1.9 Cotton Leaf Curl Disease (Clcud) in Pakistan

Potential of SiRNA and Artificial MiRNAs Against Cotton Leaf Curl Burewala Virus V2 Gene Yielding Resistance to Begomoviruses

Irfan Ali

2015

Department of Biotechnology (NIBGE) Pakistan Institute of Engineering and Applied Sciences Nilore, Islamabad, Pakistan

Thesis Approval Form

Student’s Name: Irfan Ali Department: Biotechnology (NIBGE)

Registration Number:10-7-1-023-2008 Date of Registration: 24-04-2008

Thesis Title:

RECOMMENDATION (if any) by: When the final thesis defense of the student has been concluded and all other requirements have been met, I a. Do Recommend that the candidate be certified to the faculty for the degree of Doctor of Philosophy b. Do Recommend that the candidate be certified to the faculty for the degree of Doctor of Philosophy subject to the minor correction in the thesis. c. Do Recommend that the candidate should reappear in the oral defense d. Do NOTRecommend that the candidate be certified to the faculty for the degree of Doctor of Philosophy

Examiners Signatures

1. Internal Examiner (Name & Affiliation): 2. Internal Examiner (Name & Affiliation): 3. Internal Examiner (Name & Affiliation): 4. Supervisor (Name & Affiliation): 5. Head of Department (Name): 6. Dean (Research) :

Approved by: Head of the Department (Name) :______Signatures/Date ______

Distribution: 1. Original to be placed in Student’s Personal file in the office of Dean (Research) 2. Copy to be included in the thesis prior to final submission.

Thesis Submission Approval

This is to certify that the work contained in this thesis entitled, Potential of SiRNAs and Artificial MiRNAs Against Cotton Leaf Curl Burewala Virus V2 Gene Yielding Resistance to Begomoviruses, was carried out by Irfan Ali, and in my opinion, it is fully adequate, in scope and quality, for the degree of Ph.D. Furthermore, it is hereby approved for submission for review and thesis defense.

Supervisor: ______Name: Prof. Dr. Rob. W. Briddon Date: 12 June, 2015 Place: NIBGE, Faisalabad.

Co-Supervisor: ______Name: Prof. Dr. Shahid Mansoor (S.I) Date: 12 June, 2015 Place: NIBGE, Faisalabad.

Head, Department of NIBGE: ______Name: Prof. Dr. Shahid Mansoor (S.I) Date: 12 June, 2015 Place: NIBGE, Faisalabad.

Potential of SiRNA and Artificial MiRNAs Against Cotton Leaf Curl Burewala virus V2 Gene Yielding Resistance to Begomoviruses

Irfan Ali

Submitted in partial fulfillment of the requirements for the degree of Ph.D

2015

Department of NIBGE Pakistan Institute of Engineering and Applied Sciences Nilore, Islamabad, Pakistan

Dedications

I dedicate my dissertation work to my parents (late), my wife and my children. A special gratitude to my parents in law whose words of encouragement and push for tenacity ring in my ears.

Declaration of Originality

I hereby declare that the work contained in this thesis and the intellectual content of this thesis are the product of my own work. This thesis has not been previously published in any form nor does it contain any verbatim of the published resources which could be treated as infringement of the international copyright law. I also declare that I do understand the terms ‘copyright’ and ‘plagiarism,’ and that in case of any copyright violation or plagiarism found in this work, I will be held fully responsible of the consequences of any such violation.

______(Irfan Ali)

06 June, 2015 NIBGE, Faisalabad.

iii

Copyrights Statement

The entire contents of this thesis entitled “Potential of siRNA and artificial MiRNAs against Cotton leaf curl Burewala virus V2 gene yielding resistance to begomoviruses” by Irfan Ali are the intellectual property of Pakistan Institute of Engineering & Applied Sciences (PIEAS). No portion of the thesis should be reproduced without obtaining explicit permission from PIEAS.

Acknowledgements

All thanks are for “ALLAH” whose blessings enabled me to seek knowledge and invigorate me for this task. Words can’t express my feelings of thankfulness for “ALLAH” almighty. I offer my special gratitude and love to The Holy Prophet Muhammad (peace be upon Him), the source of guidance for humanity as a whole forever. It is my utmost pleasure to avail this opportunity to gratitude to my supervisor Prof.Dr. Rob. W. Briddon whose presence was always a source of confidence for me. It is because of his support and encouragement that I faced various challenges of life and complete the research with patience. I really want to thank him for his personal interest, suggestions and lots of help in research work and writing of this manuscript. I offer my special thanks to Dr. Shahid Mansoor, Director NIBGE, for providing me lab facilities and NIBGE transport for sampling tours across the country. I couldn't find enough words to express my deep sense of gratitude for Dr. Shahid Mansoor, who has made a great contribution for the successful completion of this work. His skilful advices, sincere cooperation, and learned guidance enabled me to complete this work. I learned a lot from him and he has been a very kind teacher and for him no acknowledge could ever adequately express my obligation. He supported me in every walk of life and discussion with him always helped me to complete my PhD research. I want to extend my gratitude to Dr. Shahid Mehmood Baig for support and encouragement during my Ph. D. I am also thankful to Dr. Zafar Mehmood Khalid and Dr. Sohail Hameed (ex-Directors NIBGE) for their full support in my PhD. Special gratitude is due to Higher Education Commission of Pakistan for providing financial support to my studies and making my dreams come true. All the staff of HEC was very cooperative especially Miss Saima Naurin and Mr. Jehanzeb Khan. I am deeply indebted to Dr.Imran Amin for his cooperation, encouragement and useful suggestions in accomplishment of this work. I have respectful appreciation for Dr. Muhammad Saeed and Dr. Javaria Qazi for their all time available help and sincere cooperation. I want to thank all my seniors, Dr. Muhammad Shafiq

Shahid, Dr. Muhammad Tehseen Azhar,Dr. Luqman Amrao, Dr. Aamir Humayun Malik, Dr. Nazia Nahid, Saiqa Andleeb, Rohina Bashir, Dr. Muhammad Mubin and colleagues Huma Mumtaz, Musarrat Shaheen, Atiq ur Rehman, Dr. Nouman Tahir, Dr. Sohail Akhter, Dr. Zafar Iqbal, Muhammad Yusuf, Ghulam Rasool Baloch, Ghulam Rasool, Dr. Khadim Hussain, Muhammad Shafiq, Qamar Abbas, Imran Sohail, Alia, Ishtiaq Hasan, Iftikhar Ali, Fazal-e-Akbar, Rahimullah, Ms. Shaista Javaid, Mrs. Sumera Yousaf. I want to pay my special thanks to supporting staff of our lab, Ghulam Mustafa, Rizwan, Aamir, Shahid and Yasmin for their cooperation in lab work. I want to also acknowledge Prof. Dr. Thomas Hohn and Dr. Mikhael Pooggin, University of Basel, Switzerland, for they support. They involved me in various projects of lab, which helped me in better understanding of plant virology. I also want to acknowledge other lab members at University of Basel, Switzerland especailly Katiya, Nichelli, Dr Basanta K Borah, Dr. Rajeswaran and Jonathan for their support during my stay at his lab. I also want to appreciate Tanveer Mustafa and Mr. Ali Imran of University Cell. They always facilitated and never wasted my time in official hurdles. In the end, i want to express my heartiest gratitude to my parents. They raised me with great care and saved me from every hurdle of life. It was their great wish that i should complete my PhD. Although they are no more. But I know that they will the most happiest persons to see my PhD dissertation. I am writing this PhD dissertation because of their financial, moral support and prayers. I want to also pay my special thanks to my brothers and sisters. Finally, I want to express my gratitude to my parents in law. They have very important role in completion of my PhD studies. After the death of my parents, they always tried to prove themselves as my parents. May Allah bless all of them with great happiness forever.

Irfan Ali

Table of contents

Title page...... i Dedications...... ii Declaration of Originality...... iii Copyright Statement...... iv Acknowledgement...... v Table of Contents...... vii List of Figures...... ix

List of Tables...... xii

Abstract...... xiii

List of Publications and Patents...... xv

List of Abbreviations...... xvi

Virus Acronyms...... xix

CHAPTER 1 1 Introduction and review of literature ...... 01 1.1 Viruses ...... 01 1.2 Plant viruses ...... 01 1.3 Geminiviruses ...... 02 1.3.1 Classification of geminiviruses ...... 02 1.3.2 Satellites associated with begomoviruses...... 08 1.4 Functions and interactions of proteins encoded by geminiviruses...... 13 1.4.1 Replication-associated protein (Rep)...... 13 1.4.2 Transcriptional activator protein (TrAP)/C2...... 14 1.4.3 Replication enhancer protein (REn)...... 15 1.4.4 (A)C4...... 15 1.4.5 (A)V2 ...... 16 1.4.6 Curtovirus V2 and V3 Proteins ...... 17 1.4.7 Coat Protein (CP) ...... 17 1.4.8 Nuclear Shuttle Protein (NSP) ...... 19 1.4.9 Movement Protein (MP)...... 20 1.5 Replication of Geminiviruses ...... 21

1.6 Transgenic Strategies for Countering Geminivirusues...... 23 1.6.1 Pathogen Derived Resistance...... 23 1.6.2 Non-Pathogen Derived Resistance...... 25 1.7 RNA Interference (RNAi)...... 26 1.7.1 Mechanism of RNAi...... 26 1.7.2 Components of RNAi ...... 27 1.8 Importance of Cotton and Cotton Leaf Curl Disease (CLCuD) ...... 33 1.9 Cotton Leaf Curl Diesease (CLCuD) in Pakistan ...... 34 1.10 Objectives of the Study ...... 37 2Materials and Methods...... 38 2.1 Isolation of DNA from Plants...... 38 2.2 Quantification of DNA...... 38 2.3 Polymerase Chain Reaction (PCR)...... 38 2.4 Gel Electrophoresis ...... 39 2.5 Ligation ...... 39 2.6 Preparation of Competent Cells ...... 39 2.6.1 Preparation of Heat-Shock Competent Escherichia coli cells...... 39 2.6.2 Preparation of Electro-Competent Agrobacterium Tumefaciens cells...... 41 2.7 Transformation of Bacterial cells ...... 41 2.7.1 Transformation of Heat-Shock Competent E. coli Cells ...... 41 2.7.2 Transformation ofA. Tumefaciens byElectroporation ...... 42 2.8 Isolation of Plasmid from E. Coli (Miniprep) ...... 42 2.9 Restriction Analysis...... 43 2.10 DNA Purification by Gel Extraction...... 43 2.11 DNA Purification by Phenol Chloroform Treatment...... 44 2.12 Glycerol Stocks...... 44 2.13 Agrobacterium-Mediated Inoculation of Begomoviruses to Plants ...... 44 2.14 Agrobacterium-Mediated Transformation of N. Benthamiana...... 45 2.15 RNA Extraction...... 46 2.16 Southern Blot Hybridization ...... 46 2.17 Photography and Computer Graphics ...... 48 2.18 Plant Growth Conditions...... 48

vii

3. Antisense V2-mediated resistance to CLCuBuV...... 49 3.1 Introduction ...... 49 3.2 Methodology...... 50 3.2.1 Production of Antisense RNA Constructs...... 50 3.2.2 Detection of Small RNAs...... 50 3.3. Results...... 52 3.3.1 Analysis of Transgenic Plants...... 52 3.3.2 Response of Transgenic Plants to Inoculation with CLCuBuV...... 55 3.3.3 Response of transgenic N. Benthamiana Plants to Inoculation with CLCuBuV and CLCuMuB...... 59 3.3.4 Responses of Transgenic Plants to Inoculation with CLCuKoV...... 64 3.3.5 Response of Transgenic Plants to Inoculation with PedLCuV...... 68 3.3.6 Response of Transgenic Plants to Inoculation with the Bipartite Begomovirus ToLCNDV...... 72 3.4 Discussion ...... 76

4. Artificial MiRNA Based Resistance Against Begomoviruses...... 82 4.1 Introduction ...... 82 4.2 Materials and Methods...... 83 4.2.1. Production of AmiRNA Expression Constructs...... 83 4 .3 Results ...... 83 4.3.1 Production and Analysis of Transgenic N. Benthamiana Plants Harbouring miRNA...... 83 4.3.2 Response of Transgenic Plants Harbouring AmiRNA to Inoculation with CLCuBuV...... 85 4.3.3 Response of Transgenic Plants Harbouring AmiRNA to Inoculation with CLCuKoV...... 89 4.3.5 Response of Transgenic Plants Harbouring AmiRNA to Inoculation with PedLCuV ...... 92 4.3.6 Response of Transgenic Plants Harbouring AmiRNA to Inoculation with ToLCNDV...... 95 4.4 Discussion ...... 98 5.General Discussion ...... 101 6.References...... 103

viii

List of Figures Figure 1-1 Pseudo-Atomic Reconstruction Of the Capsid Of Maize Streak Virus. Reproduced from Zhang et al. [7]...... 3

Figure 1-2 Typical Genome Arrangement of Mastreviruses and the Leafhopper. Vector of Maize Streak Virus, Cicadulina Mbila...... 5

Figure 1-3 Typical Genome Arrangement of Curtoviruses and the Leafhopper Vector of Beet Curly Top Virus, Circulifer Tenellus...... 6

Figure 1-4 Typical Genome Organization and the Treehopper Vector; Micrutalis Malleifera, of Tomato Pseudo Curly Top Virus...... 7

Figute 1-5 Typical Genome Arrangement of Begomoviruses, Their

Associated Satellites and the Whitefly Vector of Begomoviruses, Bemisia Ttabaci...... 11

Figure 1-6 Rolling-Circle Replication (RCR) and Recombination-Dependent Replication (RDR) Mechanisms...... 22

Figure 1-7 Typical MicroRNA Pathway in Plants...... 29

Figure 1-8 Elements and Pathways of the RNAi Response...... 32

Figure 1-9 Symptoms of CLCuD in Cotton Plants...... 36

Figure 2-1 Southern Blot Assembly for the Capillary Transfer of DNA from Agarose Gel to Nylon Membrane...... 48

Figure 3-1 Detection of CLCuBuV-Specific Small RNAs in Transgenic N. Benthamiana Plants...... 54

Figure 3-2 Responses of Transgenic Plants to Inoculation with CLCuBuV...... 56

Figure 3-3 Southern Blot Hybridization for the Detection of CLCuBuV...... 57

Figure 3-4 Responses of Transgenic N. Benthamiana Plants to Inoculation

with CLCuBuV and CLCuMB...... 60

Figure 3-5 Southern Blot Hybridization for the Detection of CLCuBuV...... 61

Figure 3-6 Southern Blot Hybridization for the Detection of CLCuMB...... 62

Figure 3-7 Responses of Transgenic N. Benthamiana Plants to Inoculation

with CLCuKoV...... 65

Figure 3-8 Southern Blot Hybridization for the Detection of CLCuKoV in

Transgenic N. Benthamiana Plants...... 66

Figure 3-9 Responses of Transgenic Plants to inoculation with PedLCuV...... 69

Figure 3-10 Southern blot hybridization for the detection of PedLCuV in N.

Benthamiana plants...... 70

Figure 3-11 Responses of Transgenic Plants to Inoculation with the Bipartite Begomovirus ToLCNDV...... 73

Figure 3-12 Southern Blot Hybridization for the Detection of ToLCNDV

(DNA A) in N. Benthamiana Plants...... 74

Figure 3-13 Alignment of the N-terminal V2 Gene Sequences, Homologous to the CLCuBuV Fragment Introduced into N. Benthamiana, of the

Viruses Used for Inoculation...... 79 Figure 3-14 Alignment of the Middle Portion V2 Gene Sequences, Homolog- ous to the CLCuBuV Fragment Introduced into N. Benthamiana, of the Viruses Used for Inoculation...... 80

Figure 3-15 Alignment of the C-terminal V2 gene Sequences, Homologous to the CLCuBuV Fragment Introduced into N. Benthamiana, of the Viruses Used for Inoculation...... 80

Figure 4-1 Predicted Secondary Structures of Pre-miRNAs...... 84

Figure 4-2 Symptoms Exhibited by Transgenic N. Benthamiana Plants Follo-- wing Inoculation with Begomoviruses...... 86

Figure 4-3 Southern Blot Detection of CLCuBuV...... 87

Figure 4-4 Southern Blot Detection of CLCuKoV...... 90

Figure 4-5 Southern Blot Detection of PedLCuV...... 93

Figure 4-6 Southern Blot Detection of ToLCNDV DNA A...... 96

Figure 4-7 Alignment of the V2 Gene Sequences Homologous to the AmiRNA of the Bogomoviruses Used for Inoculation...... 99

List of tables Table 2.1 Sequences of primers used in the study...... 40

Table 3.1 Oligonucleotides used for detection of transgene-derived

small RNAs...... 51

Table 3.2 Analysis of transgenic N. benthamiana plants...... 53

Table 3.3 Infectivity of CLCuBuV in transgenic Nicotiana benthamiana

plants...... 58

Table 3.4 Infectivity of CLCuBuV with CLCuMuB in transgenic Nicotiana benthamiana plants...... 63

Table 3.5 Infectivity of CLCuKoV in transgenic Nicotiana benthamiana

plants...... 67

Table 3.6 Infectivity of PedLCuV in transgenic N. benthamiana...... 71

Table 3.7 Infectivity of ToLCNDV in transgenic N. benthamiana...... 75

Table 4.1 Infectivity of CLCuBuV in transgenic N. benthamiana plants...... 88

Table 4.2 Infectivity of CLCuKoV in transgenic N. benthamiana plants harbouring amiRNA...... 91

Table 4.3 Infectivity of PedLCuV in transgenic N. benthamiana plants harbouring amiRNA...... 94

Table 4.4 Infectivity of ToLCNDV in transgenic N. benthamiana plants harbouring amiRNA...... 97

xii

Abstract

Diseases of crop plants caused by begomoviruses (whitefly-transmitted viruses of the family Geminiviridae) are a major constraint to productivity across the warmer parts of the world. Cotton leaf curl disease (CLCuD) across Pakistan and northwestern India has caused severe losses to cotton cultivation since the early 1990s. In Pakistan the disease at this time is caused by a single begomovirus, Cotton leaf curl Burewala virus (CLCuBuV), and a betasatellite, Cotton leaf curl Multan betasatellite (CLCuMuB). Efforts to prevent losses due to CLCuD rely on the use of insecticides to control the vector whitefly and the use of tolerant cotton varieties; no immune varieties so far having been identified. RNAi technology offers a possible mechanism of rapidly developing resistant crop varieties to counter diseases caused by plant-infecting viruses. Here antisense RNA and artificial micro (ami)RNA have been investigated for their potential to yield resistance to CLCuBuV. A major challenge to use of RNAi is the need to identify the best target sequence. Here three fragments of the virion-sense gene V2 of CLCuBuV have been transformed into Nicotiana benthamiana in antisense orientation and assessed for their ability to yield resistance against CLCuBuV and three heterologous begomoviruses. The results are consistent with the idea that RNAi is a homology-based response with transgenic plants showing levels of resistance that correlate with the levels of sequence identity between the transgene and the inoculated virus. However, only for CLCuBuV was resistance at near immunity levels with the V2 sequence closest to the promoter providing the best resistance. Nevertheless, with all three constructs, transgenic plants inoculated with CLCuBuV showed no symptoms, or recovered from initial mild symptoms, and viral DNA levels were low. Additionally, inoculation of CLCuBuV with the CLCuD-associated betasatellite CLCuMuB to transgenic plants did not significantly affect the outcome although it increased the numbers of plants in which viral DNA could be detected, suggesting that the betasatellite may impair RNAi resistance. This effect is likely due to the betasatellite encoding a strong suppressor that inhibits RNAi at both the transcriptional and posttranscriptional levels.

xiii

Earlier studies have shown that the sequences of naturally occurring miRNA genes can be changed to alter the messenger RNAs that they bind to. Here a cotton microRNA gene (miR169a) was altered to replace the sequence of the mature miRNA with 21 nucleotides of sequence from the V2 gene of CLCuBuV and transformed into N. benthamiana. Two constructs were produced. In one construct (P1CN) the sequence of the miRNA backbone, with the exception of the 21 nucleotides, was left unchanged. In the other (P1DM) the sequence of the backbone was changed to, at least in part, restore the secondary structure of the immature miRNA (referred to as a precursor- miRNA). Inoculation of plants with a range of begomoviruses showed P1CN to give efficient resistance against the homologous virus (CLCuBuV) but not against heterologous viruses. Overall the levels of resistance exhibited depended upon the levels of sequence identity to the target (21nt) sequence, although other factors also likely play a part. For a small number of P1CN plants inoculated with CLCuBuV symptoms were initially evident but the plants recovered and contained low levels of viral DNA. In contrast, transgenic plants inoculated with heterologous viruses showed a greater number of plants symptomatically infected, that did not recover and showed high levels of viral DNA although lower than in infected non-transgenic plants. Transgenic plants harbouring P1DM showed poor resistance to CLCuBuV and little resistance to the heterologous viruses, indicating that the backbone sequence of the pre- miRNA is important for the biogenesis of mature miRNA. The results indicate that both antisense-RNA and amiRNA have the potential to deliver resistance against begomoviruses. The significance of the results are discussed.

xiv

List of Publications and Patents

Journal Publications

 I. Ali, I. Amin, R. W. Briddon and S. Mansoor, “Artificial MicroRNA Mediated Resistance Against Monopartite Begomovirus Cotton Leaf Curl Burewala Virus” Virology J., vol. 10, pp. 1–8, 2013.  I. Ali, A. H. Malik and S. Mansoor, “First Report of Tomato Leaf Curl Palampur Vrus on Bittergourd in Pakistan,”Plant Dis., vol. 94, pp. 276, 2010.

List of Abbreviations

μL micorlitre AAP acquisition access period asRNA anti-sense RNA amiRNA artificial microRNA AZPs artificial zinc finger proteins BC before Christ BSA bovine serum albumin

CaCl2 calcium chloride cccDNA covalently closed circular DNA CIAP calf intestine alkaline phosphatase CLCuD cotton leaf curl disease CP coat protein CR common region CTAB cetyl trimethyl ammonium bromide DEAE diethyl amino ethyl cellulose DNA deoxyribonucleic acid DNAi DNA interference dNTP deoxyribonucleotide triphosphate dsDNA double-stranded DNA dsRNA double-stranded RNA DTT dithiothreitol EDTA ethylene diamine tetraacetic acid

FeSO4.7H2O ferrous sulphate hepta hydrate GFP green fluorescence protein GUS beta-glucuronidase hpRNA hairpin RNA HC-Pro helper component protease HR hypersensitive response ICTV International Committee on Taxonomy of Viruses

xvi

IPTG isopropyl-beta-D-1-thiogalactopyranoside IR intergenic region IRD iteron-related domain

K2HPO4 dipotassium phosphate KCl potassium chloride Kn kanamycine kDa kilo Dalton kV kilo Volt LB Luria Bertani LIR large intergenic region MCS multiple cloning site mg milligram

MgSO4 magnesium sulphate

MgSO4.7H2O magnesium sulphate heptahydrate miRNA microRNA mM millimolar MP movement protein mRNA messenger RNA NaCl sodium chloride

NaH2PO4 sodium phosphate NaOH sodium hydroxide ng nanogram

NH4Cl ammonium chloride NLS nuclear localization signals NSP nuclear shuttle protein nt nucleotide NW New World OD optical density ORF open reading frame OW Old World PCNA proliferating cell nuclear antigen PCR polymerase chain reaction PDR pathogen-derived resistance pH paviour of hydrogen

xvii

pre-miRNA precursor micro RNA BLAST Basic local alignment search tool PVP polyvinyl pyrrolidone RCR rolling-circle replication RDR recombination-dependent replication RdRP RNA-dependent RNA polymerase REn replication enhancer protein Rep replication associated protein RISC RNA-induced silencing complex RNA ribonucleic acid RNAi RNA interference rpm revolutions per minute SCR satellite conserved region SDS sodium dodecyl sulphate SDW sterile distilled water SIR small intergenic region siRNA small interfering RNA SSC standard sodium citrate ssDNA single-stranded DNA TAE tris-acetate EDTA Taq Thermus aquaticus ta-siRNAs trans-acting small interfering RNAs TGS transcriptional gene silencing TrAP transcriptional activator protein T-Rep truncated Rep UV ultra violet VIGS virus-induced gene silencing X-Gal 5-bromo-4-chloro-3-indolyl-b-D-galactopyranoside

xviii

Virus Acronyms

Abutilon mosaic virus AbMV African cassava mosaic virus ACMV Ageratum yellow vein virus AYVV Barley yellow dwarf virus BYeDV Bean dwarf mosaic virus BDMV Bean golden yellow mosaic virus BGYMV Bean yellow dwarf virus BeYDV Beet curly top virus BCTV Beet severe curly top virus BSCTV Cabbage leaf curl virus CabLCuV Corchorus golden mosaic virus CoGMV Corchorus yellow vein virus CoYVV Cotton leaf crumple virus CLCrV Cotton leaf curl Kokhran virus CLCuKoV Cotton leaf curl Multan betasatellite CLCuMuB Cotton leaf curl Multan virus CLCuMuV Cymbidium ringspot virus CymRSV East African cassava mosaic Cameroon virus EACMCV East African cassava mosaic Zanzibar virus EACMZV Indian cassava mosaic virus ICMV Maize streak virus MSV Mungbean yellow mosaic India virus MYMIV Mungbean yellow mosaic virus MYMV Papaya leaf curl virus PaLCV Pedilanthus leaf curl virus PedLCuV Potato virus X PVX Squash leaf curl virus SqLCuV Sri Lankan cassava mosaic virus SLCMV Tobacco curly shoot betasatellite TbCSB Tobacco leaf curl betasatellite TbLCB Tobacco mosaic virus TMV

xix

Tobacco etch virus TEV Tobacco rattle virus TRV Tobacco ringspot virus TSRV Tomato golden mosaic virus TGMV Tomato leaf curl New Delhi virus ToLCNDV Tomato leaf curl virus ToLCV Tomato mottle virus ToMoV Tomato pseudo-curly top virus TPCTV Tomato yellow leaf curl China betasatellite TYLCCNB Tomato yellow leaf curl China virus TYLCCNV Tomato yellow leaf curl virus TYLCV Tomato leaf curl Java virus ToLCJV Turnip crinkle virus TCV

Chapter 1

1 Introduction and Review of Literature

1.1 Viruses Viruses are submicroscopic agents that infect living organisms. They consist of nucleic acid (either DNA or RNA) and a protein coat . More complex viruses may additionally have a membranous envelope which is derived from the host but also contains virus-encoded proteins. Although the issue is debatable, viruses are generally not considered to be “living” and are probably best described as molecular parasites. They are not functionally active outside host cells and require the biochemical machinery of a host cell to reproduce (multiply).

Viruses infect virtually every form of cellular life, including the simplest bacteria, animals and plants. The 9th report of the International Committee on Taxonomy of Viruses (ICTV) has classified viruses into 6 orders, 87 families, 19 subfamilies, 349 genera and more than 2200 species [1].

1.2 Plant Viruses The relationship of plant viruses with plant diseases was identified little more than a century ago. The first virus, Tobacco mosaic virus (TMV), was identified in 1898 by Martinus Beijerinck, who determined that plant sap from “mosaic disease” affected tobacco can cause infection even after passing through a porcelain filter which retained bacteria. Beijerinck referred this infectious fluid as a "contagium vivum fluidum", from which the term "virus" is derived. TMV was crystallized first by Wendell Stanley in 1935 [2]. He received the Nobel Prize in Chemistry in 1946. Major advances were made in the field of plant virology during the 1930s resulting in the publication of the first text book of plant virology in 1937 by Kenneth Smith [3].

The majority of plant viruses have RNA genomes. However, some plant viruses have DNA genomes, and these may be further sub-grouped into single- stranded DNA (ssDNA) and double-stranded DNA (ssDNA) viruses. Geminiviruses

Chapter 1 Introduction and Review of Literature and nanoviruses are examples of ssDNA viruses [4] whereas badnaviruses and caulimoviruses are examples of plant viruses having dsDNA genomes [5].

1.3 Geminiviruses The geminivirus are a large group of economically important phytopathogenic viruses. They have a twinned icosahedral structure (Figure 1.1) and on the basis of this unique character they were named geminiviruses after the zodiac sign gemini, meaning twins [6]. Three dimensional image reconstruction of cryo-electron microscopic analysis of Maize streak virus (MSV) particles helped to refine their structure [7]. The geminiviruses were recognized as a distinct group in 1979 by the International Committee on the Taxonomy of Viruses (ICTV). Classification was based on their unique geminate virion structure and possession of circular single- stranded (ss) DNA [2, 8] and in 1995 was upgraded to the family Geminiviridae [9, 10]. Geminiviruses have genomes that consist of either one or two circular ssDNA molecules of 2.6-3.1 kb [9, 11]. Each DNA molecule contains a conserved ~200 nt non-coding, intergenic region (IR) that contains a predicted hairpin loop structure having, within the loop, a nonanucleotide sequence of either TAATATTAC or TAAGATTCC.

The family Geminiviridae is the second largest family of plant viruses, after the potyviruses, with nearly 400 recognized species [12]. The geminiviruses have recently emerged as one of the most damaging groups of viral pathogens causing severe economic losses to agricultural production worldwide [13-15].

1.3. 1 Classification of Geminiviruses Viruses of the family Geminiviridae have been classified into seven genera based on type of insect vector, host range and genome organization – Begomovirus, Mastrevirus, Curtovirus, Topocuvirus, Becurtovirus, Turncurtovirus and Eragrovirus. Of these, three (Becurtovirus, Turncurtovirus and Eragrovirus) have only recently been established and there is little information for viruses in these new genera [16]. For this reason only the four main, long established genera will be discussed in the following sections.

Chapter 1 Introduction and Review of Literature

Figure 1-1 Pseudo-atomic Reconstruction of the Capsid of Maize Streak Virus. Shown are the ten peripheral capsomers, ten equatorial capsomers and the two apical capsomers (in red, blue and green, respectively). Reproduced from [7].

Chapter 1 Introduction and Review of Literature

1.3.1.1 Mastrevirus The name of this genus is derived from the name of the first identified member of this genus, Maize streak virus (MSV). Mastreviruses have monopartite genomes (consisting of one ssDNA molecule), are transmitted by specific species of leafhopper and infect either monocotyledonous or dicotyledonous plants [17, 18]. The two well- studied monocot-infecting mastreviruses are MSV and Wheat dwarf virus (WDV), while examples of dicot infecting viruses are Chickpea chlorotic dwarf virus (CpCDV; [19]) and Tobacco yellow dwarf virus (TbYDV; [20]).

Mastreviruses encode four genes, two in each orientation [20, 21]. The genes in the virion sense encode the movement protein (MP) and the coat protein (CP) whereas the genes in the complementary-sense encode the replication-associated protein (Rep) and RepA genes (Figure 1.2). Uniquely for geminiviruses the Rep protein is translated from a spliced transcript which joins the RepA and Rep B open reading frames whereas the Rep A protein is translated from a non-spliced messenger RNA [21, 22].

Virion and complementary-sense genes are separated by a large intergenic region (LIR) and a small intergenic region (SIR) that contain regulatory elements (Figure 1.2). The predicted stem loop structure present in the LIR contains the nonanucleotide sequence TAATATTAC and is the origin of virion-sense replication of viral DNA [23]. The presence of short DNA primer (˜70 to 80nt) encapsidated within the virion is a unique character of mastreviruses [24-26]. This primer has been shown to prime complementary-sense DNA replication.

Chapter 1 Introduction and Review of Literature

Figure 1-2 Typical Genome Arrangement of Mastreviruses (Left) and the Leafhopper Vector of Maize Streak Virus, Cicadulina Mbila (Right). The coat protein (CP) and movement protein (MP) genes are encoded in the virion-sense whereas the RepA and RepB genes are encoded in the complementary-sense. There are two non-coding regions, the large intergenic region (LIR) and short intergenic region (SIR). The position of the predicted hairpin structure, containing the conserved nonanucleotide sequence (TAATATTAC) in the loop, is shown at position zero.

1.3.1.2Curtovirus Curtoviruses are monopartite, occur in both the OW and the NW and are transmitted by the leafhopper Circulifer tenellus. The most well characterized curtovirus, Beet curl top virus (BCTV), has a very wide host range amongst dicotyledonous plants, encompassing some 300 species in 44 plant families [27].

The taxonomy of curtoviruses has recently been revised and its members now include three species - BCTV, Horseradish curly top virus (HRCTV) and Spinach severe curly top virus [28]. The genomes of curtoviruses are around 3.0 kb and encode seven genes. In the complementary-sense they encode the Rep, C2, replication-enhancer (REn) and C4 proteins and in the virion-sense the CP,V2 and V3 proteins (Figure 1.3)[29-33]. Unusually, HRCTV appears to lacks the REn gene [34].

Chapter 1 Introduction and Review of Literature

Figure 1-3 Typical Genome Arrangement of Curtoviruses (Left) and the Leafhopper Vector of Beet Curly Top Virus, Circulifer Tenellus (Right). The coat protein (CP), ss/dsDNA regulator (V2) and putative movement protein (V3) are encoded in the virion-sense whereas the replication associated protein (Rep), replication enhancer protein (REn), C2 and C4 are encoded in the complementary- sense. The position of the predicted hairpin structure, containing the conserved nonanucleotide sequence (TAATATTAC) in the loop, is shown at position zero.

1.3.1.3Topocuvirus The genus Topocuvirus contains only a single member, Tomato pseudo-curly top virus (TPCTV) that is transmitted by the treehopper (Micrutalis malleifera) and occurs in Florida. The genome of TPCTV is monopartite and approximately 2.8kb in size. It encodes six genes, two (encoding the CP and V2 protein) in the virion-sense and four (encoding the Rep, C2, C3 and C4 proteins) in the complementary-sense (Figure 1.4). The functions of TPCTV genes have not been investigated but, based upon their sequence relatedness to the products of other geminiviruses, it is presumed they have similar functions to the positionally analogous genes of begomoviruses. The only study conducted on TPCTV showed that it can trans-complement the movement of DNAA of bipartite begomoviruses in the absence of the DNA B [35].

Chapter 1 Introduction and Review of Literature

Figure 1-4 Typical Genome Organization (Left) and the Treehopper Vector, Micrutalis Malleifera (Right), of Tomato Pseudo Curly Top Virus. The coat protein (CP) and V2 are encoded in the virion-sense whereas the replication associated protein (Rep), C2, C3 (replication enhancer protein [REn]) and C4 genes are encoded in the complementary-sense. The position of the predicted hairpin structure, containing the conserved nonanucleotide sequence (TAATATTAC) in the loop, is shown at position zero.

1.3.1.4 Begomovirus The genus Begomovirus is the largest genus of the family Geminiviridae having more than 300 species [12]. These are all transmitted by the whitefly Bemisia tabaci to dicotyledonous host plants. In the NW the begomoviruses are typically bipartite, with genomes consisting of two ssDNA components (known as DNA-A and DNA-B) that are usually both required for viral infection. Recently the first monopartite begomovirus, with a genome consisting of a single ssDNA circle homologous to the DNA A components of bipartite viruses, has been identified in the NW [36, 37]. In the OW the vast majority of begomoviruses are monopartite, with bipartite viruses being less common. The genomes of monopartite begomoviruses are a homologue of the DNA-A components of bipartite viruses [38].

The genomes of monopartite, and DNA A components of bipartite begomovirus, encode two genes in the virion-sense and four genes in the

Chapter 1 Introduction and Review of Literature complementary-sense (Figure 1.5). The genes in the virion-sense encode the V2 protein (section 1.4.5) and the coat protein (CP; section 1.4.7). The complementary- sense genes encode the replication-associated protein (Rep; section 1.4.1), the transcriptional-activator protein (section 1.4.2), the replication enhancer protein (REn, section 1.4.3) and the C4 protein (section 1.4.4). All begomoviruses native to the NW lack the (A)V2 gene. In the OW two bipartite begomoviruses having features typical of the NW viruses, including the lack of the AV2 gene have been identified; Corchorus golden mosaic virus[39] and Corchorus yellow vein virus [40]. DNA B components encode two genes, one in each orientation (Figure 1.5). These are, in the virion-sense, the nuclear shuttle protein (NSP; section 1.4.8) and in the complementary-sense the movement protein (MP; section 1.4.9). The DNA A and DNA B components of begomoviruses share an approximately 200 nt sequence (known as the common region [CR]) which contains the conserved, between all geminiviruses, nonanucleotide-containing hairpin and sequences involved in the interaction with Rep to initiate virion-strand DNA replication [41].

The majority of monopartite begomoviruses are associated with novel ssDNA satellites, known as betasatellite and alphasatellites, which are approximately half the size of the helper begomovirus genome (Figure 1.5).

1.3.2 Satellites Associated with Begomoviruses Satellites are defined as subviral agents, composed of nucleic acid, that rely on co- infection with a helper virus for their proliferation. Satellite nucleic acids have nucleotide sequences that are distinct from those of their helper viruses. Many RNA viruses are associated with (RNA) satellites and these vary greatly in size, from less than 200 nucleotides to over 1,500 nucleotides. Some of the larger satellites may encode functional genes, generally the smaller satellites do not but do have a strong secondary structured. Satellites may have dramatic effects on the symptoms induced by their helper viruses [42, 43], ranging from symptom amelioration to severe exacerbation of symptoms. These effects may vary depending upon the helper virus and host plant.

The first DNA satellite was identified in association with Tomato leaf curl virus (ToLCV) in tomato plants originating from Australia and is known as ToLCV-

Chapter 1 Introduction and Review of Literature sat [44]. Subsequently two classes of satellites have been identified in association with begomoviruses, the alphasatellites (previously known as DNA-1) and the betasatellites (previously known as DNA β). The evidence suggests that ToLCV-sat is a defective betasatellite [44].

1.3.2.1. Betasatellites

The majority of betasatellites identified so far have been found associated with monopartite begomoviruses, and only in the OW. However, more recently, betasatellites have also been found associated with some bipartite begomoviruses and with a mastrevirus (Wheat dwarf India virus) in a monocotyledonous plant, wheat [45-48].

The interaction of betasatellites with geminiviruses ranges from fully dependent, the virus requires a betasatellite to infect a particular host, to facultative, the virus does not require the betasatellite but this sometimes associated with it. The best example of a dependent interaction that of the requirement of a number of viruses associated with cotton leaf curl disease in South Asia requiring the betasatellite Cotton leaf curl Multan betasatellite to infect and cause disease in cotton[49, 50]. In the field, every plant with CLCuD symptoms contains the satellite. In contrast, in the field only some tobacco plants infected with Tobacco curly shoot virus are also associated with Tobacco curly shoot betasatellite [51]. In most cases the presence of the betasatellite enhances symptoms and increases viral DNA levels in plants [52-54].

Betasatellites are approximately half the size (~1350nt) of their helper virus genomes and depend upon their helper virus for encapsidation, insect transmission, movement and replication in plants [55]. Their sequences are unrelated to geminiviruses with the exception of a nonanucleotide sequence (TAATATTAC) forming part of a predicted stem-loop structure with similarity to the origin of virion- strand DNA replication of geminiviruses. Betasatellites have a highly conserved structure (Figure 1.5). They encode a single protein, known as βC1, a region of sequence rich in adenine (A-rich region) and sequence of ~150 nt conserved between all betasatellites (known as the satellite conserved region ([SCR]; [56]).

βC1 is protein of ~118 amino acids with an approximate molecular weight of 13.7kDa. This protein mediates all function of betasatellites identified so far. βC1 is a

Chapter 1 Introduction and Review of Literature dominant symptom (pathogenicity) determinant [57], may be involved in virus movement [58, 59] and interferes with plant host defense by suppressing posttranscriptional (PTGS) and transcriptional gene silencing (TGS; [60-62]. Additionally βC1 has been shown to down-regulate the expression of some jasmonic acid responsive genes which are involved in plant defenses against insects [63] and modulate the expression levels of some microRNAs (miRNAs) involved in plant development [64]; see section 1.6.2.2 for a description of miRNAs and their functions), although the precise mechanism by which this is achieved remains unknown. The βC1 protein has been shown to interact with a number of host factors including ASYMMETRIC LEAVES 1, which is involved in leaf polarity and plant defense responses [64], and SUCROSE-NONFERMENTING1-related kinase (SnRK1) [59]. The βC1 protein also interacts with the host ubiquitin-conjugating enzyme SIUBC3 and alters the host ubiquitination system [65]. Additionally the βC1 protein of Bhendi yellow vein betasatellite has been shown to interact with the CP of its helper virus, Bhendi yellow vein virus [66]. Although the significance of this has yet to be elucidated, the interaction may occur to facilitate virus movement in planta.

Chapter 1 Introduction and Review of Literature

Figure 1-5 Typical Genome Arrangement of Begomoviruses (Top), Structures of their Associated Satellites (Bottom Left) and the Vector of Begomoviruses, The Whitefly Bemisia Tabaci (Bottom Right). The genomes of most New World (NW) begomoviruses consist of two components called DNA A and DNA B. Only a single monopartite NW begomovirus has been identified. In the Old World (OW) the vast majority of begomoviruses are monopartite with a few bipartite examples. The genomes of monopartite begomoviruses are a homolog of the DNA A of bipartite viruses. The genes on the genomes of monopartite begomoviruses (or the DNA A components of bipartite viruses)encode the replication-associated protein (Rep), the coat protein (CP), the replication enhancer protein (REn) and the transcriptional- activator protein (TrAP). The products encoded by the (A)V2 and (A)C4 genes have yet to be named. Genes on the DNA B component encode the nuclear shuttle protein (NSP) and the movement protein (MP). The DNA A and DNA B components share a sequence, known as the common region (CR), which encompasses a conserved hairpin structure containing the nonanucleotide sequence TAATATTAC. The genomes of NW begomoviruses differ from those of the OW in lacking the (A)V2

Chapter 1 Introduction and Review of Literature gene. However, two bipartite viruses have been identified in the OW which also lack the AV2 gene. Most monopartite begomoviruses (and occasionally bipartite begomoviruses) are associated with betasatellites and, in some cases, alphasatellites, which are approximately half the size of begomovirus components. Both beta- and alphasatellites contain a region of sequence rich in adenine (A-rich) and both contain a predicted hairpin structure (shown at position zero) which contains a nonanucleotide sequence (TAATATTAC for betasatellites, TAGTATTAC for alphasatellites). Betasatellites encode a single product, the βC1 protein, on a gene in the complementary-sense and have a region of sequence conserved between all characterized betasatellites (the satellite conserved region [SCR]). The alphasatellites encode a single product (Rep) from a gene in the virion-sense. Note that the components are not drawn to scale.

1.3.2.2 Alphasatellites

In the OW monopartite begomoviruses that are associated with betasatellites are frequently also associated with another type of circular ssDNA molecule, collectively known as alphasatellites (previously called DNA 1; [70]). Alphasatellites are capable of autonomous replication in permissive the host cells without the support of a helper virus [67] but depend on helper virus for movement and vector transmission [68, 69]. For this reason they are not considered true satellites and are best described as satellite like molecules. In common with betasatellites, alphasatellites are approximately half the size (~1380nt) of helper begomoviruses. Alphasatellites have a highly conserved structure (Figure 1.5). They encode a rolling-circle replication (RCR) initiator protein in the virion-sense, with similarities to the Rep proteins of nanoviruses [67, 70], a region of sequence rich in adenine residues (A-rich) and contain a predicted hairpin- loop like structure containing the nanovirus-like nonanucleotide sequence TAGTATTAC. It has been suggested that alphasatellites might have evolved from nanovirus components during a mixed infection with a begomovirus [13, 67, 68]. Recently, phylogenetically distinct alphasatellites have also been reported for the first time in the NW, associated with bipartite begomoviruses [71, 72]. The interaction of alphasatellites with a mastrevirus has recently been reported for the first time in a monocotyledonous plant [45]. Earlier it was found that alphasatellites have little

Chapter 1 Introduction and Review of Literature genetic diversity but recent reports shown that these molecules are far more diverse than originally thought[70, 73-75].

The alphasatellites appear to have no role in pathogenicity [68, 70] and their precise function remains unclear. It has been suggested that they may act as interfering molecules, slowing down the replication of their helper begomoviruses, allowing the host plant to survive longer and giving the virus complex a longer time to be transmitted [76]. Recently, It has been shown that Ageratum yellow vein Singapore alphasatellite (AYVSGA) can reduce the symptoms of the virus complex with which it is associated, specifically reducing the levels of the associated betasatellite [77]. The Rep proteins of at least some alphasatellites have suppressor of PTGS activity, suggesting that alphasatellites may be involved in overcoming host defenses [78].

1.4. Functions and Interactions of Proteins Encoded by Geminiviruses

1.4.1 Replication-Associated Protein (Rep) The replication-associated protein (Rep) is a 39-41 kDa protein, encoded in complementary-sense orientation by the genomes of all whitefly transmitted geminiviruses and has homology with the RCR initiator proteins of bacterial plasmids [79, 80]. Mastreviruses, and possibly eragroviruses, transcribe Rep from a spliced messenger RNA [12, 22, 81].

Rep is the only virus-encoded product required for viral DNA replication. Active Rep is a homo-oligomeric protein that plays a crucial role in initiating RCR of the circular virus genome. The N-terminal end of the Rep protein contains nicking, ligation and DNA binding domains, while the C-terminal end contains ATPase activity[82-87]. During RCR, Rep binds with the iteron-related sequences and on the virion strand, produces a nick at the stem loop region for the initiation of replication. It binds with the nicked DNA at the 5' end via a tyrosine residue. The 3' end of the DNA then acts as a primer for DNA synthesis (see section 1.5; [87].

Geminiviruses do not encode DNA polymerase enzymes. Rather Rep modifies the host cell cycle by interacting with the retinoblastoma related proteins of plants and

Chapter 1 Introduction and Review of Literature thereby activates the host machinery for DNA synthesis. Geminivirus Rep acts together with various host factors, such as factor C, histone H3 and proliferating nuclear cell antigen (PCNA), to recruit host DNA replication machinery at the origin of replication [88-91].

A most surprising recent result has been the demonstration that Rep has suppression of TGS activity (see detail of TGS in section 1.6). It has been previously demonstrated that the Rep proteins of several begomoviruses reduce expression of methyltransferase1 (MET1) and chromomethylase3 (CMT3); proteins responsible for the maintenance of DNA methylation in plant cells [92]. TGS suppression activity of Rep was subsequently also demonstrated for the mastrevirus WDV [93] . This work also showed that N-terminal Rep sequences were responsible for this activity.

1.4.2 Transcriptional Activator Protein (TrAP)/C2

The transcriptional activator protein (TrAP/C2) is a multifunctional protein encoded by begomo, curto and topocu viruses (Figure 1.5). It is small protein of approximately 134 aa[38, 94, 95]. Only a single virus species, the monopartite begomovirus Cotton leaf curl Burewala virus (CLCuBuV), lacks a ~134 aa TrAP gene. This virus potentially expresses a truncated 35aa, residual protein [96-98] which, the evidence suggests, maintains many of the functions of the full-length protein [97]. Mastreviruses lack a TrAP gene and trans-activation of the virion-sense transcription unit appears to be conducted by the RepA protein [99].

The TrAP/C2 gene is transcribed from a promoter sequence located in the Rep gene [100]. The TrAP transactivates (upregulates) the virion-sense promoter to switch-on expression of the late genes encoding the V2 protein, CP and, for bipartite begomoviruses, NSP. Some TrAP homologs, such as that of BCTV, do not transactivate and are hence called C2 [101]. In addition to controlling virus gene expression, TrAP/C2 also modulates host gene expression, including the expression of at least some miRNAs [102, 103]. To be able to influence either viral or host transcription it is necessary that the TrAP/C2 protein accumulates in the nucleus [102]. The TrAP of the monopartite begomovirus Bhendi yellow vein mosaic virus has been shown to interact with karyopherin α, part of a protein family which is involved

Chapter 1 Introduction and Review of Literature in nucleo-cytoplasmic trafficking of proteins and RNAs, and is transported to the nucleoplasm [104].

The TrAP/C2 protein may be a determinant of pathogenicity[104, 105], may suppress both post-transcriptional (PTGS) and transcriptional gene silencing (TGS; [[106, 107]) and may counter a hypersensitive (programmed cell death) response induced by other virus-encoded proteins including NSP and V2 [108, 109].

TrAP/C2 alters several host proteins levels that are part of the photosynthesis pathway and hence cause an imbalance in cellular homeostasis and normal growth [110]. TrAP/C2 additionally inactivates the universal metabolism regulator SNF1 kinase, that responsible for maintaining cellular energy balance [337]. Recently TrAP as also been shown to be important in the maintenance of betasatellites by begomoviruses [111].

1.4.3 Replication Enhancer Protein (REn)

The replication-enhancer protein (REn) is a small protein ~16 kDa, consist of ~132 aa; encoded by most of dicot-infecting geminiviruses. For mastreviuses the function of REn is believed to be performed by the Rep A protein [80]. REn is an important protein required for optimal replication of geminvirus genomes. The protein is not essential for infectivity but dramatically up-regulates virus accumulation by interaction with the Rep protein [112, 113]. REn interacts with Rep, the important protein involved in rolling-circle replication. Although REn is not essential, its presence increases viral DNA upto 50 fold [114].

As well as binding with Rep, REn binds with and forms oligomeric interactions with various host factors such as plant retinoblastoma related (pRBR) protein and PCNA, which is an essential part of the DNA replisome. Analysis of REn using the yeast two hybrid system showed that mutation in the core region of this protein resulted not only the reduced level of REn oligomerization but also inactivates the PCNA and Rep interactions. These results showed the importance of REn-REn, Rep- REn and REn-PCNA interactions in geminivirus replication [88, 114, 115].

Chapter 1 Introduction and Review of Literature

1.4.4 (A)C4

The (A)C4 gene is found in most dicot-infecting geminiviruses and shows considerable variation in sequence and gene length. The C4 gene lies within the Rep coding sequence but in a different reading frame [41]. The precise function of the AC4 protein is remains unclear. However, mutation analysis of C4 has shown that this protein is involved in symptom development and is a pathogenicity determinant [111, 116, 117]. Stanley and Latham, (1992) made mutations in the C4 gene of BCTV without disturbing Rep amino acid sequence[118]. The N. benthamiana plants inoculated with the C4 mutant showed a modified phenotype with downward leaf curling and vein yellowing, but did not produce vein thickening and upward leaf curling, which are the characteristic symptoms of BCTV [118]. BCTV C4 mutants cause asymptomatic infection in Beta vulgaris, without affecting DNA replication, suggesting a role for C4 in pathogenicity rather than replication [32, 116, 119].

The C4 protein of BCTV binds non-specifically with DNAs and may act, in conjunction with the V2 protein to facilitate virus movement from nucleus to cytoplasm. The C4 protein of TYLCV was found to localize along the peripheral area of the cell, which is common with the movement protein of bipartite begomoviruses [120]. The role of AC4 protein as suppressor of post transcriptional gene silencing has also been shown. AC4 has the ability to bind with siRNAs [121, 122]. For monopartite begomoviruses the C4 protein has also been shown to suppress PTGS, having strong affinity to bind with small dsRNAs ([60]).

In transgenic plants of N. benthamiana, constitutive expression of the C4 protein resulted virus-like symptoms, suggesting that the C4 protein interferes in plant development, likely by interfering with miRNA expression [103, 123, 124].

1.4.5 (A)V2

This gene is the distinguishing character of OW begomoviruses, with the two exceptions of Corchorus golden mosaic virus (CoGMV; [125]) and Corchorus yellow vein virus (CoYVV; [40]), but is absent in NW begomoviruses. The (A)V2 protein consist of approximately 112aa and is essential for systemic infection of monopartite begomoviruses [111, 126]. For bipartite begomoviruses the AV2 is not essential for

Chapter 1 Introduction and Review of Literature infectivity but mutation reduces CP expression suggesting that the expression of the two proteins is closely linked [127]. Additionally the pathogenicity of AV2 is dependent on a conserved protein kinase C (PKC) motif, and phosphorylation is essential for its functionality and the elicitation of cell death [385]. The V2 of monopartite begomoviruses is a symptom determinant and PVX-mediated expression leads to the development of virus-like symptoms and a systemic HR in N. benthamiana and N. tabacum [103, 109].

The begomovirus V2 protein localizes around the cell periphery, the nucleus and co-localizes with endoplasmic reticulum [128]. This pattern of localization is similar to the localization of the bipartite begomovirus MP[120]. Mutational analysis of the (A)V2 gene suggested that the proteins is involved in intercellular movement and systemic infection [111, 126].

The V2 protein is suppressor of post transcriptional gene silencing (PTGS). For TYLCV the V2protein has been shown to bind with small RNAs whereas that of CLCuMuV binds with long RNAs, especially with dsRNA but appears not to bind small RNAs ([60, 129]. Additionally the V2 of TYLCV has been shown to interact with SISGS3, which is involved in the RNA silencing pathway [130].

1.4.6 Curtovirus V2 and V3 Proteins

The V2 gene of curtoviruses encodes a protein that appears unique to viruses of this genus. Mutation of this gene results in virus that is infectious but does not induce symptoms. Such infections are characterized by low levels of ssDNA, suggesting that this protein controls the switch from viral dsDNA to ssDNA production [31].

The V3 gene of curtoviruses is believed to be involved in movement of virus because mutation results in greatly reduced infectivity and infections with greatly reduced viral DNA levels [31, 131]. Although the V3 protein of curtoviruses appears to be the functional analog of the mastreviruses MP and begomovirus V2 protein, it has no sequence similarity to these.

Chapter 1 Introduction and Review of Literature

1.4.7 Coat Protein (CP)

The CP gene is encoded by all geminiviruses on the virion-sense strand. It is the only structural protein encoded by geminiviruses, forming the typical geminate capsids. Geminivirus virions consist of two incomplete and joined T=1 icosahedral heads and 110 CP subunits, organized as 22 pentameric capsomers (Figure 1.1)[7, 132-134]. Each virion (geminate particle) has been shown to encapsidate a single ~2800nt ssDNA [7] whereas monomeric (isometric) particles encapsidate approx. half genome (genomic component) sized ssDNAs [135].

The geminivirus CP is multifunctional, being involved in encapsidation [136], insect transmission [137, 138], accumulation of ssDNA and movement in plants [139, 140]. For bipartite begomoviruses the CP is not essential for infectivity. Mutation of the CP gene of bipartite begomoviruses leads to infections that have longer latent periods (the time between inoculation and first symptoms), attenuated symptoms and reduced amounts of ssDNA [126]. For all other geminiviruses which have been assessed, mutation of the coat protein prevents infection of plants, although the virus is still able to replicate in inoculated tissues [111]. The difference between bipartite and monopartite geminiviruses is believed to be due to the ability of the DNA B encoded products of bipartite begomoviruses to complement the missing functions of the CP. Nevertheless, the effect on latent period, of mutation of the CP gene, indicates that for bipartite begomoviruses the CP still has an important function; presumed to be the ability to use the fast spread throughout the plant using the phloem. This suggests that the form of the virus that is translocated in the phloem is either as virions or as nucleoprotein complexes involving the CP.

The coat protein of geminiviruses plays a vital role in insect transmission and determines insect vector specificity. Replacement of the CP gene ofACMV, a bipartite whitefly-transmitted begomovirus, with CP gene ofBCTV, a leafhopper- transmitted curtovirus, resulted in change of insect vector from whitefly to leafhopper [137]. Further studies revealed that replacement of the CP gene of the whitefly nontransmissible Abutilon mosaic virus (AbMV) with that of the transmissible the Sida golden mosaic virus (SiGMV) resulted in a chimeric virus that was transmissible to various hosts by whiteflies, showing that the lack of transmission of the AbMV was due to defect(s)/mutation(s)in the CP [138].

Chapter 1 Introduction and Review of Literature

The CP binds DNA in a sequence non-specific and cooperative manner. The CP of MSV has been shown to bind equally well with both ssDNA and dsDNA; the sequences of the CP mediating DNA binding were mapped to the N-terminal 104 amino acids [141]. The CP of TYLCV, in contrast, bound much more readily with ssDNA [142]. The CP localizes to the nucleus and nucleolus [120]. Both nuclear localisation signals (NLSs; [143]) and nuclear export signals (NES; [144]) have been identified in geminivirus CP sequences. For the bipartite begomovirus MYMV the CP has been shown to interact with importin α, a component of the complex that targets the nuclear pore [145]. For the CP of the monopartite begomovirus TYLCV interaction with karyopherin α occurs via the N-terminal NLS [146] to facilitate nucleo-cytoplasmic trafficking. The import and export from the nucleus is dependent on binding to ssDNA [147]. Together these findings indicate that the CP moves viral DNA between the nucleus and the cytoplasm [148, 120, 149, 150]. This is particularly important immediately after insect transmission and before any virus genes are expressed, a time at which only the CP is associated with the virus genome.

For TYLCV the CP, or more specifically virions, has been shown to interact with GroEL, a protein in the hemolymph of whiteflies that is produced by endosymbiotic bacteria [151]. This interaction is believed to protect the virus whilst circulating in the insect. Recently that CP has also been shown to play an important role in the maintenance of betasatellites by begomoviruses [111]. Additionally the CP of BYVV had been shown to interact with the βC1 protein of its cognate betasatellite. This interaction likely is involved in the movement of the virus in planta.

1.4.8 Nuclear Shuttle Protein (NSP)

The NSP is encoded on the virion-sense strand of the DNA B component of bipartite begomoviruses (Figure 1.5). It is a multifunctional protein whose synthesis is regulated by TrAP at the transcriptional level. Transport of ssDNA of bipartite geminiviruses into and out of the nucleus depends on NSP. However, immediately upon infection, when no NSP is available, the CP is involved in the transport of viral DNA into the nucleus [152]. For some begomoviruses, such as Tomato leaf curl New Delhi virus, NSP has been shown to be a pathogenicity determinant which can induce a hypersensitive (necrotic) response in plants [153].

Chapter 1 Introduction and Review of Literature

NSP in a sequence non-specific DNA binding protein, that has the ability to bind both ssDNA and dsDNA in the size range of 2kb to 9kb, with a preference for the open-circular form. The protein contains two nuclear localization signals, mutation of which abolishes virus infectivity. The protein interacts with MP [see below for a discussion of the models proposed for explaining of bipartite begomovirus movement in plants; [154-156]. NSP additionally interact with a variety of host factors, including an acetyl transferase from A. thaliana, a receptor-like protein kinase from tomato and soybean, the NSP-interacting kinase (NIK), the NSP interacting GTPase (NIG) and a proline-rich extensin-like receptor protein kinase (PERK; [157- 159].

1.4.9 Movement Protein (MP)

The MP of bipartite begomoviruses is encoded on the complementary sense strand of the DNA B component (Figure 1.5). The major function of the MP of bipartite geminiviruses is cell-to-cell movement of virus by interaction with endoplasmic reticulum [160, 161]. The MP localizes at the cell periphery and at plasmodesmata [160, 162]. It can facilitate virus movement by increasing the size exclusion limit of plasmodesmata [163]. MP has also, in some cases, been shown to be a pathogenicity determinant [164, 165].

The MP of Abutilon mosaic virus (AbMV) has been shown to contain three phosphorylated residues which play important part in the accumulation of viral DNA and the development of symptoms. The C-terminal domain of AbMV MP contains 3 phosphorylated amino acid residues [166]. Mutation (thus prevention of phosphorylation) of two of these sites resulted in viruses with enhanced symptoms and with elevated viral DNA levels.

Two models have been proposed to explain the movement of bipartite begomoviruses –the “couple skating model” and the “relay race model”. The couple skating model proposes that NSP play its role in the nucleus and interacts with viral DNA, transferring this to the cytoplasm, where MP join the DNA-NSP complex to facilitate the movement of viral ssDNA through plasmodesmata into the next cell. The only difference with the relay race model is that, rather than NSP joining MP, it displaces NSP and facilitates movement of viral DNA through plasmodesmata. NSP

Chapter 1 Introduction and Review of Literature and MP are both essential for intracellular movement of viruses [154, 386]. In some cases, MP has been found to localize at the plasma membrane and plasmodesmata [160], whereas in other cases, such as the MP of Mungbean yellow mosaic India virus in N.benthamiana, it was found to localize around epidermal cells [167].

1.5 Replication of Geminiviruses

The replication of geminivirus DNA takes place in the nucleus of host cells by rolling-circle replication (RCR)[168]. RCR occurs after synthesis of the complementary-sense strand using the host DNA replication machinery and an endogenous primer [4]. Uniquely mastreviruses have been shown have an encapsidated primer that would prime the first round of complementary-strand synthesis following infection [24, 25]. Geminivirus RCR is analogous to that found in some bacteriophages and prokaryotic ssDNAs [168, 169]. To initiate RCR Rep recognizes and binds to iterons in the IR and produces a nick in the virion-sense strand, within the nonanucleotide sequence ahead of the terminal adenine (TAATATT/AC;[170]. Rep becomes covalently attached to the 5'end of the nicked strand via a tyrosine residue [170]. The virion-strand is elongated by host DNA polymerases using the 3'terminus as the primer and the complementary-sense strand as template [387, 112, 91, 388].Unit length genome copies are then released by the nicking-joining activity of Rep to release ssDNA molecules which may be either encapsidated or serves as template for RCR to produce more copies of virus genome (Figure 1.6).

In addition to RCR, geminiviruses also appear to use a recombination- depenndent replication (RDR) mechanism [4, 171, 172]. The proposed model for RDR of geminiviruses consists of three main steps (Figure 1.6). 1) Firstly, damaged dsDNA is processed to form a single-stranded 3' end that is required for DNA strand invasion which forms a displacement loop structure by invasion of homologous duplex.2) This permits the ssDNA to function as primer for DNA replication. 3) The hetero-duplex is extended by host polymerases at the back of the loop as DNA polymerase extend leading strand at front of the loop. The size of loop possibly remains unchanged because both the reactions are taking place at a similar rate [4, 173]). Geminiviruses are transcribed bi-directionally, meaning that there is the

Chapter 1 Introduction and Review of Literature possibility of collision between transcription and replication machineries[174]. The detailed mechanism of RDR is not very well understood. During RCR double stranded breaks may occur in the viral genome. Such damaged genome copies are possibly rescued by RDR [173]. This RDR model is based on replication intermediates, which are compatible with RDR mode analogous to bacteriophage T4. Various geminiviruses, including TYLCV, TGMV, BCTV and AbMV have been shown experimentally to use RDR [4, 172].

Fig 1-6 Rolling-Circle Replication (RCR) and Recombination-Dependent Replication (RDR) Mechanisms. For RCR the replication associated protein (Rep) binds with the origin of replication (ori) (a), nicks at the origin and binds at the 5'-end of the nicked strand (b) Host polymerases extend the nicked strand, using the 3’end as a primer and the complementary strand as the template, displacing the DNA to which Rep is bound (c) A new ssDNA molecule is released by Rep nicking and ligating at

Chapter 1 Introduction and Review of Literature the origin (d) new nicking, ssDNA closing and Rep release. (A) The 3’ end of a damaged viral genome, processed to be single-stranded, interacts with cccDNA at an homologous site. (B) homologous recombination (C) loop migration and ssDNA elongation (D) ssDNA elongation and complementary strand synthesis resulting in a dsDNA. This figure was modified and reproduced from [4].

1.6 Transgenic Strategies for Countering Geminiviruses

At this time the only way to counter geminiviruses is by killing the insect vectors using insecticides, preventing access of the vector to plants, for example by using screens or plastic film, or by breeding virus resistant plant varieties. The use of insecticides is expensive, environmentally unfriendly and also not durable since the insect vectors develop resistance. The use of screens is only practical on a small scale. In many cases the breeding of resistant varieties has not proven possible, due to the absence of suitable resistance sources, or has not been durable, such as the loss of resistance against the viruses causing CLCuD in Pakistan in the early 2000s [73, 97, 175]. It is for these reasons that researchers have increasingly looked at genetic engineering as a means of obtaining resistance against viruses, including geminiviruses. In essence the strategies used to obtain transgenic resistance to geminiviruses can be divided in those that are pathogen-derived and those that are not.

1.6.1 Pathogen Derived Resistance (PDR)

PDR can be further divided into two subclasses - 1) Pathogen derived protein mediated resistance (PDPMR), in which a functional protein is used to mediate resistance [176, 177] and 2) pathogen derived non-protein mediated resistance (PDNPMR) for which viral sequences which donot encode a functional viral protein is used [178, 179]. PDPMR was possibly first shown for geminiviruses by the expression of a truncated Rep protein of African cassava mosaic virus (ACMV) in N. benthamiana which yielded modest resistance in transgenic plants [180]. This resistance was very sequence specific because the transgenic plants harbouring Rep protein of ACMV didnot show resistance against distantly related species of geminiviruses, TGMV and BCTV. The mechanism of resistance in this case remains unclear. Possibly it could be due to the formation of non-function Rep multimers – a phenomenon known as dominant negative mutant. However, it is equally possible that

Chapter 1 Introduction and Review of Literature the resistance was due to RNAi (see subsequent sections) since, although transcription of the transgene was demonstrated, expression of the truncated Rep protein was not. Sinisterra et al. [181] similarly could not detect protein when expressing the CP of a begomovirus in N. tabacum, although transcription was evident and plants showed various responses from susceptibility to immunity [181]. Hou et al. [182] showed a more convincing PDPMR by expressing the MP and NSP proteins of BDMV in tomato. Expression of the proteins was demonstrated and this yielded resistance, but not immunity, and was also shown to be able to delay the infection of a related begomovirus. Unfortunately the expression of these proteins in plants in some cases induced virus-like symptoms, one of the potential drawbacks of protein expression for obtaining resistance.

Extensive efforts have been made in the realm of PDNPMR to use viral DNA, specifically defective interfering (di) viral DNAs to obtain resistance in plants. In most geminivirus infections, replication errors lead to a population of virus derived DNAs of approximately half virus genome (component) size [183]. Transformation of plants with partial or full dimeric repeats of such diDNAs has been shown to reduce virus levels in plants and attenuate symptoms [184]. Additionally the resistance was shown to be very virus specific – due to the specificity, for trans-replication, imparted by Rep (section 1.4.1). Unfortunately, after extensive investigation, this has so far not yielded a useable resistance. [185], using transgenic sugarbeet expressing a BCTV diDNA, showed that, rather than yielding resistance, the transgene derived diDNA enhanced symptoms. The authors speculated that this could be due to the expression, from the transgene derived diDNA, of a pathogenicity determinant (the C4 protein; Figure 1.5).

The most widely used and successful PDNPMR strategy for resistance has used RNA interference (see section 1.7). This strategy involves the expression in plants of virus derived sequences which are processed by the plant to produce so- called small interfering (si)RNAs which mediate the effect of RNAi. The transgenes used could be virus sequences expressed in sense, antisense or, more recently, hairpin constructs (expression of both sense and antisense sequences separated by an intron, which has been shown to deliver more efficient resistance; [121, 186]. A variety of geminivirus sequences from a range of viruses has been used to generate resistance although in most cases, it was a truncated version of the Rep gene was chosen.

Chapter 1 Introduction and Review of Literature

Examples of this include African cassava mosaic virus [ACMV; [187]], Mungbean yellow mosaic virus (MYMV; [188]), Tomato yellow leaf curl virus (TYLCV; [189]), SriLankan cassava mosaic virus (SLCMV; [187]), Chickpea chlorotic dwarf virus (CpCDV; [190]) and Tomato leaf curl New Delhi virus (ToLCNDV; [191]). RNAi- mediated resistance has some advantage over protein mediated resistance since viral coding or non-coding sequences can be targeted and there is less likelihood of deleterious effects on plant growth.

1.6.2 Non-Pathogen Derived Resistance

NPDR has so far always involved the expression of proteins. Expression of a homologue of GroEL (a chaparonin produce by insect endosymbiotic bacteria) has been shown to impart resistance. GroEL has been shown to bind geminiviruses in insects where it is believed to stabilize (protect) the virus as it circulates through the insect’s haemolymph. Plants transformed with GroEL were surprisingly protected from harmful effects of virus without reduction of virus titer [192-194].

Another novel approach for resistance against geminiviruses utilises peptide aptamers. Peptide aptamers are short ~20aa peptides which binda target protein and interferes with its function. Aptamers can interfere with protein-DNA and protein- protein interactions [195, 196]. The peptide aptamer approach to resistance has been investigated by targeting the Rep protein of TGMV [197]. Recently, various peptide aptamers have been identified which strongly interact with Rep protein of quite distinct begomoviruses. Although not providing immunity, the aptamers had striking effect on symptoms in transgenic plants and significantly reduced virus DNA levels [198].

Artificial zinc finger (AZF) proteins, which are modified nucleic acid binding proteins, are another resistance strategy which has been investigated in last decade for resistance particularly against geminiviruses [199, 200]. Various techniques have been adopted previously to increase its affinity of AZF protein to bind with ssDNA viruses which resulted in reduced or no replication of the virus [201, 202].

Although not entirely non-pathogen derived, Hong et al.[203, 204] used the “inducible” properties of the begomovirus virion-sense transcription unit to express dianthin in transgenic plants. Thus, upon infection, the TrAP induced the expression

Chapter 1 Introduction and Review of Literature of dianthin, a potent ribosome-inactivating protein, leading to cell death. This strategy was shown to lead to efficient resistance (just cell death at the site of inoculation). However, the approach has not found further use due to the fear of expressing such a toxic protein in plants for human or animal consumption.

Despite extensive efforts to obtain resistance against geminiviruses using genetic engineering, only for one virus has a commercially useful variety been introduced to the market. Bean lines with RNAi-mediated resistance to BGMV have recently been introduced in Brazil [205]. The resistance in this case appears to impart immunity.

1.7 RNA Interference (RNAi)

RNA interference (RNAi; also known as RNA silencing, in plants, and quelling, in fungi) is an evolutionarily conserved mechanism used by eukaryotic organisms, including plants animals, fungi and insects [206-208], that plays a role in diverse biological systems including host defense, control of gene expression (including chromatin modeling and DNA methylation) and developmental regulation [209-211]. Two major silencing pathways have been described in plants [212, 213]. These are post-transcriptional gene silencing (PTGS) and transcriptional gene silencing (TGS).

When exposed to foreign or aberrant nucleic acids, most living organisms possess a system to silence (degrade) this in a highly sequence specific manner, to avoid its integration in the host chromosomes or other cellular and sub-cellular processes [207, 214, 215]. In the past few years, biochemical and genetic studies have been made separately or in combination to understand the mechanism of RNAi (reviewed by [216]).

1.7.1 Mechanism of RNAi

At the heart of RNAi is the production of 21-25nt double stranded RNA (dsRNA) by the action of RNA nucleases on long dsRNAs [217, 218]. RNAi has been extensively studied in the last decade and can be summarized into two steps mechanism.

In the first step, aberrant or any other ssRNA comes under the action of an RNA dependent RNA polymerase (RdRp) to form dsRNA. This is then degraded (diced) into short interfering RNAs (siRNAs) of 21-25 nt by the action of dicer-like

Chapter 1 Introduction and Review of Literature enzymes (DCLs) having RNase III activity. In the second step, these siRNAs serve as sequence-specific guides for recognition and degradation of target RNAs. Although, it is not a universal characteristic of RNAi, in some circumstances signal amplification and spread of silencing throughout the organisms have also been reported [219, 220].

Depending upon the source of the dsRNA trigger the RNAi response can lead to either TGS or PTGS [reviewed by [221]. TGS is related to histone modification and DNA methylation which leads to transcriptional repression. Translational repression and mRNA degradation occur in the case of PTGS [222]. However, in cases where the siRNA and target have imperfect complementarity, PTGS can lead to translational repression without extensive target degradation.

1.7.2 Components of the RNAi Pathway

1.7.2.1 Double Stranded RNA (dsRNA)

The unifying feature of RNAi is the production of small double stranded RNAs which act as specific determinants for gene regulation [223, 224]. The first evidence of the involvement of small RNAs in RNAi was obtained with the identification of the accumulation of small RNAs of ˜25 nt in five transgenic lines of tomato transformed with 1-aminocyclopropane-1-carboxyl oxidase (ACO; [225]). Further evidence about the generation of siRNAs was obtained using a Drosophila derived invitro cell free system [226] and subsequently much information was added to the literature concerning the biogenesis of dsRNA [129, 227]. The dsRNA intermediates trigger RNAi by processing the RNA duplexes into short 21-24 nucleotides. These short dsRNA are transferred into the cytoplasm [228, 229] and are incorporated into the RNA induced silencing complex (RISC) to guide the sequence specific degradation of mRNAs (described in Figure 1.8).

1.7.2.2 MicroRNA (miRNA)

miRNAs are 18-25 nucleotide long non-coding RNAs which play very important roles in various developmental processes of plants including apoptosis, differentiation and cellular immunity [229-231] by down-regulating gene expression, either by translational repression or degradation of the target mRNAs. There are two

Chapter 1 Introduction and Review of Literature main differences between the siRNA and miRNA pathways. 1) miRNAs are transcribed from endogenous, non-protein coding genes (miRNA genes); by contrast siRNAs may originate from almost any dsRNA. 2) miRNAs show limited complementarity to their recognition sites (can perform even with 3-4 mismatches with the complementary target sequence), whereas siRNAs work only when they have full complementarity to their targets. [223, 232, 233]. After transcription the transcripts of miRNA genes take on a hairpin-like structure and undergo sequential actions of RNaseIII like enzymes (DCLs) to form mature miRNA (Figure 1.7)[234]. During the last decade, many databases for miRNAs have been developed and more than ten thousand sequences of miRNA from various organisms have been deposited in these databases. Newly discovered miRNA should meet the following criteria. (a) The small RNA sequence should be present in one arm of a hairpin structure and it should be phylogenetically conserved [235] (b) there should be the accumulation of the miRNA precursor in organisms with reduced Dicer function [236, 237] (c) they should have a cap structure and a polyA tail present at the ends of the pri-miRNA sequence [229].

The DAWDLE (DDL) protein is thought to play an important role in the biogenesis of miRNAs as it recruits DCL1, processes pri-miRNA with the help of HYPONASTIC LEAVES 1 (HYL1) and SERRATE (SE) to form an RNA duplex. The duplex is then methylated by HUA ENHANCER1 (HEN1) and exported to cytoplasm by exportin and is recruited into the RISC complex to target the complementary mRNA [238].

Chapter 1 Introduction and Review of Literature

Figure 1-7 Typical MicroRNA Pathway in Plants. miRNA genes are transcribed by DNA polymerase II (POL II) into primary (pri)-miRNA structures with poly-A tails which through the action of Dicer like protein1 (DCL1), HYPONASTIC LEAVES 1 (HYL1) and SERRATE (SER) are processed into precursor (pre)-miRNA. Further action by Hua Enhancer 1 (HEN1) and DCL1 process pre-miRNAs into mature miRNAs .miRNAs are then exported into the nucleus and one strand (the guide strand) is incorporated into the RNA induced silencing complex (RISC). The incorporated miRNA then guides the sequence-specific recognition of the target mRNA which is cut by the action of an Argonaute protein (AGO), part of the RISC.

Chapter 1 Introduction and Review of Literature

1.7.2.3 Dicer (DCL) The DCL proteins are ribonucleases which process dsRNA into small RNAs [239]. The functions of these proteins were first demonstrated in 2001, when it was found that a class of RNAseIII enzymes was involved in the production of siRNAs in an ATP dependent manner. The DCLS appears as common dominator in both miRNAs and siRNA pathways [240]. These enzymes are evolutionarily conserved among many eukaryotic organisms. Four important DCLs have been reported in Arabidopsis thaliana [230]. DCL1 plays a major part in miRNA biogenesis [241] by processing pri-miRNA to pre-miRNA. This was confirmed by the fact that the level of pri- miRNA was increased, and the level of pre-miRNA was lowered, in DCL1 mutant plants [242]. The role of DCL1 was also confirmed by immuno-precipation of DCL1 from A. thaliana and was found to convert long strands of dsRNAs into 21nt small RNAs [243]. siRNAs are generated by the cleavage activity of DCL2. Heterochromatin related siRNAs are produced by the action of DCL3 [244]. There is another class of siRNA, called transacting siRNA (ta-siRNA), that are produced by the specific dicer-like enzyme DCL4 [245]. Although every DCL has a specific function, loss of function of one DCL mutant may be compensated for by the other DCL enzyme [246]. Nevertheless, such mutations can result in abnormal phenotypes [247].

1.7.2.4 RNA Induced Silencing Complex (RISC)

RISC is a molecular complex consisting of ribo-nucleoproteins that can be programmed to target almost any gene for silencing. Agronaute (AGO) proteins are the most important part of RISC although it also contains numerous other ribonucleoproteins [248, 249]. Nearly all RISCs contain Argonaute (AGO) proteins and are responsible for slicing. AGO proteins are ~100kDa, highly basic and have been linked to RNAi by mutant screening in different eukaryotic organisms [250- 252]. These proteins have three major functional domains: PIWI, MID and PAZ domains (reviewed by [253]. The PAZ domain lies on the N-terminus and has been shown to anchor the 3'end of small RNA. The C-terminal end contains MID and PIWI domains. The PIWI domains possess catalytic activity which resembles closely with RNase-H domain containing proteins of Bacillus holodurans while the MID domain anchors the 5'end of the bound short RNAs [254-257].The bound small RNAs guide RISC to the complementary RNA transcript to target by Watson and Crick base

Chapter 1 Introduction and Review of Literature pairing [258]. Bound mRNA is then “sliced” (cut) by the RNase activity of AGO [259].

1.7.2.5 Hua Enhancer 1 (HEN1)

HEN1 plays an important part in the processing of small RNA[260]. Plant siRNAs and miRNAs contain a2'-O-methyl group on the 3' terminus, which is added by the activity of the methyl transferase\ protein HEN1. This methylation protects the short RNAs from enzymatic degradation. There is evidence that C-terminal sequences of HEN1 have methyltransferase activity, which transfers methyl groups onto both strands of double stranded RNA[261]. HEN1 binds all types of small RNAs. Mutation of HEN1 resulted in a decrease in miRNA accumulation and developmental abnormalities [262].

A 2nt 3′ overhang in the miRNA/miRNA* duplex is absolutely required for HEN1 and is a characteristic of Dicer cleavage. It has been shown that blunt ends can be methylated at greatly reduced efficiency and that HEN1 specifically methylates short RNAs, showing the importance of the 2'-O-methyl group in RNA interference [212, 263].

1.7.2.6 HYL1

The HYL1 gene encodes a nuclear, double-stranded RNA binding protein. Mutation of the gene resulted developmental abnormalities, reducing sensitivity to the plant hormones auxins and cytokinins [264].HYL1 is required for accumulation of miRNA and plant development. The developmental abnormalities in HYL1 mutant plants overlap with those exhibited by DCL1and HEN1 mutations, suggesting that the HYL1 protein acts together with DCL1 and HEN1 in the nucleus [265, 266]. HYL1 and DCL1 both contain two dsRNA binding domains, which are essential for miRNAs processing [267].HYL1 forms a complex with SERRATE and DCL1 and facilitate the biogenesis of mature miRNAs from pri-miRNAs [268].

1.7.2.7 SERRATE (SE)

The SE is a protein around 300 kDa, involved in the processing of pri-miRNA to mature miRNAs [269]. Mutation of SE can cause disruption in miRNA biogenesis, abnormal embryo development and defects in leaf shapes and flowers [269-272]. SE

Chapter 1 Introduction and Review of Literature localizes in the nucleus and interacts with HYL1. SE is a regulator of miRNA related gene expression and works closely with AGO1 but not AGO2 or AGO3. It is also thought that SE can repress leaf polarity genes such as PHABULOSA [271].

Figure 1-8 Elements and Pathways of the RNAi Response. The trigger initiating RNAi is dsRNA, whether that be foreign dsRNA (such as dsRNA viruses) or artificially produced (antisense RNA hybridizing to mRNA, or RNA hairpin structures [constructs expressing hairpin RNAs] or natural hairpin RNAs such as the precursors of miRNAs) or aberrant RNAs which are made ds by a cellular RdRP. Transcription can produce dsRNA by read-through from adjacent transcripts, as has been proposed for geminiviruses and may occur for repetitive gene families (dashed blue arrows). Alternatively, transcription may be triggered experimentally or developmentally, for example in the expression of short hairpin (shRNA) genes and

Chapter 1 Introduction and Review of Literature endogenous hairpin (miRNA) genes. The small RNA products of the Dicer-mediated processing of dsRNA guide distinct protein complexes to their targets. These silencing complexes include the RNA-induced silencing complex (RISC), which is implicated in mRNA destruction and translational repression, and the RNA-induced transcriptional silencing complex (RITS), which is implicated in chromatin silencing. Sequence mismatches between a miRNA and its target mRNA lead to translational repression (solid black arrow), whereas near perfect complementarity results in mRNA destruction (dashed black arrow). Feedback cycles permit an amplification and long-term maintenance of silencing. Modified (methylated) DNA or chromatin

(CH3), the 7-methylguanine cap structure of mRNAs (7mG), mRNA poly-adenosine tails (AAAA) and translation termination codons (TGA) are shown. Reproduced from Mello and Conte [215].

1.8 Importance of Cotton and Cotton Leaf Curl Disease (CLCuD)

Cotton (Gossypium spp.) is an important fiber producing crop in many countries, fulfilling not only the fiber requirements for industry but also an important part of the feed and oil industry, with seed that is high in protein and oil. More than 340 million people are engaged with the production and processing of cotton. More than 20 viral diseases of cotton have been described of which two are of geminivirus etiology [273]. In the south-western USA, Central and South America leaf crumpling is the major symptom and the disease (known as cotton leaf crumple disease) has only fairly recently been shown to be caused by a bipartite begomovirus, Cotton leaf crumple virus [274]. The disease is not considered significant, appearing only late in the cotton growing season and causing only minor losses. Across Africa and Southern Asia cotton is affected by cotton leaf curl disease (CLCuD). CLCuD affected plants have unusual and distinctive symptoms consisting of leaf curling, vein thickening, vein darkening and enations, which may develop into leaf like growth on the underside of the leaves (Figure 1.9).

CLCuD was first reported in 1912 in Nigeria. At that time the disease was not a severe problem but, in 1924, it appeared as a second outbreak in Nigeria. The disease caused major losses to cotton in Sudan in 20th century. At that time, it was

Chapter 1 Introduction and Review of Literature found that the disease is transmitted by the whitefly Bemisia tabaci[275]. The disease in Africa was not shown to be caused by a begomovirus, in association with a betasatellite until 2005 [276, 277].

1.9 Cotton Leaf Curl Disease (CLCuD) in Pakistan

CLCuD is the major constraint to production of cotton in Pakistan and northwestern India. The disease was first noted in 1967 but occurred only late in the season and on the upper portions of the plant [278]. In 1973 the disease was noted more widely on cotton varieties that included 149-F and B-557 but was still not considered significant [278]. This changed in 1987 when the incidence was up to 80% in certain fields [279].

In 1989, the CLCuD affected area was 500 acres and in very next year, 2000 acres. The area affected by CLCuD increased in subsequent years to include all cotton growing areas of the Punjab and also spread into India. Prior to the major losses due to CLCuD, in the year 1991-1992, 12.8 million cotton bales were produced in Pakistan. The following year production fell to 9.05 million bales and in 1993-1994 to 8.04 million bales.

CLCuD in southern Asia is caused by monopartite begomoviruses in association with a specific betasatellite – CLCuMB [56, 280]. During the 1990s at least seven distinct monopartite begomoviruses were identified in cotton with CLCuD symptoms;Cotton leaf curl Multan virus (CLCuMuV), Cotton leaf curl Rajasthan virus (CLCuRV), Cotton leaf curl Kokhran virus (CLCuKoV), Cotton leaf curl Alabad virus (CLCuAV), Tomato leaf curl Banglore virus (ToLCBV) and Papaya leaf curl virus (PaLCuV).

Following the introduction of resistant cotton lines in the late 1990s, produced by conventional breeding and selection, cotton production was restored to pre- epidemic levels. By the late 1990s, cotton production was again at record levels. However, the resistance was not durable, in 2001 resistance was broken. Symptoms of CLCuD appeared on all previously resistant cotton varieties in the vicinity of Burewala, Punjab province, and rapidly spread to almost all cotton growing regions of Pakistan and subsequently into northwestern India [13, 97, 98, 175, 281, 282]. The virus associated with resistance breaking was shown to be a distinct monopartite begomovirus which is now called CLCuBuV. CLCuBuV is recombinant consisting of

Chapter 1 Introduction and Review of Literature sequences derived from two species earlier associated with CLCuD, CLCuMuV and CLCuKoV. CLCuBuV is the only begomovirus which lack the TrAP gene [96, 98, 283]. At this time CLCuBuV is the most commonly identified begomovirus in CLCuD affected cotton across the cotton growing areas of the Punjab, Pakistan.

The betasatellite component associated with resistance breaking was also characterized and shown to be a recombinant version of the pre-resistance breaking CLCuD betasatellite, CLCuMB, with part of the SCR derived from Tomato leaf curl betasatellite[284]. However, the precise mechanism of resistance breaking by CLCuBuV and CLCuMBur remains unclear. At this time the most plausible hypothesis suggests that the TrAP protein of CLCuBuV was a virulence determinant recognized by resistant cotton and that resistance was overcome by the virus dispensing with this gene product [96, 97, 285].

Recently CLCuD has also become established in south eastern China. Analysis of the virus and betasatellite show these to be most similar to the CLCuMuV and CLCuMB present in India and Pakistan pre-resistance breaking. Significantly these components were first reported in Hibiscus rosa-sinensis [286] and subsequently okra (ref) and cotton. This has led to the suggestion that the disease was introduced into China in ornamental plants [73, 97]. Significantly the same virus and betasatellite have also recently been shown inH. rosa-sinensis in the Phillipines – which is also a cotton growing country – raising concerns that the disease could become established there.

Chapter 1 Introduction and Review of Literature

Figure 1-9 Symptoms of CLCuD in Cotton Plants. The photos show the leaf-like enations that frequently develop on the undersides of leaves of affected plants(top left), the vein thickening with upward or downward leaf curling (top right), a cotton field affected by CLCuD (bottom left) and a severely dwarfed cotton plant with severe leaf curling (bottom right).

Chapter 1 Introduction and Review of Literature

1.10 Objectives of the study

The main objectives of this study were to assess the potential of antisense RNA and artificial miRNA (amiRNA), targeting the V2 gene, for their ability to yield resistance against CLCuBuV in transgenic N. benthamiana. Additionally the transgenic plants would be assessed for their ability to yield broad-spectrum resistance by assessing their responses to other, heterologous begomoviruses.

In any homology based resistance mechanism the choice of target sequence is important. To investigate this, the antisense RNA study was additionally to look at the effects of differing target sequences by using three fragments spanning the V2 gene of CLCuBuV.

Previous studies have suggested that the sequence of the backbone of the miRNA plays an important part in the expression of the miRNA and thus its effectiveness in down-regulating expression of the target gene. To investigate this, the amiRNA study was additionally to look at the effects of altering the backbone sequence of the amiRNA on the efficiency of resistance.

The long term objective of the study was to identify the optimum and minimum target sequence for resistance with the ultimate goal of delivering effective and durable broad-spectrum resistance against begomoviruses, particularly in cotton.

Chapter 2

2 Materials and Methods

2.1Isolation of DNA from plants

Total DNA was isolated from plants by the cetyl trimethyl ammonium bromide (CTAB) method [287]. Leaf tissues (˜150mg) were homogenized in a pestle and mortar with liquid nitrogen and transferred into a 1.5mL micro-centrifuge tube. CTAB extraction buffer (650µL; 20mM EDTA, 1.4M NaCl, 2% [w/v] CTAB, 100mM Tris-HCl and 0.2% [v/v] β-mercaptethanol), pre-heated to 50oC, was added and incubated at 65oC for 40 minutes. The tube was inverted every ten minutes, to mix the contents, and then cooled to room temperature. An equal volume (650µL) of chloroform isoamyl alcohol (24:1 [v/v]) was added, mixed well and centrifuged for 10 minutes in a microfuge. The upper aqueous layer was removed to a new tube, mixed with 0.6 volume of isopropanol and centrifuged for 10 minutes. The supernatant was discarded and the pellet was washed with 70% ethanol. Finally the tube was centrifuged for 2 minutes, the supernatant was discarded, the pellet was dried at 37oC, dissolved in sterile distilled water (SDW) and stored at -20oC.

2.2 Quantification of DNA and RNA

DNA and RNA samples were quantified by using a spectrophotometer (SmartSpec Plus, BIORAD). DNA and RNA samples were diluted in SDW and the absorbance was measured at 260nm. An OD260 of 1 is equivalent to 50µg/mL of DNA or 40µg/mL of RNA. RNA samples were stored at -70°C after quantification.

2.3 Polymerase chain reaction (PCR)

PCR reactions were run in 0.5mL thin-walled PCR tubes in a volume of 50µL containing 50ng template DNA, 1.5mM MgCl2, 1µL of each primer (10 picomolar), 1µL 10mM dNTPs, 5µL 10X Taq polymerase buffer (Fermentas) and 1.25 units of TaqDNA polymerase (Fermentas). The volume was made up to 50µL with SDW. Reaction tubes were incubated in thermocycler (Eppendorf; Model, Master cycler

Chapter 2 Materials and Methods gradient /BioRad; model, Thermal cycler) set for denaturation at 94°C for 5 minutes (min) followed by 35 cycles of 94°C for 30 seconds (sec), 50°C-64°C for 30 sec (annealing temperature dependent upon the primers being used) and 72°C for 30 sec-3 min (extension time dependent upon the size of product being amplified, usually 1 min per 1000 nucleotides). For diagnostic PCR,, the reaction volume was reduced to 25µL.

2.4 Gel electrophoresis

Agarose gel electrophoresis was conducted in a midigel apparatus (18 x 15cm) or minigel apparatus (12 x 9cm). Agarose gels (1% w/v) were prepared with 0.5X TAE (20mM Tris-acetate, 0.5M EDTA [pH 8.0]) buffer and 0.5µg/mL ethidium bromide. Samples (~20µL) were mixed with 5X loading dye (for 5µL DNA, 1µL loading dye) and loaded into the wells cast into the agarose gel. A size marker (1kb ladder, Fermentas) was run on all gels. Gels were electrophoresed at 80V in 0.5X TAE buffer. Ethidium bromide stained bands were visualized under UV illumination on a trans-illuminator (Eagle Eye, Stratagene) and photographed using a still video system (Eagle Eye, Stratagene).

2.5 Ligation

PCR productswereligated into thepTZ57R/Tcloning vector using the PCR cloning kit according to manufacturer protocol (Fermentas). The PCR fragment (50-100ng depending upon the length of PCR fragment), 4µL of pTZ57R/T vector, 4uL 10X ligation buffer and 4 units of T4 DNA Ligase was used to make a reaction mixture of 40µL in a500µL microfuge tube. The reaction mixture was incubated overnight at 16°C andthen used to transform competent E. coli cells as described in section 2.6.1.

2.6 Preparation of competent cells 2.6.1 Preparation of heat shock competent Escherichia coli cells A single colony was picked from a freshly grown plate of Escherichia coli (strain Top 10) and transferred into 30 mL liquid Luria Broth (LB) medium (1% tryptone [w/v], 0.5% yeast extract [w/v] and 1% NaCl [w/v]) and placed in a shaker overnight at 37oC. An aliquot (1mL) of the overnight culture was added to 300mL LB in a 1L o flask and shaken vigorously (160 rotations per minute) at 37 C until an OD600 of 0.5-

Chapter 2 Materials and Methods

1.0 (equivalent to approx. 1010cells/mL) was obtained. The culture was chilled on ice for 45 minutes and transferred aseptically to sterile disposable 50mL propylene tubes and centrifuged (Eppendorf, model 5810R) at 3200×g at 4oC for 5 minutes to pellet the cells. The cell pellet was re-suspended in 25mL of 0.1M MgCl2 and centrifuged again. The pellet was re-suspended in 20mL of 0.1M CaCl2 and incubated on ice for 30 minutes. The cell suspension was centrifuged for 5 minutes and the resulting pellet was re-suspended in 3-4mL of 0.1M CaCl2 and filter-sterilized cold glycerol (in an approx. 3:1 ratio). The cells were stored in aliquots of 200μL in microfuge tubes at - 80°C.

Table 2.1 Sequences of primers used in the study

Primer Sequence (5’-3’) ASF AGGGATCCTGGCTATACATTCTGTACAT ASR AGTCTAGAATGTGGGATCCATTATTG V2CF TTCAAAGCTTATGGGAACATCTGGACTTCTGTAC V2CR CGTGGAATTCTAGCCATTGTCCGCGTCACCAAAG V2MF CGGCAAGCTTATGGGCTGTCGAAGTTGAGACGGC V2MR ATTTGAATTCTGAAATAAGGGCTAGGAATTATGT V2NF AATGAAGCTTATGAGTAAGTTTTCTCTACTAACTG V2NR CGTTGAATTCTAATGGGATCCACTGTTAAATGAGT IRVF CGTGGAATTCATGTGGGATCCACTGTTAAATGAG IRVR TTCGTCGACGAACATCTGGACTTCTGTA P1CF GACAGTGGTCCCAAAGATGGA P1CR CAGGCAAGTCATCCTTGGCTA PedLCVV2F ATGTGGGATCCGTTATTGAAC PedLCVV2R CTAGGAACATCTGGACTTCTG ToLCNDV2F GGTCGACAAACATGTGGGATCC ToLCNDV2R CCCGGGCTTCTATACATTCTGTAC CLCuKV2F GTCGACAAGTATGCGTTTGAAAAATGTG CLCuKV2R GGATCCACCTTCACATCCTCTAGGAAC MV2F AAATATCGATATGTGGGATCCACTATTAAACG MV2R TCTGGTCGACCTATACATGGGCCTGTTTGT BAF CTCGAGAGTGTCCCCGTCCTTGTCG BAR CTCGAGTGGGGAGAGTTTCAGATCG β01 GGTACCACTACGCTACGCAGCAGCC β02 GGTACCTACCCTCCCAGGGGTACA P1DF GACAGTGGTCCCAAAGATGGA P1DR TAGCCCATATGCCCGGATTG P35F GACAGTGGTCCCAAAGATGGA P35R CAGTGGAGATATCACATCAATCCA

Chapter 2 Materials and Methods

2.6.2 Preparation of Electro-Competent Agrobacterium Tumefaciens Cells

A single colony from a freshly grown plate of Agrobacterium tumefaciens (strainsGV3101) was picked using a sterile toothpick and inoculated into 20 mL LB liquid medium with 25 µg/mL rifampicin in a 50 mL flask and incubated in a shaker (160 rotations per minute) at 28°C for 48 hours. An aliquot (5 mL) of the culture was inoculated into a 1L flask containing 250 mL of LB medium with 25 µg/mL rifampicin and incubated in a shaker at 28°C until the OD600 of cells was 0.5-1. The cells were transferred aseptically to ice cold 50 mL propylene tubes, incubated on ice for 10 minutes and centrifuged (Eppendorf, model 5810R) at 3200×g for 10 minutes at 4°C. The pellet was resuspended in 50 mL of cold SDW and centrifuged again. Cells were again resuspended in cold SDW and the wash step was repeated. Then the cells were resuspended in 10 mL cold SDW containing filter sterilized cold 10% [v/v] glycerol and centrifuged. This wash was also repeated. Finally cells were resuspended in 3-4 mL of filter sterilized cold 10% [v/v] glycerol, aliquoted in 1.5 mL micro-centrifuge tubes and stored at –80°C.

2.7 Transformation of Bacterial Cells

2.7.1 Transformation of Competent E. coli Cells

E. coli cells were transformed with plasmids by the heat shock method [288]. Half of the ligation mixture (20µL; section 2.3) was added to 200µLthawed competent E. coli cells (section 2.6.2) in a microfuge tube and incubated on ice for 30 minutes. The cells were heat shocked at 42°C for two minutes and transferred to ice for 1-2 minutes. Approximately 1mL LB media was added to each tube and the tubes were placed at 37°C. After 50 minutes the cells were pelleted by centrifugation for a few seconds in a microfuge. The supernatant was discarded and the pelleted cells in a small volume of liquid LB were spread on petri-plates containing solid LB medium (1% [w/v] tryptone, 0.5% [w/v] yeast extract 1% NaCl [w/v] and 0.5% [w/v] agar) containing antibiotic selection and incubated overnight at 37°C.

Chapter 2 Materials and Methods

2.7.2 Transformation of A. tumefaciens by Electroporation

Transformation of A. tumefaciens was carried out by electroporation. A binary plasmid (approx. 100 ng DNA) was mixed with 200 µL electro-competent A. tumefaciens cells in an electroporation cuvette and placed on ice. The cuvette was inserted into the electroporator (BTX Harvards) and a 1.44kV shock was delivered. Liquid LB medium (1mL) was immediately added to the cuvette, mixed, transferred to a 1.5 mL microfuge tube and placed at 28oC for 2 hours. The cells were gently pelleted by centrifugation in a microfuge for a few second and the cells in ~100 µL LB were spread on petri-plates containing solid LB medium supplemented with the 25 µg/mL rifampicin and 50 µg/mL kanamycin. Plates were incubated at 28°C for 2 days.

2.8 Isolation of Plasmids from E. coli (Miniprep)

Plasmids were isolated from E. coli by the alkaline lysis method, essentially as described previously [289]. A colony on a petri-plate was transferred to 1.5 mL of liquid LB medium in a test tube using a sterile tooth pick and incubated at 37°C overnight with gentle shaking. The culture (1.5 mL) was transferred to a microfuge and centrifuged for two minutes. The harvested cells were resuspended with 100 µL re-suspension solution (50 mM glucose, 10 mM EDTA [pH 8.0] and 25 mM Tris-Cl [pH 8.0]), (100 µg/mL RNase A, 10 mM EDTA [pH 8.0]) by vortexing. Lysis solution(150 µL; 0.2M NaOH and 1% [w/v] SDS) was added and mixed gently by inversion. Finally 200 µL of neutralization solution (3M potassium acetate [pH 5.5] and glacial acetic acid 11.5 %) was added. The solution was mixed gently, kept on ice for 30 minutes and then centrifuged for 15 minutes. The supernatant was transferred to a fresh microfuge tube and two volumes of 100% ethanol was added and the tube centrifuged for 3 minutes. The resulting pellet was washed with 70% ethanol and dried at 37°C for 30 minutes. Finally the DNA pellet was dissolved in 100 µL SDW and stored on -20°C.

For DNA sequencing plasmids were isolated using a GeneJET purification kit (Fermentas). An E.coli culture (1.5 mL) was transferred to a 1.5 mL microfuge tube and centrifuged for 2 minutes. The supernatant was removed. The pellet was suspended in 250 µL resuspension solution and 250 µL lysis solution was added

Chapter 2 Materials and Methods which was neutralized by adding 350 µL neutralization solution. The microfuge tube was centrifuged at 13,000 rpm in a microfuge for ten minutes. During that time mini- column provided with kit was placed in collection tube. The supernatant was pipetted into the column and centrifuged for one minute to bind DNA with the matrix. The flow through was discarded and 500 µL of wash solution, provided with kit, was added to The column and centrifuged for 1 minute. The flow through was discarded and the washing step was repeated. The column was centrifuged for one more minute in order to remove residual ethanol. At the end, the column was placed in a clean 1.5 mL microfuge tube, 50 µL elution buffer was added and was centrifuged for one more minute to collect the purified plasmid. The resulting solution was stored at -20oC.

2.9 Restriction Analysis

DNA samples such as PCR products and isolated plasmids were digested with restriction enzymes in the buffer according to the manufacturer's recommendations (Fermentas). A 10 µL reaction volume (500 ng to 1µg DNA, 1µL 10x buffer, 5 units restriction enzyme and SDW) was made in a 0.5 mL microfuge tube. The tube was incubated at the optimum temperature (37°C for the majority of enzymes) for the suitable time, required to digest the DNA (1-16 hours). The size of digested DNA was determined on ethidium bromide stained gels by comparing with a co-electrophoresed DNA marker.

2.10 DNA Purification by Gel Extraction

Gel extraction was done using a GeneJET Gel Extraction Kit (Fermentas) following the manufacturer’s protocol. A gel slice containing the desired DNA fragment was excised from ethidium bromide stained agarose gel using a clean scalpel and placed in 1.5 mL microfuge tube. One volume of binding buffer was added and incubated at 55°C for ten minutes until the gel was completely dissolved. The resulting solution was transferred to GeneJET purification column and centrifuged for 1 minute. The flow through was discarded and 700 μL of wash solution was added and centrifuged for one minute. The column was transferred to a clean 1.5 mL microfuge tube and 50 μL of elution buffer was added. After incubation for one minute the tube with column was centrifuged for one minute. The column was discarded and the resulting DNA solution was stored at -20°C.

Chapter 2 Materials and Methods

2.11 DNA Purification by Phenol Chloroform Treatment

A DNA solution in a microfuge tube was mixed with equal volume of phenol- chloroform (1:1) and mixing by inverting the tube 4-5 times. The tube was centrifuged at 13000 rpm in a microfuge for ten minutes and the upper aqueous phase was transferred into a clean 1.5 mL microfuge tube. Sodium acetate (1/10th volume; 3M [pH 5.4]) was added, mixed and 2.5volume of cold absolute ethanol was added. The solution was mixed well and placed at -20°C for 20 minutes. DNA was pelleted by centrifugation for ten minutes in a microfuge. The supernatant was discarded and the pellet was washed with 70% ethanol, air dried and dissolved in an appropriate volume of SDW.

2.12 Glycerol Stocks

For long term preservation of bacterial cultures glycerol stocks were prepared. A 700 µL aliquot of an overnight bacterial culture was mixed with 300 µL sterile glycerol in a 1.5 mL autoclaved microfuge tube and placed at -80°C. The bacterial culture was recovered by streaking a small amount of the glycerol stock was spread on solid growth medium with antibiotics, if required, using a wire loop.

2.13 Agrobacterium-Mediated Inoculation of Begomoviruses to Plants

Agrobacterium mediated inoculation of plants with CLCuBuV (AM421522; [290]), CLCuMuB [PK:Veh:06] (AM774307; [290]), CLCuKoV (AJ496286; [291]), PedLCuV (AM712436; [292]) and ToLCNDV (DNA A [U15015] and DNA B [U15017]; [293]) was conducted as previously described [108].To prepare an inoculum for agro-inoculation, the relevant binary vector construct (containing the a partial repeat of the virus genome/genomic component) was transformed into A. tumefaciens strain GV3101. Cells were streaked on solid LB medium with kanamycin (50 µg/mL) and rifampicin (12.5 µg/mL) and incubated at 28ºC 48 hours. Around 40ml culture was prepared in LB medium with appropriate antibiotic. After incubation in a shaker (120 rpm) at 28°C until an O.D600 of 1 was obtained, the culture was centrifuged at 4000 rpm for 10 minutes and cells were resuspended in 10

Chapter 2 Materials and Methods

mM MgCl2 containing 100 µM acetosyringone and kept at room temperature overnight.

2.14 Agrobacterium-Mediated Transformation of Nicotiana Benthamiana

N. benthamiana was transformed by the leaf disc method using A. tumefaciens[294].Seeds of N. benthamiana were rinsed in 5% bleach and 0.1% HgCl2 for 10 minutes followed by a one minute wash in 80% ethanol. Ethanol was removed by washing in sterile double distilled water and dried on sterile filter paper. Seed where sown in autoclaved MS-O medium (3% sucrose, 1% agar and 0.5% MS salt [pH 5.8-6.0]). After germination, seedlings were transferred into jars and after 3-4 weeks fully expanded leaves were used for transformation.

Single A. tumefaciens colony harbouring the required construct for transformation was picked from a petri-plate and inoculated into 30 mL of liquid LB medium containing 50 μg/mL kanamycin and 100μg/mL rifampicin in a 100 mL flask. The flask was incubated in a shaker (160-200 rpm) for 48 hours at 28oC. Sterilized scissors and forceps were used to cut leaf discs of the appropriate size (~1cm2) which were placed on MS-0 medium on petri plates and incubated for 48 hours at 25°Cwith a 16 hour light/8 hour dark cycle. After 2 days leaf discs were dipped in the Agrobacterium culture medium for 2 minutes and then dried on sterilized filter paper before being placed on fresh MS-O medium plates in petri plates. Plates were incubated at 25°C for approximately 48 hours.

After 48 hours the leaf discs were washed with cefotaxime (0.25 mg/mL), washed twice with SDW, dried on filter paper and placed on selection medium (3% [w/v] sucrose, 0.446% [w/v] MS salt, 500 mg/L kanamycin, 0.54 µM NAA, .94 µM BAP, and 250 mg/L cefotaxime) in petri plates and incubated in a growth chamber having photoperiod 25°C for two to three weeks with a 16 hour light/8 hour dark cycle.

Once shoots developed the leaf disc was transferred onto shooting medium (3% [w/v] sucrose, 4.44 µM benzyl amino-purine, 0.54 µM NAA, 0.446 µg/mL MS

Chapter 2 Materials and Methods salt, 5 µg/mL phytagel, 500 mg/L kanamycin). When required, shoots were transferred into larger jars.

Shoots were excised from callus when at least 1 inter-node was formed and transferred to rooting medium (3% [w/v] sucrose, MS salt, 1 µg/mL naphthalene acetic acid, 0.1 µg/mL BAP, 5 g/L Phytagel, 250 mg/L kanamycin) in jars and placed at 25°C. Once roots were well developed, plants were transferred to soil and maintained under controlled conditions in a growth room at 25°C with a 16 hour light/8 hour dark cycle.

2.15 RNA Extraction

Leaf tissue (~600mg) was ground to a fine powder using liquid nitrogen in a mortar and pestle. Approx. 5 mL of extraction buffer (6.5 M guanidine hydrochloride, 100 mM TrisHCl [pH 8], 100 mM sodium acetate [pH 5.5], 100 mM β-mercaptoethanol) was added and the slurry was transferred to a 15 mL centrifuge tube, mixed vigorously, incubated at room temperature for 10 minutes and centrifuged (Hettich) at 12000 rpm for 10 minutes at 4°C. The supernatant was transferred to a fresh 15mL tube and 2.5mL of Trizol reagent (Invitrogen) and 1 mL of chloroform was added, mixed well and centrifuged again at 12,000xg at 4oC. The aqueous phase was transferred to a fresh tube and an equal volume of isopropanol was added. The tube was incubated on ice for 30 minutes and centrifuged (BioRad) at 12,000xg at 4°C for 25 minutes. The supernatant was discarded and the pellet was washed with 5 mL 75% [v/v] ethanol. After centrifugation for 10 minutes at 4°C the supernatant was discarded and the pellet was dried and dissolved in SDW.

2.16 Southern Blot Hybridization

DNA samples (10µg) were loaded onto 1% (w/v) agarose gels in TAE buffer (section 2.4) and run slowly at 50 volt to avoid smearing of DNA. Gels were run for 3-4 hours until the loading dye reached the bottom of gel. Gels were then treated with de- purification solution (0.25 M HCl) for 15-20 minutes, denaturation solution (1.5 M NaCl and 0.5 M NaOH) for 30 minutes and finally neutralization solution (1 M Tris [pH 7.4], 1.5 M NaCl) for 30 minutes. These steps were conducted at room temperature on a platform shaker at low speed. DNA in gels was transferred to nylon

Chapter 2 Materials and Methods membrane (Hybond, Amersham) using 4X SSC (75 mM sodium citrate and 0.75 M NaCl) by capillary action overnight using the transfer apparatus shown in Figure 2.1. The nylon membrane was then carefully removed from the apparatus, washed in 2X SSC and the DNA fixed to the membrane using an ultraviolet cross-linker (CL-1000 Ultraviolet Crosslinker, UVP) at 120 mJ/cm2 energy. After air drying the membrane was stored wrapped in cling film.

For hybridization the membrane was placed in hybridization bottle and treated with pre-hybridization solution (6X SSC, 5X Denhardt’s solution [0.1% each BSA, Ficol {mol. wt. 70,000} and PVP {mol. wt. 40,000}], 0.5% [w/v] SDS, 50% [v/v] deionized formamide and 50 μg/mL denatured salmon sperm DNA) for 2-3 hours at 52°C. The probe was prepared using a Digoxigenin labelling kit (Roche) according to manufacturer's protocol, added to the hybridization bottle and incubated at 52°C overnight in a hybridization oven (Midi-dual 14, Hybaid).

After hybridization the probe was removed from the hybridization bottle and stored frozen for reuse. The blot was washed at 52oC in the hybridization bottle with 2X SSC followed by 1X and finally with 0.1X SSC each for 30 minutes. After washing, the blot was treated with blocking solution at 30°C for 30 minutes, to which the detecting antibody was then added and incubated for 30minutes at 30°C. Excess (unbound) antibody was removed by washing with washing solution (50 mL 1X maleic acid, 150 µL tween20) after which the blot was treated with detection buffer for 5 minutes at 30°C. Finally CDP-star (diluted 1:100 in detection buffer) was applied to blot, air dried, covered with cling film and exposed to X-ray film (Super RX, Fuji film).

Chapter 2 Materials and Methods

Figure 2-1 Southern Blot Assembly for the Capillary Transfer of DNA from Agarose Gel to Nylon Membrane. The gel is placed on a filter paper wick supported on a solid base. Both edges of the wick are dipped in transfer buffer (4X SSC) in a shallow dish. The nylon membrane (Hybond) was placed on the gel and covered with filter paper and paper towels to absorb the transfer buffer.

2.17 Photography and Computer Graphics Photographs of plants were taken using a digital camera (Sony, DSC W50). Photographs were manipulated using Corel PhotoPaint (Corel Corp). Diagrams were produced using CorelDraw version 13 (Corel Corp.).

2.18 Plant Growing Conditions

All plants were grown under controlled conditions in a glasshouse or growth room at a temperature of ~25°C with supplementary lighting to give a 16 hour light/8 hour dark cycle. The soil used for N. benthamiana plants consisted of 30% compost, 40% clay and 30% sand. Plants were watered twice daily and, once every 10 days, with

Hoagland nutrient solution (1.5mM Ca(NO3)2.4 H2O, 1.25mM KNO3, 0.75mM

MgSO4.7 H2O, 0.5mM KH2PO4, micronutrients [15μM MnCl2.4H2O, 50μM H3BO3,

1.5μM CuSO4.5 H2O] , 0.5μM Na2MoO4.2 H2O, 2.0 M ZnSO4.7H2O and Fe-EDTA

[30μM FeSO4.7 H2O, 30μM EDTA.2Na, 1mM KOH].

Chapter 3

3 Antisense V2-Mediated Resistance to CLCuBuV

3.1 Introduction

RNAi consists of a number of processes that use short RNAs (approx. 21-26nt) to recognize and manipulate complementary nucleic acids. RNAi-related pathways are involved in the control of gene expression, epigenetic modification, regulation of heterochromatin and in the interactions between hosts and parasites. The possible involvement of RNAi in plant host defense against viruses was first shown when transgenic tobacco plants carrying Tobacco etch virus sequences were found to recover from infection by the virus [295]. Subsequently RNAi was shown to be a natural component of innate antiviral immunity of plants when viruses were found to naturally induce a similar response in non-transgenic plants [296, 297]. Since these initial investigations, RNAi-based strategies have become the “weapon” of choice in trying to develop resistance against phytopathogenic viruses [292, 298-300]. These studies have met with a good degree of success with respect to viruses with RNA genomes, and transgenic, virus-resistant plant varieties with PTGS(siRNA)-mediated resistance are available commercially [301]. The first and most prominent of these is the use of transgenic papaya to overcome losses due to Papaya ringspot virus in Hawaii [302].

PTGS (siRNA) mediated transgenic resistance has also been investigated as a means of providing plants with protection against plant-infecting viruses with DNA genomes. For geminiviruses a hand-full of studies have been published with varying levels of success [298, 300, 303, 304]. Despite these efforts so far only a single success story has so far been described. Transgenic beans have been produced in Brazil with a hairpin RNAi construct targeting the Rep gene of Bean golden mosaic virus– a bipartite begomovirus [305]. Recently the bean variety has been approved for commercial cultivation [306, 307]. This apparent lack of success in obtaining

Chapter 3 Antisense V2-Mediated Resistance to CLCuBuV resistance against geminiviruses using the siRNA approach can be attributed to a number of factors including the high mutation rate of these viruses, the diversity of these viruses (with usually multiple viruses in an area causing disease in each crop) and the fact that geminiviruses encode efficient suppressor of RNA silencing [60, 61, 308, 309] and their genomes, being located in the nucleus [14, 41, 156, 163, 310, 311] are immune from PTGS.

The study described here has investigated the siRNA approach to generating resistance against the monopartite, betasatellite-associated begomovirus CLCuBuV. Specifically the study has investigated the best sequences of the V2 gene for generating resistance by separately expressing three antisense fragments of the gene.

3.2 Methodology

3.2.1 Production of Antisense RNA Constructs

Primers were designed to PCR amplify three fragments of the V2 gene of CLCuBuV (AM774301; [96] Table 2.1). The N-terminal, middle and C-terminal fragments were amplified using primer pairs V2NF/V2NR, V2MF/V2MR and V2CF/V2CR, respectively (Table 2.1). The primers included unique restriction sites EcoRI and HindIII, allowing directional cloning. The fragments were individually cloned, in antisense orientation, under the control of the Cauliflower mosaic virus 35S promoter in the expression vector pJIT163 [312]. The pJIT163 expression cassettes were then transferred into the binary vector pGreen0029 [313].

3.2.2 Detection of Small RNAs

Total genomic RNA was isolated from plant tissues according to the protocol described in section 2.15.Extracted RNA (~20mg) was suspendedin10µL loading buffer (0.02M EDTA [pH 8.0], 95% [v/v] formamide, 0.05% [w/v] bromophenol blue and 0.05% [w/v] xylene cyanol), heated at 95°C for 2 min. Samples were carefully loaded on a 15% polyacrylamide gel (a 19:1 ratio of acrylamide to bis-acrylamide, 8M urea) and electrophoresed in 1X TBE (89mM Tris, 89mM boric acid, 2mM EDTA) buffer initially at 150Vin a SE 600 vertical electrophoresis unit (Hoefer) for one hour and then at 250V for 3 hours.

Chapter 3 Antisense V2-Mediated Resistance to CLCuBuV

The gel was carefully separated from the apparatus and washed in SDW. Small RNAs were transferred to Hybond N+ nylon membrane (Amersham) in 1X TBE using an electroblotter (Transphor unit TE52;Hoefer) at 4°C and run at 10V for 16-20 hours. RNAs were fixed to the membrane by UV crosslinking, air dried and stored at 4°C until use.

The blot was first incubated in 5mL Ultra-hyb-oligo buffer (Ambion) in a hybridization oven for 2 hours at 45oC. Radiolabelled probes were prepared by treating 1µLoligonucleotides (1µM/µL; Table 3.1) with 10 units of T4 polynucleotide kinase (Roche), 2µL 10X labeling buffer and [α-32P] dCTP (5Mbeq) using a Megaprime labeling kit (Amersham) in a total volume of 20µL. Oligonucleotides were separated from unincorporated radioactive label using microSpin G-25 columns (Amersham) according to manufacturer's protocol.

The probe was added to the buffer in the hybridization tube and incubated at 45°C for 16 h. After hybridization, unbound probe was removed by washing twice with 2X SSC and 0.5% [w/v] SDS for 30 min. Radioactive signals on the blot were detected using a storage phosphor screen. Images were acquired after 36h exposure using a Typhoon phosphoimager (Amersham).

Table 3.1 Oligonucleotides used for detection of transgene-derived small RNAs

Primer Sequence (5’- 3’)

NterS ATGAGTAAGTTTTCTCTACTAACTG

NterAS TAATGGGATCCACTGTTAAATGAGT

MPorS ATGGGCTGTCGAAGTTGAGACGGC

MPorAS TGAAATAAGGGCTAGGAATTATGT

CterS ATGGGAACATCTGGACTTCTGTAC

CterAS TAGCCATTGTCCGCGTCACCAAAG

Chapter 3 Antisense V2-Mediated Resistance to CLCuBuV

3.3 Results 3.3.1 Analysis of Transgenic Plants The results of the production of transgenic N. benthamiana harbouring the three constructs are summarized in Table 3.2. Three T0 plants (henceforth referred to as lines 1 to 3) resulting from leaf disks treated with Agrobacterium cultures harbouring each of the three constructs and likely resulting from independent transformation events were selected for further analysis. Selection of the three plants per construct was made after ensuring that the plants contained the transgene cassette by PCR with 35S promoter-specific primers (P35F and P35R; Table 2.1), as well as with gene fragment-specific primers (Table 2.1).The nine T0 plants were transferred to soil and self-pollinated to yield T1 seed. Seeds of the T1 generation were germinated on hormone free MS medium (Section 2.14) containing 100mg/L kanamycin. Green seedlings (not bleached) were grown on and self-pollinated to yield T2 seed and subsequently T3 seed. There was no segregation in the T3 seed, indicating that these were homozygous with respect to the transgene. The three transgenic N. benthamiana lines for each construct were analyzed for the production of transgene derived small RNA (Figure 3.1). Of the transgenic lines tested, three (BV2N line 2, BV2M line 2and BV2C line 3; Table 3.2) were shown to produce detectable levels of transgene derived small RNAs (Figure 3.1). These three lines were used in the further studies to assess the resistance imparted by the transgene to infection by begomoviruses. Throughout these procedures all transgenic N. benthamiana plants were normal with no apparent effect of the transgenes on plant growth or morphology.

Chapter 3 Antisense V2-Mediated Resistance to CLCuBuV

Table 3.2 Analysis of transgenic N. benthamiana plants

Kanamycin PCR-mediated detection resistance of construct$ (plants resistant/ Transgene (plants positive/plants examined) plants examined) specific

T1 T2 sRNA* Construct Line T1 T2 35S Tg 35S Tg 1 17/19 6/7 9/14 9/14 5/5 4/5 (-) BV2N 2 14/18 5/5 4/14 3/14 5/5 5/5 (+) 3 11/17 7/7 7/11 7/11 5/5 5/5 (-)

1 12/19 5/5 9/12 9/12 5/5 5/5 (-) BV2M 2 10/16 6/6 4/10 3/10 4/4 4/4 (+) 3 9/16 5/5 7/9 7/9 3/5 4/5 (-) 1 13/18 5/5 2/10 3/10 5/5 5/5 (-) BV2C 2 11/15 4/4 5/10 5/10 5/5 5/5 (-) 3 7/19 5/5 6/7 6/7 5/5 5/5 (+)

* The results of the detection of transgene-derived sRNAs by hybridization are given as either positive (+) or negative (-) $ Transgenic lines were examined for incorporation of the expression constructs by PCR-mediated amplification of CaMV 35S promoter sequences (35S) using primer pair P35F/P35R (Table 2.1) and virus sequences (Tg) using primer pairs V2NF/V2NR (for the N-terminal fragment), V2MF/V2MR (for the middle fragment) and V2CF/V2CR (for the C-terminal fragment; Table 2.1).

Chapter 3 Antisense V2-Mediated Resistance to CLCuBuV

sRNA

Figure 3-1 Detection of CLCuBuV-Specific Small RNAs in Transgenic N. Benthamiana Plants. The small RNA samples were extracted from a non-transgenic N. benthamiana plant (lane 1) and transgenic N. benthamiana plants (from lines 1 to 3 in each case) transformed with constructs BV2N (lanes 2-4), BV2M (lanes 5-7) and BV2C (lanes 8-10). Approximately 10µg of RNA was loaded in each well. A photograph of the ribosomal RNA band on the ethidium-stained acrylamide gel is shown below the blot to confirm equal loading.

Chapter 3 Antisense V2-Mediated Resistance to CLCuBuV

3.3.2 Responses of Transgenic Plants to Inoculation with CLCuBuV

Non-transgenic N. benthamiana plants inoculated with CLCuBuV showed the first symptoms of infection at 9 days post-inoculation (dpi) and symptoms became more severe until 28 dpi (Fig. 3.2, panel A). The symptoms consisted of downward leaf curling, vein swelling, vein yellowing and a reduction in leaf size. All inoculated plants became symptomatic and PCR diagnostics showed the presence of viral DNA in young, newly developing leaves (Table 3.3). In contrast, inoculation of transgenic N. benthamiana plants harbouring the BV2N construct did not lead to symptoms of infection, even after 28 dpi (Fig. 3.2, panel B). PCR-mediated diagnostics (by PCR using primers IRVF and IRVR; Table 2.1), however, showed the presence of the virus in one plant of the 20 inoculated even though no viral DNA was detected by Southern blot hybridization (Fig. 3.3). This indicates that DNA levels were below the threshold for detection by hybridization.

N. benthamiana plants harboring constructs BV2M and BV2C inoculated with CLCuBuV began to show very mild symptoms of infection at between 9 and 15 dpi. Symptoms in this case were milder than for infections of non-transgenic plants (less pronounced leaf curling). Subsequently, newly developing leaves gradually showed less severe symptoms with plants ultimately recovering from infection; new growth showing no symptoms for all plants from ~28 dpi onwards (Fig. 3.2, panels C and D respectively). For the BV2M plants, PCR diagnostics showed the presence of the virus in the majority of plants (17 out of 20 inoculated) in both experiments (Table 3.3). However, Southern blot hybridization showed no hybridization, suggesting that virus DNA levels were below the detection threshold (Fig. 3.3). In contrast, for the BV2C plants, PCR diagnostics showed far fewer plants (8 out of 20 inoculated) to contain the virus and very weak signals of hybridization were found by Southern blot hybridization (Fig. 3.3). During these experiments, the non-inoculated and mock- inoculated plants remained non-symptomatic and no virus was detected by either Southern blotting or PCR (Table 3.3).

Chapter 3 Antisense V2-Mediated Resistance to CLCuBuV

Figure 3-2 Responses of Transgenic Plants to Inoculation with CLCuBuV. Photographs show a non-transgenic N. benthamiana plant (A), and transgenic N. benthamiana plants harbouring constructsBV2N (B), BV2M (C) and BV2C (D) inoculated with CLCuBuV. Non-transgenic N. benthamiana plants, either mock inoculated (with an Agrobacterium culture harbouring pGreen0029; E) or not inoculated (F), are shown for comparison. The photographs were taken at 28 dpi.

Chapter 3 Antisense V2-Mediated Resistance to CLCuBuV

Figure 3-3 Southern Blot Hybridization for the Detection of CLCuBuV in Transgenic N. Benthamiana Plants. DNA samples run on the gel were extracted from CLCuBuV inoculated non-transgenic N. benthamiana plants (lanes 4 and 5) and transgenic N. benthamiana plants harbouring the constructs BV2N (lanes 1 and 2), BV2M (lanes 6 and 7) and BV2C(lanes 8 and 9). A sample extracted from a non- inoculated N. benthamiana plant (lane 3) was included as a negative control. Viral DNA forms are labeled as single-stranded (ss), super-coiled (sc), linear (lin) and open-circular (oc). Approximately equal amounts of total DNA (10µg) were run in each lane. A photograph of the genomic DNA bands on the ethidium bromide stained agarose gel is shown below the blot to confirm equal loading.

Chapter 3 Antisense V2-Mediated Resistance to CLCuBuV

Table 3.3 Infectivity of CLCuBuV in transgenic N. benthamiana plants.

Plant Infectivity Diagnostics (plants symptomatic/plants inoculated) Exp. 1 Exp. 2 PCR£ Southern 15dpi 28dpi 15dpi 28dpi Exp. 1 Exp. 2

N. b. 9/10 10/10 10/10 10/10 10/10 10/10 ++++ BV2N 0/10 0/10 0/10 0/10 1/10 0/10 - BV2M 5/10 0/10 7/10 0/10 8/10 9/10 + BV2C 7/10 0/10 10/10 0/10 5/10 3/10 + N. b* 0/10 0/10 0/10 0/10 0/10 0/10 ND N. b# 0/5 0/5 0/5 0/5 0/5 0/5 -

* Non-transgenic N. benthamiana plants inoculated with Agrobacterium cultures harbouring pGreen0029. # Non-inoculated N. benthamiana plants. £CLCuBuV was detected in nucleic acid samples extracted from plants by PCR using primers IRVF and IRVR (Table 2.1) $ Southern hybridization results are given as strong hybridization (++++), through weak hybridization (+), to no hybridization detected (-).Some plants were not examined for the presence of virus by hybridization (ND).

Chapter 3 Antisense V2-Mediated Resistance to CLCuBuV

3.3.3 Responses of Transgenic N. Benthamiana Plants to Inoculation With CLCuBuV and CLCuMuB

Non-transgenic N. benthamiana plants co-inoculated with CLCuBuV and CLCuMuB showed the first symptoms of infection at 15 dpi. Symptoms consisted of downward leaf curling, vein swelling, vein yellowing and a reduction leaf size (Figure 3.4, panel A), and were more severe than symptoms exhibited by plants inoculated with only CLCuBuV (Figure 3.2, panel A). All inoculated plants became symptomatic and PCR diagnostics showed the presence of both the virus and the betasatellite by using specific primers (Table 2.1) in all plants (Table 3.4). In contrast, inoculation of transgenic N. benthamiana plants harbouring the construct BV2N did not show symptoms of infection, even after 28 dpi (Figure 3.4, panel B). PCR-mediated diagnostics, however, showed the presence of the virus, but not the betasatellite, in one of the 20 inoculated plants.

CLCuBuV/CLCuMuB co-inoculated in N. benthamiana plants harbouring constructsBV2M and BV2C began to show symptoms of infection at 15 dpi. Symptoms were milder than for infections of non-transgenic plants with less pronounced leaf curling and less vein yellowing (Figure 3.4, panels C and D). Subsequently, newly developing leaves gradually showed less severe symptoms with plants ultimately recovering from infection; all plants non-symptomatic in new growth at ~28 dpi (Figure 3.7, panel E). For the BV2M plants, PCR diagnostics showed the presence of the virus (16 out of 20 inoculated) and the betasatellite(15 out of 20 inoculated) in most plants (Table 3.4). However, Southern blot hybridization showed no hybridization with either virus or betasatellite probes, suggesting that virus and betasatellite DNA levels were below the detection threshold. In contrast, for the BV2C plants, PCR diagnostics showed far fewer plants (8 out of 20 inoculated) to contain the virus and but only 3 to contain the betasatellite (Table 3.4). During these experiments, non-inoculated and mock-inoculated plants remained non-symptomatic and no virus or betasatellite was detected by either Southern blotting or PCR.

Chapter 3 Antisense V2-Mediated Resistance to CLCuBuV

Figure 3-4 Responses of Transgenic N. Benthamiana Plants to Inoculation with CLCuBuV and CLCuMuB. Photographs show a non-transgenic N. benthamiana (A), and transgenic N. benthamiana plants harbouring constructsBV2N (B), BV2M (C) and BV2C (D) co-inoculated with CLCuBuV and CLCuMuB. Non-transgenic N. benthamiana plants, either mock inoculated (with an Agrobacterium culture harbouring pGreen0029; E) or not inoculated (F), are shown for comparison. The photographs were taken at 28 dpi.

Chapter 3 Antisense V2-Mediated Resistance to CLCuBuV

Figure 3-5 Southern Blot Hybridization for the Detection of CLCuBuV. DNA samples run on the gel were extracted from a CLCuBuV/CLCuMuB inoculated non- transgenic N. benthamiana plant (lane 5) and transgenic N. benthamiana plants harbouring constructsBV2N (lanes 1), BV2M (lane 2) and BV2C (lanes 3). A sample extracted from a non-inoculated N. benthamiana plant (lane 4) was included as a negative control. Betasatellite DNA forms of are labeled as single-stranded (ss), super-coiled (sc) linear (lin) and open-circular (oc). Approximately equal amounts of total DNA (10µg) were run in each lane. A photograph of the genomic DNA bands on the ethidium bromide stained agarose gel is shown below the blot to confirm equal loading.

Chapter 3 Antisense V2-Mediated Resistance to CLCuBuV

Figure 3-6 Southern Blot Hybridization for the Detection of CLCuMuB. DNA samples run on the gel were extracted from CLCuBuV/CLCuMuB inoculated non- transgenic N. benthamiana plants (lanes 4 and 5) and transgenic N. benthamiana plants harbouring constructsBV2N (lanes 1 and 2), BV2M (lanes 6 and 7) and BV2C (lanes 8 and 9). A sample extracted from a non-inoculated N. benthamiana plant (lane 3) was included as a negative control. Betasatellite DNA forms of are labeled as single-stranded (ss), super-coiled (sc) linear (lin) and open-circular (oc). Approximately equal amounts of total DNA (10µg) were run in each lane. A photograph of the genomic DNA bands on the ethidium bromide stained agarose gel is shown below the blot to confirm equal loading.

Chapter 3 Antisense V2-Mediated Resistance to CLCuBuV

Table 3.4 Infectivity of CLCuBuV with CLCuMuB in transgenic N. benthamiana plants

Plant Infectivity Diagnostics (plants symptomatic/plants inoculated) Exp. 1 Exp. 2 PCRV PCRβ Southern$ 15dpi 28dpi 15dpi 28dpi Exp.1 Exp.2 Exp.1 Exp.2 CLCuBuV CLCuMuB N. b. 9/10 10/10 9/10 10/10 10/10 10/10 10/10 10/10 ++++ ++++ BV2N 0/10 0/10 0/10 0/10 5/10 2/10 0/10 0/10 + - BV2M 5/10 0/10 7/10 0/10 9/10 7/10 9/10 6/10 + - BV2C 3/10 0/10 4/10 0/10 3/10 5/10 1/10 2/10 + - N. b* 0/10 0/10 0/10 0/10 0/10 0/10 0/10 0/10 ND ND N. b# 0/5 0/5 0/5 0/5 0/5 0/5 0/5 0/5 - -

* Non-transgenic N. benthamiana plants inoculated with Agrobacterium cultures harbouring pGreen0029. # Non-inoculated plants. $ Southern hybridization results are given as strong hybridization (++++), through weak hybridization (+), to no hybridization detected (-).Some plants were not examined for the presence of virus/betasatellite by hybridization (ND). V PCR diagnostics for the detection of CLCuBuV using primers IRVF and IRVR (Table 2.1). β PCR diagnostics for the detection of CLCuMuB using primers β01 and β02 (Table 2.1).

Chapter 3 Antisense V2-Mediated Resistance to CLCuBuV

3.3.4 Responses of Transgenic Plants to Inoculation with CLCuKoV

Inoculation of non-transgenic N. benthamiana with CLCuKoV resulted in the development of downward leaf curling and vein thickening at 24 dpi and all plants were symptomatic by 28 dpi (Figure 3.7, panel A). Transgenic N. benthamiana harboring constructsBV2N and BV2C did not show symptoms of infection even at 28 dpi (Figure 3.7, panels B and D) except for one plant out of 20 harbouring BV2 C showing very mild symptoms(downward leaf curling) of infection. The transgenic plants harbouring BV2M showed mild symptoms of CLCuKoV infection, the form of mild downward leaf curling,at~25 dpi. Eventually, by28 dpi, most of the plants (18 out of 20 inoculated) harbouring BV2M started to show symptoms of infection, downward leaf curling, which were milder than symptoms in non-transgenic N. benthamiana plants inoculated with the virus (Figure 3.7; panel C).

PCR diagnostics showed the presence of viral DNA in newly developing leaves for almost all the transgenic (one BV2N plant out of 20 inoculated did not contain viral DNA as judged by PCR) as well as non-transgenic plants that were inoculated with CLCuKoV (Table 3.5). Southern blot hybridization analysis showed low viral DNA levels in BV2N and BV2Cplants (Figure 3.8). In contrast, the levels of virus detected in BV2M plants were comparable to those detected in non-transgenic N. benthamiana plants (Figure 3.8). During these experiments, non-inoculated and mock inoculated plants did not show symptoms of infection and no virus was detected by PCR or hybridization.

Chapter 3 Antisense V2-Mediated Resistance to CLCuBuV

Figure 3-7 Responses of Transgenic N. Benthamiana Plants to Inoculation With CLCuKoV. The photographs show a non-transgenic N. benthamiana (A), and transgenic N. benthamiana plants harbouring constructsBV2N (B), BV2M (C) and BV2C (D) inoculated with CLCuKoV. Non-transgenic N. benthamiana plants, either mock inoculated (with pGreen0029; E) or not inoculated (F), are shown for comparison. The photographs were taken at 28 dpi.

Chapter 3 Antisense V2-Mediated Resistance to CLCuBuV

Figure 3-8 Southern Blot Hybridization for the Detection of CLCuKoV in Transgenic N. Benthamiana Plants. DNA samples run on the gel were extracted from CLCuKoV inoculated non-transgenic N. benthamiana plants (lanes 8 and 9), transgenic N. benthamiana plants harbouring constructsBV2N (lanes 1 and 2), BV2M (lanes 3 and 4) and BV2C(lanes 5 and 6). A sample extracted from a non-inoculated N. benthamiana plant (lane 7) was included as a negative control. Viral DNA forms are labeled as single-stranded (ss), super-coiled (sc) linear (lin) and open-circular (oc). Approximately equal amounts of total DNA (10µg) were run in each lane. A photograph of the genomic DNA bands on the ethidium bromide stained agarose gel is shown below the blot to confirm equal loading.

Chapter 3 Antisense V2-Mediated Resistance to CLCuBuV

Table 3.5 Infectivity of CLCuKoV in transgenic N. benthamiana plants Plant Infectivity Diagnostics (plants symptomatic/plants inoculated) Exp. 1 Exp. 2 PCR£ Southern$

15dpi 28dpi 15dpi 28dpi Exp. 1 Exp. 2 N. b. 0/10 10/10 10/10 10/10 10/10 10/10 ++++ BV2N 0/10 0/10 0/10 0/10 10/10 9/10 + BV2M 0/10 8/10 0/10 10/10 10/10 10/10 ++ BV2C 0/10 0/10 0/10 1/10 10/10 10/10 + N. b* 0/10 0/10 0/10 0/10 0/10 0/10 ND N. b# 0/5 0/5 0/5 0/5 0/5 0/5 -

* Non-transgenic N. benthamiana plants inoculated with Agrobacterium cultures harbouring pGreen0029. # Non-inoculated plants. £CLCuKoV was detected in nucleic acid samples extracted from plants by PCR using primers CLCKV2F and CLCKV2R (Table 2.1). $ Southern hybridization results are given as strong hybridization (++++) through weak hybridization (++), very weak hybridization (+) to no hybridization detected (-). Some plants were not examined for the presence of virus by hybridization (ND).

Chapter 3 Antisense V2-Mediated Resistance to CLCuBuV

3.3.5 Responses of Transgenic Plants to Inoculation with PedLCuV. Non-transgenic N. benthamiana plants inoculated with PedLCuV showed the first symptoms of infection at 15 dpi. The symptoms consisted of mild upward leaf curling which became more prominent up to 21 dpi (Figure 3.9; panel A), with plants showing upward leaf curling, vein darkening and leaf yellowing. All inoculated plants ultimately showed symptoms of infection.

The majority (18 out of 20 inoculated) of PedLCuV inoculated transgenic N. benthamiana plants harboring BV2N showed the first symptoms of infection at 15 dpi. These symptoms became more prominent up to 21 dpi and consisted of upward leaf curling, vein darkening and leaf yellowing; symptoms were indistinguishable from those induced by the virus in non-transgenic plants (Figure 3.9; panel B). Viral DNA was detected by diagnostic PCR in all inoculated BV2N plants (Table 3.6).

Transgenic N. benthamiana plants harboring both the BV2M and BV2C constructs inoculated with PedLCuV also showed the first symptoms at 15 dpi which increased in severity up to 21 dpi. The symptoms were indistinguishable from those induced by the virus in non-transgenic plants (Figure 3.9, panel C and D). However, initially fewer plants (12/20 and 13/20, respectively) showed symptoms than either for inoculated non-transgenic plants or inoculated BV2N plants. Nevertheless, ultimately, all plants were symptomatic. Southern blot analysis showed BV2 M (Figure 3.10, lanes 3 and 4) and BV2C (Figure 3.7, lanes 5 and 6) to contain significantly less viral DNA in young developing tissues than either inoculated BV2N (Figure 3.10, lanes 1 and 2) or inoculated non-transgenic plants (Figure 3.10, lanes 8 and 9).

Chapter 3 Antisense V2-Mediated Resistance to CLCuBuV

Figure 3-9 Responses of Transgenic Plants to Inoculation with PedLCuV. Photographs show a non-transgenic N. benthamiana (A), and transgenic N. benthamiana plants harbouring constructsBV2N (B), BV2M (C) and BV2C (D) inoculated with PedLCuV. Non-transgenic N. benthamiana plants, either mock inoculated (with pGreen0029; E) or not inoculated (F), are shown for comparison. The photographs were taken at 28 dpi.

Chapter 3 Antisense V2-Mediated Resistance to CLCuBuV

Figure 3-10 Southern Blot Hybridization for the Detection of PedLCuV in N. Benthamiana Plants. DNA samples run on the gel were extracted from PedLCuV inoculated non-transgenic N. benthamiana plants (lanes 8 and 9), transgenic N. benthamiana plants harbouring constructsBV2N (lanes 1 and 2), BV2M (lanes 3 and 4) and BV2C (lanes 5 and 6). A sample extracted from a non-inoculated N. benthamiana plant (lane 7) was included as a negative control. PedLCuV DNA forms are labeled as single-stranded (ss), super-coiled (sc), linear (lin) and open-circular (oc). A photograph of the genomic DNA bands on the ethidium bromide stained agarose gel is shown below the blot to confirm equal loading.

Chapter 3 Antisense V2-Mediated Resistance to CLCuBuV

Table 3.6 Infectivity of PedLCuV in Transgenic N. Benthamiana.

Plant Infectivity Diagnostics (plants symptomatic/plants inoculated) Exp. 1 Exp. 2 PCR£ Southern 15dpi 28dpi 15dpi 28dpi Exp. 1 Exp. 2 N. b. 10/10 10/10 10/10 10/10 10/10 10/10 ++++ BV2N 10/10 10/10 8/10 10/10 10/10 10/10 ++++ BV2M 6/10 10/10 6/10 10/10 10/10 10/10 +++ BV2C 7/10 10/10 6/10 10/10 10/10 10/10 +++ N. b* 0/10 0/10 0/10 0/10 0/10 0/10 ND N. b# 0/5 0/5 0/5 0/5 0/5 0/5 -

* Non-transgenic N. benthamiana plants inoculated with Agrobacterium cultures harbouring pGreen0029. # Non-inoculated N. benthamianaplants. £PedLCuV was detected in nucleic acid samples extracted from plants by PCR using primers PedLCVV2F and PedLCuVV2R (Table 2.1) $ Southern hybridization results are given as strong hybridization (++++), through weak hybridization (+++), to no hybridization detected (-).Some plants were not examined for the presence of virus by hybridization (ND).

Chapter 3 Antisense V2-Mediated Resistance to CLCuBuV

3.3.6 Responses of Transgenic Plants to Inoculation with the Bipartite Begomovirus ToLCNDV

The first symptoms of infection appeared on non-transgenic N. benthamiana plants inoculated with the DNA A and DNA B components of ToLCNDV at 14 dpi. The symptoms consisted of upward leaf curling, leaf yellowing, vein thickening and a reduction in leaf size (Figure 3.11, panel A). All inoculated non-transgenic plants developed symptoms of infection (Table 3.7).

Transgenic N. benthamiana plants harboring the BV2N construct inoculated with ToLCNDV behaved much like non-transgenic (Figure 3.8, panel B) plants with the exception that for a few plants (4 out of 20 inoculated) symptoms were delayed by 1 to 2 days (Table 3.7). Southern blot hybridization showed the accumulation of approximately the same levels of viral DNA in BV2N plants (Figure 3.12, lanes 1 and 2) as detected in non-transgenic plants (Figure 3.12, lanes 8 and 9) .

Inoculated BV2M and BV2C responded in the same way as BV2N plants with some plants showing a delay in the initial appearance of symptoms by 1 to 2 days but a greater number of plants showed the delay (11 out of 20 for BV2 M and 14 out of 20 for BV2C; Table 3.7). Eventually all plants showed full symptoms of infection which were indistinguishable from the symptoms exhibited by non-transgenic plants. Southern blot analysis of BV2M (Figure 3.12, lanes 3 and 4) and BV2C (Figure 3.12, lanes 5 and 6) inoculated plants showed the accumulation of viral DNA at levels that were slightly lower than in either infected non-transgenic (Figure 3.12, lanes 8 and 9) or BV2N transgenic plants (Figure 3.9, lanes 1 and 2) with the main difference being a lower level of the ssDNA form.

Chapter 3 Antisense V2-Mediated Resistance to CLCuBuV

Figure 3-11 Responses of Transgenic Plants to Inoculation with the Bipartite Begomovirus ToLCNDV. Photographs show a non-transgenic N. benthamiana (A), and transgenic N. benthamiana plants harbouring the BV2N (B), BV2M (C) and BV2C (D) constructs inoculated with ToLCNDV. Non-transgenic N. benthamiana plants, either mock inoculated (with pGreen0029; E) or not inoculated (F), are shown for comparison. The photographs were taken at 21 dpi.

Chapter 3 Antisense V2-Mediated Resistance to CLCuBuV

Figure 3-12 Southern Blot Hybridization for the Detection of ToLCNDV (DNA A) in N. Benthamiana Plants. DNA samples run on the gel were extracted from ToLCNDV inoculated non-transgenic N. benthamiana plants (lanes 8 and 9), transgenic N. benthamiana plants harbouring constructsBV2N (lanes 1 and 2), BV2M (lanes 3 and 4) and BV2C(lanes 5 and 6). A sample extracted from a non-inoculated N. benthamiana plant (lane 7) was included as a negative control. Viral DNA forms are labeled as single-stranded (ss), super-coiled (sc) linear (lin) and open-circular (oc). Approximately equal amounts of total DNA (10µg) were run in each lane. A photograph of the genomic DNA bands on the ethidium bromide stained agarose gel is shown below the blot to confirm equal loading.

Chapter 3 Antisense V2-Mediated Resistance to CLCuBuV

Table 3.7 Infectivity of ToLCNDV in Transgenic N. Benthamiana.

Plant Infectivity Diagnostics (plants symptomatic/plants inoculated) Exp. 1 Exp. 2 PCR£ Southern 15dpi 21dpi 15dpi 21dpi Exp. 1 Exp. 2 N. b. 10/10 10/10 9/10 10/10 10/10 10/10 ++++ BV2N 8/10 10/10 8/10 10/10 10/10 10/10 ++++ BV2M 4/10 10/10 5/10 10/10 10/10 10/10 +++ BV2C 2/10 10/10 4/10 10/10 10/10 10/10 +++ N. b.* 0/10 0/10 0/10 0/10 0/10 0/10 ND N. b.# 0/5 0/5 0/5 0/5 0/5 0/5 -

* Non-transgenic N. benthamiana plants inoculated with Agrobacterium cultures harbouring pGreen0029. # Non-inoculatedN. benthamiana plants. £ToLCNDV (DNA A) was detected in nucleic acids extracted from plants by PCR using primers ToLCNDVV2F and ToLCNDVV2R (Table 2.1) $ Southern hybridization results are given as strong hybridization (++++) through weak hybridization (+++) to no hybridization detected (-). Some plants were not examined for the presence of virus by hybridization (ND).

Chapter 3 Antisense V2-Mediated Resistance to CLCuBuV

3.4 Discussion RNAi has become the technology of choice in efforts to develop transgenic resistance against phyto-pathogenic viruses. Numerous studies have shown this approach to potentially yield effective resistance against geminiviruses (reviewed by [303, 314, 315]. The work conducted here has shown for that this approach also has promise for engineering resistance against monopartite begomoviruses that interact with betasatellites.

Transgenic plants harbouring the BV2N construct overall showed better resistance against the homologous virus CLCuBuV. Begomoviruses transcribe in a bidirectional manner using promoter sequences residing in the IR [316, 317]. It was suggested nearly a decade ago that targeting the intergenic region or promoter regions of DNA viruses could result in complete virus resistance, most likely by TGS and DNA methylation and some success has been achieved using this approach [188, 318, 319]. The better resistance yielded by the N-terminal sequence of the V2 gene may thus be due to these sequences lying adjacent to the IR, with promoter sequences silenced (TGS) due to transitive RNAi [188, 320-322]. TGS could expand along the flanking regions as proposed earlier [321, 323].

A previous study has suggested that PTGS-mediated resistance to a virus may be overcome by the presence of a betasatellite [324]. This is likely due to the fact that betasatellites encode a strong suppressor of silencing – the βC1 protein, a suppressor of both TGS and PTGS [61, 62, 324]. Similarly, the stability of PTGS-based resistance very much depends upon the ability of the infecting virus to suppress the silencing effect of the transgene [121, 325, 326]. Begomoviruses encode strong suppressors which overcome the transgenic resistance in host. However, it also depends on threshold level of initially infected cells because if the virus level exceeds from the threshold level then spread of virus can no longer be prevented [327].

Certainly an effect of the betasatellite is seen here in the best resistant line harbouringBV2N where viral DNA levels were raised in the presence of CLCuMuB such that they could be detected by hybridization and the virus was detected in more plants by PCR-diagnostics. Nevertheless, plants remained symptomless. This contrasts with the previous study which showed that in the presence of a betasatellite for plants transiently inoculated with virus and a resistance construct developed

Chapter 3 Antisense V2-Mediated Resistance to CLCuBuV symptoms, whereas this was not the case for plants inoculated with virus and resistance construct only [328]. This difference may indicate that V2-targeted silencing is more efficient than Rep-targeted silencing at yielding resistance. Maintenance of betasatellites by begomoviruses requires both trans-replication by the helper virus-encoded Rep [56, 329, 330] and trans-movement by the helper virus movement functions [70], which include the V2 protein, CP and possibly C4 [57, 111, 120, 331, 332]. The lack of symptoms for CLCuBuV/CLCuMuB inoculated transgenic plants here may be due to suppression of expression of the V2 protein, which is required for symptoms even in the presence of the dominant symptom determinant encoded by βC1 [111]. Alternatively it may be due to the V2-mediated resistance slowing down the spread of virus in plants, allowing transgene-mediated silencing to more effectively counter the virus, whereas in Rep silenced plants replication is slowed (but apparently not abolished), possibly allowing the virus to spread and induce symptoms.

Across the three regions of V2 sequence used, CLCuKoV shows only one nucleotide change (in the N-terminal V2 fragment) with respect to CLCuBuV; the sequences of the middle and C-terminal fragments are identical (Figures 3.10, 3.11, and 3.12). Despite this the resistance to CLCuKoV is poorer than to CLCuBuV. Overall more transgenic plants are infected by CLCuKoV (as judged by PCR diagnostics), virus levels in plants were possibly higher and, for the BV2C construct, plants did not recover. Since these differences in responses to infection by CLCuBuV and CLCuKoV cannot be attributed to sequence differences between the transgene and the infecting virus, they must be due to the viruses concerned. No work has been conducted to examine the relative potencies of homologous suppressor from different geminiviruses, or the relative abilities of different geminiviruses to replicate and spread in plants. The poorer response of transgenic plants to CLCuKoV, in comparison to CLCuBuV, may thus be due to CLCuKoV encoding more effective suppressors, which counter the resistance, or the virus is better able to replicate in, or spread throughout plants more efficiently – thereby possibly being less affected by the transgene mediated silencing effect. This is an important question, which will need to be addressed in the future if broad spectrum resistance (resistance from one construct against a number of different viruses) is to be achieved. However, there is one significant difference between these two viruses which might be responsible for this

Chapter 3 Antisense V2-Mediated Resistance to CLCuBuV effect. CLCuBuV is the only begomovirus known to lack an intact C2 gene [96]. Although not absolutely required for infectivity, mutation of the C2 gene of monopartite begomoviruses attenuates (or even abolishes) symptoms and significantly reduces the levels of viral DNA accumulation in plants [106, 107, 111]. The C2 protein (and its homolog in bipartite viruses, TrAP) is multifunctional and important in virus-host interactions. It modulates host gene expression including microRNA genes [103, 333], in some cases is a pathogenicity factor [333, 334], suppressor of PTGS [102, 109, 335, 336] may counter programmed cell death [108, 109], interacts with and inactivates SNF1-related kinase[337]and adenosine kinase [338] and also appears to be important in the maintenance of betasatellites [111]. Although one might think that a virus lacking a full C2 might be debilitated, the virus is nevertheless infectious [49, 96, 339, 340] and present across a large area of northwest India [98, 340]. Although the reason for the absence of an intact C2 in CLCuBuV remains unclear it has been suggested that the C2 protein was the avirulence determinant for the resistance in cotton and CLCuBuV was able to break resistance by dispensing with this gene product (or at least most of it; [96, 97]. Thus although CLCuBuV may have a selective advantage over other viruses in resistant cotton, this may not be the case in N. benthamiana where a virus with C2/Trap may have the advantage. Recently it has been shown that the remaining (truncated) 35aa C2 protein of CLCuBuV nevertheless retains many of the functions of the full-length C2 protein, including acting as a suppressor and modulating miRNA levels in plants (Fazal Akbar, unpublished results; [97]. However, it is possible that the short C2 protein of CLCuBuV lacks some of the functions which could reduce its ability to counter transgene-induced silencing.

Chapter 3 Antisense V2-Mediated Resistance to CLCuBuV

Figure 3-13 Alignment of the N-terminal V2 Gene Sequences, Homologous to The CLCuBuV Fragment Introduced into N. benthamiana, of the Viruses Used for Inoculation. Gaps (-) were introduced into the sequences to optimize the alignment. Nucleotide sequences differing from CLCuBuV (top line) are shown in red text and are boxed. The nucleotide coordinates of the sequences are shown in each case.

Although the resistance to PedLCuV provided by the three constructs was very poor, BV2M and BV2C appeared to provide marginally better resistance than the overall best construct BV2N. Comparisons of the sequence of PedLCuV homologous to the three transgenes (Figures 3.10, 3.11 and 3.12) show the N-terminal fragment to have 13 mismatches, whereas the middle and C-terminal fragments have 3 and 4 respectively. This result is thus consistent with the idea that RNAi is an homology- dependent phenomenon [341-343]. The same is also the case for ToLCNDV.

For a number of the transgenic plants inoculated as part of this study there were initial symptoms which gradually declined with, ultimately, new growth on plants showing no symptoms. This is a phenomenon known as recovery and is attributed to a build-up of siRNA in infected tissues that reduce virus levels [343- 345]. The recovery seen thus likely indicates that, although the virus is initially able to replicate to levels which induce symptoms in the plant, ultimately the transgene derived siRNA are able to reduce virus levels such that they are no longer able to affect plant growth and development.

Chapter 3 Antisense V2-Mediated Resistance to CLCuBuV

Figure 3-14 Alignment of the Middle Portion V2 Gene Sequences, Homologous to the CLCuBuV Fragment Introduced into N. Benthamiana, of the Viruses Used for Inoculation. Nucleotide sequences differing from CLCuBuV (top line) are shown in red text and are boxed. The nucleotide coordinates of the sequences are shown in each case.

Figure 3-15 Alignment of The C-terminal V2 Gene Sequences, Homologous to the CLCuBuV Fragment Introduced into N. Benthamiana, of the Viruses Used for Inoculation. Nucleotide sequences differing from CLCuBuV (top line) are shown in red text and are boxed. The nucleotide coordinates of the sequences are shown in each case.

An analysis of the viral siRNA produced in response to infection of tomato and N. benthamiana by the monopartite begomovirus Tomato yellow leaf curl China virus (TYLCCNV) showed the distribution of siRNA to be non-uniform, with a greater proportion of the siRNA produced against the region of the genome containing the V2 gene [345, 346]. There was no apparent difference in the distribution of virion- and complementary-sense siRNAs. The analyses indicated that the greater

Chapter 3 Antisense V2-Mediated Resistance to CLCuBuV proportion of siRNA in this region was due to the higher expression levels (higher levels of transcription) across this region, rather than due to transcripts in this region having more secondary structure (leading to hairpin structures [dsRNA]) which might act as substrate for processing into siRNA. Additionally, infection with the cognate betasatellite of TYLCCNV (Tomato yellow leaf curl China betasatellite [TYLCCNB]) reduced the levels of siRNA against the V2 region, instead leading to a majority of siRNAs targeting the complementary-sense genes sequences with a slight peak within the C2. This effect was shown to be mediated by the TYLCCNB βC1 protein. However, what is unclear from this work is whether, with more siRNA targeting this region during infection, this makes the V2 sequences a more or less effective target for RNAi-mediated engineered resistance. Certainly the results obtained in the study presented here suggest it is a good target.

The question of which region of the genome of monopartite begomoviruses makes the best target for resistance has been addressed by [347]. For the monopartite begomovirus Tomato leaf curl Taiwan virus (ToLCTWV), using 10 fragments spanning the entire genome, the study showed that the most efficient resistance was achieved using fragments spanning the IR and N-terminal end of the Rep gene or a fragment spanning the overlap of the TrAP and REn genes. A not dissimilar study of the monopartite begomovirus Cotton leaf curl Multan virus also concluded that the sequences of the overlapping Rep and TrAP genes formed the best target for resistance [328]. Since these two studies and that of Yang et al. [345] used different viruses, it is not possible to draw definitive conclusions. Such studies would need to be done using one virus to assess whether the region of the genome that induces the greatest number of siRNA during a normal infection is also the best target for RNAi- mediated resistance. This is something that will need to be done in the future, so that the best RNAi-mediated resistance can be achieved.

Chapter 4

4 Artificial MicroRNA-Mediated Resistance Against CLCuBuV

4.1 Introduction RNA interference is a general phenomenon in eukaryotes that plays diverse roles, including defense against pathogens. The key features of RNAi include the production of 21–25 nt small RNAs (sRNA) by enzymes known as Dicers [214, 240 and the formation of RNA-induced silencing complexes (RISCs) which contain Argonaute (Ago) proteins that directly carry out gene silencing at the transcriptional or posttranscriptional levels [ 241, 242, 348-354]. There are two major classes of sRNAs involved in RNAi, small interfering RNAs (siRNAs) and microRNAs (miRNAs). The siRNAs result from the action of dicers on large double-stranded RNAs which have diverse origins, while miRNAs are transcribed from their own genes, or from introns and from fold-back structures with regions that are double stranded. In plants these primary-miRNAs are processed by the action of dicers into the precursor-miRNA (pre-miRNA) and then miRNA:miRNA* duplexes in the nucleus before being exported for incorporation into RISCs (see detail of RISC in section 1.7.2.4. in the Chapter 1).

Cotton leaf curl disease (CLCuD) is a major constraint to cotton production across Pakistan and north-western India. The disease is caused by monopartite begomoviruses, the most important of which at this time is CLCuBuV, in association with a specific satellite [49, 73, 98, 283, 355, 356]. Following the demonstration by Vaucheret et al.[389] that changes in the sequences of mature miRNAs does not affect their biogenesis and action, several studies have been successful in the use of modified miRNAs (referred to as artificial-miRNA [amiRNAs]) to target viruses and generate resistance [357-359]. These include resistance to the potyvirus Potato virus X in Nicotiana tabacum[360]. Most recently this approach has been successfully applied to the bipartite begomovirus ToLCNDV in tomato [361]. The amiRNA approach has the advantage over approaches that rely on the production of siRNAs

Chapter 4 Artificial MiRNA Mediated Resistance Against CLCuBuV

, which usually involve quite long virus derived sequences, that only short sequences are required, thus reducing the chances of recombination between the transgene sequence and the infecting virus. Moreover, the use of a small, 21 nt sequence derived from a virus may avoid silencing of the transgene by the invading virus. Silencing of the transgene has been shown to be a significant possible constrain to the use of siRNA-mediated resistance when generated from relatively long sequences [327]. Here the amiRNA approach has for the first time been investigated as a means of generating resistance to a monopartite begomovirus.

4.2 Materials and Methods 4.2.1 Production of AmiRNA Expression Constructs

The amiRNA constructs were based on the backbone sequence of the cotton pre- miR169a [362] (Figure 4.1) and were synthesized by Macrogen (Korea). Synthetic amiRNA were transferred to the expression vector pJIT163 [363] as EcoRI and HindIII fragments. Resulting expression cassettes were cloned in the binary vector pGreen0029 [313].

4.3 Results

4.3.1 Production and Analysis of Transgenic N. Benthamiana Plants Harbouring AmiRNA

The amiRNA produced were based upon the sequence of the cotton pre-miRNA169a (Figure 4.1). For construct P1CN the 21nt of pre-miRNA169a that form the mature miRNA were replaced with 21 nucleotides of the sequence of the V2 gene of CLCuBuV without any further changes (Figure 4.1C). For construct P1D M the same change as in P1CN was made but additionally sequence changes were introduced into the sequence of the backbone of pre-miRNA169a (in the sequence that forms the passenger strand [miRNA*] of the mature miRNA duplex) to restore some of the hydrogen bonding in the predicted structure of the pre-miRNA lost by introducing the CLCuBuV sequences (Figure 4.1B). These constructs were transformed into N. benthamiana by Agrobacterium-mediated transformation [294].

Chapter 4 Artificial MiRNA Mediated Resistance Against CLCuBuV

A total of 13 kanamycin resistant primary transformed N. benthamiana plants were obtained from the transformation (7 transformed with the P1CN construct and 6 with P1DM). However, PCR analysis using specific primers (P1CF/P1CR andP1DF/P1DR, respectively; Table 2.1) for the presence of the miRNA indicated that only three of the P1CN and four of theP1DM plants contained the respective transgene. These lines were progressed to the T2 generation by self-pollination and selection of resulting seed on kanamycin. In the T3 generation a single line for each construct that did not show segregation were selected for virus inoculation. Southern blot analysis of these plants by digestion of extracted DNA with a restriction enzyme that cuts once within the transgene and probing with an NptII gene fragment yielded single bands, suggestive of a single integration site for each line (results not shown)

Figure 4-1 Predicted Secondary Structures of Pre-miRNAs. The predicted structures of pre-miRNA169a (4.1 A), pre-amiRNAP1DM (4.1 B) and pre-amiRNA P1CN (4.1 C) are shown. The sequence which forms the mature miRNA is highlighted on the left. For the amiRNA this will be the introduced sequence of CLCuBuV. Sequences changes introduced into pre-amiRNA P1DM to maintain a structure similar to pre-miRNA169a are highlighted by a red box.

Chapter 4 Artificial MiRNA Mediated Resistance Against CLCuBuV

4.3.2 Responses of Transgenic Plants Harbouring AmiRNA to Inoculation with CLCuBuV

The first symptoms of infection, consisting of mild downward curling of newly developing leaves, were visible on non-transgenic N. benthamiana plants inoculated with CLCuBuV at 15 dpi. By 28 dpi all non-transgenic N. benthamiana plants showed symptoms of infection consisting of downward leaf curling and some crumpling of newly developing leaves (Figure 4.2, panel 1).

For CLCuBuV inoculated transgenic N. benthamiana plants harbouring P1CN a small number of plants (3 out of 20 plants inoculated) showed very mild symptoms at 28 dpi (Table 4.1; Figure 4.2A, panel 2). However, these symptoms did not develop into the severe symptoms shown by non-transgenic plants, with all subsequently developing leaves showing no symptoms. PCR analysis showed the majority of plants (19 out of 20) to contain viral DNA (Table 4.1). Southern blot analysis of DNA extracted from inoculated plants showed that plants that exhibited the initial mild symptoms contained slightly more viral DNA than plants that remained asymptomatic (Figure 4.3, lanes 1 and 2). However, the transgenic plants all contained significantly lower viral DNA levels than infected, non-transgenic plants (Figure 4.3, lane 6).

Transgenic N. benthamiana plants harbouring P1DM inoculated with CLCuBuV showed the first mild symptoms of infection at 15 dpi in a small number of plants (5 out of 20 plants inoculated). However, most of these plants (18/20) showed very mild symptoms in all newly developing leaves in the form of mild leaf curling (Figure 4.2B, panel 4). These symptoms were less severe than symptoms in non- transgenic N. benthamiana plants inoculated with virus. All other inoculated P1DM transgenic plants remained symptomless throughout (Figure 4.2, panels 8 and 9). Southern blot hybridization showed the presence of viral DNA at levels below those detected in infected, non-transgenic plants but greater than those in inoculated P1CN plants (Table 4.1).

Chapter 4 Artificial MiRNA Mediated Resistance Against CLCuBuV

Figure 4-2 Symptoms exhibited by Transgenic N. Benthamiana Plants Following Inoculation with Begomoviruses. In each case transgenic plants harbouring the P1CN (A) or P1DM (B) constructs were inoculated with CLCuBuV (panel 2), CLCuKoV (panel 4), PedLCuV (panel 6) or ToLCNDV (panel 8). Non-transgenic plants inoculated with CLCuBuV (panel 1), CLCuKoV (panel 3), PedLCuV (panel 5) or ToLCNDV (panel 7) are shown for comparison. Panels 9 and 10 show non- inoculated non-transgenic and mock-inoculated transgenic plants, respectively. Photographs were taken at 28 dpi.

Chapter 4 Artificial MiRNA Mediated Resistance Against CLCuBuV

Figure 4-3 Southern Blot Detection of CLCuBuV. Samples were extracted from CLCuBuV inoculated transgenic plants harbouring constructs P1CN (lanes 1 and 2) or P1DM (lanes 3 and 4) or a CLCuBuV inoculated non-transgenic plant (lane 6). DNA extracted from a non-inoculated transgenic plant was run in lane 5. The positions of viral single-stranded (ss), super-coiled (sc), linear (lin) and open-circular (oc) DNA forms are indicated. Approximately 10µg of total DNA was loaded in each case. A photograph of the genomic DNA bands on the ethidium bromide stained agarose gel is shown below the blot to confirm equal loading.

Chapter 4 Artificial MiRNA Mediated Resistance Against CLCuBuV

Table 4.1 Infectivity of CLCuBuV in transgenic N. benthamiana plants harbouring amiRNA. Plant Infectivity Diagnostics (plants symptomatic/plants inoculated) Exp. 1 Exp.2 PCR£ Southern$ 15dpi 28dpi 15dpi 28dpi Exp. 1 Exp.2 N. b. 8/10 10/10 10/10 10/10 9/10 10/10 ++++ P1CN 0/10 2/10 1/10 0/10 10/10 10/10 + P1DM 3/10 8/10 2/10 10/10 10/10 10/10 +++ N. b* 0/10 0/10 0/10 0/10 0/10 0/10 ND N. b# 0/5 0/5 0/5 0/5 0/5 0/5 -

* Non-transgenic N. benthamiana plants inoculated with Agrobacterium cultures harbouring pGreen0029. # Non-inoculated plants. £CLCuBuV was detected in nucleic acids extracted from plants by PCR using primers IRVF and IRVR (Table 2.1) $ Southern hybridization results are given as strong hybridization (++++), weak hybridization (+++), through very weak hybridization (+), to no hybridization detected (-). Some plants were not examined for the presence of virus by hybridization (ND).

Chapter 4 Artificial MiRNA Mediated Resistance Against CLCuBuV

4.3.3 Responses of Transgenic Plants Harbouring AmiRNA to Inoculation with CLCuKoV

Non-transgenic N. benthamiana plants inoculated with CLCuKoV exhibited the first symptoms of infection, consisting of a mild downward leaf curling of the edges of newly developing leaves, at 21 dpi. All non-transgenic plants developed severe downward leaf curling symptoms in newly developing leaves by 28 dpi (Figure 4.2, panel 3; Table 4.2).

None of the transgenic plants harbouring the P1CN construct developed symptoms following inoculation with CLCuKoV (Figure 4.2, panel 4). However, diagnostic PCR with primers CLCKV2F and CLCKV2R showed the presence of viral DNA in young, newly developing leaves even though no viral DNA could be detected by Southern blot hybridization (Figure 4.4; Table 4.2). This suggests that viral DNA levels were below the detection threshold for hybridization.

The first symptoms of infection on transgenic N. benthamiana plants harbouring P1DM following inoculation with CLCuKoV were visible in a small number of plants at 21 dpi and the majority of plants showed severe symptoms of infection by 28 dpi (Figure 4. 2B, panel 4; Table 4.2). Southern blot analysis showed the presence of significant amounts of viral DNA in P1DM transgenic plants, although this was lower than the levels of viral DNA detected in infected, non-transgenic plants (Figure 4.4, lane 6 and 7).

During these experiments, non-inoculated and mock-inoculated N. benthamiana plants remained symptomless and no virus was detected by PCR or Southern blot hybridization (Figure 4.2; Figure 4.4; Table 4.2).

Chapter 4 Artificial MiRNA Mediated Resistance Against CLCuBuV

Figure 4-4 Southern Blot Detection of CLCuKoV. DNA samples were extracted from CLCuKoV inoculated transgenic plants harbouring constructs P1CN (lanes 1 and 2) or P1DM (lanes 3 and 4) or CLCuKoV inoculated non-transgenic plants (lanes 6 and 7). DNA extracted from a non-inoculated transgenic plant was run in lane 5. The positions of viral single-stranded (ss), super-coiled (sc), linear (lin) and open-circular (oc) DNA forms are indicated. Approximately 10µg of total DNA was loaded in each case. A photograph of the genomic DNA bands on the ethidium bromide stained agarose gel is shown below the blot to confirm equal loading.

Chapter 4 Artificial MiRNA Mediated Resistance Against CLCuBuV

Table 4.2 Infectivity of CLCuKoV in transgenic N. benthamiana plants harbouring amiRNA.

Plant Infectivity(plants symptomatic/plants Diagnostics inoculated) Exp. 1 Exp.2 PCR£ Southern$ 15dpi 28dpi 15dpi 28dpi Exp. 1 Exp.2 N. b. 0/10 10/10 1/10 10/10 10/10 10/10 ++++ P1CN 0/10 1/10 0/10 0/10 10/10 10/10 + P1DM 0/10 8/10 0/10 10/10 10/10 10/10 ++ N. b* 0/10 0/10 0/10 0/10 0/10 0/10 ND N. b# 0/5 0/5 0/5 0/5 0/5 0/5 -

* Non-transgenic N. benthamiana plants inoculated with Agrobacterium cultures harbouring pGreen0029. # Non-inoculated plants. £CLCuKoV was detected in nucleic acids extracted from plants by PCR using primers CLCKV2F and CLCKV2R (Table 2.1) $ Southern hybridization results are given as strong hybridization (++++), weak hybridization (++), through very weak hybridization (+), to no hybridization detected (-). Some plants were not examined for the presence of virus by hybridization (ND).

Chapter 4 Artificial MiRNA Mediated Resistance Against CLCuBuV

4.3.5 Response of Transgenic Plants Harbouring AmiRNA to Inoculation with PedLCuV

The first symptoms of infection, a mild upward curling of the edges of newly developing leaves, in non-transgenic N. benthamiana plants inoculated with PedLCuV were visible at 15 dpi. By 21 dpi all non-transgenic plants exhibited severe symptoms consisting of upward leaf curling, vein thickening and leaf shortening (Figure 4.2A, panel 5; Table 4.3).

Mild symptoms of infection appeared in 3 out 10 PedLCuV inoculated transgenic plants harbouring P1CN construct but all the plants showed severe symptoms by 21 dpi (Figure 4.2A, panel 6). In contrast, for plants transformed with the P1DM construct, all inoculated plants showed initial mild symptoms at 15 dpi and severe symptoms by 21 dpi (Figure 4.2B, Panel 6; Table 4.3). Southern blot hybridization of genomic DNA extracted from systemic leaves showed the accumulation of high levels of viral DNA in non-transgenic and P1DM transgenic N. benthamiana plants (Figure 4.5). However, in transgenic plants harboring P1CN slightly less viral DNA accumulated than in non-transgenic plants (Figure 4.5; Table 4.3).

During these experiments, non-inoculated and mock-inoculated N. benthamiana plants remained non-symptomatic and no virus was detected by PCR or Southern blot hybridization (Table 4.3).

Chapter 4 Artificial MiRNA Mediated Resistance Against CLCuBuV

Figure 4-5 Southern Blot Detection of PedLCuV. DNA samples were extracted from PedLCuV inoculated transgenic plant harbouring the P1CN (lanes 1 and 2) or P1DM (lanes 3 and 4) constructs or PedLCuV inoculated non-transgenic plants (lanes 6 and 7). DNA extracted from a non-inoculated transgenic plant was run in lane 5. The positions of viral single-stranded (ss), super-coiled (sc), linear (lin) and open- circular (oc) DNA forms are indicated. Approximately 10 µg of total DNA was loaded in each case. A photograph of the genomic DNA bands on the ethidium bromide stained agarose gel is shown below the blot to confirm equal loading.

Chapter 4 Artificial MiRNA Mediated Resistance Against CLCuBuV

Table 4.3 Infectivity of PedLCuV in Transgenic N. Benthamiana Plants Harbouring AmiRNA

Plant Infectivity Diagnostics (plants symptomatic/plants inoculated) Exp. 1 Exp.2 PCR£ Southern$ 15dpi 28dpi 15dpi 28dpi Exp. 1 Exp.2 N. b. 10/10 10/10 10/10 10/10 10/10 10/10 ++++ P1CN 3/10 10/10 1/10 10/10 10/10 10/10 +++ P1DM 8/10 10/10 10/10 10/10 10/10 10/10 ++++ N. b* 0/10 0/10 0/10 0/10 0/10 0/10 ND N. b# 0/5 0/5 0/5 0/5 0/5 0/5 -

* Non-transgenic N. benthamiana plants inoculated with Agrobacterium cultures harbouring pGreen0029. # Non-inoculated plants. £PedLCuV was detected in nucleic acids extracted from plants by PCR using primers PedLCVV2F and PedLCuVV2R (Table 2.1) $ Southern hybridization results are given as strong hybridization (++++) through relatively weak hybridization (+++) to no hybridization detected (-). Some plants were not examined for the presence of virus by hybridization (ND).

Chapter 4 Artificial MiRNA Mediated Resistance Against CLCuBuV

4.3.6 Responses of Transgenic Plants Harbouring AmiRNA to Inoculation with ToLCNDV

Non-transgenic N. benthamiana plants inoculated with the bipartite begomovirus ToLCNDV showed the first symptoms of infection, mild leaf curling, at 15 dpi. By 21 dpi all plants were symptomatic showing upward leaf curling, leaf yellowing, vein thickening and a reduction in leaf size (Figure 4.2A, panel 7).

All transgenic plants inoculated with ToLCNDV behaved like the non- transgenic plants, with initial symptoms appearing at 15 dpi and full symptoms in all plants developing by 21 dpi (Figure 4.2A, panel 8; Figure 4.2B, panel 8; Table 4.4). Southern blot analysis of inoculated plants showed the levels of ToLCNDV DNA in transgenic plants harbouring the P1DM construct to be approximately equal to the levels of viral DNA detected in non-transgenic plants (Figure 4.6, lane 3 and 4). However, for transgenic plants harbouring the P1CN construct, the levels of ToLCNDV were marginally lower. No hybridization was found in non-transgenic N. benthamiana without virus inoculation, used as a negative control (Table 4.4). Non- inoculated and mock-inoculated N. benthamiana plants did not shown symptoms of infection throughout the experiment and no virus was detected by PCR or hybridization (Table 4.4).

Chapter 4 Artificial MiRNA Mediated Resistance Against CLCuBuV

Figure 4-6 Southern Blot Detection of ToLCNDV DNA A. DNA samples were extracted from ToLCNDV inoculated transgenic plant harbouring the P1CN (lanes 1 and 2), P1DM (lanes 3 and 4) constructs or ToLCNDV inoculated non-transgenic plants (lanes 6 and 7). DNA extracted from a non-inoculated transgenic plant was run in lane 5. The positions of viral single-stranded (ss), super-coiled (sc), linear (lin) and open-circular (oc) DNA forms are indicated. Approximately 10 µg of total DNA was loaded in each case. A photograph of the genomic DNA bands on the ethidium bromide stained agarose gel is shown below the blot to confirm equal loading.

Chapter 4 Artificial MiRNA Mediated Resistance Against CLCuBuV

Table 4.4 Infectivity of ToLCNDV in transgenic N. benthamiana plants harbouring amiRNA.

Plant Infectivity Diagnostics (plants symptomatic/plants inoculated) Exp. 1 Exp.2 PCR£ Southern$ 15dpi 28dpi 15dpi 28dpi Exp. 1 Exp.2 N. b. 10/10 10/10 9/10 10/10 10/10 10/10 10/10 P1CN 9/10 10/10 7/10 10/10 10/10 10/10 10/10 P1DM 10/10 10/10 10/10 10/10 10/10 10/10 10/10 N. b* 0/10 0/10 0/10 0/10 0/10 0/10 0/10 N. b# 0/5 0/5 0/5 0/5 0/5 0/5 0/5

* Non-transgenic N. benthamiana plants inoculated with Agrobacterium cultures harbouring pGreen0029. # Non-inoculated plants. £ToLCNDV was detected in nucleic acids extracted from plants by PCR using primers ToLCNDVV2F and ToLCNDVV2R (Table 2.1) $ Southern hybridization results are given as strong hybridization (++++) through weak hybridization to no hybridization detected (-). Some plants were not examined for the presence of virus by hybridization (ND).

Chapter 4 Artificial MiRNA Mediated Resistance Against CLCuBuV

4.5 Discussion Since the phenomenon was first identified, RNAi has become the strategy of choice in efforts to develop transgenic resistance against viruses in plants. The siRNA strategy has been shown to be widely applicable against phyto-pathogenic viruses, including geminiviruses, fungal and bacterial pathogens.. More recently engineered miRNAs have been investigated as a means of obtaining resistance following the demonstration that the targeting sequences of pre-miRNAs could be modified [359, 360, 364]. This approach has been shown to effectively deliver resistance against viruses including, most recently, the bipartite begomovirus ToLCNDV [361]. The results obtained here show for the first time that the amiRNA may also deliver resistance against monopartite begomoviruses.

The P1CN amiRNA construct delivered efficient resistance against both CLCuBuV and CLCuKoV. The majority of plants remained symptomless and the few plants that developed mild symptoms initially proceeded to lose those symptoms, a phenomenon known as recovery. Nevertheless, all CLCuBuV inoculated P1CN plants were shown to contain viral DNA by PCR but (at least for plants that did not show the initial symptoms) the levels of DNA were below the detection threshold of Southern blot hybridization and significantly lower than infected non-transgenic control plants.

Less efficient resistance in P1CN plants was evident to PedLCuV and ToLCNDV infection. Plants inoculated with PedLCuV showed delayed symptoms, although ultimately the viral DNA levels were high but lower than in non-transgenic plants. Inoculation of P1CN plants with ToLCNDV had no apparent effect on the timing of symptom appearance or symptom severity. Nevertheless in some plants the levels of viral DNA were lower than in infected non-transgenic plants. An alignment of the V2 (AV2 for ToLCNDV) gene sequences homologous to those of the amiRNA of the four begomoviruses is shown in Figure 4.7. This shows the sequences of the V2 genes of CLCuBuV and CLCuKoV to be identical in the region targeted by the P1CN/P1DMamiRNA. In contrast the V2 of PedLCV and the AV2 of ToLCNDV show mismatches (5nucleotides for PedLCuV and 9 for ToLCNDV). The relative levels of resistance detected thus correlates with the levels of sequence identity, consistent with RNAi being an homology dependent process [209, 249, 360, 365, 366].

Chapter 4 Artificial MiRNA Mediated Resistance Against CLCuBuV

Figure 4-7 Alignment of The V2 Gene Sequences Homologous to the AmiRNA of The Begomoviruses Used. Shown are the sequences of the (A)V2 genes of Cotton leaf curl Burewala virus (CLCuBuV), Cotton leaf curl Kokhran virus (CLCuKoV) and Pedilanthus leaf curl virus (PedLCuV) as well as the AV2 gene of Tomato leaf curl New Delhi virus (ToLCNDV). Nucleotides differing from those of the CLCuBuV sequence are highlighted in red.

Overall the P1DM amiRNA gave much poorer resistance although, with the possible exception of ToLCNDV, some symptom amelioration or reduction in viral DNA levels in plants was detected. This shows that the resistance resulting from amiRNA is influenced by the backbone sequence. This may be due to expression levels of the amiRNA or its interaction with AGO proteins, both of which have been shown to be affected by the sequence of the backbone [332, 366-370].

Mutation of the V2 gene of monopartite begomoviruses leads to viruses that induce infections that are non-symptomatic with very low viral DNA levels [111, 368, 369], indicating that the V2 protein is a pathogenicity determinant and possibly involved in virus movement in plants. These features of V2 mutants are thus equivalent to the effects of silencing of the V2 gene using an amiRNA shown here. The product of the AV2 gene of bipartite begomoviruses is not essential for infectivity and mutation of these results in viruses that induce delayed but symptomatically normal infections, suggesting that this protein plays a part in, but is not essential for, virus movement; the essential virus-encoded proteins being encoded on the second component (DNA B)[126, 127, 371, 372]. Although it is likely that the poor levels of resistance seen here to ToLCNDV are due to sequence differences with the amiRNA, it is also likely that part of the effect is due to complementation of the silenced AV2 gene functions by the genes encoded on the DNA B. In light of this it is somewhat surprising that the amiRNA-mediated resistance targeting virion-sense genes of ToLCNDV reported by [361]resulted in either mild transient or no symptoms

Chapter 4 Artificial MiRNA Mediated Resistance Against CLCuBuV of infection. Possibly this is a host specific effect; the earlier study having used tomato whereas the study here used the highly permissive host N. benthamiana.

The use of 22 nt miRNA* or miRNA:miRNA* duplexes with asymmetric bulges can trigger transitivity – spread of the silencing outside the targeted sequence by the production of secondary siRNAs [321, 373, 374]. Making use of this phenomenon may be useful in improving miRNA-mediated resistance against geminiviruses with the possibility of inducing TGS and should be investigated in further studies. Also, targeting multiple transcripts with distinct amiRNA may yield improved resistance and reduce the chance of the resistance being broken by sequence changes in the virus.

CLCuD is caused by begomoviruses associated with a symptom modulating betasatellite [56, 375]. Betasatellites encode a single protein,βC1, which is a pathogenicity determinant [64, 376], possibly involved in virus movement in plants (Saeed, 2010) and suppresses both PTGS and TGS [62, 324]. Due to time limitations, the effect of including a betasatellite on the amiRNA-mediated resistance was not assessed here. As shown by the work presented in the previous chapter, and previous studies [52, 53], betasatellites can adversely affect RNAi-mediated resistance. It is therefore desirable to investigate the effect of virus with betasatellite on the amiRNA- mediated resistance.

The results of the study conducted here show that transgenic expression of an engineered miRNA can efficiently counter infection of a monopartite begomovirus but does not lead to immunity. The ability of the expressed miRNA to deliver resistance against heterologous viruses being depended upon the levels of complementarity between the miRNA and the target is consistent RNAi being a sequence homology-dependent phenomenon. The sequence of the miRNA backbone was shown to influence the levels of resistance obtained, restoration of the base pairing in the structure of the amiRNA apparently improving the levels of resistance. This suggests that modification of miRNA backbone sequence adversely affects amiRNA biogenesis.

100

Chapter 5

5 General Discussion

The ultimate aim of the study described here is to develop a broad-spectrum begomovirus resistance that can be deployed in a number of crops but particularly in cotton. It is clear from the results obtained that immunity using the RNAi-based approach is unlikely to be forthcoming. This is consistent with earlier studies and has been attributed to these DNA viruses avoiding genome methylation (possibly by utilizing RDR) and by encoding suppressors of silencing [307]. However, for at least one study, reporting field trials of transgenic beans carrying a hairpin RNAi construct of Rep sequences derived from the bipartite begomovirus BGMV, the transgene gave immunity level resistance [377], although virus could be detected by PCR in the early stages of infection [378]. The reason for this success with BGMV is unclear.

Tolerance, although useful, is not a desirable trait since tolerant plants with virus are a source of virus for infection of other plants and there is the possibility of mutation leading to enhanced virulence [49, 284, 379, 380]. The available evidence also suggests that resistance in plants with a single mechanism of resistance is rapidly broken. A good example here is the natural resistance in cotton to CLCuD introduced in Pakistan in the late 1990s – this succumbed to a resistance breaking virus in little more than three years [73, 381]. Although the precise mechanism of resistance breaking in this case is unclear, the available evidence suggests that inter-specific recombination and mutation is responsible [97].

Relying solely on a homology-based resistance, particularly in an area of high virus diversity such as south Asia would seem destined for failure [292, 298, 300]. The wisest course of action would be to stack (so called “pyramiding”) resistances that act by distinct mechanism. So, for example, use the best available natural host plant resistance with an RNAi-based resistance and resistance based upon protein expression, either virus-derived or non-pathogen derived [382]. Further improvement in transgenic resistance against phloem limited viruses, such as many of the

101

Chapter 5 General Discussion

geminiviruses, can possibly be achieved by using tissue specific promoters fortransgene expressions. This expression would also avoid accumulation of siRNAs in those tissues where viruses are absent [383]. A number of reviews have outlined the strategies that have been tried for obtaining resistance to geminiviruses [292, 298, 300].

Although the evidence suggests that the RNA-based resistance approach may not deliver immunity, it is clear from the results presented here and elsewhere that the choice of sequences used in the transgene make a big difference – when it comes to resistance not all sequences are equal. The study here analyzed three fragments across a single gene and concluded that the N-terminal fragment provided the best resistance to the homologous virus. In determining the best virus-derived sequences to use for RNAi-resistance the approach of Lin et al.[384] would seem desirable – a comprehensive analysis of all virus sequences to determine which is the best for delivering RNAi–mediated resistance. Possibly also a global analysis of virus-derived small RNAs would also be useful in identifying areas of the genome that naturally induce the most siRNAs, although it remains unclear whether the region inducing the most siRNA also is the region imparting the best RNAi-mediated virus resistance. Such investigations will need to be the subjects of future studies in the continuing efforts to overcome losses to CLCuD and other geminivirus diseases.

102

References

[1] A. M. Q. King, M. J. Adams, E. B. Carstens, and E. J. Lefkowitz, Virus Taxonomy - Ninth Report of the International Committee on Taxonomy of Viruses, Oxford: Elsevier, 2011.

[2] W. M. Stanley, “Isolation of a Crystalline Protein Possessing the Properties of Tobacco-Mosaic Virus,” Science, vol. 81, pp. 644-645, 1935.

[3] K. M. Smith, “A Text Book of Plant Virus Diseases,” London : Churchill, pp. 615, 1937.

[4] H. Jeske, M. Lutgemeier, and W. Preiss, “DNA Forms Indicate Rolling Circle and Recombination-Dependent Replication of AbutilonMosaic Virus,” EMBO J., vol. 20, pp. 6158-6167, 2001.

[5] C. M. Thomas, R. Hull, J. A. Bryant, and A. J. Maule, “Isolation of a Fraction from Cauliflower Mosaic Virus-Infected Protoplasts Which Is Active in the Synthesis of (+) and (-) Strand Viral DNA and Reverse Transcription of Primed RNA Templates,” Nucleic Acids Res., vol. 13, pp. 4557-4576, 1985.

[6] B. D. Harrison, H. Barker, K. R. Bock, E. J. Guthrie, G. Meredith, and M. Atkinson, “Plant Viruses with Circular Single-Stranded DNA,” Nature, vol. 270, pp. 760-762, 1977.

[7] W. Zhang, N. H. Olson, T. S. Baker, L. Faulkner, M. Agbandje-McKenna, M. I. Boulton, J. W. Davies, and R. McKenna, “Structure of the Maize Streak Virus Geminate Particle,” Virology, vol. 279, pp. 471-477, 2001.

[8] J. W. Davies, “Geminivirus Genomes,” Microbiol Sci., vol. 4, pp. 18-23, 1987.

[9] R. W. Briddon, and P. G. Markham, "Geminiviridae," Virus Taxonomy; Sixth Report of the International Committee on Taxonomy of Viruses, F. A. Murphy

103

Chapter 6 References

, C. M. Fauquet, D. H. L. Bishop, S. A. Ghabrial, A. W. Jarvis, G. P. Martelli, M. A. Mayo and M. D. Summers, eds., pp. 158-165, Wien: Springer, 1995.

[10] E. P. Rybicki, “A Proposal for Naming Geminiviruses: A Reply by the Geminiviridae Study Group Chair,” Arch. Virol., vol. 143, pp. 421-424, 1998.

[11] S. G. Lazarowitz, “Geminiviruses: Genome Structure and Gene Function,” Crit. Rev. Plant Sci., vol. 11, pp. 327-349, 1992.

[12] J. K. Brown, C. M. Fauquet, R. W. Briddon, M. Zerbini, E. Moriones, and J. Navas-Castillo, "Geminiviridae," Virus Taxonomy - Ninth Report of the International Committee on Taxonomy of Viruses, A. M. Q. King, M. J. Adams, E. B. Carstens and E. J. Lefkowitz, eds., pp. 351-373, London, Waltham, San Diego: Associated Press, Elsevier Inc., 2012.

[13] S. Mansoor, R. W. Briddon, Y. Zafar, and J. Stanley, “Geminivirus Disease Complexes: An Emerging Threat,” Trends Plant Sci., vol. 8, pp. 128-134, 2003.

[14] M. R. Rojas, C. Hagen, W. J. Lucas, and R. L. Gilbertson, “Exploiting Chinks in the Plant's Armor: Evolution and Emergence of Geminiviruses,” Ann. Rev. Phytopathol., vol. 43, pp. 361-394, 2005.

[15] A. Varma, and V. G. Malathi, “Emerging Geminivirus Problems: A Serious Threat to Crop Production,” Ann. Appl. Biol., vol. 142, pp. 145-164, 2003.

[16] M. J. Adams, E. J. Lefkowitz, A. M. Q. King, and E. B. Carstens, “Recently Agreed Changes to the International Code of Virus Classification and Nomenclature,” Arch. Virol., vol. 158, pp. 2633-2639, 2013.

[17] M. I. Boulton, “Functions and Interactions of Mastrevirus Gene Products,” Physiol. Mol. Plant Pathol., vol. 60, pp. 243-255, 2002.

[18] N. Nahid, I. Amin, S. Mansoor, E. P. Rybicki, E. van der Walt, and R. W. Briddon, “Two Dicot-Infecting Mastreviruses (Family Geminiviridae) Occur in Pakistan,” Arch. Virol., vol. 153, pp. 1441-1451, 2008.

104

Chapter 6 References

[19] L. Liu, T. van Tonder, G. Pietersen, J. W. Davies, and J. Stanley, “Molecular Characterization of a Subgroup I Geminivirus from a Legume in South Africa,” J. Gen. Virol., vol. 78, pp. 2113-2117, 1997.

[20] B. A. M. Morris, K. A. Richardson, A. Haley, X. Zhan, and J. E. Thomas, “The Nucleotide Sequence of the Infectious Cloned DNA Component of Tobacco Yellow Dwarf Virus Reveals Features of Geminiviruses Infecting Monocotyledonous Plants,” Virology, vol. 187, pp. 633-642, 1992.

[21] E. A. Wright, T. Heckel, J. Groenendijk, J. W. Davies, and M. I. Boulton, “Splicing Features in Maize Streak Virus Virion- and Complementary-Sense Gene Expression,” Plant J., vol. 12, pp. 1285-1297, 1997.

[22] P. M. Mullineaux, F. Guerineau, and G.-P. Accotto, “Processing of Complementary Sense RNAs of Digitaria Streak Virus in Its Host and in Transgenic Tobacco,” Nucleic Acids Res., vol. 18, pp. 7259-7265, 1990.

[23] K. E. Palmer, and E. P. Rybicki, “The Use of Geminiviruses in Biotechnology and Plant Molecular Biology, with Particular Focus on Mastreviruses,” Plant Sci., vol. 129, pp. 115-130, 1997.

[24] J. Donson, B. A. M. Morris-Krsinich, P. M. Mullineaux, M. I. Boulton, and J. W. Davies, “A Putative Primer for Second-Strand DNA Synthesis of Maize Streak Virus Is Virion-Associated,” EMBO J., vol. 3, pp. 3069-3073, 1984.

[25] R. J. Hayes, H. MacDonald, R. H. A. Coutts, and K. W. Buck, “Priming of Complementary DNA Synthesis in Vitro by Small DNA Molecules Tightly Bound to Virion DNA of Wheat Dwarf Virus,” J. Gen. Virol., vol. 69, pp. 1345-1350, 1988.

[26] H. R. B. Yazdi, J. Heydarnejad, and H. Massumi, “Genome Characterization and Genetic Diversity of Beet Curly Top Iran Virus: A Geminivirus with a Novel Nonanucleotide,” Virus Genes, vol. 36, pp. 539-545, 2008.

[27] C. W. Bennett, “The Curly Top Disease of Sugarbeet and Other Plants.,” Monograph 7, American Phytopathological Society, St. Paul, Minnesota, vol. 81, 1971.

105

Chapter 6 References

[28] A. Varsani, D. P. Martin, J. Navas-Castillo, E. Moriones, C. Hernández- Zepeda, A. Idris, F. Murilo Zerbini, and J. K. Brown, “Revisiting the Classification of Curtoviruses Based on Genome-Wide Pairwise Identity,” Arch. Virol., vol. 159, pp. 1873-1882, 2014.

[29] R. W. Briddon, D. C. Stenger, I. D. Bedford, J. Stanley, K. Izadpanah, and P. G. Markham, “Comparison of a Beet Curly Top Virus Isolate from the Old World with Those from the New World,” Eur. J. Plant Pathol., vol. 104, pp. 77-84, 1998.

[30] R. W. Briddon, J. Watts, P. G. Markham, and J. Stanley, “The Coat Protein of Beet Curly Top Virus Is Essential for Infectivity,” Virology, vol. 172, pp. 628- 633, 1989.

[31] S. G. Hormuzdi, and D. M. Bisaro, “Genetic Analysis of Beet Curly Top Virus: Evidence for Three Virion Sense Genes Involved in Movement and Regulation of Single- Annd Double-Stranded DNA Levels,” Virology, vol. 193, pp. 900-909, 1993.

[32] J. R. Latham, K. Saunders, M. S. Pinner, and J. Stanley, “Induction of Cell Division by Beet Curly Top Virus Gene C4,” Plant J., vol. 11, pp. 1273-1283, 1997.

[33] J. Stanley, "Beet Curly Top Virus," Encyclopedia of Virology, B. W. J. Mahy and M. H. V. van Regenmortel, eds., pp. 301-307, Oxford: Academic Press, 2008.

[34] K. A. Klute, S. A. Nadler, and D. C. Stenger, “Horseradisch Curly Top Virus Is a Distinct Subgroup Ii Geminivirus Species with Rep and C4 Genes Derived from a Subgroup Iii Ancestor,” J. Gen. Virol., vol. 77, pp. 1369-1378, 1996.

[35] R. W. Briddon, and P. G. Markham, “Complementation of Bipartite Begomovirus Movement Functions by Topocuviruses and Curtoviruses,” Arch. Virol., vol. 146, pp. 1811-1819, 2001.

[36] T. A. Melgarejo, T. Kon, M. R. Rojas, L. Paz-Carrasco, F. M. Zerbini, and R. L. Gilbertson, “Characterization of a New World Monopartite Begomovirus

106

Chapter 6 References

Causing Leaf Curl Disease of Tomato in Ecuador and Peru Reveals a New Direction in Geminivirus Evolution,” J. Virol., vol. 87, pp. 5397-5413, 2013.

[37] S. Sanchez-Campos, A. Martínez-Ayala, B. Márquez-Martín, L. Aragón- Caballero, J. Navas-Castillo, and E. Moriones, “Fulfilling Koch's Postulates Confirms the Monopartite Nature of Tomato Leaf Deformation Virus: A Begomovirus Native to the New World,” Virus Res., vol. 173, pp. 286-293, 2013.

[38] J. Stanley, D. M. Bisaro, R. W. Briddon, J. K. Brown, C. M. Fauquet, B. D. Harrison, E. P. Rybicki, and D. C. Stenger, "Geminiviridae," Virus Taxonomy, Viiith Report of the ICTV, C. M. Fauquet, M. A. Mayo, J. Maniloff, U. Desselberger and L. A. Ball, eds., pp. 301-326, London: Elsevier/Academic Press, 2005.

[39] R. Ghosh, P. Palit, S. Paul, S. Ghosh, and A. Roy, “Detection of Corchorus Golden Mosaic Virus Associated with Yellow Mosaic Disease of Jute (Corchorus Capsularis),” Indian J. Virol., vol. 23, pp. 70-74, 2012.

[40] C. Ha, S. Coombs, P. Revill, R. Harding, M. Vu, and J. Dale, “Corchorus Yellow Vein Virus, a New World Geminivirus from the Old World,” J. Gen. Virol., vol. 87, pp. 997-1003, 2006.

[41] L. Hanley-Bowdoin, S. B. Settlage, B. M. Orozco, S. Nagar, and D. Robertson, “Geminviruses: Models for Plant DNA Replication, Transcription, and Cell Cycle Regulation,” Crit. Rev. Plant Sci., vol. 18, pp. 71-106, 1999.

[42] C. W. Collmer, and S. H. Howell, “Role of Satellite Rna in the Expression of Symptoms Caused by Plant Viruses,” Ann. Rev. Phytopathol., vol. 30, pp. 419-442, 1992.

[43] A. E. Simon, M. J. Roossinck, and Z. Havelda, “Plant Virus Satellite and Defective Interfering Rnas: New Paradigms for a New Century,” Ann. Rev. Phytopathol., vol. 42, pp. 415-438 2004.

107

Chapter 6 References

[44] I. Dry, L. R. Krake, J. E. Rigden, and M. A. Rezaian, “A Novel Subviral Agent Associated with a Geminivirus: The First Report of a DNA Satellite,” Proc. Natl. Acad. Sci. U.S.A., vol. 94, pp. 7088-7093, 1997.

[45] J. Kumar, S. P. Singh, and R. Tuli, “Association of Satellites with a Mastrevirus in Natural Infection: Complexity of Wheat Dwarf India Virus Disease,” J. Virol., vol. 88, pp. 7093-104, 2014.

[46] M. S. Nawaz-ul-Rehman, S. Mansoor, R. W. Briddon, and C. M. Fauquet, “Maintenance of an Old World Betasatellite by a New World Helper Begomovirus and Possible Rapid Adaptation of the Betasatellite,” J. Virol., vol. 83, pp. 9347-9355, 2009.

[47] A. Rouhibakhsh, and V. G. Malathi, “Severe Leaf Curl Disease of Cowpea – a New Disease of Cowpea in Northern India Caused by Mungbean Yellow Mosaic India Virus and a Satellite DNA B,” Plant Pathol., vol. 54, pp. 259, 2005.

[48] P. Sivalingam, and A. Varma, “Role of Betasatellite in the Pathogenesis of a Bipartite Begomovirus Affecting Tomato in India,” Arch. Virol., vol. 157, pp. 1081-1092, 2012.

[49] L. Amrao, S. Akhter, M. N. Tahir, I. Amin, R. W. Briddon, and S. Mansoor, “Cotton Leaf Curl Disease in Sindh Province of Pakistan Is Associated with Recombinant Begomovirus Components,” Virus Res., vol. 153, pp. 161-165, 2010.

[50] M. Saeed, “Tomato Leaf Curl Virus and Cotton Leaf Curl Multan Betasatellite Can Cause Mild Transient Symptoms in Cotton,” Australas. Plant Dis. Notes, vol. 5, pp. 58-60, 2010.

[51] Z. H. Li, Y. Xie, and X. P. Zhou, “Tobacco Curly Shoot Virus DNAB Is Not Necessary for Infection but Intensifies Symptoms in a Host-Dependent Manner,” Phytopathology, vol. 95, pp. 902-908, 2005.

108

Chapter 6 References

[52] T. Ito, J. Kimbara, P. Sharma, and M. Ikegami, “Interaction of Tomato Yellow Leaf Curl Virus with Diverse Betasatellites Enhances Symptom Severity,” Arch. Virol., vol. 154, pp. 1233-1239, 2009.

[53] P. Jyothsna, Q. M. I. Haq, P. Singh, K. V. Sumiya, S. Praveen, R. Rawat, R. Briddon, and V. G. Malathi, “Infection of Tomato Leaf Curl New Delhi Virus (ToLCNDV), a Bipartite Begomovirus with Betasatellites, Results in Enhanced Level of Helper Virus Components and Antagonistic Interaction between DNA B and Betasatellites,” Appl. Microbiol. Biotechnol., vol. 97, pp. 5457-5471, 2013.

[54] M. Saeed, S. Mansoor, M. A. Rezaian, R. W. Briddon, and J. W. Randles, “Satellite DNA β Overrides the Pathogenicity Phenotype of the C4 Gene of Tomato Leaf Curl Virus, but Does Not Compensate for Loss of Function of the Coat Protein and V2 Genes,” Arch. Virol., vol. 153, pp. 1367-1372, 2008.

[55] R. W. Briddon, and S. Mansoor, "Beta Ssdna Satellites," Encyclopedia of Virology, B. W. J. Mahy and M. H. V. van Regenmortel, eds., pp. 314-321, Oxford: Academic Press, 2008.

[56] R. W. Briddon, S. E. Bull, I. Amin, A. M. Idris, S. Mansoor, I. D. Bedford, P. Dhawan, N. Rishi, S. S. Siwatch, A. M. Abdel-Salam, J. K. Brown, Y. Zafar, and P. G. Markham, “Diversity of DNA β: A Satellite Molecule Associated with Some Monopartite Begomoviruses,” Virology, vol. 312, pp. 106-121, 2003.

[57] J. Qazi, I. Amin, S. Mansoor, J. Iqbal, and R. W. Briddon, “Contribution of the Satellite Encoded Gene ΒC1 to Cotton Leaf Curl Disease Symptoms,” Virus Res., vol. 128, pp. 135-139, 2007.

[58] M. Saeed, Y. Zafar, J. W. Randles, and M. A. Rezaian, “A Monopartite Begomovirus-Associated DNA β Satellite Substitutes for the DNA B of a Bipartite Begomovirus to Permit Systemic Infection ” J. Gen. Virol., vol. 88, pp. 2881-2889, 2007.

109

Chapter 6 References

[59] Q. Shen, Z. Liu, F. Song, Q. Xie, L. Hanley-Bowdoin, and X. Zhou, “Tomato S1SnRK1 Protein Interacts with and Phosphorylates βC1, a Pathogenesis Protein Encoded by a Geminivirus Betasatellite,” Plant Physiol., vol. 157, pp. 1394-406, 2011.

[60] I. Amin, K. Hussain, R. Akbergenov, J. S. Yadav, J. Qazi, S. Mansoor, T. Hohn, C. M. Fauquet, and R. W. Briddon, “Suppressors of RNA Silencing Encoded by the Components of the Cotton Leaf Curl Begomovirus- Betasatellite Complex,” Mol. Plant-Microbe Interact., vol. 24, pp. 973-983, 2011.

[61] R. Shukla, S. Dalal, and V. G. Malathi, “Suppressors of RNA Silencing Encoded by Tomato Leaf Curl Betasatellites,” J Biosci, vol. 38, pp. 45-51, 2013.

[62] X. Yang, Y. Xie, P. Raja, S. Li, J. N. Wolf, Q. Shen, D. M. Bisaro, and X. Zhou, “Suppression of Methylation-Mediated Transcriptional Gene Silencing by βC1-SAHH Protein Interaction During Geminivirus-Betasatellite Infection,” PLoS Pathog., vol. 7, pp. e1002329, 2011.

[63] L. Salvaudon, C. M. De Moraes, J.-Y. Yang, N.-H. Chua, and M. C. Mescher, “Effects of the Virus Satellite Gene Βc1 on Host Plant Defense Signaling and Volatile Emission,” Plant Signaling & Behavior, vol. 8, pp. e23317, 2013.

[64] J. Y. Yang, M. Iwasaki, C. Machida, Y. Machida, X. Zhou, and N. H. Chua, “BetaC1, the Pathogenicity Factor of TYLCCNV, Interacts with AS1 to Alter Leaf Development and Suppress Selective Jasmonic Acid Responses,” Genes Dev., vol. 22, pp. 2564-77, 2008.

[65] O. Eini, S. Dogra, L. A. Selth, I. B. Dry, J. W. Randles, and M. A. Rezaian, “Interaction with a Host Ubiquitin-Conjugating Enzyme Is Required for the Pathogenicity of a Geminiviral DNA B Satellite,” Mol. Plant-Microbe Interact., vol. 22, pp. 737-746, 2009.

[66] P. P. Kumar, R. Usha, A. Zrachya, Y. Levy, H. Spanov, and Y. Gafni, “Protein-Protein Interactions and Nuclear Trafficking of Coat Protein and BC1

110

Chapter 6 References

Protein Associated with Bhendi Yellow Vein Mosaic Disease,” Virus Res., vol. 122, pp. 127-136, 2006.

[67] S. Mansoor, S. H. Khan, A. Bashir, M. Saeed, Y. Zafar, K. A. Malik, R. W. Briddon, J. Stanley, and P. G. Markham, “Identification of a Novel Circular Single-Stranded DNA Associated with Cotton Leaf Curl Disease in Pakistan,” Virology, vol. 259, pp. 190-199, 1999.

[68] R. W. Briddon, and J. Stanley, “Sub-Viral Agents Associated with Plant Single-Stranded DNA Viruses,” Virology, vol. 344, pp. 198-210, 2006.

[69] K. Saunders, and J. Stanley, “A Nanovirus-Like Component Associated with Yellow Vein Disease of Ageratum Conyzoides: Evidence for Interfamilial Recombination between Plant DNA Viruses,” Virology, vol. 264, pp. 142- 152, 1999.

[70] R. W. Briddon, S. E. Bull, I. Amin, S. Mansoor, I. D. Bedford, N. Rishi, S. S. Siwatch, M. Y. Zafar, A. M. Abdel-Salam, and P. G. Markham, “Diversity of DNA 1; a Satellite-Like Molecule Associated with Monopartite Begomovirus- DNA Β Complexes,” Virology, vol. 324, pp. 462-474, 2004.

[71] T. Paprotka, V. Metzler, and H. Jeske, “The First DNA 1-Like a Satellites in Association with New World Begomoviruses in Natural Infections,” Virology, vol. 404, pp. 148-157, 2010.

[72] G. Romay, D. Chirinos, F. Geraud-Pouey, and C. Desbiez, “Association of an Atypical Alphasatellite with a Bipartite New World Begomovirus,” Arch. Virol., vol. 155, pp. 1843-1847, 2010.

[73] M. N. Sattar, A. Kvarnheden, M. Saeed, and R. W. Briddon, “Cotton Leaf Curl Disease – an Emerging Threat to Cotton Production Worldwide,” J. Gen. Virol., vol. 94, pp. 695-710, 2013.

[74] M. S. Shahid, M. Ikegami, A. Waheed, R. W. Briddon, and K. T. Natsuaki, “Association of an Alphasatellite with Tomato Yellow Leaf Curl Virus and Ageratum Yellow Vein Virus in Japan Is Suggestive of a Recent Introduction.,” Viruses, vol. 6, pp. 189-200, 2014.

111

Chapter 6 References

[75] Y. Xie, P. Wu, P. Liu, H. Gong, and X. Zhou, “Characterization of Alphasatellites Associated with Monopartite Begomovirus/Betasatellite Complexes in Yunnan, China,” Virol. J., vol. 7, pp. 178, 2010.

[76] R. Hull, Matthew's Plant Virology, 4 ed., San Diego: Academic Press, 2002.

[77] A. M. Idris, M. S. Shahid, R. W. Briddon, A. J. Khan, J.-K. Zhu, and J. K. Brown, “An Unusual Alphasatellite Associated with Monopartite Begomoviruses Attenuates Symptoms and Reduces Betasatellite Accumulation,” J. Gen. Virol., vol. 92, pp. 706-717, 2011.

[78] M. S. Nawaz-ul-Rehman, N. Nahid, S. Mansoor, R. W. Briddon, and C. M. Fauquet, “Post-Transcriptional Gene Silencing Suppressor Activity of the Alpha-Rep of Non-Pathogenic Alphasatellites Associated with Begomoviruses,” Virology, vol. 405, pp. 300-308, 2010.

[79] E. V. Koonin, and T. V. Ilyina, “Geminivirus Replication Proteins Are Related to Prokaryotic Plasmid Rolling Circle DNA Replication Initiator Proteins,” J. Gen. Virol., vol. 73, pp. 2763-2766, 1992.

[80] J. Laufs, I. Jupin, C. David, S. Schumacher, F. Heyraud-Nitschke, and G. B., “Geminivirus Replication:Genetic and Biochemical Characterization of Rep Protein Function, a Review,” Biochimie, vol. 77, pp. 765-773, 1995.

[81] K. E. Palmer, and E. P. Rybicki, “The Molecular Biology of Mastreviruses,” Adv. Virus Res., vol. 50, pp. 183-234, 1998.

[82] R. Campos-Olivas, J. M. Louis, D. Cleroy, B. Gronenborn, and A. M. Gronenborn, “The Structure of a Replication Initiator Unites Diverse Aspects of Nucleic Acid Metabolism,” Proc. Natl. Acad. Sci. U.S.A., vol. 99, pp. 10310–10315, 2002.

[83] D. Clerot, and F. Bernardi, “DNA Helicase Activity Is Associated with the Replication Initiator Protein Rep of Tomato Yellow Leaf Curl Geminivirus,” J. Virol., vol. 80, pp. 11322-11330, 2006.

112

Chapter 6 References

[84] C. Desbiez, C. David, A. Mettouchi, J. Laufs, and B. Gronenborn, “Rep Protein of Tomato Yellow Leaf Curl Geminivirus Has an Atpase Activity Required for Viral Replication,” Proc. Natl. Acad. Sci. U.S.A., vol. 92, pp. 5640-5644, 1995.

[85] S. F. Hanson, R. A. Hoogstraten, P. Alquist, R. L. Gilbertson, D. R. Russell, and D. P. Maxwell, “Mutational Analysis of a Putative NTP-Binding Domain in the Replication-Associated Protein (Ac1) of Bean Golden Mosaic Virus,” Virology, vol. 211, pp. 1-9, 1995.

[86] V. Raghavan, P. S. Malik, N. R. Choudhury, and S. K. Mukherjee, “The DNA-a Component of a Plant Geminivirus (Indian Mung Bean Yellow Mosaic Virus) Replicates in Budding Yeast Cells,” J. Virol., vol. 78, pp. 2405-2413, 2004.

[87] F. Heyraud-Nitschke, S. Schumacher, J. Laufs, S. Schaefer, J. Schell, and B. Gronenborn, “Determination of the Origin Cleavage and Joining Domain of Geminivirus Rep Proteins,” Nucleic Acids Res., vol. 23, pp. 910-916, 1995.

[88] A. G. Castillo, D. Collinet, S. Deret, A. Kashoggi, and E. R. Bejarano, “Dual Interaction of Plant Pcna with Geminivirus Replication Accessory Protein (Ren) and Viral Replication Protein (Rep),” Virology, vol. 312, pp. 381-394, 2003.

[89] A. G. Castillo, L. J. Kong, L. Hanley-Bowdoin, and E. R. Bejarano, “Interaction between a Geminivirus Replication Protein and the Plant Sumoylation System,” J. Virol., vol. 78, pp. 2758–2769, 2004.

[90] L. J. Kong, and L. Hanley-Bowdoin, “A Geminivirus Replication Protein Interacts with a Protein Kinase and a Motor Protein That Display Different Expression Patterns During Plant Development and Infection,” Plant Cell, vol. 14, pp. 1817-1832, 2002.

[91] A. Luque, A. P. Sanz-Burgos, E. Ramirez-Parra, C. M.M., and C. Gutierrez, “Interaction of Geminivirus Rep Protein with Replication Factor C and Its

113

Chapter 6 References

Potential Role During Geminivirus DNA Replication,” Virology, vol. 302, pp. 83 –94, 2002.

[92] E. Rodríguez-Negrete, R. Lozano-Durán, A. Piedra-Aguilera, L. Cruzado, E. R. Bejarano, and A. G. Castillo, “Geminivirus Rep Protein Interferes with the Plant DNA Methylation Machinery and Suppresses Transcriptional Gene Silencing,” New Phytol., vol. 199, pp. 464-475, 2013.

[93] Y. Wang, M. Dang, H. Hou, Y. Mei, Y. Qian, and X. Zhou, “Identification of an Rna Silencing Suppressor Encoded by a Mastrevirus,” J. Gen. Virol., vol. 95, pp. 2082-8, Sep, 2014.

[94] X. Dong, R. van Wezel, J. Stanley, and Y. Hong, “Functional Characterization of the Nuclear Localization Signal for a Suppressor of Posttranscriptional Gene Silencing,” J. Virol., vol. 77, pp. 7026-7033, 2003.

[95] G. Sunter, and D. M. Bisaro, “Transactivation of Geminivirus AR1 and BR1 Gene Expression by the Viral AL2 Gene Product Occurs at the Level of Transcription,” Plant Cell, vol. 4, pp. 1321-1331, 1992.

[96] L. Amrao, I. Amin, S. Shahid, R. W. Briddon, and S. Mansoor, “Cotton Leaf Curl Disease in Resistant Cotton Is Associated with a Single Begomovirus That Lacks an Intact Transcriptional Activator Protein,” Virus Res., vol. 152, pp. 153-163, 2010.

[97] R. W. Briddon, F. Akbar, Z. Iqbal, L. Amrao, I. Amin, M. Saeed, and S. Mansoor, “Effects of Genetic Changes to the Begomovirus/Betasatellite Complex Causing Cotton Leaf Curl Disease in South Asia Post-Resistance Breaking,” Virus Res., vol. 186, pp. 114-119, 2014.

[98] P. A. Rajagopalan, A. Naik, P. Katturi, M. Kurulekar, R. S. KankanalluI, and R. Anandalakshmi, “Dominance of Resistance-Breaking Cotton Leaf Curl Burewala Virus (CLCuBuV) in Northwestern India,” Arch. Virol., vol. 157, pp. 855-868, 2012.

[99] J. M. I. Hofer, E. L. Dekker, H. V. Reynolds, C. J. Woolston, B. S. Cox, and P. M. Mullineaux, “Coordinate Regulation of Replication and Virion Sense

114

Chapter 6 References

Gene Expression in Wheat Dwarf Virus,” Plant Cell, vol. 4, pp. 213-223, February 1, 1992, 1992.

[100] L. Hanley-Bowdoin, J. S. Elmer, and S. G. Rogers, “Functional Expression of the Leftward Open Reading Frames of the a Component of Tomato Golden Mosaic Virus in Transgenic Tobacco Plants,” Plant Cell, vol. 1, pp. 1057- 1067, 1989.

[101] S. G. Hormuzdi, and D. M. Bisaro, “Genetic Analysis of Beet Curly Top Virus: Examination of the Roles of L2 and L3 Genes in Viral Pathogenesis,” Virology, vol. 206, pp. 1044-1054, 1995.

[102] D. Trinks, R. Rajeswaran, P. V. Shivaprasad, R. Akbergenov, E. J. Oakeley, K. Veluthambi, T. Hohn, and M. M. Pooggin, “Suppression of RNA Silencing by a Geminivirus Nuclear Protein, AC2, Correlates with Transactivation of Host Genes,” J. Virol., vol. 79, pp. 2517-2527, 2005.

[103] I. Amin, B. L. Patil, R. W. Briddon, S. Mansoor, and C. M. Fauquet, “Comparison of Phenotypes Produced in Response to Transient Expression of Genes Encoded by Four Distinct Begomoviruses in Nicotiana Benthamiana and Their Correlation with the Levels of Developmental MiRNAs.,” Virol. J., vol. 8, pp. 238, 2011.

[104] S. Chandran, C. Jeyabharathy, and R. Usha, “The C2 Protein of Bhendi Yellow Vein Mosaic Virus Plays an Important Role in Symptom Determination and Virus Replication,” Virus Genes, pp. 1-5, 2013.

[105] R. Van Wezel, H. Liu, P. Tien, J. Stanley, and Y. Hong, “Gene C2 of the Monopartite Geminivirus Tomato Yellow Leaf Curl Virus-China Encodes a Pathogenicity Determinant That Is Localized in the Nucleus,” Mol. Plant- Microbe Interact., vol. 14, pp. 1125-1128, 2001.

[106] R. Van Wezel, X. Dong, H. Liu, P. Tien, J. Stanley, and Y. Hong, “Mutation of Three Cysteine Residues in Tomato Yellow Leaf Curl Virus-China C2 Protein Causes Dysfunction in Pathogenesis and Posttranscriptional Gene

115

Chapter 6 References

Silencing Suppression,” Mol. Plant-Microbe Interact., vol. 15, pp. 203-208, 2002.

[107] Z. Zhang, H. Chen, X. Huang, R. Xia, Q. Zhao, J. Lai, K. Teng, Y. Li, L. Liang, Q. Du, X. Zhou, H. Guo, and Q. Xie, “Bsctv C2 Attenuates the Degradation of Samdc1 to Suppress DNA Methylation-Mediated Gene Silencing in Arabidopsis,” Plant Cell, vol. 23, pp. 273-288, 2011.

[108] M. Hussain, S. Mansoor, S. Iram, Y. Zafar, and R. W. Briddon, “The Hypersensitive Response to Tomato Leaf Curl New Delhi Virus Nuclear Shuttle Protein Is Inhibited by Transcriptional Activator Protein,” Mol. Plant- Microbe Interact., vol. 20, pp. 1581-1588, 2007.

[109] M. Mubin, I. Amin, L. Amrao, R. W. Briddon, and S. Mansoor, “The Hypersensitive Response Induced by the V2 Protein of a Monopartite Begomovirus Is Countered by the C2 Protein,” Mol. Plant Pathol., vol. 11, pp. 245-254 2010.

[110] L. S. T. Carmo, R. O. Resende, L. P. Silva, S. G. Ribeiro, and A. Mehta, “Identification of Host Proteins Modulated by the Virulence Factor AC2 of Tomato Chlorotic Mottle Virus in Nicotiana Benthamiana,” Proteomics, vol. 13, pp. 1947-1960, 2013.

[111] Z. Iqbal, M. N. Sattar, A. Kvarnheden, S. Mansoor, and R. W. Briddon, “Effects of the Mutation of Selected Genes of Cotton Leaf Curl Kokhran Virus on Infectivity, Symptoms and the Maintenance of Cotton Leaf Curl Multan Betasatellite,” Virus Res., vol. 169, pp. 107-116, 2012.

[112] J. Laufs, W. Traut, F. Heyraud, V. Matzeit, S. G. Rogers, J. Schell, and B. Gronenborn, “In Vitro Cleavage and Joining at the Viral Origin of Replication by the Replication Initiator Protein of Tomato Yellow Leaf Curl Virus,” Proc. Nat. Acad. Sci. U.S.A., vol. 92, pp. 3879-3883, 1995.

[113] S. B. Settlage, A. B. Miller, and L. Hanley-Bowdoin, “Interactions between Geminivirus Replication Proteins,” J. Virol., vol. 70, pp. 6790-6795, 1996.

116

Chapter 6 References

[114] S. B. Settlage, R. G. See, and L. Hanley-Bowdoin, “Geminivirus C3 Protein: Replication Enhancement and Protein Interactions,” J. Virol., vol. 79, pp. 9885-9895, 2005.

[115] S. B. Settlage, A. B. Miller, W. Gruissem, and L. Hanley-Bowdoin, “Dual Interaction of a Geminivirus Replication Accessory Factor with a Viral Replication Protein and a Plant Cell Cycle Regulator,” Virology, vol. 279, pp. 570-576, 2001.

[116] I. Jupin, F. De Kouchkovsky, F. Jouanneau, and B. Gronenborn, “Movement of Tomato Yellow Leaf Curl Geminivirus (TYLCV): Involvement of the Protein Encoded by Orf C4,” Virology, vol. 204, pp. 82-90, 1994.

[117] J. E. Rigden, L. R. Krake, M. A. Rezaian, and I. B. Dry, “ORF C4 of Tomato Leaf Curl Geminivirus Is a Determinant of Symptom Severity,” Virology, vol. 204, pp. 847-850, 1994.

[118] J. Stanley, and J. R. Latham, “A Symptom Variant of Beet Curly Top Geminivirus Produced by Mutation of Open Reading Frame C4,” Virology, vol. 190, pp. 506-509, 1992.

[119] J. Park, H.-S. Hwang, K. Buckley, J.-B. Park, C.-K. Auh, D.-G. Kim, S. Lee, and K. Davis, “C4 Protein of Beet Severe Curly Top Virus Is a Pathomorphogenetic Factor in Arabidopsis,” Plant Cell Reports, vol. 29, pp. 1377-1389, 2010.

[120] M. R. Rojas, H. Jiang, R. Salati, B. Xoconostle-Cázares, M. R. Sudarshana, W. J. Lucas, and R. L. Gilbertson, “Functional Analysis of Proteins Involved in Movement of the Monopartite Begomovirus, Tomato Yellow Leaf Curl Virus,” Virology, vol. 291, pp. 110-125, 2001.

[121] S. Sunitha, G. Shanmugapriya, V. Balamani, and K. Veluthambi, “Mungbean Yellow Mosaic Virus (MYMV) AC4 Suppresses Post-Transcriptional Gene Silencing and an AC4 Hairpin Rna Gene Reduces Mymv DNA Accumulation in Transgenic Tobacco,” Virus Genes, vol. 46, pp. 496-504, 2013/02/01, 2013.

117

Chapter 6 References

[122] R. Vanitharani, P. Chellappan, and C. M. Fauquet, “Geminiviruses and RNA Silencing,” Trends Plant Sci., vol. 10, pp. 144-151, 2005.

[123] P. Gopal, P. Kumar, B. Sinilal, J. Jose, A. Kasin Yadunandam, and R. Usha, “Differential Roles of C4 and Bc1 in Mediating Suppression of Post- Transcriptional Gene Silencing: Evidence for Transactivation by the C2 of Bhendi Yellow Vein Mosaic Virus, a Monopartite Begomovirus,” Virus Res., vol. 123, pp. 9-18, 2007.

[124] I. Amin, B. L. Patil, R. W. Briddon, S. Mansoor, and C. M. Fauquet, “A Common Set of Developmental MiRNAs Are Upregulated in Nicotiana Benthamiana by Diverse Begomoviruses,” Virol. J., vol. 8, pp. 143, 2011.

[125] C. Ha, S. Coombs, P. Revill, R. Harding, M. Vu, and J. Dale, “Molecular Characterization of Begomoviruses and DNA Satellites from Vietnam: Additional Evidence That the New World Geminiviruses Were Present in the Old World Prior to Continental Separation,” J. Gen. Virol., vol. 89, pp. 312- 326, 2008.

[126] M. Padidam, R. N. Beachy, and C. M. Fauquet, “The Role of AV2 ("Precoat") and Coat Protein in Viral Replication and Movement in Tomato Leaf Curl Geminivirus,” Virology, vol. 224, pp. 390-404, 1996.

[127] S. E. Bull, R. W. Briddon, W. S. Sserubombwe, K. Ngugi, P. G. Markham, and J. Stanley, “Infectivity, Pseudorecombination and Mutagenesis of Kenyan Cassava Mosaic Begomoviruses,” J. Gen. Virol., vol. 88, pp. 1624-1633, 2007.

[128] P. Sharma, R. Gaur, and M. Ikegami, “Subcellular Localization of V2 Protein of Tomato Leaf Curl Java Virus by Using Green Fluorescent Protein and Yeast Hybrid System,” Protoplasma, vol. 248, pp. 281-288, 2011.

[129] R. Fukunaga, and J. A. Doudna, “DsRNA with 5' Overhangs Contributes to Endogenous and Antiviral Rna Silencing Pathways in Plants,” EMBO J., vol. 28, pp. 545-555, 2009.

118

Chapter 6 References

[130] E. Glick, A. Zrachya, Y. Levy, A. Mett, D. Gidoni, E. Belausov, V. Citovsky, and Y. Gafni, “Interaction with Host Sgs3 Is Required for Suppression of Rna Silencing by Tomato Yellow Leaf Curl Virus V2 Protein,” Proc. Natl. Acad. Sci. U.S.A., vol. 105, pp. 157-161, 2008.

[131] T. Frischmuth, S. Roberts, A. von Arnim, and J. Stanley, “Specificity of Bipartite Geminivirus Movement Proteins,” Virology, vol. 196, pp. 666-673, 1993.

[132] R. I. B. Francki, T. Hatta, G. Boccardo, and J. W. Randles, “The Composition of Chloris Striate Mosaic Virus, a Geminivirus,” Virology, vol. 101, pp. 233- 241, 1980.

[133] T. Hatta, and R. I. B. Francki, “The Fine Structure of Chloris Striate Mosaic Virus,” Virology, vol. 92, pp. 428-435, 1979.

[134] P. M. Mullineaux, J. Donson, B. A. M. Morris-Krsinich, M. I. Boulton, and J. W. Davies, “The Nucleotide Sequence of Maize Streak Virus DNA,” EMBO J., vol. 3, pp. 3063-3068, 1984.

[135] T. Frischmuth, M. Ringel, and C. Kocher, “The Size of Encapsidated Single- Stranded DNA Determines Multiplicity of African Cassava Mosaic Virus Particles,” J. Gen. Virol., vol. 82, pp. 673-676, 2001.

[136] B. D. Harrison, M. M. Swanson, and C. Fargette, “Begomovirus Coat Protein:Serology, Variation and Functions,” Physiol. Mol. Plant Pathol., vol. 60, pp. 257-271, 2002.

[137] R. W. Briddon, M. S. Pinner, J. Stanley, and P. G. Markham, “Geminivirus Coat Protein Replacement Alters Insect Specificity,” Virology, vol. 177, pp. 85-94, 1990.

[138] P. Hofer, I. D. Bedford, P. G. Markham, H. Jeske, and T. Frischmuth, “Coat Protein Replacement Results in Whitefly Transmission of an Insect Nontransmissible Geminivirus Isolate,” Virology, vol. 236, pp. 288-295, 1997.

119

Chapter 6 References

[139] O. Azzam, J. Frazer, D. de la Rosa, J. S. Beaver, P. Ahlquist, and D. P. Maxwell, “Whitefly Transmission and Efficient Ssdna Accumulation of Bean Golden Mosaic Geminivirus Requires Functional Coat Protein,” Virology, vol. 204, pp. 289-296, 1994.

[140] P. Priyadarshini, C. G., M. V. Ambika, R. Tippeswamy, and H. S. Savithri, “Functional Characterization of Coat Protein and V2 Involved in Cell to Cell Movement of Cotton Leaf Curl Kokhran Virus-Dabawali,” PLoS ONE, vol. 6, pp. e26929, 2011.

[141] H. Liu, M. I. Boulton, and J. W. Davies, “Maize Streak Virus Coat Protein Binds Single- and Double-Stranded DNA in Vitro,” J. Gen. Virol., vol. 78, pp. 1265-1270, 1997.

[142] K. Palanichelvam, T. Kunik, V. Citovsky, and Y. Gafni, “The Capsid Protein of Tomato Yellow Leaf Curl Virus Binds Cooperatively to Single-Stranded DNA,” J. Gen. Virol., vol. 79, pp. 2829-2833, 1998.

[143] S. Unseld, M. Honle, M. Ringel, and T. Frischmuth, “Subcellular Targeting of Coat Protein of African Cassava Mosaic Geminivirus,” Virology, vol. 286, pp. 373-383, 2001.

[144] B. M. Ward, and S. G. Lazarowitz, “Nuclear Export in Plants: Use of Geminivirus Movement Proteins for a Cell-Based Export Assay,” Plant Cell, vol. 11, pp. 1267-1276, 1999.

[145] O. Guerra-Peraza, D. Kirk, V. Seltzer, K. Veluthambi, A. C. Schmit, T. Hohn, and E. Herzog, “Coat Proteins of Rice Tungro Bacilliform Virus and Mungbean Yellow Mosaic Virus Contain Multiple Nuclear-Localization Signals and Interact with Importin A,” J. Gen. Virol., vol. 86, pp. 1815–1826, 2005.

[146] T. Kunik, L. Mizrachy, V. Citovsky, and Y. Gafni, “Characterization of a Tomato Karyopherin a That Interacts with the Tomato Yellow Leaf Curl Virus (TYLCV) Capsid Protein,” J. Exp. Biol., vol. 50, pp. 731-732, 1999.

120

Chapter 6 References

[147] C. Pitaksutheepong, A. Vimoltat, B. Nathwong, and S. Attathom, “The N- Terminal 62 Amino Acid Residues of the Coat Protein of Tomato Yellow Leaf Curl Thailand Virus Are Responsible for DNA Binding,” J. Gen Plant Pathol., vol. 73, pp. 72-75, 2007.

[148] T. Kunik, K. Palanichelvam, H. Czosnek, V. Citovsky, and Y. Gafni, “Nuclear Import of the Capsid Protein of Tomato Yellow Leaf Curl Virus (TYLCV) in Plant and Insect Cells,” Plant J., vol. 13, pp. 393-399, 1998.

[149] H. Liu, M. I. Boulton, C. L. Thomas, D. A. M. Prior, K. J. Oparka, and J. W. Davies, “Maize Streak Virus Coat Protein Is Karyophyllic and Facilitates Nuclear Transport of Viral DNA,” Mol. Plant-Microbe Interact., vol. 12, pp. 894-900, 1999.

[150] H. Liu, M. I. Boulton, K. J. Oparka, and J. W. Davies, “Interaction of the Movement and Coat Proteins of Maize Streak Virus: Implications for the Transport of Viral DNA,” J. Gen. Virol., vol. 82, pp. 35-44, 2001.

[151] S. Morin, M. Ghanim, I. Sobol, and H. Czosnek, “The Groel Protein of the Whitefly Bemisia Tabaci Interacts with the Coat Protein of Transmissible and Nontransmissible Begomoviruses in the Yeast Two-Hybrid System,” Virology, vol. 276, pp. 404-16, 2000.

[152] Y. Gafni, and B. L. Epel, “The Role of Host and Viral Proteins in Intra- and Inter-Cellular Trafficking of Geminiviruses,” Physiol. Mol. Plant Pathol., vol. 60, pp. 231-241, 2002.

[153] M. Hussain, S. Mansoor, S. Iram, A. N. Fatima, and Y. Zafar, “The Nuclear Shuttle Protein of Tomato Leaf Curl New Delhi Virus Is a Pathogenicity Determinant,” J. Virol., vol. 79, pp. 4434–4439, 2005.

[154] S. Frischmuth, C. Wege, D. Hülser, and H. Jeske, “The Movement Protein Bc1 Promotes Redirection of the Nuclear Shuttle Protein BV1 of Abutilon Mosaic Geminivirus to the Plasma Membrane in Fission Yeast,” Protoplasma, vol. 230, pp. 117-123, 2007.

121

Chapter 6 References

[155] S. C. Zhang, C. Wege, and H. Jeske, “Movement Proteins (BC1 and BV1) of Abutilon Mosaic Geminivirus Are Cotransported in and between Cells of Sink but Not of Source Leaves as Detected by Green Flourescent Protein Tagging,” Virology, vol. 290, pp. 249-260, 2001.

[156] Y. Zhou, M. R. Rojas, M.-R. Park, Y.-S. Seo, W. J. Lucas, and R. L. Gilbertson, “Histone H3 Interacts and Co-Localizes with the Nuclear Shuttle Protein and Movement Protein of a Geminivirus,” J. Virol., vol. 85, pp. 11821-11832, 2011.

[157] C. M. Carvalho, J. P. B. Machado, F. M. Zerbini, and E. P. B. Fontes, “NSP- Interacting Gtpase: A Cytosolic Protein as Cofactor for Nuclear Shuttle Proteins,” Plant Signal. Behav., vol. 3, pp. 752-754, 2008.

[158] L. H. Florentino, A. A. Santos, M. R. Fontenelle, G. L. Pinheiro, F. M. Zerbini, M. C. Baracat-Pereira, and E. P. B. Fontes, “A Perk-Like Receptor Kinase Interacts with the Geminivirus Nuclear Shuttle Protein and Potentiates Viral Infection,” J. Virol., vol. 80, pp. 6648-6656, 2006.

[159] A. A. Santos, K. V. G. Lopes, J. A. C. Apfata, and E. P. B. Fontes, “Nsp- Interacting Kinase, Nik: A Transducer of Plant Defence Signalling,” J. Exp. Bot., pp. erq219, July 11, 2010, 2010.

[160] T. Kleinow, F. Tanwir, C. Kocher, B. Krenz, C. Wege, and H. Jeske, “Expression Dynamics and Ultrastructural Localization of Epitope-Tagged Abutilon Mosaic Virus Nuclear Shuttle and Movement Proteins in Nicotiana Benthamiana Cells,” Virology, vol. 390, pp. 89-101, 2009.

[161] B. M. Ward, R. Medville, S. G. Lazarowitz, and R. Turgeon, “The Geminivirus Bl1 Movement Protein Is Associated with Edoplasmic Reticulum-Derived Tubules in Developing Phloem Cells,” J. Virol., vol. 71, pp. 3726-3733, 1997.

[162] S. C. Zhang, R. Ghosh, and H. Jeske, “Subcellular Targeting Domains of Abutilon Mosaic Geminivirus Movement Protein Bc1,” Arch. Virol., vol. 147, pp. 2349-2363, 2002.

122

Chapter 6 References

[163] A. O. Noueiry, W. J. Lucas, and R. L. Gilbertson, “Two Proteins of a Plant DNA Virus Coordinate Nuclear and Plasmodesmal Transport,” Cell, vol. 76, pp. 925-932, 1994.

[164] Y. P. Duan, C. A. Powell, D. E. Purcifull, P. Broglio, and E. Hiebert, “Phenotypic Variation in Transgenic Tobacco Expressing Mutated Geminivirus Movement/Pathogenicity (BC1) Proteins,” Mol. Plant-Microbe Interact., vol. 10, pp. 1065-1074, 1997.

[165] E. Pascal, P. E. Goodlove, L. C. Wu, and S. G. Lazarowitz, “Transgenic Tobacco Plants Expressing the Geminivirus Bl1 Protein Exhibit Symptoms of Viral Disease,” Plant Cell, vol. 5, pp. 795-807, 1993.

[166] T. Kleinow, M. Nischang, A. Beck, U. Kratzer, F. Tanwir, W. Preiss, G. Kepp, and H. Jeske, “Three C-Terminal Phosphorylation Sites in the Abutilon Mosaic Virus Movement Protein Affect Symptom Development and Viral DNA Accumulation,” Virology, vol. 390, pp. 89-101, 2009.

[167] G. K. Radhakrishnan, G. A. Splitter, and R. Usha, “DNA Recognition Properties of the Cell-to-Cell Movement Protein (MP) of Soybean Isolate of Mungbean Yellow Mosaic India Virus (Mymiv-Sb),” Virus Res., vol. 131, pp. 152-159, 2008.

[168] K. Saunders, A. Lucy, and J. Stanley, “DNA Forms of the Geminivirus African Cassava Mosaic Virus Consistent with a Rolling Circle Mechanism of Replication,” Nucleic Acids Res., vol. 19, pp. 2325-2330, 1991.

[169] M. C. P. Timmermans, O. P. Das, and J. Messing, “Geminiviruses and Their Uses as Extrachromosomal Replicons,” Annu. Rev. Plant Physiol. Plant Mol. Biol., vol. 45, pp. 79-112, 1994.

[170] B. M. Orozco, and L. Hanley-Bowdoin, “A DNA Structure Is Required for Geminivirus Replication Origin Function,” J. Virol., vol. 7, pp. 148-158, 1996.

[171] B. Alberter, M. A. Rezaian, and H. Jeske, “Replicative Intermediates of Tomato Leaf Curl Virus and Its Satellite DNAs,” Virology, vol. 331, pp. 441- 448, 2005.

123

Chapter 6 References

[172] W. Preiss, and H. Jeske, “Multitasking in Replication Is Common among Geminiviruses,” J. Virol., vol. 77, pp. 2972–2980, 2003.

[173] K. N. Kreuzer, “Recombination-Dependent DNA Replication in Phage T4,” Trends Biochem. Sci., vol. 25, pp. 165-173, 2000.

[174] B. J. Brewer, “When Polymerases Collide: Replication and the Transcriptional Organization of the E. Coli Chromosome,” Cell, vol. 53, pp. 679-86, Jun 3, 1988.

[175] S. Mansoor, I. Amin, S. Iram, M. Hussain, Y. Zafar, K. A. Malik, and R. W. Briddon, “Breakdown of Resistance in Cotton to Cotton Leaf Curl Disease in Pakistan,” Plant Pathol., vol. 52, pp. 784, 2003.

[176] Y. Antignus, R. Vunsh, O. Lachman, M. Pearlsman, L. Maslenin, U. Hananya, and A. Rosner, “Truncated Rep Gene Originated from Tomato Yellow Leaf Curl Virus-Israel [Mild] Confers Strain-Specific Resistance in Transgenic Tomato,” Ann. Appl. Biol., vol. 144, pp. 39-44, 2004.

[177] A. Chatterji, R. N. Beachy, and C. M. Fauquet, “Expression of the Oligomerization Domain of the Replication-Associated Protein (Rep) of Tomato Leaf Curl New Delhi Virus Interferes with DNA Accumulation of Heterologous Geminiviruses,” J. Biol. Chem., vol. 276, pp. 25631-25638, 2001.

[178] S. Asad, W. A. A. Haris, A. Bashir, Y. Zafar, K. A. Malik, M. N. Malik, and C. P. Lichtenstein, “Transgenic Tobacco Expressing Geminiviral RNAs Are Resistant to the Serious Viral Pathogen Causing Cotton Leaf Curl Disease,” Arch. Virol., vol. 148, pp. 2341-2352, 2003.

[179] I. Ali, I. Amin, R. Briddon, and S. Mansoor, “Artificial MicroRNA-Mediated Resistance against the Monopartite Begomovirus Cotton Leaf Curl Burewala Virus,” Virol. J., vol. 10, pp. 231, 2013.

[180] J. Hong, and J. Stanley, “Virus Resistance in Nicotiana Benthamiana Conferred by African Cassava Mosaic Virus Replication-Associated Protein (AC1) Transgene,” Mol. Plant-Microbe Interact., vol. 4, pp. 219-225, 1996.

124

Chapter 6 References

[181] X. H. Sinisterra, J. E. Polston, A. M. Abouzid, and E. Hiebert, “Tobacco Plants Transformed with a Modified Coat Protein of Tomato Mottle Begomovirus Show Resistance to Virus Infection,” Phytopathology, vol. 89, pp. 701-706, 1999.

[182] Y. M. Hou, R. Sanders, V. M. Ursin, and R. L. Gilbertson, “Transgenic Plants Expressing Geminivirus Movement Proteins: Abnormal Phenotypes and Delayed Infection by Tomato Mottle Virus in Transgenic Tomatoes Expressing the Bean Dwarf Mosaic Virus BV1 or BC1 Proteins,” Mol. Plant- Microbe Interact., vol. 13, pp. 297-308, 2000.

[183] D. C. Stenger, M. C. Stevenson, S. G. Hormuzdi, and D. M. Bisaro, “A Number of Subgenomic Dnas Are Produced Following Agroinoculation of Plants with Beet Curly Top Virus,” J. Gen. Virol., vol. 73, pp. 237-242, 1992.

[184] K. Saunders, I. D. Bedford, R. W. Briddon, P. G. Markham, S. M. Wong, and J. Stanley, “A Unique Virus Complex Causes Ageratum Yellow Vein Disease.,” Proc. Natl. Acad. Sci. U.S.A., vol. 97, pp. 6890-6895, 2000.

[185] J. Horn, S. Lauster, B. Krenz, J. Kraus, T. Frischmuth, and H. Jeske, “Ambivalent Effects of Defective DNA in Beet Curly Top Virus-Infected Transgenic Sugarbeet Plants,” Virus Res., vol. 158, pp. 169-178, 2011.

[186] A. Fuentes, P. Ramos, E. Fiallo, D. Callard, Y. Sa¡nchez, R. Peral, R. Rodraguez, and M. Pujol, “Intron-Hairpin RNA Derived from Replication Associated Protein C1 Gene Confers Immunity to Tomato Yellow Leaf Curl Virus Infection in Transgenic Tomato Plants,” Transgenic Res., vol. 15, pp. 291, 2006.

[187] P. Chellappan, M. V. Masona, R. Vanitharani, N. J. Taylor, and C. M. Fauquet, “Broad Spectrum Resistance to ssDNA Viruses Associated with Transgene-Induced Gene Silencing in Cassava,” Plant Mol. Biol., vol. 56, pp. 601-611, 2004.

125

Chapter 6 References

[188] M. Pooggin, P. V. Shivaprasad, K. Veluthambi, and T. Hohn, “RNAi Targeting of DNA Virus in Plants,” Nat. Biotechnol., vol. 21, pp. 131-132, 2003.

[189] A. Zrachya, P. P. Kumar, U. Ramakrishnan, Y. Levy, A. Loyter, T. Arazi, M. Lapidot, and Y. Gafni, “Production of siRNA Targeted against TYLCV Coat Protein Transcripts Leads to Silencing of Its Expression and Resistance to the Virus,” Transgenic Res., vol. 15, pp. 385–398, 2007.

[190] N. Nahid, I. Amin, R. W. Briddon, and S. Mansoor, “RNA Interference Based Resistance against a Legume Mastrevirus.,” Virol. J., vol. 8, pp. 499, 2011.

[191] M. Mubin, S. Mansoor, M. Hussain, and Y. Zafar, “Silencing of AV2 Gene by Antisense RNA Protect Transgenic Plants against a Bipartite Begomovirus ” Virol. J., vol. 4:10, 2007.

[192] S. Morin, M. Ghanim, M. Zeidan, H. Czosnek, M. Verbeek, and J. F. J. M. van den Heuvel, “A GroEL Homologue from Endosymbiotic Bacteria of the Whitefly Bemisia Tabaci Is Implicated in the Circulative Transmission of Tomato Yellow Leaf Curl Virus,” Virology, vol. 256, pp. 75-84, 1999.

[193] F. Akad, N. Dotan, and H. Czosnek, “Trapping of Tomato Yellow Leaf Curl Virus (Tylcv) and Other Plant Viruses with a GroEL Homologue from the Whitefly Bemisia Tabaci,” Arch. Virol., vol. 149, pp. 1481 - 1497, 2004.

[194] F. Akad, A. Eybishtz, D. Edelbaum, R. Gorovits, O. Dar-Issa, N. Iraki, and H. Czosnek, “Making a Friend from a Foe: Expressing a Groel Gene from the Whitefly Bemisia Tabaci in the Phloem of Tomato Plants Confers Resistance to Tomato Yellow Leaf Curl Virus,” Arch. Virol., vol. 152, pp. 1323-1339, 2007.

[195] P. Colas, B. Cohen, T. Jessen, I. Grishina, J. McCoy, and R. Brent, “Genetic Selection of Peptide Aptamers that Recognize and Inhibit Cyclin-Dependent Kinase 2,” Nature, vol. 380, pp. 548-50, 1996.

[196] F. Hoppe-Seyler, and K. Butz, “Peptide Aptamers: Powerful New Tools for Molecular Medicine,” J. Mol. Med., vol. 78, pp. 426-30, 2000.

126

Chapter 6 References

[197] L. Lopez-Ochoa, J. Ramirez-Prado, and L. Hanley-Bowdoin, “Peptide Aptamers That Bind to a Geminivirus Replication Protein Interfere with Viral Replication in Plant Cells,” J. Virol., vol. 80, pp. 5841-5853, June 15, 2006, 2006.

[198] M. I. Reyes, T. E. Nash, M. M. Dallas, J. T. Ascencio-Ibáñez, and L. Hanley- Bowdoin, “Peptide Aptamers That Bind to Geminivirus Replication Proteins Confer a Resistance Phenotype to TYLCV and ToMoV Infection in Tomato,” J. Virol., vol. 87, pp. 9691-9706, 2013.

[199] K. Takenaka, Y. Koshino-Kimura, Y. Aoyama, and T. Sera, “Inhibition of Tomato Yellow Leaf Curl Virus Replication by Artificial Zincfinger Proteins,” Nucleic Acids Symp. Ser., vol. 51, pp. 429-430, 2007.

[200] Y. Koshino-Kimura, K. Takenaka, F. Domoto, M. Ohashi, T. Miyazaki, Y. Aoyama, and T. Sera, “Construction of Plants Resistant to TYLCV by Using Artificial Zinc-Finger Proteins,” Nucleic Acids Symp. Ser., vol. 53, pp. 281- 282, 2009.

[201] T. Sera, “Inhibition of Virus DNA Replication by Artificial Zinc Finger Proteins,” J. Virol., vol. 79, pp. 2614-2619, 2005.

[202] T. Mori, K. Takenaka, F. Domoto, Y. Aoyama, and T. Sera, “Inhibition of Binding of Tomato Yellow Leaf Curl Virus Rep to Its Replication Origin by Artificial Zinc-Finger Protein,” Mol. Biotechnol., vol. 54, pp. 198-203, 2012.

[203] H. Hong, K. Saunders, M. R. Hartley, and J. Stanley, “Resistance to Geminivirus Infection by Virus-Induced Expression of Dianthin in Transgenic Plants,” Virology, vol. 220, pp. 119-127, 1996.

[204] Y. Hong, K. Saunders, and J. Stanley, “Transactivation of Dianthin Transgene Expression by African Cassava Mosaic Virus AC2,” Virology, vol. 228, pp. 383-37, 1997.

[205] F. J. L. Aragao, and J. C. Faria, “First Transgenic Geminivirus-Resistant Plant in the Field,” Nat Biotech, vol. 27, pp. 1086-1088, 2009.

127

Chapter 6 References

[206] D. Baulcombe, “RNA Silencing,” Trends Biochem. Sci., vol. 30, pp. 290-293, 2005.

[207] A. Fire, S. Xu, M. K. Montgomery, S. A. Kostas, S. E. Driver, and C. C. Mellow, “Potent and Specific Genetic Interference by Double-Stranded RNA in Caenorhabditis Elegans.,” Nature, vol. 391, pp. 806-811, 1998.

[208] J. L. Umbach, and B. R. Cullen, “The Role of RNAi and Micrornas in Animal Virus Replication and Antiviral Immunity,” Genes & Development, vol. 23, pp. 1151-1164, 2009.

[209] G. J. Hannon, “RNA Interference,” Nature, vol. 418, pp. 244-251, 2002.

[210] Z. Lippman, and R. Martienssen, “The Role of RNA Interference in Heterochromatic Silencing,” Nature, vol. 431, pp. 364-370, 2004.

[211] P. M. Waterhouse, M.-B. Wang, and T. Lough, “Gene Silencing as an Adaptive Defence against Viruses,” Nature, vol. 411, pp. 834-842, 2001.

[212] D. Baulcombe, “RNA Silencing in Plants,” Nature, vol. 431, pp. 356-363, 2004.

[213] T. Hohn, and F. Vazquez, “Rna Silencing Pathways of Plants: Silencing and Its Suppression by Plant DNA Viruses,” Biochimica et Biophysica Acta (BBA) - Gene Regulatory Mechanisms, vol. 1809, pp. 588-600, 2011.

[214] G. Meister, and T. Tuschl, “Mechanisms of Gene Silencing by Double- Stranded RNA,” Nature, vol. 431, pp. 343-349, 2004.

[215] C. C. Mello, and D. Conte, “Revealing the World of RNA Interference,” Nature, vol. 431, pp. 338-342, 2004.

[216] A. M. Denli, and G. J. Hannon, “RNAi: An Ever-Growing Puzzle,” Trends Biochem. Sci., vol. 28, pp. 196-201, 2003.

[217] A. C. Mallory, and H. Vaucheret, “Functions of Micrornas and Related Small RNAs in Plants” Nature Genet., vol. 38, pp. S31-S36, 2006.

128

Chapter 6 References

[218] J. F. Palatnik, E. Allen, X. Wu, C. Schommer, R. Schwab, J. C. Carrington, and D. Weigel, “Control of Leaf Morphogenesis by MicroRNAs,” Nature, vol. 425, pp. 257, 2003.

[219] K. Kobayashi, and P. Zambryski, “RNA Silencing and Its Cell-to-Cell Spread During Arabidopsis Embryogenesis,” Plant J., vol. 50, pp. 597-604, 2007.

[220] R. D. Garcia-Perez, H. Van Houdt, and A. Depicker, “Spreading of Post- Transcriptional Gene Silencing Along the Target Gene Promotes Systemic Silencing,” Plant J., vol. 38, pp. 594-602, 2004.

[221] N. Buchon, and C. Vaury, “RNAi: A Defensive RNA-Silencing against Viruses and Transposable Elements,” Heredity, vol. 96, pp. 195-202, 2005.

[222] R. Akbergenov, A. Si-Ammour, T. Blevins, I. Amin, C. Kutter, H. Vanderschuren, P. Zhang, W. Gruissem, F. Meins, Jr., T. Hohn, and M. M. Pooggin, “Molecular Characterization of Geminivirus-Derived Small RNAs in Different Plant Species,” Nucleic Acids Res., vol. 34, pp. 462-471, 2006.

[223] N. Agrawal, P. V. N. Dasaradhi, A. Mohmmed, P. Malhotra, R. K. Bhatnagar, and S. K. Mukherjee, “RNA Interference: Biology, Mechanism, and Applications,” Microbiol. Mol. Biol. Rev., vol. 67, pp. 657-685, 2003.

[224] P. Parameswaran, E. Sklan, C. Wilkins, T. Burgon, M. A. Samuel, R. Lu, K. M. Ansel, V. Heissmeyer, S. Einav, W. Jackson, T. Doukas, S. Paranjape, C. Polacek, F. B. dos Santos, R. Jalili, F. Babrzadeh, B. Gharizadeh, D. Grimm, M. Kay, S. Koike, P. Sarnow, M. Ronaghi, S.-W. Ding, E. Harris, M. Chow, M. S. Diamond, K. Kirkegaard, J. S. Glenn, and A. Z. Fire, “Six RNA Viruses and Forty-One Hosts: Viral Small RNAs and Modulation of Small RNA Repertoires in Vertebrate and Invertebrate Systems,” PLoS Pathog., vol. 6, pp. e1000764, 2010.

[225] A. J. Hamilton, and D. C. Baulcombe, “A Species of Small Antisense RNA in Post-Transcriptional Gene Silencing in Plants.,” Science, vol. 286, pp. 950– 952, 1999.

129

Chapter 6 References

[226] T. Tuschl, P. D. Zamore, R. Lehmann, D. P. Bartel, and P. A. Sharp, “Targeted MRNA Degradation by Double-Stranded RNA in Vitro,” Genes & Development, vol. 13, pp. 3191-3197, 1999.

[227] H.-C. Lee, A. P. Aalto, Q. Yang, S.-S. Chang, G. Huang, D. Fisher, J. Cha, M. M. Poranen, D. H. Bamford, and Y. Liu, “The DNA/RNA-Dependent RNA Polymerase Qde-1 Generates Aberrant RNA and DsRNA for RNAi in a Process Requiring Replication Protein a and a DNA Helicase,” PLoS Biol., vol. 8, pp. e1000496, 2010.

[228] A. Vermeulen, L. Behlen, A. Reynolds, A. Wolfson, W. S. Marshall, J. Karpilow, and A. Khvorova, “The Contributions of DsRNA Structure to Dicer Specificity and Efficiency,” RNA, vol. 11, pp. 674-82, 2005.

[229] D. P. Bartel, “MicroRNAs: Genomics, Biogenesis, Mechanism, and Function,” Cell, vol. 116, pp. 281–297, 2004.

[230] R. Aliyari, and S. W. Ding, “RNA-Based Viral Immunity Initiated by the Dicer Family of Host Immune Receptors,” Immunol. Rev., vol. 227, pp. 176- 188, 2009.

[231] A. Cimmino, G. A. Calin, M. Fabbri, M. V. Iorio, M. Ferracin, M. Shimizu, S. E. Wojcik, R. I. Aqeilan, S. Zupo, M. Dono, L. Rassenti, H. Alder, S. Volinia, C.-g. Liu, T. J. Kipps, M. Negrini, and C. M. Croce, “MiR-15 and MiR-16 Induce Apoptosis by Targeting BCL2,” Proc. Natl. Acad. Sci. U.S.A., vol. 102, pp. 13944-13949, 2005.

[232] S. A. Shabalina, and E. V. Koonin, “Origins and Evolution of Eukaryotic RNA Interference,” Trends Ecol. Evolut., vol. 23, pp. 578-587, 2008.

[233] B. H. Zhang, X. P. Pan, S. B. Cox, G. P. Cobb, and T. A. Anderson, “Evidence That MiRNAs Are Different from Other RNAs,” Cell. Mol. Life Sci., vol. 63, pp. 246-254, 2006.

[234] J. C. Carrington, and V. Ambros, “Role of MicroRNAs in Plant and Animal Development,” Science, vol. 301, pp. 336-8, 2003.

130

Chapter 6 References

[235] O. Voinnet, “Origin, Biogenesis, and Activity of Plant MicroRNAs,” Cell, vol. 136, pp. 669-687, 2009.

[236] V. N. Kim, “Microrna Biogenesis: Coordinated Cropping and Dicing,” Nat. Rev. Mol. Cell Biol., vol. 6, pp. 376-85, 2005.

[237] I. Bentwich, A. Avniel, Y. Karov, R. Aharonov, S. Gilad, O. Barad, A. Barzilai, P. Einat, U. Einav, E. Meiri, E. Sharon, Y. Spector, and Z. Bentwich, “Identification of Hundreds of Conserved and Nonconserved Human MicroRNAs,” Nature Genet., vol. 37, pp. 766-70, 2005.

[238] S. Katiyar-Agarwal, and H. Jin, “Role of Small RNAs in Host-Microbe Interactions,” Ann. Rev. Phytopathol., vol. 48, pp. 225-246, 2010.

[239] G. Hutvagner, J. McLachlan, A. E. Pasquinelli, E. Balint, T. Tuschl, and P. D. Zamore, “A Cellular Function for the RNA-Interference Enzyme Dicer in the Maturation of the Let-7 Small Temporal RNA,” Science, vol. 293, pp. 834-8, Aug 3, 2001.

[240] E. Bernstein, A. A. Caudy, S. M. Hammond, and G. J. Hannon, “Role for a Bidentate Ribonuclease in the Initiation Step of RNA Interference.,” Nature, vol. 409, pp. 363-366, 2001. [241] Y. Kurihara, and Y. Watanabe, “Arabidopsis Micro-RNA Biogenesis through Dicer-Like 1 Protein Functions,” Proc. Natl. Acad. Sci. U.S.A., vol. 101, pp. 12753-12758, 2004.

[242] E. Lackey, D. W.-K. Ng, and Z. J. Chen, “RNAi-Mediated Down-Regulation of DCL1 and AGO1 Induces Developmental Changes in Resynthesized Arabidopsis Allotetraploids,” New Phytol., vol. 186, pp. 207-215, 2010.

[243] Y. Qi, and G. J. Hannon, “Uncovering RNAi Mechanisms in Plants: Biochemistry Enters the Foray,” FEBS Lett., vol. 579, pp. 5899, 2005.

[244] Z. Xie, L. K. Johansen, A. M. Gustafson, K. D. Kasschau, A. D. Lellis, D. Zilberman, S. E. Jacobsen, and J. C. Carrington, “Genetic and Functional Diversification of Small RNA Pathways in Plants,” PLoS Biol., vol. 2, 2004.

131

Chapter 6 References

[245] F. Vazquez, H. Vaucheret, R. Rajagopalan, C. Lepers, V. Gasciolli, A. C. Mallory, J.-L. Hilbert, D. P. Bartel, and P. Crété, “Endogenous Trans-Acting SirNAs Regulate the Accumulation of Arabidopsis MRNAs,” Mol. Cell, vol. 16, pp. 69-79, 2004.

[246] A. Deleris, J. Gallego-Bartolome, J. Bao, K. D. Kasschau, J. C. Carrington, and O. Voinnet, “Hierarchical Action and Inhibition of Plant Dicer-Like Proteins in Antiviral Defense.,” Science, vol. 7, pp. 68-71, 2006. [247] Z. Xie, E. Allen, A. Wilken, and J. C. Carrington, “Dicer-Like 4 Functions in Trans-Acting Small Interfering RNA Biogenesis and Vegetative Phase Change in Arabidopsis Thaliana,”Proc. Natl. Acad. Sci. U.S.A.vol. 102, pp. 12984- 12989, 2005.

[248] R. I. Gregory, T. P. Chendrimada, N. Cooch, and R. Shiekhattar, “Human Risc Couples MicroRNA Biogenesis and Posttranscriptional Gene Silencing,” Cell, vol. 123, pp. 631, 2005.

[249] S. M. Hammond, E. Bernstein, D. Beach, and G. J. Hannon, “An RNA- Directed Nuclease Mediates Post-Transcriptional Gene Silencing in Drosophila Cells,” Nature, vol. 404, pp. 293-296, 2000.

[250] J. Zhai, Y. Zhao, S. A. Simon, S. Huang, K. Petsch, S. Arikit, M. Pillay, L. Ji, M. Xie, X. Cao, B. Yu, M. Timmermans, B. Yang, X. Chen, and B. C. Meyers, “Plant MicroRNAs Display Differential 3′ Truncation and Tailing Modifications That Are Argonaute1 Dependent and Conserved across Species,” Plant Cell, 2013.

[251] J. T. van Mierlo, A. W. Bronkhorst, G. J. Overheul, S. A. Sadanandan, J.-O. Ekström, M. Heestermans, D. Hultmark, C. Antoniewski, and R. P. van Rij, “Convergent Evolution of Argonaute-2 Slicer Antagonism in Two Distinct Insect RNA Viruses,” PLoS Pathog., vol. 8, pp. e1002872, 2012.

[252] S. Iwasaki, T. Kawamata, and Y. Tomari, “Drosophila Argonaute1 and Argonaute2 Employ Distinct Mechanisms for Translational Repression,” Mol. Cell, vol. 34, pp. 58-67, 2009.

132

Chapter 6 References

[253] A. Mallory, and H. Vaucheret, “Form, Function, and Regulation of Argonaute Proteins,” Plant Cell, vol. 22, pp. 3879-3889, 2010.

[254] J. J. Song, S. K. Smith, G. J. Hannon, and L. Joshua-Tor, “Crystal Structure of Argonaute and Its Implications for Risc Slicer Activity,” Science, vol. 305, pp. 1434-7, 2004.

[255] Y. Wang, S. Juranek, H. Li, G. Sheng, T. Tuschl, and D. J. Patel, “Structure of an Argonaute Silencing Complex with a Seed-Containing Guide DNA and Target RNA Duplex,” Nature, vol. 456, pp. 921-926, 2008.

[256] X.-J. He, Y.-F. Hsu, S. Zhu, A. T. Wierzbicki, O. Pontes, C. S. Pikaard, H.-L. Liu, C.-S. Wang, H. Jin, and J.-K. Zhu, “An Effector of RNA-Directed DNA Methylation in Arabidopsis Is an Argonaute 4- and RNA-Binding Protein,” Cell, vol. 137, pp. 498-508, 2009.

[257] E. R. Havecker, L. M. Wallbridge, T. J. Hardcastle, M. S. Bush, K. A. Kelly, R. M. Dunn, F. Schwach, J. H. Doonan, and D. C. Baulcombe, “The Arabidopsis RNA-Directed DNA Methylation Argonautes Functionally Diverge Based on Their Expression and Jnteraction with Target Loci,” Plant Cell, pp. tpc.109.072199, 2010.

[258] A. J. Pratt, and I. J. MacRae, “The RNA-Induced Silencing Complex: A Versatile Gene-Silencing Machine,” J. Biol. Chem., vol. 284, pp. 17897-901, 2009.

[259] J. S. Parker, S. M. Roe, and D. Barford, “Crystal Structure of a Piwi Protein Suggests Mechanisms for SiRNA Recognition and Slicer Activity,” EMBO J., vol. 23, pp. 4727-4737, 2004.

[260] B. Yu, L. Bi, J. Zhai, M. Agarwal, S. Li, Q. Wu, S.-W. Ding, B. C. Meyers, H. Vaucheret, and X. Chen, “SiRNAs Compete with MiRNA for Methylation by HEN1 in Arabidopsis,” Nucleic Acids Res., vol. 38, pp. 5844-5850, 2010, 2010.

133

Chapter 6 References

[261] Y. Huang, L. Ji, Q. Huang, D. G. Vassylyev, X. Chen, and J.-B. Ma, “Structural Insights into Mechanisms of the Small RNA Methyltransferase HEN1,” Nature, vol. 461, pp. 823-829, 2009.

[262] S. Boutet, F. Vazquez, J. Liu, C. Béclin, M. Fagard, A. Gratias, J.-B. Morel, P. Crété, X. Chen, and H. Vaucheret, “Arabidopsis HEN1: A Genetic Link between Endogenous MiRNA Controlling Development and SiRNA Controlling Transgene Silencing and Virus Resistance,” Curr. Biol., vol. 13, pp. 843-848, 2003.

[263] Z. Yang, Y. W. Ebright, B. Yu, and X. Chen, “Hen1 Recognizes 21-24 Nt Small RNA Duplexes and Deposits a Methyl Group onto the 2' Oh of the 3' Terminal Nucleotide,” Nucleic Acids Res., vol. 34, pp. 667-675, 2006.

[264] C. Lu, and N. Fedoroff, “A Mutation in the Arabidopsis HYL1 Gene Encoding a DsRNA Binding Protein Affects Responses to Abscisic Acid, Auxin, and Cytokinin,” Plant Cell, vol. 12, pp. 2351-2366, 2000.

[265] F. Vazquez, V. Gasciolli, P. Crete, and H. Vaucheret, “The Nuclear DsRNA Binding Protein Hyl1 Is Required for MicroRNA Accumulation and Plant Development, but Not Posttranscriptional Transgene Silencing.,” Curren. Biology vol. 14, pp. 346-351, 2004.

[266] M.-H. Han, S. Goud, L. Song, and N. Fedoroff, “The Arabidopsis Double- Stranded RNA-Binding Protein HYL1 Plays a Role in MicroRNA-Mediated Gene Regulation,” Proc. Natl. Acad. Sci. U.S.A., vol. 101, pp. 1093-1098, 2004.

[267] Q. Liu, Q. Yan, Y. Liu, F. Hong, Z. Sun, L. Shi, Y. Huang, and Y. Fang, “Complementation of Hyponastic Leaves1 by Double-Strand RNA-Binding Domains of Dicer-Like1 in Nuclear Dicing Bodies,” Plant Physiol., vol. 163, pp. 108-17, 2013.

[268] S. W. Yang, H. Y. Chen, J. Yang, S. Machida, N. H. Chua, and Y. A. Yuan, “Structure of Arabidopsis Hyponastic Leaves1 and Its Molecular Implications for MiRNA Processing,” Structure, vol. 18, pp. 594-605, 2010.

134

Chapter 6 References

[269] L. Yang, Z. Liu, F. Lu, A. Dong, and H. Huang, “Serrate Is a Novel Nuclear Regulator in Primary MicroRNA Processing in Arabidopsis,” Plant J., vol. 47, pp. 841-50, 2006.

[270] S. P. Grigg, C. Canales, A. Hay, and M. Tsiantis, “Serrate Coordinates Shoot Meristem Function and Leaf Axial Patterning in Arabidopsis,” Nature, vol. 437, pp. 1022-6, 2005.

[271] D. Lobbes, G. Rallapalli, D. D. Schmidt, C. Martin, and J. Clarke, “SERRATE: A New Player on the Plant MicroRNA Scene,” EMBO Reports, vol. 7, pp. 1052-8, 2006.

[272] Y. Fang, and D. L. Spector, “Identification of Nuclear Dicing Bodies Containing Proteins for MicroRNA Biogenesis in Living Arabidopsis Plants,” Curr. Biol., vol. 17, pp. 818-23, 2007.

[273] Author ed.^eds., “Compendium of Cotton Diseases,” APS Compendium of Plant Disease Series, 2 ed., St. Paul, MN, USA: American Phytopathological Society, 2001.

[274] A. M. Idris, and J. K. Brown, “Cotton Leaf Crumple Virus Is a Distinct Western Hemisphere Begomovirus Species with Complex Evolutionary Relationships Indicative of Recombination and Reassortment,” Phytopathology, vol. 94, pp. 1068-1074, 2004.

[275] M. A. Nour, and J. J. Nour, “Identification, Transmission and Host Range of Leaf Curl Infecting Cotton in Sudan,” Empire Cotton Growing Rev., vol. 41, pp. 27-37, 1964.

[276] A. M. Idris, R. W. Briddon, S. E. Bull, and J. K. Brown, “Cotton Leaf Curl Gezira Virus-Satellite DNAs Represent a Divergent, Geographically Isolated Nile Basin Lineage: Predictive Identification of a SatDNA Rep-Binding Motif,” Virus Res., vol. 109, pp. 19-32, 2005.

[277] A. M. Idris, and J. K. Brown, “Molecular Analysis of Cotton Leaf Curl Virus- Sudan Reveals an Evolutionary History of Recombination,” Virus Genes, vol. 24, pp. 249-256, 2002.

135

Chapter 6 References

[278] T. Hussain, and M. Ali, “A Review of Cotton Diseases of Pakistan,” Pakistan Cotton, vol. 19, pp. 71-86, 1975.

[279] T. Hussain, and T. Mahmood, “A Note on Leaf Curl Disease of Cotton,” The Pakistan Cottons, vol. 32, pp. 248-251, 1988.

[280] R. W. Briddon, and P. G. Markham, “Cotton Leaf Curl Virus Disease,” Virus Res., vol. 71, pp. 151-159, 2000.

[281] S. Mansoor, L. Amrao, I. Amin, R. W. Briddon, K. A. Malik, and Y. Zafar, “First Report of Cotton Leaf Curl Disease in Central and Southern Sindh Province in Pakistan,” Plant Dis., vol. 90, pp. 826, 2006.

[282] T. Mahmood, M. Arshad, M. I. Gill, and H. T. Mahmood, “Burewala Strain of Cotton Leaf Curl Virus: A Threat to CLCuV Cotton Resistant Varieties,” Asian J. Plant Sci., vol. 2, pp. 968-970, 2003.

[283] J. Kumar, S. Gunapati, S. Singh, A. Kumar, A. Lalit, N. Sharma, R. Puranik, and R. Tuli, “A New Betasatellite Associated with Cotton Leaf Curl Burewala Virus Infecting Tomato in India: Influence on Symptoms and Viral Accumulation,” Arch. Virol., vol. 158, pp. 1349-1353, 2013.

[284] I. Amin, S. Mansoor, L. Amrao, M. Hussain, S. Irum, Y. Zafar, S. E. Bull, and R. W. Briddon, “Mobilisation into Cotton and Spread of a Recombinant Cotton Leaf Curl Disease Satellite,” Arch. Virol., vol. 151, pp. 2055-2065, 2006.

[285] F. Akbar, R. W. Briddon, F. Vazquez, and M. Saeed, “Transcript Mapping of Cotton Leaf Curl Burewala Virus and Its Cognate Betasatellite, Cotton Leaf Curl Multan Betasatellite,” Virol. J., vol. 9, pp. 249, 2012.

[286] M. Mao, Z. He, H. Yu, and H. Li, “Molecular Characterization of Cotton Leaf Curl Multan Virus and Its Satellite DNA That Infects Hibiscus Rosa- Sinensis,” Chin. J. Virol., vol. 24, pp. 64-68, 2008.

[287] J. J. Doyle, and J. L. Doyle, “Isolation of Plant DNA from Fresh Tissue,” Focus, vol. 12, pp. 13-15, 1990.

136

Chapter 6 References

[288] J. Sambrook, E. F. Frisch, and T. Maniatis, Molecular Cloning: A Laboratory Manual, New York: Cold Spring Harbor Laboratory Press, 1989.

[289] H. C. Birnboim, and J. Doly, “A Rapid Alkaline Extraction Procedure for Screening Recombinant Plasmid DNA,” Nucleic Acids Res., vol. 7, pp. 1513- 1523, 1979.

[290] L. Amrao, “Characterization and Infectivity Analysis of Begomovirus Components Found in Cotton-Based Agro-Ecosystem,” School of Biotechnology, Quaid-i-Azam University, Islamabad, 2010.

[291] S. Mansoor, R. W. Briddon, S. E. Bull, I. D. Bedford, A. Bashir, M. Hussain, M. Saeed, M. Y. Zafar, K. A. Malik, C. Fauquet, and P. G. Markham, “Cotton Leaf Curl Disease Is Associated with Multiple Monopartite Begomoviruses Supported by Single DNA β,” Arch. Virol., vol. 148, pp. 1969-1986, 2003.

[292] M. Ilyas, I. Amin, S. Mansoor, R. W. Briddon, and M. Saeed, "Challenges for Transgenic Resistance against Geminiviruses," Emerging Geminiviral Diseases and Their Management, P. Sharma, R. K. Gaur and M. Ikegami, eds., pp. 1-35, New York: Nova Science Publishers Inc., 2010.

[293] M. Padidam, R. N. Beachy, and C. M. Fauquet, “Tomato Leaf Curl Geminivirus from India Has a Bipartite Genome and Coat Protein Is Not Essential for Infectivity,” J. Gen. Virol., vol. 76, pp. 25-35, 1995.

[294] R. B. Horsch, J. E. Fry, N. L. Hoffmann, D. Eichholtz, S. G. Rogers, and R. T. Fraley, “A Simple and General Method for Transferring Genes into Plants,” Science, vol. 227, pp. 1229-1231, 1985.

[295] J. A. Lindbo, L. Silva-Rosales, W. M. Proebsting, and W. G. Dougherty, “Lnduction of a Highly Specific Antiviral State in Transgenic Plants: Implications for Regulation of Gene Expression and Virus Resistance,” Plant Cell, vol. 5, pp. 1749-1759, 1993.

[296] S. N. Covey, N. S. Al-Kaff, A. Langara, and D. S. P. Turner, “Plants Combat Infection by Gene Silencing.,” Nature, vol. 385, pp. 781-782 1997.

137

Chapter 6 References

[297] F. Ratcliff, B. D. Harrison, and D. C. Baulcombe, “A Similarity between Viral Defense and Gene Silencing in Plants,” Science, vol. 276, pp. 1558-1560, 1997.

[298] H. Vanderschuren, M. Stupak, J. Fütterer, W. Gruissem, and P. Zhang, “Engineering Resistance to Geminiviruses - Review and Perspectives” Plant Biotechnol. J., vol. 5, pp. 207-220, 2007.

[299] Q. Haq, A. Ali, and V. Malathi, “Engineering Resistance against Mungbean Yellow Mosaic India Virus Using Antisense RNA,” Indian J. Virol., pp. 1-4, 2010.

[300] D. N. Shepherd, D. P. Martin, and J. A. Thomson, “Transgenic Strategies for Developing Crops Resistant to Geminiviruses,” Plant Sci., vol. 176, pp. 1-11, 2009.

[301] MAFBNZ report, “The Current Status of Commercialised Genetically Modified Crops. Newzealand,” 2007.

[302] D. Gonsalves, Gonsalves, C., Ferreira, S., Pitz, K., Fitch, M, Manshardt, R. and Slightom, J., “Transgenic Virus-Resistant Papaya: From Hope to Reality in Controlling Papaya Ringspot Virus in Hawaii,” APS Features., 2004.

[303] H. Vanderschuren, R. Akbergenov, M. Pooggin, T. Hohn, W. Gruissem, and P. Zhang, “Transgenic Cassava Resistance to African Cassava Mosaic Virus Is Enhanced by Viral DNA-a Bidirectional Promoter-Derived siRNA,” Plant Mol. Biol., vol. 64, pp. 549-557, 2007.

[304] A. A. Shetty, J. P. Singh, and D. Singh, “Resistance to Yellow Vein Mosaic Virus in Okra: A Review,” Biological Agriculture and Horticulture, vol. 29, pp. 159-164, 2013.

[305] F. J. L. Aragão, E. O. P. L. Nogueira, M. L. P. Tinoco, and J. C. Faria, “Molecular Characterization of the First Commercial Transgenic Common Bean Immune to the Bean Golden Mosaic Virus,” J. Biotechnol., vol. 166, pp. 42-50, 2013.

138

Chapter 6 References

[306] F. Aragão, and J. Faria, “First Transgenic Geminivirus-Resistant Plant in the Field: The Development of a RNAi-Based Agriculture Technology,” In Vitro Cell. Dev. Biol. Anim., vol. 46, pp. S5, 2010.

[307] F. J. L. Aragao, and J. C. Faria, “First Transgenic Geminivirus-Resistant Plant in the Field,” Nat. Biotechnol., vol. 27, pp. 1086-1088, 2009.

[308] J. Zhang, J. Dong, Y. Xu, and J. Wu, “V2 Protein Encoded by Tomato Yellow Leaf Curl China Virus Is an RNA Silencing Suppressor,” Virus Res., vol. 163, pp. 51-8, 2012.

[309] A. P. Luna, G. Morilla, O. Voinnet, and E. R. Bejarano, “Functional Analysis of Gene Silencing Suppressors from Tomato Yellow Leaf Curl Disease Viruses,” Mol. Plant-Microbe Interact., vol. 25, pp. 1294-1306, 2012.

[310] B. D. Harrison, “Advances in Geminivirus Research,” Ann. Rev. Phytopathol., vol. 23, pp. 55-82, 1985.

[311] R. V. Chowda-Reddy, W. Dong, C. Felton, D. Ryman, K. Ballard, and V. N. Fondong, “Characterization of the Cassava Geminivirus Transcription Activation Protein Putative Nuclear Localization Signal,” Virus Res., vol. 145, pp. 270-278, 2009.

[312] F. Guerineau, and P. Mullineaux, "Plant Transformation and Expression Vectors," Plant Molecular Biology Labfax, R. R. D. Croy, ed., pp. 121-147, Oxford: Bios Scientific Publishers, 1993.

[313] R. P. Hellens, E. A. Edwards, N. R. Leyland, S. Bean, and P. M. Mullineaux, “Pgreen: A Versatile and Flexible Binary Ti Vector for Agrobacterium- Mediated Plant Transformation,” Plant Mol. Biol., vol. 42, pp. 819-832, 2000.

[314] M. Pilartz, and H. Jeske, “Mapping of Abutilon Mosaic Geminivirus Minichromosomes,” J. Virol., vol. 77, pp. 10808-10818, 2003.

[315] P. V. Shivaprasad, R. Akbergenov, D. Trinks, R. Rajeswaran, K. Veluthambi, T. Hohn, and M. M. Pooggin, “Promoters, Transcripts, and Regulatory

139

Chapter 6 References

Proteins of Mungbean Yellow Mosaic Geminivirus,” J. Virol., vol. 79, pp. 8149-8163, 2005.

[316] B. A. M. Morris-Krsinich, P. M. Mullineaux, J. Donson, M. I. Boulton, P. G. Markham, M. N. Short, and J. W. Davies, “Bidirectional Transcription of Maize Streak Virus DNA and Identification of the Coat Protein,” Nucleic Acids Res., vol. 13, pp. 7237-7256, 1985.

[317] S. Frischmuth, T. Frischmuth, and H. Jeske, “Transcript Mapping of Abutilon Mosaic Virus, a Geminivirus,” Virology, vol. 11815, pp. 596-604, 1991.

[318] R. K. Yadav, and D. Chattopadhyay, “Enhanced Viral Intergenic Region Specific Sirna Accumulation and DNA Methylation Correlates with Resistance against a Geminivirus,” Mol. Plant-Microbe Interact., vol. 24, pp. 1189-97, Oct, 2011.

[319] B. Wang, F. Li, C. Huang, X. Yang, Y. Qian, Y. Xie, and X. Zhou, “V2 of Tomato Yellow Leaf Curl Virus Can Suppress Methylation-Mediated Plant Transcriptional Gene Silencing,” J. Gen. Virol., vol. 95, pp. 225-230, November 3, 2013, 2014.

[320] F. E. Vaistij, L. Jones, and D. C. Baulcombe, “Spreading of Rna Targeting and DNA Methylation in RNA Silencing Requires Transcription of the Target Gene and a Putative RNA-Dependent RNA Polymerase,” Plant Cell, vol. 14, pp. 857-867, 2002.

[321] C. Himber, P. Dunoyer, G. Moissiard, C. Ritzenthaler, and O. Voinnet, “Transitivity-Dependent and -Independent Cell-to-Cell Movement of RNA Silencing,” EMBO J., vol. 22, pp. 4523-4533, 2003.

[322] H. Vogler, M.-O. Kwon, V. Dang, A. Sambade, M. Fasler, J. Ashby, and M. Heinlein, “Tobacco Mosaic Virus Movement Protein Enhances the Spread of RNA Silencing,” PLoS Pathog., vol. 4, pp. e1000038, 2008.

[323] M. Fojtova, H. V. Houdt, A. Depicker, and A. Kovarik, “Epigenetic Switch from Posttranscriptional to Transcriptional Silencing Is Correlated with Promoter Hypermethylation.,” Plant Physiol., vol. 133, pp. 1240-1250, 2003.

140

Chapter 6 References

[324] F. Li, C. Huang, Z. Li, and X. Zhou, “Suppression of RNA Silencing by a Plant DNA Virus Satellite Requires a Host Calmodulin-Like Protein to Repress RDR6 Expression,” PLoS Pathogen, vol. 10, pp. e1003921, 2014.

[325] O. Voinnet, Y. M. Pinto, and D. C. Baulcombe, “Suppression of Gene Silencing: A General Strategy Used by Diverse DNA and RNA Viruses of Plants,” Proc. Natl. Acad. Sci. U.S.A., vol. 23, pp. 14147-14152, 1999.

[326] T. Sijen, and J. M. Kooter, “Post-Transcriptional Gene-Silencing: RNAs on the Attack or on the Defense?,” BioEssays, vol. 22, pp. 520-531,, 2000.

[327] E. Noris, A. Lucioli, R. Tavazza, P. Caciagli, G. P. Accotto, and M. Tavazza, “Tomato Yellow Leaf Curl Sardinia Virus Can Overcome Transgene-Mediated Rna Silencing of Two Essential Viral Genes,” J. Gen. Virol., vol. 85, pp. 1745-1749, 2004.

[328] M. Mubin, M. Hussain, R. W. Briddon, and S. Mansoor, “Selection of Target Sequences as Well as Sequence Identity Determine the Outcome of RNAi Approach for Resistance against Cotton Leaf Curl Geminivirus Complex,” Virol. J., vol. 8, pp. 122, 2011.

[329] P. Ranjan, A. K. Singh, R. V. Kumar, S. Basu, and S. Chakraborty, “Host- Specific Adaptation of Diverse Betasatellites Associated with Distinct Indian Tomato-Infecting Begomoviruses,” Virus Genes, pp. 1-9, 2014.

[330] L. Qing, and X. Zhou, “Trans-Replication of, and Competition between, DNA β Satellites in Plants Inoculated with Tomato Yellow Leaf Curl China Virus and Tobacco Curly Shoot Virus,” Phytopathology, vol. 99, pp. 716-720, 2009.

[331] K. Saunders, R. W. Briddon, and J. Stanley, “Replication Promiscuity of DNA-β Satellites Associated with Monopartite Begomoviruses; Deletion Mutagenesis of the Ageratum Yellow Vein Virus DNA-β Satellite Localises Sequences Involved in Replication,” J. Gen. Virol., vol. 89, pp. 3165-3172, 2008.

[332] M. M. Pooggin, R. Rajeswaran, M. V. Schepetilnikov, and L. A. Ryabova, “Short ORF-Dependent Ribosome Shunting Operates in an RNA PicoRNA-

141

Chapter 6 References

Like Virus and a DNA Pararetrovirus That Cause Rice Tungro Disease,” PLoS Pathog., vol. 8, pp. e1002568, 2012.

[333] R. van Wezel, H. Liu, Z. Wu, J. Stanley, and Y. Hong, “Contribution of the Zinc Finger to Zinc and DNA Binding by a Suppressor of Posttranscriptional Gene Silencing,” J. Virol., vol. 77, pp. 696-700, 2003.

[334] I. Amin, M. Ilyas, J. Qazi, R. Bashir, J. S. Yadav, S. Mansoor, C. M. Fauquet, and R. W. Briddon, “Identification of a Major Pathogenicity Determinant and Suppressors of RNA Silencing Encoded by a South Pacific Isolate of Banana Bunchy Top Virus Originating from Pakistan,” Virus Genes, vol. 42, pp. 272- 281, 2011.

[335] R. Vanitharani, P. Chellappan, J. S. Pita, and C. M. Fauquet, “Differential Roles of AC2 and AC4 of Cassava Geminiviruses in Mediating Synergism and Suppression of Posttranscriptional Gene Silencing,” J. Virol., vol. 78, pp. 9487-9498, 2004.

[336] A. Soitamo, B. Jada, and K. Lehto, “Expression of Geminiviral AC2 RNA Silencing Suppressor Changes Sugar and Jasmonate Responsive Gene Expression in Transgenic Tobacco Plants,” BMC Plant Biol., vol. 12, pp. 204, 2012.

[337] L. Hao, H. Wang, G. Sunter, and D. M. Bisaro, “Geminivirus AL2 and L2 Proteins Interact with and Inactivate SNF1 Kinase,” Plant Cell, vol. 15, pp. 1034-1048, 2003.

[338] H. Wang, K. J. Buckley, X. Yang, R. C. Buchmann, and D. M. Bisaro, “Adenosine Kinase Inhibition and Suppression of RNA Silencing by Geminivirus AL2 and L2 Proteins,” J. Virol., vol. 79, pp. 7410-7418, 2005.

[339] T. Maruta, M. Noshi, A. Tanouchi, M. Tamoi, Y. Yabuta, K. Yoshimura, T. Ishikawa, and S. Shigeoka, “H2O2-Triggered Retrograde Signaling from Chloroplasts to Nucleus Plays a Specific Role in the Response to Stress,” J. Biol. Chem., 2012.

142

Chapter 6 References

[340] V. Zaffalon, S. Mukherjee, V. Reddy, J. Thompson, and M. Tepfer, “A Survey of Geminiviruses and Associated Satellite DNAs in the Cotton-Growing Areas of Northwestern India,” Arch. Virol., vol. 157, pp. 483-95, 2011.

[341] D. C. Baulcombe, “Rna as a Target and an Initiator of Post-Transcriptional Gene Silencing in Trangenic Plants,” Plant Mol. Biol., vol. 32, pp. 79-88, 1996.

[342] C. Napoli, C. Lemieux, and R. Jorgensen, “Introduction of a Chimeric Chalcone Synthase Gene into Petunia Results in Reversible Co-Suppression of Homologous Genes in Trans,” Plant Cell, vol. 2, pp. 279-289, 1990.

[343] P. Chellappan, R. Vanitharani, and C. M. Fauquet, “Short Interfering RNA Accumulation Correlates with Host Recovery in DNA Virus-Infected Hosts, and Gene Silencing Targets Specific Viral Sequences,” J. Virol., vol. 78, pp. 7465-7477, 2004.

[344] C. Hagen, M. R. Rojas, T. Kon, and R. L. Gilbertson, “Recovery from Cucurbit Leaf Crumple Virus (Family Geminiviridae, Genus Begomovirus) Infection Is an Adaptive Antiviral Response Associated with Changes in Viral Small Rnas,” Phytopathology, vol. 98, pp. 1029-1037, 2008.

[345] X. Yang, Y. Wang, W. Guo, Y. Xie, Q. Xie, L. Fan, and X. Zhou, “Characterization of Small Interfering RNAs Derived from the Geminivirus/Betasatellite Complex Using Deep Sequencing,” PLoS ONE, vol. 6, pp. e16928, 2011.

[346] T. A. Bozorov, P. P. Shree, S. T. Dinh, S.-G. Kim, M. Heinrich, K. Gase, and I. T. Baldwin, “Dicer-Like Proteins and Their Role in Plant-Herbivore Interactions in Nicotiana Attenuata,” Journal of Integrative Plant Biology, vol. 54, pp. 189-206, 2012.

[347] C. Y. Lin, W. S. Tsai, H. M. Ku, and F. J. Jan, “Evaluation of DNA Fragments Covering the Entire Genome of a Monopartite Begomovirus for Induction of Viral Resistance in Transgenic Plants Via Gene Silencing,” Transgenic Res., vol. 21, pp. 231-241, 2012.

143

Chapter 6 References

[348] P. Dunoyer, C. Himber, and O. Voinnet, “Dicer-Like 4 Is Required for RNA Interference and Produces the 21-Nucleotide Small Interfering RNA Component of the Plant Cell-to-Cell Silencing Signal,” Nature Genet., vol. 37, pp. 1356-1360., 2005.

[349] S. Mlotshwa, G. J. Pruss, A. Peragine, M. W. Endres, J. Li, X. Chen, R. S. Poethig, L. H. Bowman, and V. Vance, “Dicer-Like2 Plays a Primary Role in Transitive Silencing of Transgenes in Arabidopsis,” PLoS ONE, vol. 3, pp. e1755, 2008.

[350] T. Blevins, R. Rajeswaran, P. V. Shivaprasad, D. Beknazariants, A. Si- Ammour, H.-S. Park, F. Vazquez, D. Robertson, F. Meins, Jr., T. Hohn, and M. M. Pooggin, “Four Plant Dicers Mediate Viral Small RNA Biogenesis and DNA Virus Induced Silencing,” Nucleic Acids Res., vol. 34, pp. 6233-46, 2006.

[351] D. J. Obbard, K. H. J. Gordon, A. H. Buck, and F. M. Jiggins, “The Evolution of RNAi as a Defence against Viruses and Transposable Elements,” Philos. Trans. R. Soc. Lond. B. Biol. Sci., vol. 364, pp. 99-115, 2009.

[352] K. Mukherjee, H. Campos, and B. Kolaczkowski, “Evolution of Animal and Plant Dicers: Early Parallel Duplications and Recurrent Adaptation of Antiviral RNA Binding in Plants,” Molecular Biology and Evolution, 2012.

[353] A. Verdel, S. Jia, S. Gerber, T. Sugiyama, S. Gygi, S. I. S. Grewal, and D. Moazed, “RNAi-Mediated Targeting of Heterochromatin by the RITS Complex,” Science, vol. 303, pp. 672-676, 2004.

[354] P. Brodersen, L. Sakvarelidze-Achard, M. Bruun-Rasmussen, P. Dunoyer, Y. Y. Yamamoto, L. Sieburth, and O. Voinnet, “Widespread Translational Inhibition by Plant MiRNAs and siRNAs,” Science, vol. 320, pp. 1185-1190, 2008.

[355] R. W. Briddon, “Cotton Leaf Curl Disease, a Multicomponent Begomovirus Complex,” Mol. Plant Pathol., vol. 4, pp. 427–434, 2003.

144

Chapter 6 References

[356] A. Kumar, S.K. Snehi, S.K. Raj, J. Kumar and J.A. Khan, “Association of Cotton Leaf Curl Burewala Virus and Its Satellite Molecules with Leaf Distortion Symptoms of Cotton in India,” New Disease Reports, vol. 24, pp. 18, 2011.

[357] Q. W. Niu, S. S. Lin, J. L. Reyes, K. C. Chen, H. W. Wu, S. D. Yeh, and N. H. Chua, “Expression of Artificial MicroRNAs in Transgenic Arabidopsis Thaliana Confers Virus Resistance,” Nat. Biotechnol., vol. 24, pp. 1420-1428, 2006.

[358] Y. J. Kung, S. S. Lin, Y. L. Huang, T. C. Chen, S. S. Harish, N. H. Chua, and S. D. Yeh, “Multiple Artificial MicroRNAs Targeting Conserved Motifs of the Replicase Gene Confer Robust Transgenic Resistance to Negative-Sense Single-Stranded RNA Plant Virus,” Mol. Plant Pathol., vol. 13, pp. 303-17, 2012.

[359] X. Zhang, H. Li, J. Zhang, C. Zhang, P. Gong, K. Ziaf, F. Xiao, and Z. Ye, “Expression of Artificial Micrornas in Tomato Confers Efficient and Stable Virus Resistance in a Cell-Autonomous Manner,” Transgenic Res., pp. 1-13, 2010.

[360] T. Ai, L. Zhang, Z. Gao, C. X. Zhu, and X. Guo, “Highly Efficient Virus Resistance Mediated by Artificial MicroRNAs That Target the Suppressor of Pvx and Pvy in Plants,” Plant Biology, vol. 13, pp. 304-316, 2011.

[361] T. V. Vu, N R Choudhury, S K Mukherjee, “Transgenic Tomato Plants Expressing Artificial Micrornas for Silencing the Pre-Coat and Coat Proteins of a Begomovirus, Tomato Leaf Curl New Delhi Virus, Show Tolerance to Virus Infection.,” Virus Res., vol. 172, pp. 35-45, 2013.

[362] B. Zhang, Q. Wang, K. Wang, X. Pan, F. Liu, T. Guo, G. P. Cobb, and T. A. Anderson, “Identification of Cotton MicroRNAs and Their Targets,” Gene, vol. 397, pp. 26-37, 2007.

145

Chapter 6 References

[363] F. Guerineau, A. Lucy, and P. Mullineaux, “Effect of Two Consensus Sequences Preceding the Translation Initiator Codon on Gene Expression in Plant Protoplasts,” Plant Mol. Biol., vol. 18, pp. 815-818, 1992.

[364] Y.-J. Kung, S.-S. Lin, Y.-L. Huang, T.-C. Chen, S. S. Harish, N.-H. Chua, and S.-D. Yeh, “Multiple Artificial Micrornas Targeting Conserved Motifs of the Replicase Gene Confer Robust Transgenic Resistance to Negative-Sense Single-Stranded RNA Plant Virus,” Mol. Plant Pathol., vol. 13, pp. 303-317, 2011.

[365] S. M. Hammond, A. A. Caudy, and G. J. Hannon, “Post-Transcriptional Gene Silencing by Double-Stranded RNA,” Nat. Rev. Genet., vol. 2, pp. 110-9, Feb, 2001.

[366] H. Zhu, F. Hu, R. Wang, X. Zhou, S.-H. Sze, Lisa W. Liou, A. Barefoot, M. Dickman, and X. Zhang, “Arabidopsis Argonaute10 Specifically Sequesters Mir166/165 to Regulate Shoot Apical Meristem Development,” Cell, vol. 145, pp. 242-256, 2011.

[367] M. Prins, M. Laimer, E. Noris, J. Schubert, M. Wassenegger, and M. Tepfer, “Strategies for Antiviral Resistance in Transgenic Plants,” Mol. Plant Pathol., vol. 9, pp. 73-83, 2008.

[368] J. E. Rigden, I. B. Dry, P. M. Mullineaux, and M. A. Rezaian, “Mutagenesis of the Virion-Sense Open Reading Frames of Tomato Leaf Curl Virus,” Virology, vol. 193, pp. 1001-1005, 1993.

[369] L. Wartig, A. Kheyr-Pour, E. Noris, F. de Kouchovsky, F. Jouanneau, B. Gronenborn, and I. Jupin, “Genetic Analysis of the Monopartite Tomato Yellow Leaf Curl Geminivirus: Roles of V1,V2, and C2 ORFs in Viral Pathogenesis,” Virology, vol. 228, pp. 132-140, 1997.

[370] T. Zhao, W. Wang, X. Bai, and Y. Qi, “Gene Silencing by Artificial MicroRNAs in Chlamydomonas,” Plant J., vol. 58, pp. 157-64, Apr, 2009.

[371] E. Pascal, A. A. Sanderfoot, B. M. Ward, R. Medville, R. Turgeon, and S. G. Lazarowitz, “The Geminivirus Br1 Movement Protein Binds Single-Stranded

146

Chapter 6 References

DNA and Localizes to the Cell Nucleus,” Plant Cell, vol. 6, pp. 995-1006, 1994.

[372] A. A. Sanderfoot, and S. G. Lazarowitz, “Cooperation in Viral Movement: The Geminivirus BL1 Movement Protein Interacts with BR1 and Redirects It from the Nucleus to the Periphery,” Plant Cell, vol. 7, pp. 1185-1194, 1995.

[373] X.-Y. Bian, M. S. Rasheed, M. J. Seemanpillai, and M. A. Rezaian, “Analysis of Silencing Escape of Tomato Leaf Curl Virus: An Evaluation of the Role of DNA Methylation,” Molcular Plant-Microbe Interactions, vol. 19, pp. 614- 624, 2006.

[374] A. Bleys, L. Vermeersch, H. Van Houdt, and A. Depicker, “The Frequency and Efficiency of Endogene Suppression by Transitive Silencing Signals Is Influenced by the Length of Sequence Homology,” Plant Physiol, vol. 142, pp. 788-96, Oct, 2006.

[375] R. W. Briddon, S. Mansoor, I. D. Bedford, M. S. Pinner, K. Saunders, J. Stanley, Y. Zafar, K. A. Malik, and P. G. Markham, “Identification of DNA Components Required for Induction of Cotton Leaf Curl Disease,” Virology, vol. 285, pp. 234-243, 2001.

[376] K. Saunders, A. Norman, S. Gucciardo, and J. Stanley, “The DNA β Satellite Component Associated with Ageratum Yellow Vein Disease Encodes an Essential Pathogenicity Protein (ΒC1),” Virology, vol. 324, pp. 37-47, 2004.

[377] K. Bonfim, J. C. Faria, E. O. P. L. Nogueira, E. A. Mendes, and F. J. L. Aragao, “RNAi-Mediated Resistance to Bean Golden Mosaic Virus in Genetically Engineered Common Bean (Phaseolus Vulgaris),” Mol. Plant- Microbe Interact., vol. 20, pp. 717-726, 2007.

[378] S. García-Andrés, D. M. Tomás, J. Navas-Castillo, and E. Moriones, “Resistance-Driven Selection of Begomoviruses Associated with the Tomato Yellow Leaf Curl Disease,” Virus Res., vol. 146, pp. 66-72, 2009.

[379] B. D. Harrison, “Virus Variation in Relation to Resistance-Breaking in Plants,” Euphytica, vol. 124, pp. 181-192, 2002.

147

Chapter 6 References

[380] X. Zhou, Y. Liu, L. Calvert, C. Munoz, G. W. Otim-Nape, D. J. Robinson, and B. D. Harrison, “Evidence That DNA a of a Geminivirus Associated with Severe Cassava Mosaic Disease in Uganda Has Arisen by Interspecific Recombination,” J. Gen. Virol., vol. 78, pp. 2101-2111, 1997.

[381] J. Farooq, A. Farooq, M. Riaz, M. R. Shahid, F. Saeed, M. S. Iqbal, T. Hussain, A. Batool, and A. Mahmood, “Cotton Leaf Curl Virus Disease a Principle Cause of Decline in Cotton Productivity in Pakistan (a Mini Review),” Canad. J. Plant Protect., vol. 2, pp. 9-16, 2014.

[382] H. Vanderschuren, I. Moreno, R. B. Anjanappa, I. M. Zainuddin, and W. Gruissem, “Exploiting the Combination of Natural and Genetically Engineered Resistance to Cassava Mosaic and Cassava Brown Streak Viruses Impacting Cassava Production in Africa,” PLoS ONE, vol. 7, pp. e45277, 2012.

[383] A. Lucioli, D. E. Sallustio, D. Barboni, A. Berardi, V. Papacchioli, R. Tavazza, and M. Tavazza, “A Cautionary Note on Pathogen-Derived Sequences,” Nat. Biotechnol., vol. 26, pp. 617-619, 2008.

[384] C.-Y. Lin, H.-M. Ku, W.-S. Tsai, S. Green, and F.-J. Jan, “Resistance to a DNA and a RNA Virus in Transgenic Plants by Using a Single Chimeric Transgene Construct,” Transgenic Res., vol. 20, pp. 261-270, 2011.

[385] R. V. Chowda-Reddy, F. Achenjang, C. Felton, M. T. Etarock, M.-T. Anangfac, P. Nugent, and V. N. Fondong, “Role of a Geminivirus AV2 Protein Putative Protein Kinase C Motif on Subcellular Localization and Pathogenicity,” Virus Res., vol. 135, pp. 115-124, 2008. [386] M. R. Sudarshana, H. L. Wang, W. J. Lucas, and R. L. Gilbertson, “Dynamics of Bean Dwarf Mosaic Geminivirus Cell-to-Cell and Long-Distance Movement in Phaseolus Vulgaris Revealed, Using the Green Fluorescent Protein,” Mol. Plant-Microbe Interact., vol. 11, pp. 277-291, 1998. [387] L. J. Kong, B. M. Orozco, J. L. Roe, S. Nagar, S. Ou, H. S. Feiler, T. Durfee, A. B. Miller, W. Gruissem, D. Robertson, and L. Hanley-Bowdoin, “A Geminivirus Replication Protein Interacts with the Retinoblastoma Protein

148

Chapter 6 References

through a Novel Domain to Determine Symptoms and Tissue Specificity of Infection in Plants,” EMBO J., vol. 19, pp. 3485-3495, 2000. [388] L. A. Selth, S. C. Dogra, M. S. Rasheed, H. Healy, J. W. Randles, and M. A. Rezaian, “A NAC Domain Protein Interacts with Tomato Leaf Curl Virus Replication Accessory Protein and Enhances Viral Replication,” Plant Cell, vol. 17, pp. 311-325, 2005. [389] H. Vaucheret, F. Vazquez, P. Crete, and D. P. Bartel, “The Action of Argonaute1 in the MiRNA Pathway and Its Regulation by the MiRNA Pathway Are Crucial for Plant Development,” Genes Dev., vol. 18, pp. 1187-1197, May 15, 2004, 2004.

149