 d

o 1 2 0 *

i t

i 1 0 0

. 8 0 0 1 2 3 4 5 6 W e e k s

typh E H.

t 1 6 0 C T 2 h

g H . t y p h . i

e C T 2 + H . t y p h .

1 4 0

. y

d n s o

typh 1 2 0

i t

i 1 0 0

CT2 CT2 + % 8 0 0 1 2 3 4 5 6 W e e k s

Figure 3.11 Bacterial-specific induction of colitis by CT2 in lymphopenic mice.

(A to C) CT2 Tg cells induce colonic inflammation only in the presence of H. typhlonius. Six week old Rag1–/– mice were given H. typh. with or without naïve CT2 T cell transfer, similar to

Figure 3.10 (A) Flow cytometry analysis for the frequency of Tg cells amongst the host CD45+ 81

cells (left) (one-way ANOVA with Turkey’s post-hoc test: p=0.0235 CT2 vs CT2+H. typh.; n=4,

5, 7), and development of Treg (Foxp3+) and Teff (CD44hi CD62Llo Foxp3–) markers (right)

(n=7) in dMLN at 6 weeks. (B) Colon weight/length ratio at 6 weeks (one-way ANOVA with

Tukey’s post-hoc test: p=0.00007 CT2 vs CT2+H. typh.; 0.00003 H. typh. vs CT2+H. typh.; n=4,

5, 7). (C) Representative haematoxylin/eosin-stained section of the transverse colon at 6 weeks

(original magnification ×10). (D) Body weight change of CT6 experiment shown in Figure 3.10

(two-way repeated measures ANOVA with Tukey’s post-hoc test: p=0.0247 No treatment vs

CT6+H. apo.; n=4, 5, 7). (E) Body weight change of CT2 experiment in (A to C) above. n=4, 5,

7; two-way repeated-measures ANOVA. Bars indicate mean ± SEM. *p < .05, **p < .01, ***p

< .001, ****p < .0001.

A Fecal samples Colonoscopy samples

Healthy UC CD Healthy UC CD

Number of subjects 39 14 31 18 6 12 Age years (mean ±SD) 51.5±21.6 49.8±16.1 43±15.1 53±8.2 44.5±17 40±14.3 BMI (mean±SD) 21.4±8.7 29.4±7.9 25.7±5.6 26.4±4 25.1±5 27.8±5..3 Females (N, %) 22 (73%) 8 (42.9%) 20 (66.6%) 11 (55%) 3 (50%) 8 (57%) Years since diagnosis (mean ±SD) - 8.1±5.3 17.3±10.8 - 8.2±2.8 12.3±8.2 Helicobacter OTUs identified (N, %) H. apodemus 7 (17.9%) 1 (7.1%) 8 (25.8%) 9 (50%) 3 (50%) 8 (66.7%) H. mastomyrinus 8 (20.5%) 4 (28.6%) 9 (29%) 1 (5.6%) 1 (16.7%) 1 (8.3%) H. typhlonius 0 0 0 8 (44.4%) 3 (50%) 3 (25%)

B Abundance of OTU in fecal samples: H. apodemus H. mastomyrinus 0 .2 0 0 .8 0 .4 0 .1 5 0 .2 0 .1 0

0 .0 5 0 .1 16S reads (%) reads 16S

0 .0 0 0 .0

C D

U C U C

H H

C Abundance of OTU in colonoscopy samples: H. apodemus H. mastomyrinus H. typhlonius 0 .1 2 0 .0 1 5 6 0 .1 0 4 0 .0 1 5 0 .8 0 .0 1 0 0 .6 0 .0 1 0 0 .0 0 5 0 .4 0 .0 0 5

0 .2 16S reads (%) reads 16S

0 .0 0 0 0 .0 0 0 0 .0

D C

C D

D C

U C U C U C

H H H

Figure 3.12 Helicobacter spp are detected in fecal and colonoscopy samples from IBD patients.

(A) Demographic information of subjects and Helicobacter OTUs identified by 16S rRNA sequencing. (B) Percentage of H. apodemus or H. mastomyrinus OTUs of all 16S rRNA

sequences in fecal samples from healthy controls, UC, or CD patients. (C) Percentage of H. apodemus, H. mastomyrinus, or H. typhlonius OTU of all 16S rRNA sequences in colonoscopy samples from healthy controls, UC, or CD patients.

3.7 Tables

Series ID-TRAV ID Primer Sequence

Mi1mx-TRAV1 ACACGACGCTCTTCCGATCTGGTTATCCTGGTACCAGCA

Mi1mx-TRAV2 ACACGACGCTCTTCCGATCTCATCTACTGGTACCGACAGG

Mi1mx-TRAV3 ACACGACGCTCTTCCGATCTGGCGAGCAGGTGGAG

Mi1mx-TRAV4 ACACGACGCTCTTCCGATCTTCTGSTCTGAGATGCAATTTT

Mi1mx-TRAV5-1/4(D) ACACGACGCTCTTCCGATCTATYCGTTCAAATATGGAAAGAAA

Mi1mx-TRAV6-1/2 ACACGACGCTCTTCCGATCTCAGATGCAAGGTCAAGTGAC

Mi1mx-TRAV6-3/4(D) ACACGACGCTCTTCCGATCTAAGGTCCACAGCTCCTTC

Mi1mx-TRAV6-5/7(D) ACACGACGCTCTTCCGATCTGTTCTGGTATGTGCAGTATCC

Mi1mx-TRAV6-6 ACACGACGCTCTTCCGATCTAGATTCCGTGACTCAAACAG

Mi1mx-TRAV7 ACACGACGCTCTTCCGATCTCAKGRCYTCYYTCAACTGCAC

Mi1mx-TRAV8 ACACGACGCTCTTCCGATCTGAGCRTCCASGAGGGTG

Mi1mx-TRAV9 ACACGACGCTCTTCCGATCTCCAGTGGTTCAAGGAGTG

Mi1mx-TRAV10/(D) ACACGACGCTCTTCCGATCTAGAGAAGGTCGAGCAACAC

Mi1mx-TRAV11 ACACGACGCTCTTCCGATCTAAGACCCAAGTGGAGCAG

Mi1mx-TRAV12 ACACGACGCTCTTCCGATCTGGTTCCACGCCACTC

Mi1mx-TRAV13 ACACGACGCTCTTCCGATCTTCCTTGGTTCTGCAGG

Mi1mx-TRAV14 ACACGACGCTCTTCCGATCTGCAGCAGGTGAGACAAAG

Mi1mx-TRAV15 ACACGACGCTCTTCCGATCTCASCTTYTTAGTGGAGAGATGG

Mi1mx-TRAV16 ACACGACGCTCTTCCGATCTGTACAAGCAAACAGCAAGTG

Mi1mx-TRAV17 ACACGACGCTCTTCCGATCTCAGTCCGTGGACCAGC

Mi1mx-TRAV18 ACACGACGCTCTTCCGATCTAACGGCTGGAGCAGAG

Mi1mx-TRAV19 ACACGACGCTCTTCCGATCTGCAAGTTAAACAAAGCTCTCC

Mi1mx-TRAV21 ACACGACGCTCTTCCGATCTGTGCACTTGCCTTGTAGC

Table 3.1 TRAV Multiplex primer sequences.

In the first step PCR, a combination of TRAV-specific forward primers and a common extension sequence 5’-ACACGACGCTCTTCCGATCT-3’ at an equimolar ratio were used with a

Cα-specific reverse primer 5’-TCAGCAGGAGGATTCGGAGTCCCA-3’. In the second step, a step-out PCR was performed using primers containing the MiSeq Universal Adapter sequences followed by a region overlapping that of the first PCR primers. The reverse primer also contains an 8 bp Hamming barcode.

TCR clone TRAV CDR3 a.a. sequence Isolate specificity CT2 TRAV14-3*02 AASAIWNTGYQNFY H. typhlonius CT6 TRAV14-3*01 AASGYSALGRLH H. apodemus & Unc Clostridium spp. CT9 TRAV14-1*01 AASADNRAGNKLT H. typhloniu & H. apodemus T7-1 TRAV7-4*01 AASGWGDSNYQLI H. typhlonius & H. apodemus DP1 TRAV14-1*01 AASTSNNNAPR B. vulgatus & B. acidifaciens NT2 TRAV14D-3 AARSGRSSALGRLHF B. acidifaciens & B. uniformis CT7 TRAV14D-1*01 AASATGDNRIF B. uniformis

Table 3.2 TRAV designation, CDR3 amino acid (a.a.) sequences, and in vitro bacterial reactivity of indicated TCR clones.

Chapter 4: Concluding Remarks and Future Directions

Development of tolerance to Helicobacter species

Our data showed that Helicobacter spp. increased the frequency of colonic Treg cells

(Figure 2.6). This is potentially due to conversion of naïve T cells to Treg cells in the colon draining LNs after bacterial antigen encounter, as indicated by Tg cell studies (Figure 2.1 and

2.4). Therefore, the hosts develop tolerance to Helicobacter species. As Helicobacter species are known to induce gut pathology in several mice strains with immunodeficiency, we predict that pTreg induction by intestinal pathobionts could be involved in tolerance development in wild-type animal. A good model to test this is to use mice deficient in CNS1 which is essential for peripheral Treg cell selection24,25. It would be interesting to investigate whether T cell response to Helicobacter spp. might be skewed towards effector T cell generation in the CNS1-/- hosts, and thus render these mice more susceptible to colonic inflammatory models.

It remains unclear how intestinal APCs interact with bacteria to facilitate pTreg induction.

Previous studies suggest that CD103+ DCs can favor Treg cell selection through the production

18,82,83,86 high of RA and TGFβ . Yet a recent study showed a specific increase in the IL-10

MHCII+CD11b+CD11cint/highCD64+ resident macrophages after H. hepaticus colonization176. H. hepaticus also triggers an anti-inflammatory gene signature in intestinal macrophages through

production of soluble polysaccharide that activates TLR2. As H. hepaticus induces IL-23-driven pathology in the absence of IL-10156, it is reasonable to hypothesize that IL-10 production by macrophages could be essential for tolerance development. We will interrogate this question further with available genetic APC mouse tools coupled with Tg cell transfer.

Besides direct antigen presentation, gut bacteria can also influence CD4 T cells through the production of metabolites. One classic example is bacteria-derived SCFAs, which have been linked to enhanced Treg expansion92. As metabolites exert broad antigen-independent effect, it is possible that Treg induction by Helicobacter spp. could be influenced by metabolites derived from the whole microbiome. Testing our Tg model in GF setting or in hosts with different microbiota will be informative to address this question.

Bacteria contributing to Teff responses during colitis

Our data from both the Tg adoptive transfer study as well as TCR repertoire analysis

(Figure 3.1 and 3.3) indicate that Teff cells share TCRs with Treg cells during colitis, hence, pTreg response to gut bacteria could be diverted to Teff generation. This phenomenon argues that tolerogenic bacteria also contribute to intestinal inflammation during the pathogenesis of IBD.

As we focused on Helicobacter spp. in our study which are known for immune-stimulatory functions, a more global analysis interrogating the effect of other bacterial species are needed.

Understanding how different microbes play a role in IBD will improve our knowledge of the disease, and thus development of more targeted therapies.

We tried to address this question based on geographic locations of gut microbes in our study. We noticed a large bloom of Bacteroides spp. in the lumen in our colitis model, yet these species failed to elicit antigen-specific Teff activation. This is contrary to Helicobacter spp. that reside deeply in the mucus layer, and are potent stimulus for Teff cells under inflammatory condition. Although it is too early to form generalized ideas, our data provide evidence that even in the setting of barrier dysfunction, T cell responses could still be specifically targeted, indicating a different layer of immune-regulation during inflammation. Future studies are needed to clarify how immune system are regulated to respond to different microbes in colitis.

References

1. Brestoff, J. R. & Artis, D. Commensal bacteria at the interface of host metabolism and the

immune system. Nat. Immunol. 14, 676–84 (2013).

2. Maloy, K. J. & Powrie, F. Intestinal homeostasis and its breakdown in inflammatory

bowel disease. Nature 474, 298–306 (2011).

3. Powrie, F. & Mason, D. OX-22high CD4+ T cells induce wasting disease with multiple

organ pathology: prevention by the OX-22low subset. J. Exp. Med. 172, 1701–8 (1990).

4. Wing, K. & Sakaguchi, S. Regulatory T cells exert checks and balances on self tolerance

and autoimmunity. Nat. Immunol. 11, 7–13 (2010).

5. Josefowicz, S. Z., Lu, L.-F. & Rudensky, A. Y. Regulatory T Cells: Mechanisms of

Differentiation and Function. Annu. Rev. Immunol. 30, 531–564 (2012).

6. Powrie, F. & Mason, D. OX-22high CD4+ T cells induce wasting disease with multiple

organ pathology: prevention by the OX-22low subset. J. Exp. Med. 172, 1701–8 (1990).

7. Contractor, N. V et al. Lymphoid hyperplasia, autoimmunity, and compromised intestinal

intraepithelial lymphocyte development in colitis-free gnotobiotic IL-2-deficient mice. J.

Immunol. 160, 385–94 (1998).

8. Sadlack, B. et al. Ulcerative colitis-like disease in mice with a disrupted interleukin-2

gene. Cell 75, 253–61 (1993).

9. Schultz, M. et al. IL-2-deficient mice raised under germfree conditions develop delayed

mild focal intestinal inflammation. Am. J. Physiol. 276, G1461-72 (1999).

10. Chinen, T., Volchkov, P. Y., Chervonsky, A. V & Rudensky, A. Y. A critical role for

regulatory T cell-mediated control of inflammation in the absence of commensal

microbiota. J. Exp. Med. 207, 2323–30 (2010).

11. Obata, Y. et al. The epigenetic regulator Uhrf1 facilitates the proliferation and maturation

of colonic regulatory T cells. Nat. Immunol. 15, 571–9 (2014).

12. Asseman, C., Read, S. & Powrie, F. Colitogenic Th1 cells are present in the

antigen-experienced T cell pool in normal mice: control by CD4+ regulatory T cells and

IL-10. J. Immunol. 171, 971–8 (2003).

13. Ai, T. L., Solomon, B. D. & Hsieh, C.-S. T-cell selection and intestinal homeostasis.

Immunol. Rev. 259, 60–74 (2014).

14. Yadav, M., Stephan, S. & Bluestone, J. A. Peripherally Induced Tregs – Role in Immune

Homeostasis and Autoimmunity. Front. Immunol. 4, 232 (2013).

15. Bilate, A. M. & Lafaille, J. J. Induced CD4 + Foxp3 + Regulatory T Cells in Immune

Tolerance. Annu. Rev. Immunol. 30, 733–758 (2012).

16. Klein, L. & Jovanovic, K. Regulatory T cell lineage commitment in the thymus. Semin.

Immunol. 23, 401–409 (2011).

17. Hsieh, C.-S., Lee, H.-M. & Lio, C.-W. J. Selection of regulatory T cells in the thymus. Nat.

Rev. Immunol. 12, 157–167 (2012).

18. Sun, C.-M. et al. Small intestine lamina propria dendritic cells promote de novo

generation of Foxp3 T reg cells via retinoic acid. J. Exp. Med. 204, 1775–85 (2007).

19. Weiss, J. M. et al. Neuropilin 1 is expressed on thymus-derived natural regulatory T cells,

but not mucosa-generated induced Foxp3 + T reg cells. J. Exp. Med. 209, 1723–1742

(2012).

20. Thornton, A. M. et al. Expression of Helios, an Ikaros Transcription Factor Family

Member, Differentiates Thymic-Derived from Peripherally Induced Foxp3+ T Regulatory

Cells. J. Immunol. 184, 3433–3441 (2010).

21. Atarashi, K. et al. Induction of Colonic Regulatory T Cells by Indigenous Clostridium

Species. Science (80-. ). 331, 337–341 (2011).

22. Lathrop, S. K. et al. Peripheral education of the immune system by colonic commensal

microbiota. Nature 478, 250–4 (2011).

23. Haribhai, D. et al. A Requisite Role for Induced Regulatory T Cells in Tolerance Based on

Expanding Antigen Receptor Diversity. Immunity 35, 109–122 (2011).

24. Zheng, Y. et al. Regulatory T-cell suppressor program co-opts transcription factor IRF4 to

control TH2 responses. Nature 458, 351–356 (2009).

25. Josefowicz, S. Z. et al. Extrathymically generated regulatory T cells control mucosal TH2

inflammation. Nature 482, 395–399 (2012).

26. Gottschalk, R. A., Corse, E. & Allison, J. P. Expression of Helios in Peripherally Induced

Foxp3+ Regulatory T Cells. J. Immunol. 188, 976–980 (2012).

27. Akimova, T., Beier, U. H., Wang, L., Levine, M. H. & Hancock, W. W. Helios Expression

Is a Marker of T Cell Activation and Proliferation. PLoS One 6, e24226 (2011).

28. Haribhai, D. et al. A Requisite Role for Induced Regulatory T Cells in Tolerance Based on

Expanding Antigen Receptor Diversity. Immunity 35, 109–122 (2011).

29. Cebula, A. et al. Thymus-derived regulatory T cells contribute to tolerance to commensal

microbiota. Nature 497, 258–262 (2013).

30. Atarashi, K. et al. Treg induction by a rationally selected mixture of Clostridia strains

from the human microbiota. Nature 500, 232–6 (2013).

31. Atarashi, K. et al. Induction of Colonic Regulatory T Cells by Indigenous Clostridium

Species. Science (80-. ). 331, 337–341 (2011).

32. Geuking, M. B. et al. Intestinal Bacterial Colonization Induces Mutualistic Regulatory T

Cell Responses. Immunity 34, 794–806 (2011).

33. Livingston, M., Loach, D., Wilson, M., Tannock, G. W. & Baird, M. Gut commensal

Lactobacillus reuteri 100-23 stimulates an immunoregulatory response. Immunol. Cell

Biol. 88, 99–102 (2010).

34. Cebula, A. et al. Thymus-derived regulatory T cells contribute to tolerance to commensal

microbiota. Nature 497, 258–262 (2013).

35. Maynard, C. L. & Weaver, C. T. Intestinal Effector T Cells in Health and Disease.

Immunity 31, 389–400 (2009).

36. Belkaid, Y. & Hand, T. W. Role of the Microbiota in Immunity and Inflammation. Cell

157, 121–141 (2014).

37. Niess, J. H., Leithäuser, F., Adler, G. & Reimann, J. Commensal gut flora drives the

expansion of proinflammatory CD4 T cells in the colonic lamina propria under normal and

inflammatory conditions. J. Immunol. 180, 559–68 (2008).

38. Hall, J. A. et al. Commensal DNA Limits Regulatory T Cell Conversion and Is a Natural

Adjuvant of Intestinal Immune Responses. Immunity 29, 637–649 (2008).

39. Ivanov, I. I. et al. Induction of intestinal Th17 cells by segmented filamentous bacteria.

Cell 139, 485–98 (2009).

40. Yang, Y. et al. Focused specificity of intestinal TH17 cells towards commensal bacterial

antigens. Nature advance on, (2014).

41. Goto, Y. et al. Segmented filamentous bacteria antigens presented by intestinal dendritic

cells drive mucosal Th17 cell differentiation. Immunity 40, 594–607 (2014).

42. Gottschalk, R. A., Corse, E. & Allison, J. P. TCR ligand density and affinity determine

peripheral induction of Foxp3 in vivo. J. Exp. Med. 207, 1701–11 (2010).

43. Turner, M. S., Kane, L. P. & Morel, P. A. Dominant Role of Antigen Dose in

CD4+Foxp3+ Regulatory T Cell Induction and Expansion. J. Immunol. 183, 4895–4903

(2009).

44. Hand, T. W. et al. Acute gastrointestinal infection induces long-lived microbiota-specific T

cell responses. Science (80-. ). 337, 1553–1556 (2012).

45. Hadis, U. et al. Intestinal Tolerance Requires Gut Homing and Expansion of FoxP3+

Regulatory T Cells in the Lamina Propria. Immunity 34, 237–246 (2011).

46. Shiomi, H. et al. Gamma Interferon Produced by Antigen-Specific CD4+ T Cells

Regulates the Mucosal Immune Responses to Citrobacter rodentium Infection. Infect.

Immun. 78, 2653–2666 (2010).

47. Rivas, M. N. et al. MyD88 is critically involved in immune tolerance breakdown at

environmental interfaces of Foxp3-deficient mice. J. Clin. Invest. 122, 1933–47 (2012).

48. Rakoff-Nahoum, S., Hao, L. & Medzhitov, R. Role of toll-like receptors in spontaneous

commensal-dependent colitis. Immunity 25, 319–29 (2006).

49. Hall, J. A. et al. Commensal DNA Limits Regulatory T Cell Conversion and Is a Natural

Adjuvant of Intestinal Immune Responses. Immunity 29, 637–649 (2008).

50. Manicassamy, S. et al. Toll-like receptor 2–dependent induction of vitamin A–

metabolizing enzymes in dendritic cells promotes T regulatory responses and inhibits

autoimmunity. Nat. Med. 15, 401–409 (2009).

51. Bouladoux, N. et al. Regulatory role of suppressive motifs from commensal DNA.

Mucosal Immunol. 5, 623–34 (2012).

52. Round, J. L. et al. The Toll-Like Receptor 2 Pathway Establishes Colonization by a

Commensal of the Human Microbiota. Science (80-. ). 332, 974–977 (2011).

53. Rakoff-Nahoum, S., Paglino, J., Eslami-Varzaneh, F., Edberg, S. & Medzhitov, R.

Recognition of Commensal Microflora by Toll-Like Receptors Is Required for Intestinal

Homeostasis. Cell 118, 229–241 (2004).

54. Grainger, J. R., Askenase, M. H., Guimont-Desrochers, F., da Fonseca, D. M. & Belkaid,

Y. Contextual functions of antigen-presenting cells in the gastrointestinal tract. Immunol.

Rev. 259, 75–87 (2014).

55. Coombes, J. L. & Powrie, F. Dendritic cells in intestinal immune regulation. Nat. Rev.

Immunol. 8, 435–46 (2008).

56. Mucida, D. et al. Reciprocal TH17 and Regulatory T Cell Differentiation Mediated by

Retinoic Acid. Science (80-. ). 317, 256–260 (2007).

57. Benson, M. J., Pino-Lagos, K., Rosemblatt, M. & Noelle, R. J. All-trans retinoic acid

mediates enhanced T reg cell growth, differentiation, and gut homing in the face of high

levels of co-stimulation. J. Exp. Med. 204, 1765–1774 (2007).

58. Kinnebrew, M. A. et al. Interleukin 23 production by intestinal CD103(+)CD11b(+)

dendritic cells in response to bacterial flagellin enhances mucosal innate immune defense.

Immunity 36, 276–87 (2012).

59. Satpathy, A. T. et al. Notch2-dependent classical dendritic cells orchestrate intestinal

immunity to attaching-and-effacing bacterial pathogens. Nat. Immunol. 14, 937–48

(2013).

60. Welty, N. E. et al. Intestinal lamina propria dendritic cells maintain T cell homeostasis but

do not affect commensalism. J. Exp. Med. 210, 2011–2024 (2013).

61. Lewis, K. L. et al. Notch2 receptor signaling controls functional differentiation of

dendritic cells in the spleen and intestine. Immunity 35, 780–91 (2011).

62. Welty, N. E. et al. Intestinal lamina propria dendritic cells maintain T cell homeostasis but

do not affect commensalism. J. Exp. Med. 210, 2011–2024 (2013).

63. Farache, J., Zigmond, E., Shakhar, G. & Jung, S. Contributions of dendritic cells and

macrophages to intestinal homeostasis and immune defense. Immunol. Cell Biol. 91, 232–

239 (2013).

64. Shouval, D. S. et al. Interleukin-10 receptor signaling in innate immune cells regulates

mucosal immune tolerance and anti-inflammatory macrophage function. Immunity 40,

706–19 (2014).

65. Mortha, A. et al. Microbiota-Dependent Crosstalk Between Macrophages and ILC3

Promotes Intestinal Homeostasis. Science (80-. ). 343, 1249288–1249288 (2014).

66. Mortha, A. et al. Microbiota-Dependent Crosstalk Between Macrophages and ILC3

Promotes Intestinal Homeostasis. Science (80-. ). 343, 1249288–1249288 (2014).

67. Kappelman, M. D. et al. The Prevalence and Geographic Distribution of Crohn’s Disease

and Ulcerative Colitis in the United States. Clin. Gastroenterol. Hepatol. 5, 1424–1429

(2007).

68. Jostins, L. et al. Host–microbe interactions have shaped the genetic architecture of

inflammatory bowel disease. Nature 491, 119–124 (2012).

69. Khor, B., Gardet, A. & Xavier, R. J. Genetics and pathogenesis of inflammatory bowel

disease. Nature 474, 307–317 (2011).

70. Khor, B., Gardet, A. & Xavier, R. J. Genetics and pathogenesis of inflammatory bowel

disease. Nature 474, 307–317 (2011).

71. Kappelman, M. D. et al. The Prevalence and Geographic Distribution of Crohn’s Disease

and Ulcerative Colitis in the United States. Clin. Gastroenterol. Hepatol. 5, 1424–1429

(2007).

72. Molloy, M. J. et al. Intraluminal Containment of Commensal Outgrowth in the Gut during

Infection-Induced Dysbiosis. Cell Host Microbe 14, 318–328 (2013).

73. Molloy, M. J. et al. Intraluminal Containment of Commensal Outgrowth in the Gut during

Infection-Induced Dysbiosis. Cell Host Microbe 14, 318–328 (2013).

74. Brenchley, J. M. & Douek, D. C. Microbial Translocation Across the GI Tract. Annu. Rev.

Immunol. 30, 149–173 (2012).

75. Raetz, M. et al. Parasite-induced TH1 cells and intestinal dysbiosis cooperate in

IFN-γ-dependent elimination of Paneth cells. Nat. Immunol. 14, 136–142 (2012).

76. Winter, S. E. et al. Host-Derived Nitrate Boosts Growth of E. coli in the Inflamed Gut.

Science (80-. ). 339, 708–711 (2013).

77. Belkaid, Y., Bouladoux, N. & Hand, T. W. Effector and memory T cell responses to

commensal bacteria. Trends Immunol. 34, 299–306 (2013).

78. Irving, P. M. & Gibson, P. R. Infections and IBD. Nat. Clin. Pract. Gastroenterol. Hepatol.

5, 18–27 (2008).

79. Vernacchio, L. et al. Diarrhea in American infants and young children in the community

setting: incidence, clinical presentation and microbiology. Pediatr. Infect. Dis. J. 25, 2–7

(2006).

80. Geuking, M. B. et al. Intestinal Bacterial Colonization Induces Mutualistic Regulatory T

Cell Responses. Immunity 34, 794–806 (2011).

81. Livingston, M., Loach, D., Wilson, M., Tannock, G. W. & Baird, M. Gut commensal

Lactobacillus reuteri 100-23 stimulates an immunoregulatory response. Immunol. Cell

Biol. 88, 99–102 (2010).

82. Benson, M. J., Pino-Lagos, K., Rosemblatt, M. & Noelle, R. J. All-trans retinoic acid

mediates enhanced T reg cell growth, differentiation, and gut homing in the face of high

levels of co-stimulation. J. Exp. Med. 204, 1765–1774 (2007).

83. Mucida, D. et al. Reciprocal TH17 and Regulatory T Cell Differentiation Mediated by

Retinoic Acid. Science (80-. ). 317, 256–260 (2007).

84. Hill, J. A. et al. Retinoic Acid Enhances Foxp3 Induction Indirectly by Relieving

100

Inhibition from CD4+CD44hi Cells. Immunity 29, 758–770 (2008).

85. Nolting, J. et al. Retinoic acid can enhance conversion of naive into regulatory T cells

independently of secreted cytokines. J. Exp. Med. 206, 2131–2139 (2009).

86. Coombes, J. L. et al. A functionally specialized population of mucosal CD103+ DCs

induces Foxp3+ regulatory T cells via a TGF-beta and retinoic acid-dependent mechanism.

J. Exp. Med. 204, 1757–64 (2007).

87. Manicassamy, S. et al. Activation of -Catenin in Dendritic Cells Regulates Immunity

Versus Tolerance in the Intestine. Science (80-. ). 329, 849–853 (2010).

88. Manicassamy, S. et al. Activation of -Catenin in Dendritic Cells Regulates Immunity

Versus Tolerance in the Intestine. Science (80-. ). 329, 849–853 (2010).

89. Singh, N. et al. Activation of Gpr109a, Receptor for Niacin and the Commensal

Metabolite Butyrate, Suppresses Colonic Inflammation and Carcinogenesis. Immunity 40,

128–139 (2014).

90. Furusawa, Y. et al. Commensal microbe-derived butyrate induces the differentiation of

colonic regulatory T cells. Nature 504, 446–450 (2013).

91. Arpaia, N. et al. Metabolites produced by commensal bacteria promote peripheral

regulatory T-cell generation. Nature 504, 451–455 (2013).

92. Smith, P. M. et al. The Microbial Metabolites, Short-Chain Fatty Acids, Regulate Colonic

Treg Cell Homeostasis. Science (80-. ). 341, 569–573 (2013).

101

93. Round, J. L. et al. The Toll-Like Receptor 2 Pathway Establishes Colonization by a

Commensal of the Human Microbiota. Science (80-. ). 332, 974–977 (2011).

94. Albenberg, L. et al. Correlation Between Intraluminal Oxygen Gradient and Radial

Partitioning of Intestinal Microbiota. Gastroenterology 147, 1055–1063.e8 (2014).

95. Bjursell, M. K., Martens, E. C. & Gordon, J. I. Functional Genomic and Metabolic Studies

of the Adaptations of a Prominent Adult Human Gut Symbiont, Bacteroides

thetaiotaomicron , to the Suckling Period. J. Biol. Chem. 281, 36269–36279 (2006).

96. Sonnenburg, J. L. et al. Glycan Foraging in Vivo by an Intestine-Adapted Bacterial

Symbiont. Science (80-. ). 307, 1955–1959 (2005).

97. Li, H. et al. ARTICLE The outer mucus layer hosts a distinct intestinal microbial niche.

Nat. Commun. 6, (2015).

98. Nutsch, K. et al. Rapid and Efficient Generation of Regulatory T Cells to Commensal

Antigens in the Periphery. Cell Rep. 17, 206–220 (2016).

99. Bautista, J. L. et al. Intraclonal competition limits the fate determination of regulatory T

cells in the thymus. Nat. Immunol. 10, 610–617 (2009).

100. Liston, A. et al. Differentiation of regulatory Foxp3+ T cells in the thymic cortex. Proc.

Natl. Acad. Sci. U. S. A. 105, 11903–8 (2008).

101. Nutsch, K. et al. Rapid and Efficient Generation of Regulatory T Cells to Commensal

Antigens in the Periphery. Cell Rep. 17, 206–220 (2016).

102

102. Liston, A. et al. Differentiation of regulatory Foxp3+ T cells in the thymic cortex. Proc.

Natl. Acad. Sci. U. S. A. 105, 11903–8 (2008).

103. Lathrop, S. K. et al. Peripheral education of the immune system by colonic commensal

microbiota. Nature 478, 250–254 (2011).

104. Rakoff-Nahoum, S., Paglino, J., Eslami-Varzaneh, F., Edberg, S. & Medzhitov, R.

Recognition of Commensal Microflora by Toll-Like Receptors Is Required for Intestinal

Homeostasis. Cell 118, 229–241 (2004).

105. Caporaso, J. G. et al. Global patterns of 16S rRNA diversity at a depth of millions of

sequences per sample. Proc. Natl. Acad. Sci. U. S. A. 108 Suppl 1, 4516–22 (2011).

106. Edgar, R. C. UPARSE: highly accurate OTU sequences from microbial amplicon reads.

Nat. Methods 10, 996–998 (2013).

107. Caporaso, J. G. et al. QIIME allows analysis of high-throughput community sequencing

data. Nat. Methods 7, 335–336 (2010).

108. Fox, J. G. et al. Hepatic Helicobacter species identified in bile and gallbladder tissue from

Chileans with chronic cholecystitis. Gastroenterology 114, 755–63 (1998).

109. Fox, J. G. et al. Hepatic Helicobacter species identified in bile and gallbladder tissue from

Chileans with chronic cholecystitis. Gastroenterology 114, 755–63 (1998).

110. McDole, J. R. et al. Goblet cells deliver luminal antigen to CD103+ dendritic cells in the

small intestine. Nature 483, 345–9 (2012).

103

111. Hickey, C. A. et al. Colitogenic Bacteroides thetaiotaomicron Antigens Access Host

Immune Cells in a Sulfatase-Dependent Manner via Outer Membrane Vesicles. Cell Host

Microbe 17, 672–680 (2015).

112. Yadav, M. et al. Neuropilin-1 distinguishes natural and inducible regulatory T cells among

regulatory T cell subsets in vivo. J. Exp. Med. 209, 1713–1722 (2012).

113. Thornton, A. M. et al. Expression of Helios, an Ikaros Transcription Factor Family

Member, Differentiates Thymic-Derived from Peripherally Induced Foxp3+ T Regulatory

Cells. J. Immunol. 184, 3433–3441 (2010).

114. Weiss, J. M. et al. Neuropilin 1 is expressed on thymus-derived natural regulatory T cells,

but not mucosa-generated induced Foxp3 + T reg cells. J. Exp. Med. 209, 1723–1742

(2012).

115. Sefik, E. et al. MUCOSAL IMMUNOLOGY. Individual intestinal symbionts induce a

distinct population of RORγ+ regulatory T cells. Science 349, 993–7 (2015).

116. Yang, B.-H. et al. Foxp3+ T cells expressing RORγt represent a stable regulatory T-cell

effector lineage with enhanced suppressive capacity during intestinal inflammation.

Mucosal Immunol. 9, 444–457 (2016).

117. Kullberg, M. C. et al. Bacteria-triggered CD4(+) T regulatory cells suppress Helicobacter

hepaticus-induced colitis. J. Exp. Med. 196, 505–15 (2002).

118. Xu, M. et al. c-MAF-dependent regulatory T cells mediate immunological tolerance to a

104

gut pathobiont. Nature 554, 373–377 (2018).

119. Taylor, N. S., Xu, S., Nambiar, P., Dewhirst, F. E. & Fox, J. G. Enterohepatic Helicobacter

species are prevalent in mice from commercial and academic institutions in Asia, Europe,

and North America. J. Clin. Microbiol. 45, 2166–72 (2007).

120. Erdman, S. E. et al. Nitric oxide and TNF-alpha trigger colonic inflammation and

carcinogenesis in Helicobacter hepaticus-infected, Rag2-deficient mice. Proc. Natl. Acad.

Sci. U. S. A. 106, 1027–32 (2009).

121. Knutson, C. G. et al. Chemical and cytokine features of innate immunity characterize

serum and tissue profiles in inflammatory bowel disease. Proc. Natl. Acad. Sci. U. S. A.

110, E2332-41 (2013).

122. Kullberg, M. C. et al. Induction of colitis by a CD4+ T cell clone specific for a bacterial

epitope. Proc. Natl. Acad. Sci. U. S. A. 100, 15830–5 (2003).

123. Powell, N. et al. The Transcription Factor T-bet Regulates Intestinal Inflammation

Mediated by Interleukin-7 Receptor+ Innate Lymphoid Cells. Immunity 37, 674–684

(2012).

124. Fox, J. G. et al. A novel urease-negative Helicobacter species associated with colitis and

typhlitis in IL-10-deficient mice. Infect. Immun. 67, 1757–62 (1999).

125. Fox, J. G., Ge, Z., Whary, M. T., Erdman, S. E. & Horwitz, B. H. Helicobacter hepaticus

infection in mice: models for understanding lower bowel inflammation and cancer.

105

Mucosal Immunol. 4, 22–30 (2011).

126. Xu, M. et al. c-MAF-dependent regulatory T cells mediate immunological tolerance to a

gut pathobiont. Nature 554, 373–377 (2018).

127. Singh, N. et al. Activation of Gpr109a, Receptor for Niacin and the Commensal

Metabolite Butyrate, Suppresses Colonic Inflammation and Carcinogenesis. Immunity 40,

128–139 (2014).

128. Furusawa, Y. et al. Commensal microbe-derived butyrate induces the differentiation of

colonic regulatory T cells. Nature 504, 446–450 (2013).

129. Arpaia, N. et al. Metabolites produced by commensal bacteria promote peripheral

regulatory T-cell generation. Nature 504, 451–455 (2013).

130. Smith, P. M. et al. The Microbial Metabolites, Short-Chain Fatty Acids, Regulate Colonic

Treg Cell Homeostasis. Science (80-. ). 341, 569–573 (2013).

131. Honda, K. & Littman, D. R. The microbiota in adaptive immune homeostasis and disease.

Nature 535, 75–84 (2016).

132. Hooper, L. V, Littman, D. R. & Macpherson, A. J. Interactions between the microbiota and

the immune system. Science 336, 1268–73 (2012).

133. Wlodarska, M., Kostic, A. D. & Xavier, R. J. An Integrative View of Microbiome-Host

Interactions in Inflammatory Bowel Diseases. Cell Host Microbe 17, 577–591 (2015).

134. Belkaid, Y. & Hand, T. W. Role of the Microbiota in Immunity and Inflammation. Cell

106

157, 121–141 (2014).

135. Kamada, N., Seo, S.-U., Chen, G. Y. & Núñez, G. Role of the gut microbiota in immunity

and inflammatory disease. Nat. Rev. Immunol. 13, 321–335 (2013).

136. Shale, M., Schiering, C. & Powrie, F. CD4 + T-cell subsets in intestinal inflammation.

Immunol. Rev. 252, 164–182 (2013).

137. Manichanh, C., Borruel, N., Casellas, F. & Guarner, F. The gut microbiota in IBD. Nat.

Rev. Gastroenterol. Hepatol. 9, 599–608 (2012).

138. Ivanov, I. I. et al. Specific Microbiota Direct the Differentiation of IL-17-Producing

T-Helper Cells in the Mucosa of the Small Intestine. Cell Host Microbe 4, 337–349

(2008).

139. Yang, Y. et al. Focused specificity of intestinal T17 cells towards commensal bacterial

antigens. Nature (2014). doi:10.1038/nature13279

140. Geuking, M. B. et al. Intestinal bacterial colonization induces mutualistic regulatory T cell

responses. Immunity 34, 794–806 (2011).

141. Bautista, J. L. et al. Intraclonal competition limits the fate determination of regulatory T

cells in the thymus. Nat. Immunol. 10, 610–617 (2009).

142. Reinhardt, R. L., Liang, H.-E. & Locksley, R. M. Cytokine-secreting follicular T cells

shape the antibody repertoire. Nat. Immunol. 10, 385–393 (2009).

143. Solomon, B. D. & Hsieh, C.-S. Antigen-Specific Development of Mucosal

107

Foxp3+RORγt+ T Cells from Regulatory T Cell Precursors. J. Immunol. 197, 3512–3519

(2016).

144. Wong, P., Rudensky, A. Y. & Rudensky, A. Y. Phenotype and function of CD4+ T cells in

mice lacking invariant chain. J. Immunol. 156, 2133–42 (1996).

145. Hsieh, C.-S., Zheng, Y., Liang, Y., Fontenot, J. D. & Rudensky, A. Y. An intersection

between the self-reactive regulatory and nonregulatory T cell receptor repertoires. Nat.

Immunol. 7, 401–410 (2006).

146. Ni, P. P., Solomon, B., Hsieh, C.-S., Allen, P. M. & Morris, G. P. The ability to rearrange

dual TCRs enhances positive selection, leading to increased Allo- and Autoreactive T cell

repertoires. J. Immunol. 193, 1778–86 (2014).

147. Wong, P., Rudensky, A. Y. & Rudensky, A. Y. Phenotype and function of CD4+ T cells in

mice lacking invariant chain. J. Immunol. 156, 2133–42 (1996).

148. Mamedov, I. Z. et al. Preparing unbiased T-cell receptor and antibody cDNA libraries for

the deep next generation sequencing profiling. Front. Immunol. 4, 456 (2013).

149. Caporaso, J. G. et al. Global patterns of 16S rRNA diversity at a depth of millions of

sequences per sample. Proc. Natl. Acad. Sci. U. S. A. 108 Suppl, 4516–22 (2011).

150. Edgar, R. C. UPARSE: highly accurate OTU sequences from microbial amplicon reads.

Nat. Methods 10, 996–998 (2013).

151. Caporaso, J. G. et al. QIIME allows analysis of high-throughput community sequencing

108

data. Nat. Methods 7, 335–336 (2010).

152. CASTILLO, M. et al. Quantification of total bacteria, enterobacteria and lactobacilli

populations in pig digesta by real-time PCR. Vet. Microbiol. 114, 165–170 (2006).

153. Kau, A. L. et al. Functional characterization of IgA-targeted bacterial taxa from

undernourished Malawian children that produce diet-dependent enteropathy. Sci. Transl.

Med. 7, 276ra24 (2015).

154. Solomon, B. D. & Hsieh, C.-S. Antigen-Specific Development of Mucosal

Foxp3+RORγt+ T Cells from Regulatory T Cell Precursors. J. Immunol. 197, 3512–3519

(2016).

155. Hayashi, A. et al. A Single Strain of Clostridium butyricum Induces Intestinal

IL-10-Producing Macrophages to Suppress Acute Experimental Colitis in Mice. Cell Host

Microbe 13, 711–722 (2013).

156. Kullberg, M. C. et al. IL-23 plays a key role in Helicobacter hepaticus-induced T

cell-dependent colitis. J. Exp. Med. 203, 2485–94 (2006).

157. Jostins, L. et al. Host–microbe interactions have shaped the genetic architecture of

inflammatory bowel disease. Nature 491, 119–124 (2012).

158. Calderón-Gómez, E. et al. Commensal-Specific CD4+ Cells From Patients With Crohn’s

Disease Have a T-Helper 17 Inflammatory Profile. Gastroenterology 151, 489–500.e3

(2016).

109

159. Lathrop, S. K., Santacruz, N. A., Pham, D., Luo, J. & Hsieh, C. S. Antigen-specific

peripheral shaping of the natural regulatory T cell population. J Exp Med 205, 3105–3117

(2008).

160. Li, H. et al. The outer mucus layer hosts a distinct intestinal microbial niche. Nat.

Commun. 6, 8292 (2015).

161. Zoetendal, E. G. et al. Mucosa-associated bacteria in the human gastrointestinal tract are

uniformly distributed along the colon and differ from the community recovered from feces.

Appl. Environ. Microbiol. 68, 3401–7 (2002).

162. Ramanan, D., Tang, M. S., Bowcutt, R., Loke, P. & Cadwell, K. Bacterial Sensor Nod2

Prevents Inflammation of the Small Intestine by Restricting the Expansion of the

Commensal Bacteroides vulgatus. Immunity 41, 311–324 (2014).

163. Bloom, S. M. et al. Commensal Bacteroides Species Induce Colitis in

Host-Genotype-Specific Fashion in a Mouse Model of Inflammatory Bowel Disease. Cell

Host Microbe 9, 390–403 (2011).

164. Mottet, C., Uhlig, H. H. & Powrie, F. Cutting edge: cure of colitis by CD4+CD25+

regulatory T cells. J. Immunol. 170, 3939–43 (2003).

165. Fox, J. G., Ge, Z., Whary, M. T., Erdman, S. E. & Horwitz, B. H. Helicobacter hepaticus

infection in mice: models for understanding lower bowel inflammation and cancer.

Mucosal Immunol. 4, 22–30 (2011).

110

166. Knutson, C. G. et al. Chemical and cytokine features of innate immunity characterize

serum and tissue profiles in inflammatory bowel disease. Proc. Natl. Acad. Sci. U. S. A.

110, E2332-41 (2013).

167. Erdman, S. E. et al. Nitric oxide and TNF-alpha trigger colonic inflammation and

carcinogenesis in Helicobacter hepaticus-infected, Rag2-deficient mice. Proc. Natl. Acad.

Sci. U. S. A. 106, 1027–32 (2009).

168. Kullberg, M. C. et al. Induction of colitis by a CD4+ T cell clone specific for a bacterial

epitope. Proc. Natl. Acad. Sci. U. S. A. 100, 15830–5 (2003).

169. Thomson, J. M. et al. Enterohepatic Helicobacter in Ulcerative Colitis: Potential

Pathogenic Entities? PLoS One 6, e17184 (2011).

170. Smith, P. M. et al. The microbial metabolites, short-chain fatty acids, regulate colonic

Treg cell homeostasis. Science 341, 569–73 (2013).

171. Arpaia, N. et al. Metabolites produced by commensal bacteria promote peripheral

regulatory T-cell generation. Nature 504, 451–455 (2013).

172. Furusawa, Y. et al. Commensal microbe-derived butyrate induces the differentiation of

colonic regulatory T cells. Nature 504, 446–450 (2013).

173. Round, J. L. et al. The Toll-like receptor 2 pathway establishes colonization by a

commensal of the human microbiota. Science 332, 974–7 (2011).

174. Round, J. L. & Mazmanian, S. K. Inducible Foxp3+ regulatory T-cell development by a

111

commensal bacterium of the intestinal microbiota. Proc. Natl. Acad. Sci. U. S. A. 107,

12204–9 (2010).

175. Hand, T. W. et al. Acute Gastrointestinal Infection Induces Long-Lived

Microbiota-Specific T Cell Responses. Science (80-. ). 337, 1553–1556 (2012).

176. Danne, C. et al. A Large Polysaccharide Produced by Helicobacter hepaticus Induces an

Anti-inflammatory Gene Signature in Macrophages. Cell Host Microbe 22, 733–745.e5

(2017).

112