DOCSLIB.ORG

Corynebacterium Striatum Strains

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Corynebacterium Striatum Strains nylacetic acid assimilation (2); it was reconfi rmed by se- Clonal quencing the internal fragment of the 16S rRNA gene (3). The American Type Culture Collection (ATCC) 6940 C. Multidrug-Resistant striatum strain was included as phenotypic and molecular control. All strains were stored at –80°C until use. Corynebacterium MICs were determined by using microdilution in cation-adjusted Mueller-Hinton broth in accordance with striatum Strains, guidelines of the Clinical and Laboratory Standards Insti- Italy tute (CLSI) (4). The following antimicrobial drugs were tested: tigecycline and piperacillin/tazobactam, oxacillin, Floriana Campanile, Edoardo Carretto, gentamicin, kanamycin, levofl oxacin, erythromycin, clin- Daniela Barbarini, Annalisa Grigis, damycin, piperacillin, vancomycin, teicoplanin, tetracy- Marco Falcone, Antonio Goglio, Mario Venditti, cline, moxifl oxacin, imipenem, meropenem, quinupristin/ and Stefania Stefani dalfopristin, linezolid, and daptomycin. Etest strips (AB- BIODISK, Solna, Sweden) were used for vancomycin, We assessed the clinical relevance and performed teicoplanin, linezolid, and daptomycin. Daptomycin Etests molecular characterization of 36 multidrug-resistant strains of Corynebacterium striatum. Pulsed-fi eld gel electropho- were performed by using Muller-Hinton agar (Oxoid, Mi- resis confi rmed a single clone, possessing erm(X), tetA/B, lan, Italy), supplemented to a fi nal concentration of 50 cmxA/B, and aphA1 genes, but few related subclones. This mg/L calcium. strain is emerging as a pathogen in Italy. In the absence of approved breakpoints for Coryne- bacterium spp., we used those for α-hemolytic streptococci of the viridans group. Results were read after incubation solation of Corynebacterium spp. as the only organism at 37°C for 18–24 h. Susceptibility to daptomycin was Ifrom clinical specimens from patients, mostly with vary- defi ned as MIC <1 mg/L (5); CLSI guideline MIC break- ing degrees of immunocompromisation and severe infec- points were used for all other drugs tested (4). tions, is increasing in Italy. Therefore, we evaluated the To further characterize the C. striatum isolates, we used microbiologic characteristics, resistance profi les, and simi- 2 DNA fi ngerprinting techniques: automated ribotyping larities among genomes of multidrug-resistant (MDR) C. (RiboPrinter Microbial Characterization System; DuPont striatum strains. Qualicon, Wilmington, DE, USA) with EcoRI as restric- tion enzyme and pulsed-fi eld gel electrophoresis (PFGE) The Study macrorestriction analysis with 2 enzymes (XbaI and SwaI; We evaluated 36 strains of MDR C. striatum, isolat- New England Biolabs, Beverly, MA, USA). We had used ed from 3 hospitals in Italy during 2005–2007. Fourteen 4 enzymes (XbaI, SwaI, Sfi I, and PacI) to test 10 random strains were from bronchoalveolar lavage (BAL) fl uid, 3 strains, but because XbaI and SwaI enzyme-restriction pat- from blood, 7 from central venous catheter tips, 5 from tra- terns gave a better resolution for low and high molecular cheal aspirates, 4 from wound specimens, 1 from BAL and weight fragments, respectively, we used only these 2 re- pleural fl uid, 1 from urine, and 1 from a lung biopsy speci- striction enzymes to type all 36 strains. men. To assess the clinical relevance of these strains, we Whole genomic DNA chromosomal extraction, mac- used the Centers for Disease Control and Prevention 2004 rorestriction digestion, and PFGE (CHEF-DR II apparatus; defi nition for nosocomial infections (www.cdc.gov/ncidod/ Bio-Rad, Hercules, CA, USA) were performed as previous- dhqp/nnis_pubs.html) (1) and tracked antimicrobial drug– ly reported (6). Macrorestriction fragments were separated resistance determinants. on 1% (wt/vol) ultrapure agarose gels (Sigma Aldrich, St. We identifi ed all strains as putative C. striatum by us- Louis, MO, USA) at 6 V/cm, for 21 h at 14°C with pulse ing the commercial system API 20 Coryne (bioMérieux, times of 0.1–5 s, to separate XbaI fragments, and for 23 Marcy l’Etoile, France). C. striatum was differentiated h with pulse times of 1–70 s, to separate SwaI fragments. from C. amycolatum by supplementary tests, i.e., tyrosine Lambda DNA concatemers (New England BioLabs) were hydrolysis, N-acetylglucosamine assimilation, and phe- used as molecular size markers. Similarities among mac- Author affi liations: University of Catania, Catania, Italy (F. Campa- rorestriction patterns were identifi ed according to estab- nile, S. Stefani); Policlinico “San Matteo,” Pavia, Italy (E. Carretto, lished criteria (7). D. Barbarini); Ospedali Riuniti, Bergamo, Italy (A. Grigis, A. Goglio); The sequence of pTP10 (GenBank accession no. and University Roma La Sapienza, Rome, Italy (M. Falcone, M. AF024666) (8) was used to design the primers for erm(X), Venditti) tetA and tetB, cmx, aphA1, and repB genes. The VectorN- DOI: 10.3201/eid1501.080804 TI program (Invitrogen, www.invitrogen.com) was used Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 15, No. 1, January 2009 75 DISPATCHES for this purpose. The presence of pTP10 was confi rmed Analyses of SwaI digestion patterns showed that of the fi rst by amplifi cation and sequencing of the resistance 36 strains, only 1 clone had 3 different subtypes (30 strains determinants and the replication gene (repB) and then by subtype a1, 4 strains a2, and 2 strains a3). Macrorestriction XbaI and SwaI PFGE hybridizations, performed with the analysis with XbaI showed almost comparable results (27 specifi c probes (erm(X), tetAB, cmx, and aphA1), follow- strains A1, 7 strains A2, and 2 strains A3) (Figure). This ing a protocol previously described (9). The PCR amplifi - genotyping method and the enzymes used were defi ned as cations were performed in a Techne TC412 thermal cycler appropriate, comparing PFGE patterns of our clinical iso- (Barloworld Scientifi c, Staffordshire, UK). All primers and lates with C. striatum ATCC 6940 type strain, which was the related probe regions used in hybridization experiments different with respect to the epidemic strains. This result are shown in Table 1. demonstrates that single MDR C. striatum clones had been All C. striatum isolates were recovered from hospital- selected and were circulating in the 3 hospitals. ized patients who had undergone surgery or been admitted Further, the molecular characterization of some of to intensive care units (Table 2). We documented 19 cases the resistance genes in the 36 C. striatum isolates demon- of infections and discarded 17 as contaminants. The isolates strated the presence of erm(X), codifying for the resistance that were considered causes of infections were responsible to erythromycin and clindamycin; tetA, and tetB, codify- for 8 cases of ventilator-associated pneumonia (including 1 ing for the resistance to tetracycline, oxytetracycline, and with associated pleural empyema), 2 cases of pneumonia, 1 oxacillin; and cmx and aphA1, responsible for resistance case of catheter-related sepsis, 2 cases of ventilator-associ- to aminoglycosides and chloramphenicol, respectively. ated tracheobronchitis, and 6 cases of wound infections. The presence of pTP10 carrying all these determinants was The 36 strains showed an MDR phenotype, including confi rmed by amplifi cation and sequencing of these genes resistance to >3 classes of drugs; MICs required to inhibit and the replication gene of the plasmid, together with hy- growth of 90% (MIC90) were penicillins >256 mg/L, car- bridization experiments demonstrating that all resistance bapenems >256 mg/L, gentamicin 32 mg/L, levofl oxacin determinants were localized in the same hybridization 256 mg/L, tetracycline >256 mg/L, lincosamides >256 band generated by each probe onto PFGEXbaI (≈15 kb) and mg/L, and erythromycin 32 mg/L. C. striatum strains were PFGESwaI (≈280 kb) membranes (Figure). susceptible to only the most recent drugs used for treatment of infections with gram-positive organisms, such as glyco- Conclusions peptides and tigecycline (MIC90 1 mg/L), quinupristin/dal- We report isolation of MDR C. striatum from clini- fopristin and daptomycin (MIC90 0.25 mg/L), and linezolid cal specimens responsible for cases of pneumonia, cath- (MIC90 2 mg/L). A discrepancy was found when suscepti- eter-related bacteremia, and wound infections. Infections bility testing using a disk-diffusion method was performed sustained from this species are strongly associated with on different strains; the inhibition zone of erythromycin devices, not only tubes or catheters (91%) but also sternal was always in the intermediate range, even if MICs for this surgical wound wires. drug were in the low-resistance range. The MDR phenotype of these strains was immediately Ribotyping gave a unique profi le for all strains in observed and was responsible for the alarm that led to the this study. PFGE enabled us to discriminate the right subsequent in-depth examination of these strains. Their number of macrorestriction fragments (5,10,11) for pat- clonal nature, as demonstrated in our study, is of particu- tern comparison. lar concern. Further, the MDR phenotype correlated to the Table 1. Primer conditions, PCR products, and related sequences confirmed by BLAST analysis of 36 strains of multidrug-resistant Corynebacterium striatum, Italy, 2005–2007* Temperature, BLAST from–to, Primer Related resistance Sequence (5ƍ o 3ƍ) °C Size, bp bp ermX up Erythromycin and AACCATGATTGTGTTTCTGAACG 57 566 2,285–2,850 ermX down clindamycin ACCAGGAAGCGGTGCCCT tetA up Tetracycline, oxytetracycline, TTAGCGTTCGGCGACCTGG 58 1,829 5,496–7,324 tetB down and oxacillin AACTGGGTGCCTTCAGGGTC
Load more

Recommended publications
  • ID 2 | Issue No: 4.1 | Issue Date: 29.10.14 | Page: 1 of 24 © Crown Copyright 2014 Identification of Corynebacterium Species
    UK Standards for Microbiology Investigations Identification of Corynebacterium species Issued by the Standards Unit, Microbiology Services, PHE Bacteriology – Identification | ID 2 | Issue no: 4.1 | Issue date: 29.10.14 | Page: 1 of 24 © Crown copyright 2014 Identification of Corynebacterium species Acknowledgments UK Standards for Microbiology Investigations (SMIs) are developed under the auspices of Public Health England (PHE) working in partnership with the National Health Service (NHS), Public Health Wales and with the professional organisations whose logos are displayed below and listed on the website https://www.gov.uk/uk- standards-for-microbiology-investigations-smi-quality-and-consistency-in-clinical- laboratories. SMIs are developed, reviewed and revised by various working groups which are overseen by a steering committee (see https://www.gov.uk/government/groups/standards-for-microbiology-investigations- steering-committee). The contributions of many individuals in clinical, specialist and reference laboratories who have provided information and comments during the development of this document are acknowledged. We are grateful to the Medical Editors for editing the medical content. For further information please contact us at: Standards Unit Microbiology Services Public Health England 61 Colindale Avenue London NW9 5EQ E-mail: [email protected] Website: https://www.gov.uk/uk-standards-for-microbiology-investigations-smi-quality- and-consistency-in-clinical-laboratories UK Standards for Microbiology Investigations are produced in association with: Logos correct at time of publishing. Bacteriology – Identification | ID 2 | Issue no: 4.1 | Issue date: 29.10.14 | Page: 2 of 24 UK Standards for Microbiology Investigations | Issued by the Standards Unit, Public Health England Identification of Corynebacterium species Contents ACKNOWLEDGMENTS .........................................................................................................
    [Show full text]
  • Corynebacterium Species Rarely Cause Orthopedic Infections
    Zurich Open Repository and Archive University of Zurich Main Library Strickhofstrasse 39 CH-8057 Zurich www.zora.uzh.ch Year: 2018 Corynebacterium species rarely cause orthopedic infections Kalt, Fabian ; Schulthess, Bettina ; Sidler, Fabian ; Herren, Sebastian ; Fucentese, Sandro F ; Zingg, Patrick O ; Berli, Martin ; Zinkernagel, Annelies S ; Zbinden, Reinhard ; Achermann, Yvonne Abstract: Corynebacterium spp. are rarely considered as pathogens but data in orthopedic infections are sparse. Therefore, we asked how often Corynebacterium spp. caused an infection in a defined cohort of orthopedic patients with a positive culture. In addition, we aimed to determine the species variety and susceptibility of isolated strains in regards to potential treatment strategies. Between 2006 and 2015, we retrospectively assessed all Corynebacterium sp. bone and joint cultures from an orthopedic ward. The isolates were considered as relevant indicating an infection if the same Corynebacterium sp. was present in at least two samples. We found 97 orthopedic cases with isolation of Corynebacterium spp. (128 positive samples), mainly Corynebacterium tuberculostearicum (n=26), Corynebacterium amycolatum (n=17), Corynebacterium striatum (n=13), and Corynebacterium afermentans (n=11). Compared to a cohort of positive blood cultures, we found significantly more C. striatum and C. tuberculostearicum but no C. jeikeium cases. Only 16 cases out 66 cases (24.2%) with an available diagnostic set of at least 2 samples had an infection. Antibiotic susceptibility testing (AST) of different antibiotics showed various susceptibility results except for vancomycin and linezolid with a 100% susceptibility rate. Rates of susceptibility of corynebacteria isolated from orthopedic samples and of isolates from blood cultures were comparable. In conclusion, our study results confirmed that Corynebacterium sp.
    [Show full text]
  • Corynebacterium Striatum: an Emerging Respiratory Pathogen
    Brief Original Article Corynebacterium striatum: an emerging respiratory pathogen Malini Shariff1, Aditi1, Kiran Beri1 1 Vallabhbhai Patel Chest Institute, University of Delhi, Delhi, India Abstract Introduction: Corynebacterium spp. are primarily considered normal flora and dismissed when isolated from clinical specimens. In recent years, Corynebacterium striatum has emerged as a multi-drug resistant human pathogen which can cause nosocomial outbreaks. The organism has infrequently been noted to cause respiratory infections. A retrospective study was conducted to identify the clinical and microbiological features of respiratory infection by Corynebacterium striatum. Methodology: C. striatum isolates from clinical and surveillance samples were tested for susceptibility to antimicrobials and typed by Random Amplification of Polymorphic DNA (RAPD). Clinical data was obtained through a retrospective review of records. Results: 15 isolates from clinical and surveillance samples of 11 hospitalised patients were included. The patients suffered from either an exacerbation of COPD (n = 9) or pneumonia (n = 2). The isolates were all multi-drug resistant. RAPD typing found no evidence of an outbreak/ transmission between patients. Conclusions: Corynebacterium spp. must be considered potential pathogens. Suspicious isolates should be identified to the species level since Corynebacterium striatum is often multi-drug resistant. Key words: Corynebacterium; diphtheroid; respiratory infection; MDR; RAPD. J Infect Dev Ctries 2018; 12(7):581-586. doi:10.3855/jidc.10406 (Received 28 March 2018 – Accepted 14 May 2018) Copyright © 2018 Shariff et al. This is an open-access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Introduction approved by the Institute Ethics Committee.
    [Show full text]
  • Evaluation Ofapi Coryne System for Identifying Coryneform Bacteria
    756 Y Clin Pathol 1994;47:756-759 Evaluation of API Coryne system for identifying coryneform bacteria J Clin Pathol: first published as 10.1136/jcp.47.8.756 on 1 August 1994. Downloaded from A Soto, J Zapardiel, F Soriano Abstract that are aerobe or facultatively aerobe, non- Aim-To identify rapidly and accurately spore forming organisms of the following gen- coryneform bacteria, using a commercial era: Corynebacterium, Listeria, Actinomyces, strip system. Arcanobacterium, Erysipelothrix, Oerskovia, Methods-Ninety eight strains of Cory- Brevibacterium and Rhodococcus. It also per- nebacterium species and 62 additional mits the identification of Gardnerella vaginalis strains belonging to genera Erysipelorix, which often has a diphtheroid appearance and Oerskovia, Rhodococcus, Actinomyces, a variable Gram stain. Archanobacterium, Gardnerella and We studied 160 organisms in total from dif- Listeria were studied. Bacteria were ferent species of the Corynebacterium genus, as identified using conventional biochemi- well as from other morphological related gen- cal tests and a commercial system (API- era or groups, some of them not included in Coryne, BioMerieux, France). Fresh rab- the API Coryne database. bit serum was added to fermentation tubes for Gardnerella vaginalis isolates. Results-One hundred and five out ofthe Methods 160 (65.7%) organisms studied were cor- The study was carried out on Gram positive rectly and completely identified by the bacilli belonging to the genera Coryne- API Coryne system. Thirty five (21.8%) bacterium, Erysipelothrix, Oerskovia, Rhodococcus, more were correctly identified with addi- Actinomyces, Arcanobacterium, Gardnerella and tional tests. Seventeen (10-6%) organisms Listeria included in the API Coryne database were not identified by the system and (table 1).
    [Show full text]
  • Antimicrobial Susceptibility and Characterization of Resistance Mechanisms of Corynebacterium Urealyticum Clinical Isolates
    antibiotics Article Antimicrobial Susceptibility and Characterization of Resistance Mechanisms of Corynebacterium urealyticum Clinical Isolates Itziar Chapartegui-González 1,2 , Marta Fernández-Martínez 2,3, Ana Rodríguez-Fernández 3, Danilo J. P. Rocha 4, Eric R. G. R. Aguiar 5 , Luis G. C. Pacheco 4, José Ramos-Vivas 2 , Jorge Calvo 2,3, Luis Martínez-Martínez 6,7,8 and Jesús Navas 1,2,* 1 Grupo BIOMEDAGE, Facultad de Medicina, Universidad de Cantabria, Herrera Oria 2, 39011 Santander, Spain; [email protected] 2 Instituto de Investigación Valdecilla (IDIVAL), Herrera Oria s/n, 39011 Santander, Spain; [email protected] (M.F.-M.); [email protected] (J.R.-V.); [email protected] (J.C.) 3 Servicio de Microbiología, Hospital Universitario Marqués de Valdecilla (HUMV), Av. Valdecilla, 25, 39008 Santander, Spain; [email protected] 4 Instituto de Ciências da Saúde, Universidade Federal da Bahia, Av. Reitor Miguel Calmon, s/n—Canela, Salvador 40231-300, Brasil; [email protected] (D.J.P.R.); [email protected] (L.G.C.P.) 5 Department of Biological Sciences, Center of Biotechnology and Genetics, State University of Santa Cruz (UESC), Ilhéus 45662-90, Brazil; [email protected] 6 Unidad de Gestión Clínica, Hospital Universitario Reina Sofía, Av. Menéndez Pidal, s/n, 14004 Córdoba, Spain; [email protected] 7 Departamento de Microbiología, Universidad de Córdoba, Campus Rabanales. Edif. Severo Ochoa (C6), 14071 Córdoba, Spain 8 Instituto Maimónides de Investigación Biomédica de Córdoba (IMIBIC), Av. Menéndez Pidal, s/n, 14004 Córdoba, Spain * Correspondence: [email protected]; Tel.: +34-616-317-932 Received: 8 June 2020; Accepted: 10 July 2020; Published: 13 July 2020 Abstract: Corynebacterium urealyticum is a non-diphtherial urease-producing clinically relevant corynebacterial, most frequently involved in urinary tract infections.
    [Show full text]
  • Aerobic Gram-Positive Bacteria
    Aerobic Gram-Positive Bacteria Abiotrophia defectiva Corynebacterium xerosisB Micrococcus lylaeB Staphylococcus warneri Aerococcus sanguinicolaB Dermabacter hominisB Pediococcus acidilactici Staphylococcus xylosusB Aerococcus urinaeB Dermacoccus nishinomiyaensisB Pediococcus pentosaceusB Streptococcus agalactiae Aerococcus viridans Enterococcus avium Rothia dentocariosaB Streptococcus anginosus Alloiococcus otitisB Enterococcus casseliflavus Rothia mucilaginosa Streptococcus canisB Arthrobacter cumminsiiB Enterococcus durans Rothia aeriaB Streptococcus equiB Brevibacterium caseiB Enterococcus faecalis Staphylococcus auricularisB Streptococcus constellatus Corynebacterium accolensB Enterococcus faecium Staphylococcus aureus Streptococcus dysgalactiaeB Corynebacterium afermentans groupB Enterococcus gallinarum Staphylococcus capitis Streptococcus dysgalactiae ssp dysgalactiaeV Corynebacterium amycolatumB Enterococcus hiraeB Staphylococcus capraeB Streptococcus dysgalactiae spp equisimilisV Corynebacterium aurimucosum groupB Enterococcus mundtiiB Staphylococcus carnosusB Streptococcus gallolyticus ssp gallolyticusV Corynebacterium bovisB Enterococcus raffinosusB Staphylococcus cohniiB Streptococcus gallolyticusB Corynebacterium coyleaeB Facklamia hominisB Staphylococcus cohnii ssp cohniiV Streptococcus gordoniiB Corynebacterium diphtheriaeB Gardnerella vaginalis Staphylococcus cohnii ssp urealyticusV Streptococcus infantarius ssp coli (Str.lutetiensis)V Corynebacterium freneyiB Gemella haemolysans Staphylococcus delphiniB Streptococcus infantarius
    [Show full text]
  • Author Section
    AUTHOR SECTION patients with new onset of fever, demographic, clinical, and laborato- Mycoplasma spp. Overall, the spectrum of antibacterial activity indi- ry variables were obtained during the 2 days after inclusion, while cates a potential role for this combination in the treatment of diffi- microbiological results for a follow-up period of 7 days were collect- cult-to-treat Gram-positive infections, including those caused by ed. Patients were followed up for survival or death, up to a maximum multidrug-resistant organisms. Since this activity extends to Gram- of 28 days after inclusion. MEASUREMENTS AND RESULTS: Of negative respiratory bacteria, quinupristin/dalfopristin may also find all patients, 95% had SIRS, 44% had sepsis with a microbiologically a role in the treatment of atypical, as well as typical, pneumonia. confirmed infection, and 9% died. A model with a set of variables all significantly (p<0.01) contributing to the prediction of mortality was Boubaker A. et al. [Investigation of the urinary tract in children in nuclear med- derived.The set included the presence of hospital-acquired fever, the icine]. Rev Med Suisse Romande. 2000; 120(3) : 251-7.p Abstract: peak respiratory rate, the nadir score on the Glasgow coma scale, and The early detection of urologic abnormalities by antenatal sonogra- the nadir albumin plasma level within the first 2 days after inclusion. phy has resulted in the investigation of many infants and neonates for This set of variables predicted mortality for febrile patients with suspicion of either obstructive uropathy or reflux nephropathy. microbiologically confirmed infection even better.The predictive val- Nuclear medicine techniques allow to assess renal parenchyma ues for mortality of SIRS and sepsis were less than that of our set of integrity, to detect pyelonephritic scars and to measure absolute and variables.
    [Show full text]
  • Microbiological Characteristics of Corynebacterium Striatum, an Emerging Pathogen
    Review Microbiological Characteristics of Corynebacterium striatum, Hanyang Med Rev 2018 Jun;38(2):93-98 https://doi.org/10.7599/hmr.2018.38.2.93 an Emerging Pathogen pISSN 1738-429X eISSN 2234-4446 Sae Am Song1, Jeong Hwan Shin1,2 1Department of Laboratory Medicine, Inje University College of Medicine, Busan, Korea 2Paik Institute for Clinical Research, Inje University College of Medicine, Busan, Korea C. striatum is part of the normal skin and mucous membrane flora in humans and Corresponding Author: Jeong Hwan Shin Department of Laboratory Medicine, Inje is widely disseminated in the environment. Traditionally, these strains have been University Busan Paik Hospital, 75 Bokji- considered contaminants. However, C. striatum has been linked to respiratory ro, Busanjin-gu, Busan 47392, Korea infection, bacteremia, and endocarditis; and it is strongly related to nosocomial Tel: +82-51-890-6475 Fax: +82-51-890-8615 outbreaks. At present, matrix-assisted laser desorption/ionization time-of-flight mass E-mail: [email protected] spectrometry (MALDI-TOF) is the most accurate routine identification method. Many C. striatum strains are multi-drug resistant, being susceptible only to vancomycin Received 3 Apr 2018 and linezolid. We should survey the antimicrobial susceptibility results regularly to Revised 5 May 2018 monitor its resistance and consider it a possible pathogen. Accepted 12 Jun 2018 This is an Open Access article distributed under the terms of Key words: Corynebacterium striatum; Emerging pathogen; Resistance the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
    [Show full text]
  • Multiple Septic Emboli in the Skin, Lungs, and Brain Due to Corynebacterium Striatum Bacteremia in a Patient with Acute Myelogenous Leukemia
    American Journal of Medical Case Reports, 2018, Vol. 6, No. 12, 241-246 Available online at http://pubs.sciepub.com/ajmcr/6/12/4 ©Science and Education Publishing DOI:10.12691/ajmcr-6-12-4 Multiple Septic Emboli in the Skin, Lungs, and Brain due to Corynebacterium Striatum Bacteremia in a Patient with Acute Myelogenous Leukemia Motoharu Shibusawa*, Jiro Tadokoro, Shouhei Sato, Makoto Kashimura Shinmatsudo Central General Hospital, Department of Hematology *Corresponding author: [email protected] Received November 04, 2018; Revised December 06, 2018; Accepted December 28, 2018 Abstract A 29-year-old man developed fever after chemotherapy for acute myelogenous leukemia. Corynebacterium striatum was detected via blood culture, and antibacterial treatment with vancomycin started. In the course of treatment, papules of the skin, multiple nodular shadows of the lung, cerebral infarction, and subdural empyema appeared. A diagnosis of multiple septic emboli in the skin, lungs, and brain due to C. striatum bacteremia was made from the clinical course. The antibacterial treatment improved skin and pulmonary lesions. The subdural empyema was considered as a postoperative infection of burr-hole craniotomy. It improved by performing craniotomy twice with drainage and empiric antibiotic therapy. In our case, neutropenia was present as an immunodeficiency, which made bacteremia severe. There has not been reported a case of septic emboli of three lesions; skin, lung, and brain. C. striatum bacteremia may result in septic emboli and should immediately be treated with antibiotics. Keywords: Corynebacterium striatum, acute myelogenous leukemia, septic emboli Cite This Article: Motoharu Shibusawa, Jiro Tadokoro, Shouhei Sato, and Makoto Kashimura, “Multiple Septic Emboli in the Skin, Lungs, and Brain due to Corynebacterium Striatum Bacteremia in a Patient with Acute Myelogenous Leukemia.” American Journal of Medical Case Reports, vol.
    [Show full text]
  • Importance of Coryneform Bacteria in Infective Endocarditis
    Infectious Disease Reports 2015; volume 7:6103 Importance of coryneform Toxigenic strains of different clonal groups have exhibited an aggregative-adhering pat- Correspondence: Alexander von Graevenitz, bacteria in infective endocarditis tern in HEp-2 cells.11 While strains of C. pseu- University of Zürich, Nidelbadstrasse 10, CH dodiphtheriticum affected males and those 8802 Kilchberg, Switzerland. Alexander von Graevenitz with prosthetic valves more frequently and Tel.: +41.44.715.3274. University of Zürich, Switzerland showed higher mortality than non-toxigenic E-mail: [email protected] strains of C. diphtheriae,12 strains of C. stria- tum causing endocarditis were frequently Key words: Infective endocarditis; coryneforms; Coryneform bacteria have been defined as corynebacterium; propionibacterium. non-sporing Gram-positive rods with an irregu- nosocomial and multiply antibiotic-resistant lar outline.1 Almost all can be grown aerobical- but the majority of patients survived under Conflict of interest: the author reports no conflict 8,13 ly and assigned to the class Actinobacteria appropriate treatment. of interest. which are characterized by a high guanine- P. acnes is probably underestimated as an cytosine content (>50%) and specific 16S agent of infective endocarditis. While the per- Received for publication: 7 July 2015. rDNA signature nucleotides.2 Some of the gen- centage of isolates from blood cultures that Accepted for publication: 21 July 2015. era in this class are environmental bacteria can be attributed to endocarditis is very small – most isolates are skin contaminants – This work is licensed under a Creative Commons but some (e.g., Actinomyces, Brevibacterium, Attribution NonCommercial 3.0 License (CC BY- Corynebacterium, Dermabacter, Propion - approximately 50 cases have been reported in 14 NC 3.0).
    [Show full text]
  • Antimicrobial Susceptibility Testing for Corynebacterium Species Isolated from Clinical Samples in Romania
    antibiotics Article Antimicrobial Susceptibility Testing for Corynebacterium Species Isolated from Clinical Samples in Romania Cristiana Cerasella Dragomirescu 1,2, Brandusa Elena Lixandru 1, Ileana Luminita Coldea 1, Olguta Nicoleta Corneli 1, Marina Pana 1, Andi Marian Palade 1, Violeta Corina Cristea 3, Ioana Suciu 4, George Suciu 4, Loredana Sabina Cornelia Manolescu 2,* , Loredana Gabriela Popa 2,5 and Mircea Ioan Popa 1,2 1 “Cantacuzino” National Medico Military Institute for Research and Development, 050096 Bucharest, Romania; [email protected] (C.C.D.); [email protected] (B.E.L.); [email protected] (I.L.C.); [email protected] (O.N.C.); [email protected] (M.P.); [email protected] (A.M.P.); [email protected] (M.I.P.) 2 “Carol Davila” University of Medicine and Pharmacy, 050474 Bucharest, Romania; [email protected] 3 Central Reference Laboratory Synevo, 021408 Bucharest, Romania; [email protected] 4 BEIA Consult International, Peroni 16, 041386 Bucharest, Romania; [email protected] (I.S.); [email protected] (G.S.) 5 Colentina Clinical Hospital (CDPC), 020125 Bucharest, Romania * Correspondence: [email protected]; Tel.: +40-723-699-253 Received: 10 December 2019; Accepted: 14 January 2020; Published: 16 January 2020 Abstract: Antimicrobial resistance is one of the most important public health issues. Besides classical multidrug resistance species associated with medical care involved in superficial or invasive infections, there are strains less commonly associated with hospital or outpatient setting’s infections. Non-diphtheria Corynebacterium spp. could produce infections in patients with or without immune-compromised status. The aim of our study was to determine the susceptibility to antimicrobial agents to Corynebacterium spp.
    [Show full text]
  • Native Valve Endocarditis Due to Corynebacterium Striatum
    Case Report Infection & http://dx.doi.org/10.3947/ic.2016.48.3.239 Infect Chemother 2016;48(3):239-245 Chemotherapy ISSN 2093-2340 (Print) · ISSN 2092-6448 (Online) Native Valve Endocarditis due to Corynebacterium striatum confirmed by 16S Ribosomal RNA Sequencing: A Case Report and Literature Review Hyo-Lim Hong1, Hwi-In Koh1, and A-Jin Lee2 1Department of Internal Medicine; and 2Department of Laboratory Medicine, Catholic University of Daegu School of Medicine, Daegu, Korea Corynebacterium species are non-fermentous Gram-positive bacilli that are normal flora of human skin and mucous mem- branes and are commonly isolated in clinical specimens. Non-diphtheriae Corynebacterium are regarded as contaminants when found in blood culture. Currently, Corynebacterium striatum is considered one of the emerging nosocomial agents im- plicated in endocarditis and serious infections. We report a case of native-valve infective endocarditis caused by C. striatum, which was misidentified by automated identification system but identified accurately by 16S ribosomal RNA sequencing, in a 55-year-old male patient. The patient had two mobile vegetations on his mitral valve, both of which had high embolic risk. Through surgical valve replacement and an antibiotic regimen, the patient recovered completely. In unusual clinical scenarios, C. striatum should not be simply dismissed as a contaminant when isolated from clinical specimens. The possibility of C. striatum infection should be considered even in an immunocompetent patient, and we suggest a genotypic assay, such as 16S rRNA se- quencing, to confirm species identity. Key Words: Corynebacterium; Endocarditis; RNA, Ribosomal, 16S Introduction Recently, there have been increasingly frequent reports of in- fection by non-diphtheriae Corynebacterium in immuno- Corynebacterium species are non-spore-forming aerobic compromised patients who were hospitalized or in immuno- Gram-positive bacilli that are spread widely in the environ- competent patients who had implanted medical devices.
    [Show full text]