An Investigation Into the Role of Iga and Its Fc Receptor (Fcαri) in Activation of Pro-Inflammatory Signaling and Inhibition Thereof

Home , FCGR2A, Fc receptor

An Investigation Into the Role of IgA and Its Fc Receptor (FcαRI) in Activation of Pro-Inflammatory Signaling and Inhibition Thereof

The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters

Citation Getchell, Kristen. 2019. An Investigation Into the Role of IgA and Its Fc Receptor (FcαRI) in Activation of Pro-Inflammatory Signaling and Inhibition Thereof. Master's thesis, Harvard Extension School.

Citable link http://nrs.harvard.edu/urn-3:HUL.InstRepos:42004156

Terms of Use This article was downloaded from Harvard University’s DASH repository, and is made available under the terms and conditions applicable to Other Posted Material, as set forth at http:// nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of- use#LAA An Investigation into the Role of IgA and its Fc Receptor (FcαRI) in Activation of Pro-

inflammatory Signaling and Inhibition Thereof

Kristen Getchell

A Thesis in the Field of Biotechnology

for the Degree of Master of Liberal Arts in Extension Studies

Harvard University

Autoimmune diseases are defined as conditions in which the immune system mistakenly attacks the person’s tissues or organs. This often leads to inflammation, tissue destruction, and organ damage. In many cases, unknown precursors trigger autoimmune diseases, which presents a difficult therapeutic problem. Although some therapeutics are effective, many are not across all patients highlighting an unmet medical need. Some non-responder patients with autoimmune diseases have increased levels of immunoglobulin A (IgA). IgA’s sole activating Fc receptor, FcRI, activates the

Immunoreceptor Tyrosine Activation Motif (ITAM) which triggers downstream pro- inflammatory pathways. These pathways are only activated by polymeric IgA. Scientists showed that inhibiting FcRI with a blocking antibody prevents this activation; however, there is limited understanding of how polymeric IgA’s structure influences activation of inflammatory pathways. Furthermore, a crosstalk between IgA and IgG receptors has been reported. These studies sought to develop in vitro methods to facilitate further investigation into IgA’s activating pro-inflammatory mechanisms. A method was designed to create synthetic immune complex memetics of IgA and IgG, which were used to probe the activation of pro-inflammatory pathways in the U937 monocytic cell line. A comprehensive gene panel of pro-inflammatory pathways associated receptors and cytokines was developed and used to measure via qPCR the downstream impact of IgA- and IgG-immune complex mimetics. IgA-immune complexes induced an increase in expression of IL8, FCAR1, CXCL2, TNFA, and IL1B. IgG-immune complexes also induced a pro-inflammatory signal, which had a unique signature in comparison to IgA- immune complex activation. Immune complex activation could be inhibited with a FcRI receptor blocking antibodies; thus, reversing the pro-inflammatory signal and suggesting this signal is mediated by FcRI. Therefore, these studies outline a method development process that resulted in a reproducible assay that can be used to analyze IgA- and IgG- immune complex activation and subsequent inhibition with blocking FcαRI antibodies by measuring gene expression changes in U937 cells. These methods can therefore be useful for screening of therapeutic candidates designed to inhibit IgA and IgG mediated pro-inflammatory signals and further understanding of structural properties of immune complexes necessary to induce cellular activation. Acknowledgments

This thesis would not have been possible without the support of my colleagues at

Momenta Pharmaceuticals, Inc. Carlos Bosques, my thesis director, for his mentorship and knowledge. Jay Duffner for his experimental design help and assistance in developing the idea for this research. Naveen Bhatnagar for his help with conducting the size exclusion chromatography experiments. John Scheck for his help to conduct endotoxin removal of the immunoglobulins. And lastly, for the Momenta Research Team, for their thought-provoking discussions surrounding this research throughout this past year.

v Table of Contents

Acknowledgments...... v

List of Tables...... viii

List of Figures...... x

Chapter I Introduction ...... 1

IgA Structure and Function ...... 4

IgA Deficiency ...... 6

IgA Deposition ...... 7

The IgA Fc Receptor: FcαRI ...... 8

IgA and FcαRI: Anti- and Pro-inflammatory Mechanisms ...... 8

IgA and Autoimmunity ...... 11

Chapter II Materials and Methods ...... 14

Cell Culture of U937 Cells ...... 14

Endotoxin Removal, Biotinylation, and Quantification of IgA and IgG ...15

Size Exclusion Chromatography Analysis of IgA- and IgG-Immune

Complexes...... 16

IgA- and IgG-immune Complex Activation in U937 Cells ...... 17

Inhibition of IgA and IgG-Immune Complex Activation by Antibodies ..17

RNA Extraction and Quantitation ...... 18

Quantitative Reverse Transcription Polymerase Chain Reaction ...... 19

Chapter III Results ...... 21

Endotoxin Analysis ...... 21

vi Preparation and Characterization of IgA- and IgG-Immune Complexes via

SEC Analysis ...... 22

Selection of Genes to be Measured by qPCR to Monitor After Cellular

Activation ...... 26

Optimization of Immune Complex Driven Cellular Stimulation of U937

Cells ...... 28

Varying Concentrations of IgA-immune Complexes to Induce Activation

...... 31

Varying Concentrations of IgG-immune Complexes to Induce Activation

...... 32

Inhibition of IgA- and IgG-immune complex Activation with Blocking

Antibodies ...... 33

Chapter IV Discussion ...... 38

Appendix...... 42

Additional Figures ...... 42

References...... 92

vii List of Tables

Table 1. Primer List for Measuring Gene Expression in Pro-Inflammatory Pathways. ....42

Table 2. Gene Array for Measuring Gene Expression Changes in Pro-Inflammatory

Pathways with qPCR...... 43

Table 3. Statistical analysis (p values) of all genes measured for expression and the effects of cell culture media at 30 minutes incubation with IgA-immune complex mimetics……...... 50

Table 4. Statistical analysis (fold change log2) of all genes measured for expression and the effects of cell culture media at 30 minutes incubation with IgA-immune complex mimetics……...... 51

Table 5. Statistical analysis (p values) of all genes measured for expression and the effects of cell culture media at 60 minutes incubation with IgA-immune complex mimetics……...... 52

Table 6. Statistical analysis (fold change log2) of all genes measured for expression and the effects of cell culture media at 60 minutes incubation with IgA-immune complex mimetics……...... 53

Table 7. Statistical analysis (p value) of all genes measured for expression after incubation with a titration of IgA-immune complex mimetics...... 61

Table 8. Statistical analysis (fold change log2) of all genes measured for expression after incubation with a titration of IgA-immune complex mimetics...... 62

viii Table 9. Statistical analysis (p value) of all genes measured for expression after incubation with a titration of IgG-immune complex mimetics...... 71

Table 10. Statistical analysis (fold change log2) of all genes measured for expression after incubation with a titration of IgG-immune complex mimetics...... 72

Table 11. Statistical analysis (p value) of all genes measured for expression after incubation with IgA-immune complex mimetics and subsequent inhibition with FcαRI blocking antibodies...... 80

Table 12. Statistical analysis (fold change log2) of all genes measured for expression after incubation with IgA-immune complex mimetics and subsequent inhibition with FcαRI blocking antibodies...... 81

Table 13. Statistical analysis (p value) of all genes measured for expression after incubation with IgG-immune complex mimetics and subsequent inhibition with FcαRI blocking antibodies...... 90

Table 14. Statistical analysis (fold change log2) of all genes measured for expression after incubation with IgG-immune complex mimetics and subsequent inhibition with FcαRI blocking antibodies...... 91

ix List of Figures

Figure 1. IgA isoforms...... 5

Figure 2. ITAM and ITAMi pathways...... 10

Figure 3. Size exclusion chromatograms of avidin, biotinylated IgA, and biotinylated

IgG…………...... 23

Figure 4. Size exclusion chromatograms of biotinylated IgA and varying concentrations of avidin to determine the optimal ratio to form IgA-immune complex mimetics...... 24

Figure 5. Size exclusion chromatograms of biotinylated IgG and varying concentrations of avidin to determine the optimal ratio to form IgG-immune complex mimetics...... 25

Figure 6. IgA-immune complex mimetics cause an increase in IL8 gene expression at two time points and with two media types...... 30

Figure 7. Titration of IgA-immune complex mimetics induce activation in U937 cells... 44

Figure 8. Titration of IgG-immune complex mimetics induce increased IL8 expression……...... 33

Figure 9. IgA-immune complex mimetics activation is inhibited by FcαRI blocking antibodies…...... 45

Figure 10. IgG-immune complex mimetics activation is inhibited by FcαRI blocking antibodies……...... 36

Figure 11. IgA- and IgG- immune complex memetics activation and inhibition with

FcαRI blocking antibodies...... 37

Supplemental Figure 12: Time Course and Cell Culture Media Effects After IgA-immune complex Mimetics Activation as Measured Via ACTB, RPS14, CCL2, and IL1B

Expression…… ...... 46

x Supplemental Figure 13. Time Course and Cell Culture Media Effects on IgA-immune complex Mimetics Activation as Measured Via GUSB, FCER1G, FCAR2, and FCGR2A

Expression…… ...... 47

Supplemental Figure 14. Time Course and Cell Culture Media Effects on IgA-immune complex mimetics Activation as Measured Via IL6, FCAR1, TGFB2, and FCAR3

Expression…… ...... 48

Supplemental Figure 15. Time Course and Cell Culture Media Effects on IgA-immune complex mimetics Activation as Measured Via CCR1 and CCR2 Expression...... 49

Supplemental Figure 16. Titration of IgA-immune complex mimetics effects on ACTB,

FCGR2A, CCL2, and IL6 expression...... 54

Supplemental Figure 17. Titration of IgA-immune complex mimetics effects on RPS14,

TNFRSF13, GUSB, and FCAR3 expression...... 55

Supplemental Figure 18. Titration of IgA-immune complex mimetics effects on

FCER1G, CCR1, FCAR2, and CCR2 expression...... 56

Supplemental Figure 19. Titration of IgA-immune complex mimetics effects on IL10,

IL33, IL1RN, and CXCL10 expression...... 57

Supplemental Figure 20. Titration of IgA-immune complex mimetics effects on

CXCL11, CXCL9, CXCR1, and CXCR2 expression...... 58

Supplemental Figure 21. Titration of IgA-immune complex mimetics effects on CXCR4,

TNFSF13, TNFSF13B, and TGFB1 expression...... 59

Supplemental Figure 22. Titration of IgA-immune complex mimetics effects on TGFB2 expression…… ...... 60

xi Supplemental Figure 23. Titration of IgG-immune complex mimetics effects on ACTB,

FCGR2A, CCL2, and IL6 expression...... 63

Supplemental Figure 24. Titration of IgG-immune complex mimetics effects on RPS14,

FCAR1, IL1B, and TNFRSF13 expression...... 64

Supplemental Figure 25. Titration of IgG-immune complex mimetics effects on GUSB,

FCAR3, FCER1G, and CCR1 expression...... 65

Supplemental Figure 26. Titration of IgG-immune complex mimetics effects on FCAR2,

CCR2, TNFA, and IL10 expression...... 66

Supplemental Figure 27. Titration of IgG-immune complex mimetics effects on IL33,

IL1RN, CXCL10, and CXCL11 expression...... 67

Supplemental Figure 28. Titration of IgG-immune complex mimetics effects on CXCL2,

CXCL9, CXCR1, and CXCR2 expression...... 68

Supplemental Figure 29. Titration of IgG-immune complex mimetics effects on CXCR4,

TNFSF13, TNFSF13B, and TGFB1 expression...... 69

Supplemental Figure 30. Titration of IgG-immune complex mimetics effects on CXCR4,

TNFSF13, TNFSF13B, and TGFB1 expression...... 70

Supplemental Figure 31. IgA-immune complex mimetics activation and inhibition by

FcαRI blocking antibodies effects on ACTB, FCGR2A, CCL2, and IL6 expression...... 73

Supplemental Figure 32. IgA-immune complex mimetics activation and inhibition by

FcαRI blocking antibodies effects on RPS14, GUSB, FCAR3, and FCER1G expression…...... 74

Supplemental Figure 33. IgA-immune complex mimetics activation and inhibition by

FcαRI blocking antibodies effects on CCR1, FCAR2, CCR2, and IL10 expression...... 75

xii Supplemental Figure 34. IgA-immune complex mimetics activation and inhibition by

FcαRI blocking antibodies effects on IL33, IL1RN, CXCL11, and CXCL10 expression…...... 76

Supplemental Figure 35. IgA-immune complex mimetics activation and inhibition by

FcαRI blocking antibodies effects on CXCL9, CXCR1, CXCR2, and CXCR4 expression…… ...... 77

Supplemental Figure 36. IgA-immune complex mimetics activation and inhibition by

FcαRI blocking antibodies effects on TNFSF13, TNFSF13B, TFB1, and TGFB2 expression…...... 78

Supplemental Figure 37. IgA-immune complex mimetics activation and inhibition by

FcαRI blocking antibodies effects on TNFRSF13 expression...... 79

Supplemental Figure 38. IgG-immune complex mimetics activation and inhibition by

FcαRI blocking antibodies effects on ACTB, CXCL2, FCAR1, and TNFA expression.. 82

Supplemental Figure 39. IgG-immune complex mimetics activation and inhibition by

FcαRI blocking antibodies effects on FCGR2A, IL6, CCL2, and RPS14 expression...... 83

Supplemental Figure 40. IgG-immune complex mimetics activation and inhibition by

FcαRI blocking antibodies effects on IL1B, GUSB, FCAR3, and FCER1G expression.. 84

Supplemental Figure 41. IgG-immune complex mimetics activation and inhibition by

FcαRI blocking antibodies effects on CCR1, FCAR2, CCR2, and IL10 expression...... 85

Supplemental Figure 42. IgG-immune complex mimetics activation and inhibition by

FcαRI blocking antibodies effects on IL33, IL1RN, CXCL10, and CXCL11 expression…… ...... 86

xiii Supplemental Figure 43. IgG-immune complex mimetics activation and inhibition by

FcαRI blocking antibodies effects on CXCL9, CXCR1, CXCR2, and CXCR4 expression…...... 87

Supplemental Figure 44. IgG-immune complex mimetics activation and inhibition by

FcαRI blocking antibodies effects on TNFSF13, TNFSF13B, TGFB1, and TGFB2 expression…… ...... 88

Supplemental Figure 45. IgG-immune complex mimetics activation and inhibition by

FcαRI blocking antibodies effects on TNFRSF13 expression...... 89

xiv

Chapter I

Introduction

Autoimmune diseases are a classification of disorders where the normal immune response to a pathogen is instead directed towards a self-antigen, resulting in the production of autoreactive immune cells and autoantibodies (Murphy & Weaver, 2016).

These immune cells and autoantibodies can target multiple organ systems in patients causing tissue and organ damage. Symptoms range from mild to severe, which can greatly affect quality of life. Often the precursor that triggered the autoimmune response is unknown, thus presenting a difficult therapeutic problem.

The antibody immunoglobulin G (IgG) can neutralize pathogens and prevent infection from viruses and bacteria (Murphy & Weaver, 2016). IgG is involved in both pro- and anti-inflammatory signaling through its interactions with Fc receptors. IgG has been extensively studied in relation to autoimmune diseases, and it has been found that autoreactive IgG or IgG deficiency can lead to activation of pro-inflammatory pathways

(Gupta et al., 2002). Therefore, to prevent further activation of inflammation in patients, therapeutics have been developed that modulate the interaction between IgG and its receptors. For example, intravenous immunoglobulin (IVIg) is widely used to treat autoimmune and inflammatory diseases. IVIg is a mixture of plasma-derived immunoglobulins fractionated from the plasma of thousands of human donors. One mechanism of IVIg is to inhibit the interaction of auto-antibodies with activating Fc receptors (Li & Kimberly, 2014). Additionally, IVIg can induce activation of activating

inhibitory Fc receptors that prevent further production of inflammatory mediators

(Murphy & Weaver, 2016).

Scientists have discovered that another antibody class, immunoglobulin A (IgA), may also play an equally important role in the homeostasis of the inflammatory responses through its own pro- and anti-inflammatory signaling properties.

Monomeric serum IgA is known to induce an anti-inflammatory pathway and cause the down regulation of inflammation (Monteiro, 2010). Research into IgA’s anti- inflammatory properties using human monocytes showed that IgA inhibited phagocytosis, chemotaxis, and antibody-dependent cellular cytotoxicity by decreasing the release of cytokines (Wolf et al., 1994). In addition, interaction between monomeric IgA and its Fc receptor, FcαRI, led to the inhibition of neutrophil chemotaxis (Wolf et al.,

1994).

Much like IgG, scientists found that IgA also has pro-inflammatory properties.

When serum IgA is present in its polymeric form, sometimes referred to as IgA-immune complexes, it induces a pro-inflammatory response when interacting with FcαRI

(Monteiro, 2010). This interaction increases inflammation through cytokine release, such as TNF-α, IL-1β, and IL-6, thus causing potentially more severe symptoms for those with autoimmune diseases (Hansen et al., 2017).

This knowledge of polymeric IgA’s role in inflammation led researchers to measure IgA levels in patients with autoimmune diseases. Numerous scientific publications show that polymeric IgA, rather than monomeric IgA, is often elevated in patients with a wide range of autoimmune diseases and inflammatory myopathies, such as Sjörgren’s syndrome, Kawasaki disease, and dermatitis herpetiformitis. IgA deposition

in the kidneys is also a predominant cause of IgA nephropathy (Donadio et al., 2002).

Despite IgA’s possible significant role in these diseases, there is still a limited understanding of monomeric and polymeric IgA’s structural influences on activating or inhibiting inflammatory pathways.

Scientists postulate that developing a therapeutic drug targeting IgA or its Fc receptor could inhibit the pro-inflammatory response (Monteiro, 2010). This could be beneficial since treating patients with anti-inflammatory therapeutics targets the symptoms rather than the cause of disease. Therefore, further characterization of IgA and understanding the mechanism of action of these diseases could help with the design of future treatments. Since it may be possible that some patients do not respond to IgG targeting therapeutics since their disease is being driven by polymeric IgA rather than

IgG, targeting IgA may pose a benefit. This might explain why some patients who receive IVIg treatment do not have an improvement of their symptoms, such as a subset of patients with Kawasaki disease who do not respond to IVIg treatment (Hwang et al.,

2011) (Downie et al., 2016) (Kim et al., 2016). Although it is difficult to know the exact cause of the lack of response, if IgA is the driver of the disease, it would explain why treatment with IVIg is not effective. It might also be possible that there is a convergent mechanism between the IgA receptor, FcαRI, and the IgG receptors, FcRs, that is driving onset of disease. Thus, IVIg treatment may still be an effective treatment if the two pathways are convergent. Further experimentation is required to better understand these pathways. Therefore, developing simple tools to better characterize markers and pathways of IgA-mediated cellular activation and identifying IgA targeted therapeutics may help.

IgA Structure and Function

Immunoglobulins (Ig), also known as antibodies, are key components of the adaptive immune response in humans. Their role is to recognize pathogenic antigens, such as those produced by viruses or bacteria, resulting in the pathogen’s neutralization and removal from the body. B cells produce immunoglobulins and comprise five isotypes known as IgM, IgD, IgE, IgG, and IgA (Murphy & Weaver, 2016). Each isotype varies in their amino acid sequence of their constant region (Fc) and each play a different immunological role.

IgA is the most abundant immunoglobulin in mucosal secretions (Woof & Kerr,

2006). In circulation, it is the second most abundant immunoglobulin after IgG

(Reinholdt et al., 2013). IgA is present in the body as different isoforms (Kerr, 1990)

(Figure 1). Both circulatory and secretory IgA are divided into two subclasses, known as

IgA1 and IgA2. These two subclasses are found in different proportions in the body.

Circulatory IgA is found predominantly as IgA1 (>85%), whereas in secretions IgA2 is found between 10-40%, depending on the secretory location, such as saliva versus large intestine (Reinholdt et al., 2013).

IgA can be found in circulation and in secretions as different isoforms (Figure 1).

Circulatory IgA1 and IgA2 are found in their monomeric form (Figure 1A). In this form,

IgA1 contains a hinge region of O-linked oligosaccharides between its Fab and Fc regions, which is absent in monomeric IgA2. The hinge region allows for greater structural flexibility but renders it susceptible to proteases produced by bacterial pathogens (Reinholdt et al., 2013). IgA2 has different numbers of N-linked

oligosaccharides within its structure compared to IgA1. There are two different allotypes of IgA2, known as IgA2m(1) and IgA2m(2). IgA2m(1)’s heavy and light chains are not covalently bound, unlike IgA2m(2) (Reinholdt et al., 2013). Population studies found that

IgA2m(1) is predominant in Caucasians, and IgA2m(2) is predominant in those of

African descent (Reinholdt et al., 2013). Secretory IgA is found in its polymer form, most often as a dimer (Figure 1B and 1C). The dimer is formed by binding through a J-chain

(Reinholdt et al., 2013).

Figure 1. IgA isoforms. Representation of the IgA structures present in the human body (Bakema & van Egmond, 2011).

IgA Deficiency

Most of the published literature has investigated IgA’s role in mucosal immunity against bacteria. Through this research, scientists found that IgA has a bi-functional role in inflammatory responses (Lang et al., 2002) (Olas et al., 2005) (Monteiro, 2010). The study of IgA deficiency in patients also explained this bi-functionality. This deficiency is common amongst Caucasians and those with a homozygous haplotype in the major histocompatibility complex (MHC) region, haplotype HLA-A1-B8-DR3. This haplotype makes them prone to have an increased risk of developing the deficiency (Wang et al.,

2011). Interestingly, despite the importance of IgA in fighting infection, it is not essential in overall immune health (Kerr, 1990). Patients with no IgA production are asymptomatic. However, upon recurrent infections, they are more likely to develop autoimmune diseases due to unknown reasons. These diseases include rheumatoid arthritis, lupus, celiac disease, and type 1 diabetes (Yel, 2010) (Abolhassani et al., 2015)

(Wang et al., 2011) (Ludvigsson et al., 2014). Of those with IgA deficiency, 7-36%, depending on the population, have an autoimmune disease (Abolhassani et al., 2015).

Patients with IgA deficiency have B cells that can only express IgM and IgG and are often IgE deficient. This is because of their inability for their B cells to class switch

(Yel, 2010). Without the ability to class switch, their B cells do not differentiate and cannot create IgA producing plasma cells (Abolhassani et al., 2015). These patients’ T helper cells are abnormal, leading to dysfunctional cytokine production (Yel, 2010). They have increased T-suppressor cells (Abolhassani et al., 2015). They have found increased autoantibodies against IgA in some of these patients (Kerr, 1990).

Investigation as to why some patients with an IgA deficiency are more prone to developing autoimmune diseases has been explored. Abolhassani et al. hypothesize that a combination of genetic factors and autoantibodies influences the increased risk of autoimmunity development. However, autoantibodies against IgA has not been proven to be a predictor of developing an autoimmune disease.

IgA Deposition

Extensive research has been conducted on the mechanism of IgA nephropathy.

This disease is characterized by the deposition of IgA in the kidneys. Sometimes, deposits of IgG or IgM are also present along with IgA. The deposits of IgA mainly comprise the IgA1 isoform. It has been hypothesized that the IgA deposits occur because of the glycosylation of IgA1.

In patients with this disease, their circulating IgA1 is galactose deficient in some of their O-glycans attached to the hinge-region. This change in glycosylation pattern leads to an exposed hinge-region that causes the formation of IgA1-immune complexes that deposit in the kidneys (Wyatt & Julian, 2013). While this pathogenesis differs from the hypothesized effect of polymeric IgA in autoimmune disease, this research has helped to further the understanding of the creation of IgA-immune complexes and the downstream activating effects of IgA. Therefore, better understanding the bi-functional role of IgA-mediated activation and inhibition of inflammation response in autoimmune diseases is important.

The IgA Fc Receptor: FcαRI

Due to the unknown mechanisms of IgA’s bi-functional role in pro- and anti- inflammation, researchers focused on the IgA receptor, FcαRI (Woof & Kerr, 2006).

Unlike IgG’s numerous interactions with multiple Fc receptors, FcαRI is the only signaling Fc receptor that interacts directly with IgA and takes minimum valency to activate. The receptor is believed to not bind other immunoglobulin classes. It is expressed only on myeloid lineage cells, such as neutrophils, monocytes, and certain macrophages (Monteiro et al., 1990). It has a similar structure to the IgG Fc receptors but is encoded by a different gene cluster located on chromosome 19 (Pasquier et al., 2005).

Researchers found that FcαRI shares homology with the flanking NK cell receptor

(KIRs) genes and leucocyte Ig-like receptors on chromosome 19 (Woof & Kerr, 2006).

FcαRI consists of a transmembrane protein but does not contain an intracellular signaling domain. Instead, it associates with an Immunoreceptor Tyrosine Activation Motif (ITAM domain). This domain is known to be responsible for intracellular anti-inflammatory signaling (ITAMi) (Lang et al., 2002).

IgA and FcαRI: Anti- and Pro-inflammatory Mechanisms

IgA was originally thought to only be involved in anti-inflammatory signaling within cells via the ITAMi pathway (Wolf, 1996). This signaling is induced by the interaction of FcαRI with monomeric IgA at low valency. Inhibition signaling is induced through the FcRI-FcR-chain complex, preventing the ITAMi pathway (Monteiro,

2010) (Figure 2). Therefore, it has been established that the interaction between monomeric IgA and its receptor leads to an anti-inflammatory response, and in turn prevents the development of inflammation in patients with autoimmune diseases

(Monteiro, 2010). This was confirmed with studies done in human monocytes, which showed that monomeric IgA can inhibit LPS-induced inflammation (Shen, 1994).

Through additional studies, it was found that monovalently blocking the FcαRI receptor with an antibody induced the anti-inflammatory ITAMi pathway, leading to decreased inflammatory signaling, fibrosis, and apoptosis (Bakema & van Egmond, 2011).

However, through the extensive study of IgA’s anti-inflammatory mechanisms, scientists discovered that IgA also can induce a pro-inflammatory response, showing it’s a regulator of immune homeostasis (Blank et al., 2009). The pro-inflammatory signals are mediated through cross-linking of FcαRI with polymeric IgA via the ITAM pathway

(Monteiro, 2010) (Figure 2B). Like anti-inflammatory signaling, the pro-inflammatory response begins with the association of the ITAM FcRγ subunit to FcRI after binding of polymeric IgA. The Src kinase, Lyn, phosphorylates the tyrosines in the ITAM domain that have associated with FcRI. Then recruitment of Syk ultimately causes calcium release and activation of fibrosarcoma-1 mitogen-activated protein kinase–mitogen- activated protein (Raf-1–MEK–MAP) kinases. This results in pro-inflammatory signaling. Experiments with human monocytes confirmed this observation. Monocytes were stimulated with human serum IgA. They showed polymeric IgA-immune complexes induced activation of pro-inflammatory molecules, such as IL-1Ra. Addition of an antibody blocking the receptor, FcαRI, prevented binding of IgA and reversed the anti- inflammatory response, leading to an increase in the presence of pro-inflammatory

molecules, such as IL-6 and TNF-alpha (Wolf et al., 1996) (Wolf et al., 1994). This showed the ability to model both ITAMi and ITAM signaling induced by either monomeric or polymeric IgA and FcαRI within a single model system.

A ITAMi B ITAM Anti-Inflammatory Pro-Inflammatory

Monomeric IgA Polymeric IgA

FcεRI FcαRI FcαRI

Figure 2. ITAM and ITAMi pathways. Activating the FcαRI receptor with monomeric serum IgA induces the ITAMi pathway, which inhibits signaling leading to an anti- inflammatory signal (Left). By cross-linking the FcαRI receptor with IgA-immune complexes, the ITAM pathway is induced, which activates pro-inflammatory signaling (Right). (Bakema & van Egmond, 2011).

Monteiro, et al. did extensive work in this area and theorized that polymeric IgA activation induced inflammation through the ITAM pathway which may be a driving factor for inflammation found in numerous diseases. In one study, they showed that by inhibiting the interaction of IgA and its receptor, FcαRI, with a monoclonal antibody, that transgenic human-FcαRI mice did not develop asthma and prevented IgG-mediated

phagocytosis (Monteiro, 2010). In a separate study, they showed blocking this interaction also prevented inflammation in two different kidney inflammatory models for IgA nephropathy. Their work implied that by blocking the receptor, IgA is prevented from triggering the ITAM signaling, pro-inflammatory response and could be a potential therapeutic target for drug development. This thesis sought to further understand the work done with IgA activation induced inflammation and inhibition thereof by developing a synthetic polymeric IgA-immune complex to induce pro-inflammatory signaling and then use blocking FcαRI antibodies to inhibit the pro-inflammatory response. Developing an assay with these materials and measuring expression of genes involved in the inflammation pathway would allow for further understanding of the mechanism by which IgA signals through ITAM through analyzing gene expression changes.

IgA and Autoimmunity

Due to the discovery of IgA’s role in pro-inflammatory signaling, scientists looked for a connection between IgA and autoimmune diseases. It is possible that targeting polymeric IgA and FcαRI in patients with autoimmunity may prevent inflammation and thus improve symptoms of their disease. Not only has IgA deficiency been associated with autoimmunity, numerous studies found that increased levels of IgA are associated with certain autoimmune diseases and inflammatory myopathies. Sjögren's syndrome, an autoimmune disease that affects the mucosal membranes leading to decreased mucus production, has been strongly correlated with an increased level of IgA- immune complexes (Levy et al., 1994). A clinical study conducted with 52 patients with

Sjögren's syndrome showed that increased levels of polymeric IgA-immune complexes were found in 48% of these patients. Comparatively, IgM-immune complexes were only present in 12% of patients (Bendaoud et al., 1991).

In addition, Kawasaki disease, an inflammatory disease, has also shown a correlation between disease and increased levels of IgA (Gupta et al., 2002). Even more intriguing, this increased production of polymeric IgA has been reported as being associated with ANCA-associated vasculitis, dermatomyositic, polymyositis, IgA pemphigus, immune thrombocytopenic purpura (ITP), dermatitis hepetiformitis, and IgA nephropathy. Despite the wide-ranging association of increased IgA and disease, little research has been conducted to confirm this association. There are also no therapeutics targeting IgA or its receptor. Thus, there may be an unmet patient need with IgA driven disease.

Pasquier’s et al. work suggests that there may be a connection between IgA and

IgG mediated activation that effects the pro-inflammatory pathway. His studies showed that by using a blocking FcαRI antibody, IgG-mediated phagocytosis was inhibited.

Other studies showed similar crosstalk between IgA, its receptor, and IgG. It has also been reported that serum IgA can mediate IgG phagocytosis, cytokine release, and many other IgG mediated mechanisms (Blank et al, 2009) (Monteiro, 2014). Monomeric IgA induces the ITAMi pathway, which leads to the recruitment of SHP-1 phosphatase to the

FcRI-associated FcR chain. This mechanism causes the blockage of activating other

ITAM domains, including the Fc receptors and the FcR chain that associates with these receptors. Therefore, blocking FcRI may not only block the pro-inflammatory pathway induced by polymeric IgA, but it may also inhibit activation of the Fc receptors.

This thesis sought to develop a simple in vitro method to aid the characterization of the pro-inflammatory signaling pathway induced by polymeric IgA’s interaction with its Fc receptor. Understanding this pathway could allow for application to how it effects

IgG mediated activation and potentially elucidate an ambiguous mechanism of crosstalk between IgA, its receptor, and IgG signaling pathways. This information could then be applied to further understanding the development of inflammation in those with autoimmune diseases and provide insight on a potential design of a therapeutic.

Chapter II

Materials and Methods

This section outlines the materials and methods used to conduct the work done for this thesis. Cell culture of the human monocyte cell line, U937, was performed according to the ATCC company’s recommendations (ATCC, Cat#: CRL-1593.2). All the cell- based assays were performed with these cells and with commercially purchased reagents.

RNA was extracted from the U937 cells treated with either monomeric IgA, monomeric

IgG, immune complexes, and blocking antibodies. The RNA was used to measure gene expression changes via quantitative polymerase chain reaction (qPCR).

Cell Culture of U937 Cells

Vials of frozen U937 cells were thawed for two minutes with gentle agitation in a

37°C water bath. The vial was decontaminated with 70% ethanol and the following steps were performed under aseptic conditions. The vial’s contents were transferred to a 15 mL conical centrifuge tube along with 4 mL complete culture medium. This medium consisted of RPMI-1640 Medium (ATCC, Cat#: ATCC-30-2001) with the addition of

10% fetal bovine serum (ATCC, Cat#: ATCC-20-2020). The cells were centrifuged at

125 x g for five minutes. The supernatant was aspirated, and the cell pellet was resuspended in 5 mL complete medium. This cell suspension was dispensed into a 75 cm2 culture flask with the addition of 15 mL of complete medium. Cells were incubated upright in the flask at 37°C. The cultures were maintained by the addition of fresh

medium of every three to four days with a cell density between 1 X 105 and 2 X 106 viable cells/mL.

Endotoxin Removal, Biotinylation, and Quantification of IgA and IgG

Biotinylation of human serum IgA and IgG was completed following the Pierce

Biotin Quantification Kit protocol (Fisher Scientific, Cat#: 21330). Human serum IgA was purchased from Jackson ImmunoResearch Laboratories (Cat #: 009-000-011), and human serum IgG was purchased from Sigma Aldrich (Cat #: I4506-100MG).

Endotoxin was removed from IgA using an Etoxiclear column per manufacturer’s instructions (Prometic Cat #: 3250). The immunoglobulin was applied to the Etoxiclear column at 120 cm/h for five minutes, the flow through was collected, and eluted in PBS buffer.

The EZ-link biotin PEG reagent was diluted with 170 µL deionized water then added to the IgA and IgG based on the number of moles of biotin per mole of protein using Beer Lambert’s Law as outlined in the kit protocol. The biotin and IgA- or IgG- reaction mix was vortexed and incubated at room temperature for 30 minutes. Then the removal of free biotin was conducted with 2 mL Zeba desalt spin columns (Fisher

Scientific, Cat#: 89889). The columns were first washed three times with 300 µL of PBS at 1000 x g for one minute. After incubation, then the biotin and IgA- or IgG-reaction mix was applied to the spin column and centrifuged at 1000 x g for 120 seconds. The resulting biotinylated IgA or IgG was quantified.

To quantify the amount of biotinylation, the HABA assay from the EZ Biotin

Quantification Kit (Fisher Scientific, Cat#: 28005) was used. Using an extinction

coefficient of 1.32 at 1 cm and 1 mg/mL, 280 nM, the protein concentration for IgA and

IgG was measured using absorbance with the Nandrop instrument. The HABA reagent was reconstituted with 100 µL deionized water, and the HABA reaction mixture was created by adding 40 µL of HABA stock to 340 µL PBS. For each reaction, 18 µL of

HABA reaction mixture was added to 2 µL of biotinylated sample. The reaction was incubated at room temperature for ten minutes before being measured by Nanodrop.

Using the biotinylation calculations in the manual, the ratio of IgA-biotin and IgG-biotin protein concentration was determined.

Size Exclusion Chromatography Analysis of IgA- and IgG-Immune Complexes

To create immune complexes, avidin was combined to the biotinylated IgA and

IgG. First, the optimal concentration of avidin (Rockland Immunochemicals, Inc. Cat#:

A003-01) plus biotinylated IgA or IgG was determined. Different concentrations of avidin (0.1, 0.2, 0.35, and 0.5 mg/mL) was added to the biotinylated IgA or IgG and incubated for 30 minutes. These complexes were analyzed using size exclusion chromatography in a total volume of 60 L each. The optimal concentration to create the synthetic immune complexes was determined to be 0.35 mg/mL avidin combined with

0.5 mg/mL biotinylated immunoglobulin. Therefore, all subsequent creation of immune complexes was used at concentration. Any dilutions of the immune complexes were completed with phosphate-buffered saline (PBS).

IgA- and IgG-immune Complex Activation in U937 Cells

A 96-well tissue culture treated plate was used. Controls groups included the following in a total volume of 100 µL: PBS, 35 µg/mL avidin, 25 µg/mL biotinylated

IgA, and 25 µg/mL biotinylated IgG. The IgA- or IgG-immune complexes were created by combining 0.35 mg/mL avidin and 0.5 mg/mL biotinylated immunoglobulin. After thirty minutes of incubation, the immune complexes were diluted with PBS to the following final concentrations in a total volume of 100 µL: 12.5 µg/mL immunoglobulin and 8.75 µg/mL avidin, 25 µg/mL immunoglobulin and 17.5 µg/mL avidin, 50 µg/mL immunoglobulin and 35 µg/mL avidin, and 75 µg/mL immunoglobulin and 52.5 µg/mL avidin. These dilution conditions were added to the appropriate wells along with 100 µL of 0.200 x 106 cells in culture media (either RPMI 1640 with 10% FBS or RPMI 1640 low serum IgG with 10% FBS). The plate was incubated at 37°C for either one or four hours. After incubation, the well volumes were transferred to 2 mL cap lock tubes and spun at 1200 rpm for five minutes. The supernatants were discarded, and the cell pellets were frozen at -80°C until RNA extraction was performed.

Inhibition of IgA and IgG-Immune Complex Activation by Antibodies

Inhibition experiments were performed in the same manner as the activation experiments. In addition to the previously outlined controls and conditions, 50 ng/µL blocking and/or non-blocking antibodies were added to the appropriate wells. The antibodies used were the following: Anti-FcαRI mouse monoclonal antibodies MIP8a,

MIP7c and MIP68b (Novus Biologicals), Antibody MIP8a (LifeSpan), and Antibody

6G3G3E7 (Sino Biologicals). After the conditions were added to the appropriate wells,

100 µL of 0.200 x 106 cells were added per well. The plate was incubated at 37°C for one hour. After incubation, the well volumes were transferred to 2 mL cap lock tubes and spun at 1200 rpm for five minutes. The supernatants were discarded, and the cell pellets were frozen at -80°C until RNA extraction was performed.

Activation and Inhibition of U937 Cells with IgA- and IgG-immune Complexes

These experiments were performed in the same manner as previously outlined. An additional condition added was the IgA- and IgG-immune complexes combination in a single well at 0.35 mg/mL avidin and 0.5 mg/mL biotinylated immunoglobulin. Then 100

µL of 50 ng/µL antibody, MIP8a or Fc Block, was added to the appropriate wells. Next,

50 µL of 0.200 x 106 cells were added per well. The plate was incubated at 37°C for one hour. After incubation, the well volumes were transferred to 2 mL cap lock tubes and spun at 1200 rpm for five minutes. The supernatants were discarded, and the cell pellets were frozen at -80°C until RNA extraction was performed.

RNA Extraction and Quantitation

Frozen RNA was extracted from the U937 cells using the RNeasy Mini Kit

(Qiagen, Cat# 74104). Cell pellets were resuspended by addition of 350 µL Buffer RLT.

The lysates were transferred to the QIAcube instrument and the RNeasy Mini Animal

Tissues and Cells protocol was performed. RNA was eluted in 50 µL RNase-free water and stored at -80°C until further use. RNA quality was assessed using Agilent’s 2200

Tapestation per the RNA ScreenTape Assay (Agilent, Cat#: 5067-5579). RNA concentration was measured using the Nanodrop 8000 software.

Quantitative Reverse Transcription Polymerase Chain Reaction

RNA samples were normalized to 0.2 µg for each reaction in a total volume of 15

µL. Reverse transcription was performed using the ProtoScript® II Reverse Transcriptase

(New England Biolabs, Cat#: M0368S). The normalized RNA was added to a reaction mix of 10 mM dNTP and 0.3 µg/µL random primer mix. Deionized water was added to bring the final volume to 30 µL. The reaction was denatured at 70°C for five minutes and cooled to 4°C for one minute on a thermocycler. Next, 5X ProtoScript II Buffer, 0.1 M

DTT, and 200 U/µL ProtoScript II RT was added to the reaction. Reverse transcription was completed on the thermocycler with the following conditions: 25°C for five minutes,

50°C for 50 minutes, 70°C for 15 minutes, and 4°C until removal. The cDNA samples were stored at -80°C until use.

Quantitative polymerase chain reaction (qPCR) was performed using one array of

28 genes (Appendix Table 1 and 2). Each primer was dispensed in its corresponding well in a 384-well qPCR plate. Then 10 µL of cDNA, 95 µL of nuclease-free water, and 200

µL of FastStart Universal SYBR Green Master Mix (Roche, Cat #: 4385610) were combined to create the reaction mix. From this reaction mix, 7.5 µL was added to each corresponding well in the qPCR plate. qPCR was performed on the Roche LightCycler

480 II instrument. The Cp was calculated by the 2nd derivative max method and the Tm was measured. Arrays were normalized to the housekeeping genes, ACTB and RPS14, to retrieve the dCp values, as well as normalized to the control group that was incubated

with PBS only to obtain the ddCp values. Statistical analysis was performed using a t-test to compare the ddCp of the groups compared to the control group to obtain the p values and the fold changes.

Chapter III

Results

This section outlines the results from the multiple in vitro experiments described in the previous section. The aim of this thesis work was to develop a better characterization tool to analyze FcRI receptor inhibitors in the presence of IgA- or IgG- immune complexes and their effects on the pro-inflammatory pathway. These assays may be efficient screening tools to allow for the identification of therapeutic products that target the IgA and the FcRI pathway.

Endotoxin Analysis

It is known that endotoxins can induce pro-inflammatory signals in cell assays.

Therefore, to ensure that the antibodies used for the studies did not activate on their own because of endotoxin contamination, each antibody was sent for endotoxin content characterization by John Scheck at Momenta Pharmaceuticals, Inc. Human serum IgA and IgG were assessed for quality by measuring endotoxin levels. IgA was found to have high endotoxin levels between 100 EU/mg. Endotoxin removal with the Etoxiclear column from Prometic reduced the level to between 0.5-1.0 EU/mg. This IgA was used for future experiments. Human IgG was found to have low levels of endotoxin within the range of 0.02 EU/mg, so no endotoxin removal was conducted. This sample was used for future experiments. Therefore, these antibodies were used to create synthetic immune complexes.

Preparation and Characterization of IgA- and IgG-Immune Complexes via SEC Analysis

To create synthetic IgA- and IgG-immune complexes that would potentially induce activation of an inflammatory signal in a monocytic cell line, a method of using biotinylated antibody and avidin was developed. First, the optimal ratio of avidin to biotinylated antibody needed was determined. To do this, different concentrations of avidin tested were tested (0.1, 0.2, 0.35, and 0.5 mg/mL) in combination a constant concentration of biotinylated IgA or IgG. Of 0.5 mg/mL.

Using size exclusion chromatography (SEC), a clear peak for avidin, biotinylated

IgA and IgG could be identified (Figure 3). These biotinylated monomers represent monomeric IgA and IgG and were used as comparison to differentiate the polymeric structures that represent the synthetic immune complexes.

Figure 3. Size exclusion chromatograms of avidin, biotinylated IgA, and biotinylated IgG. Size exclusion chromatography analysis of avidin (A), biotinylated IgA (B), and biotinylated IgG (C) show clears peaks at different retention time for each compound.

To identify the optimal ratio of avidin to biotinylated IgA that forms IgA-immune complexes, different concentrations of avidin were added (Figure 4). The addition of

0.1mg/mL avidin with biotinylated IgA produced IgA-immune complex mimetics; however, there was residual monomeric biotinylated IgA and a large amount of avidin remaining in the sample (Figure 4A). Similarly, 0.2 mg/mL avidin also produced immune complexes, but still had residual avidin and monomeric IgA (Figure 4B). No monomeric

IgA remained unconjugated within the sample when 0.35 mg/mL avidin was added to biotinylated IgA. All the IgA formed into complexes with minimal avidin remaining

(Figure 4C). Lastly, 0.5 mg/mL avidin addition was ineffective. Large amounts of monomeric IgA remained within the sample (Figure 4D). Therefore, the optimal

concentration to produce IgA-immune complexes with no remaining monomeric IgA in the sample was 0.35 mg/mL avidin in combination with 0.5 mg/mL biotinylated IgA.

This mixture was used in subsequent assays as a synthetic representation for polymeric

IgA immune complexes and was diluted further when necessary with PBS.

Figure 4. Size exclusion chromatograms of biotinylated IgA and varying concentrations of avidin to determine the optimal ratio to form IgA-immune complex mimetics. Different concentrations of avidin were added at 0.1 (A), 0.2 (B), 0.35 (C), and 0.5 (D) mg/mL with 0.5 mg/mL biotinylated-IgA to determine the optimal ratio to create IgA- immune complex mimetics.

The same concentrations of avidin were tested in combination with 0.5 mg/mL

IgG to determine the optimal ratio to produce IgG-immune complexes with no remaining monomeric biotinylated IgG in the sample (Figure 5). The creation of the IgG-immune

complexes with the addition of 0.1 or 0.2 mg/mL avidin showed a similar result to that of

0.1 and 0.2 mg/mL avidin with biotinylated IgA (Figure 5A and 5B). With the addition of

0.35 mg/mL avidin, this produced the best results with minimal residual monomeric biotinylated IgA (Figure 5C). This was comparable to the IgA-immune complex results.

At the highest concentration of avidin, there was large amounts of residual avidin in the sample (Figure D). Therefore, the ratio of 0.35 mg/mL avidin and 0.5 mg/mL biotinylated immunoglobulin was used in subsequent assays to create synthetic IgA- and

IgG-immune complex mimetics that would potentially induced an activation of an inflammatory signaling pathway.

A 0.1 mg/mL Avidin and 0.5 mg/mL IgG B 0.2 mg/mL Avidin and 0.5 mg/mL IgG

Immune Complexes Immune Complexes Avidin Monomeric IgG

Avidin

Monomeric IgG

C 0.35 mg/mL Avidin and 0.5 mg/mL IgG D 0.5 mg/mL Avidin and 0.5 mg/mL IgG Monomeric IgG (Absent)

Immune Complexes Monomeric IgG Avidin Avidin

Figure 5. Size exclusion chromatograms of biotinylated IgG and varying concentrations of avidin to determine the optimal ratio to form IgG-immune complex mimetics. Different concentrations of avidin were added at 0.1 (A), 0.2 (B), 0.35 (C), and 0.5 (D) mg/mL with 0.5 mg/mL biotinylated-IgG to determine the optimal ratio to create IgG- immune complex mimetics.

Selection of Genes to be Measured by qPCR to Monitor After Cellular Activation

In order to determine whether cellular activation or inhibition occurred after incubation of immune complex mimetics or blocking antibodies, an array of genes to be measured for expression changes was chosen based on a commercially available Qiagen

PCR Array Profile that measures genes identified to mediate inflammatory responses

(Table 2) (Qiagen Cat# PAHS-011Z) (Arikawa et al, 2011). Housekeeping genes, ACTB,

GUSB, and RPS14 were included within the array to normalize of the gene expression data due to their endogenous expression across human cells and tissues (Maeß et al,

2010) (Zhan et al, 2014).

CCL2, CCR1, CCR2, CXCL10, CXCL11, CXCL2, CXCL9, CXCR1, CXCR2, and CXCR4 are unique cytokines and chemokines that are activated when there is an inflammatory response. CCL2 is involved has been implicated in diseases that are characterized by monocytic infiltration, such as psoriasis and rheumatoid arthritis. CCR1 and CCR2 regulate monocyte chemotaxis and have been implicated in rheumatoid arthritis. CXCL10, CXCL11, CXCL2, CXCL9 are chemokines that can activate immune cells, such as monocytes and T cells and are responsible for mediating the immune system. CXCR1 and CXCR2 encode protein receptors that binds with high affinity to

IL8. CXCR4 also has been found to be increased during an inflammatory response

(NCBI Gene, 2018).

FCAR1, FCAR2, and FCAR3 were designed to measure changes in the expression of the different FCAR transcripts, of which there are eight. FCAR1 amplifies immunoglobulin alpha Fc receptor isoform a precursor (NM_002000.4), b precursor

(NM_113269.3), and c precursor (NM_133271.3). FCAR2 amplifies transcripts d precursor (NM_133272.3), e precursor (NM_133273.3), f precursor (NM_579808.1), and h precursor (NM_133278.3). FCAR3 amplifies g precursor (NM_133277.3) (NCBI

Gene, 2018).

ICOS, IFNG, IL10, IL17A, IL1B, IL1RN, IL33, IL6, and IL8 are different interferons and interleukins involved in immune responses. ICOS is important for cell signaling and proliferation in immune responses. IFNG encodes a cytokine that is produced by cells of the immune system, both innate and adaptive. IL10 regulates cytokines and mediates inflammation. IL17A encodes for a proinflammatory cytokine that is also known to induce increased expression of IL6, which is important in inflammation and has been linked with autoimmune and inflammatory diseases. IL1B encodes for a cytokine that is produced by activated macrophages, which are increased during an inflammatory response. IL1RN and IL33 also encodes for cytokines that increase during inflammation (NCBI Gene, 2018).

TGF-beta and TNF related genes TNFA, TGFB1, TGFB2, TNFRSF13B,

TNFSF13, and TNFSF13B are members of the transforming growth factor and tumor necrosis factor families. These genes have been found to have increased expression during inflammatory responses and have been linked with many autoimmune diseases and cancers.

This gene array included many genes involved in inflammatory responses and would indicate whether a pro-inflammatory signal was induced by the IgA- or IgG- immune complex mimetics by increased expression in these genes. Inhibition with blocking antibody would be indicated by a decrease in expression and a return to normal levels like the control group treated with PBS (NCBI Gene, 2018).

Optimization of Immune Complex Driven Cellular Stimulation of U937 Cells

Different cell lines were considered for these studies. Monocytic cells are known to be susceptible to immune complex activation leading to increased mRNA expression of cytokines and chemokines that can cause inflammation (Janeway, 2016). In order to have stable cell lines suitable for robust in vitro studies, the monocytic U937 cells were selected due to their expression of the IgA receptor, FcαRI, and FcR. They have been previously used to analyze the effects of immune complex activation and subsequent inhibition with a blocking FcαRI antibody (Moura, 2005) (Monteiro, 1990).

To determine the optimal incubation period for the IgA-immune complexes with these cells, a time course experiment was conducted. The two time points tested were 30 minutes and one hour. In addition to the time course, two types of cell culture growth media, base media RPMI 1640 with 10% FBS and RPMI 1640 with 2% FBS and low serum IgG, were analyzed to determine. The two types of media were tested to determine if media with lower serum IgG would improve the activation signal in cells when they were incubated with IgA-immune complex mimetics.

At both 30 minutes and one hour incubation, IgA-immune complexes induced an increase in expression of IL8 compared to the control group incubated with PBS alone (p value = 0.0002) (Figure 6). Focusing on the 30 minute incubation, this increase in IL8 expression was also seen with both media types, RPMI 1640 with 10% FBS and RPMI

1640 with 2% FBS and low serum IgG (p value = 0.0002 and p value = 0.0008, respectively, when compared to PBS control group). There was about a 4-fold increase in

IL8 compared to the control (fold change = 4.1 and fold change = 4.6, respectively). As expected, avidin and biotinylated-IgA treatment groups induced no significant changes in

IL8 expression. Biotinylated-IgA was used as synthetic monomeric IgA. Since binding of monomeric IgA to the FcαRI receptor may cause an activation of the ITAMi pathway, it was expected that biotinylated-IgA may not cause an increase in IL8 since this is a marker for the pro-inflammatory pathway.

One hour incubation with IgA-immune complexes induced a greater increase in

IL8 expression compared to the 30-minute incubation (8-fold versus 4-fold, respectively).

Compared to the PBS control group incubated for one hour, this was a significant increase in expression (p value = 0.00004). Due to the greater magnitude of increase in

IL8 expression at one hour incubation, future assays were conducted with this incubation time.

The RPMI 1640 media with 2% FBS and low serum IgG produced similar changes in expression of IL8 compared to the base media, RPMI 1640 with 10% FBS; however, the RPMI 1640 with 10% FBS media treated groups had less variability.

Therefore, the media with 2% FBS and low serum IgG did not appear to provide a clearer

inflammatory signal; thus, all future assays were conducted using the base media with

10% FBS.

All other genes measured in this assay did not show any significant changes in gene expression when compared to PBS control group at either time point or with either media type (Appendix, Figure 12, 13, 14, and15 and Tables 3, 4, 5, and 6).

This experiment helped to define assay conditions for the U937 cells; thus, creating a basis for future assay conditions to be tested, including the use of different immune complex concentrations and the introduction of blocking antibodies.

IL8

10 30 Minutes 1 Hour 9 RPMI 1640,10% FBS 8 RPMI 1640, 2% FBS, low serum IgG 7

p 6

C 5 

 4 3 2 1 0 -1 S n n S n n S n n S n n i ti IC i ti IC i ti IC i ti IC B id o - B id o - B id o - B id o - P v i A P v i A P v i A P v i A A -b Ig A -b Ig A -b Ig A -b Ig A A A A g g g g I I I I

Figure 6. IgA-immune complex mimetics cause an increase in IL8 gene expression at two time points and with two media types. U937 cells were incubated with IgA-immune complexes (IgA-IC) for 30 minutes or one hour in either RPMI 1640, 10% FBS or RPMI 1640, 2% FBS, and low serum IgG. Incubation at both time points and with both media types induced an increase in IL8 expression.

Varying Concentrations of IgA-immune Complexes to Induce Activation

After determining the appropriate assay conditions, the next step was to determine the optimal concentration of biotinylated IgA in combination with 0.35 mg/mL avidin to create the IgA-immune complex mimetics able to induce the greatest amount of activation as measured by an increased gene expression. A titration curve of IgA-immune complexes was measured at the following concentrations: 12.5, 25, 50, and 75 µg/mL biotinylated IgA. The same qPCR gene array was measured as in previous experiments.

IgA-immune complexes induced gene expression changes at all concentrations of biotinylated IgA. Five genes had increased expression after one hour immune complex incubation: IL8, CXCL2, TNFA, IL1B, and FCAR1. All other genes had no change in expression compared to the PBS control group (Appendix, Figure 7).

The 25, 50, and 75 µg/mL IgA-immune complex concentrations induced a 6.8,

6.8, and 7.2-fold increase in IL8 gene expression compared to the control, whereas the

12.5 µg/mL IgA-immune complex concentration induced a lesser 4.66-fold increase

(Appendix, Figure 7). These increases in IL8 expression were all significant compared to the PBS control group (p value = 0.00004, 0.00003, 0.00005, and 0.00001, respectively).

This indicates that IgA-immune complexes induce a pro-inflammatory activation within the cells.

A similar trend was seen for CXCL2, TNFA, IL1B, and FCAR1 expression. The

25, 50, and 75 µg/mL IgA-immune complex concentrations induced an increase in expression of these genes to a similar degree (Appendix, Figure 7). For CXCL2, TNFA, and IL1B, expression was at least two-fold or greater compared to the PBS control group.

FCAR1 had a trend towards increased expression, but only the 75 µg/mL concentration induced greater than a two-fold increase. The 12.5 µg/mL IgA-immune complex concentration induced a smaller magnitude of change in expression compared to the other concentrations tested. All other genes measured showed no changes when incubated with

IgA-immune complexes compared to the PBS control group (Appendix, Figure 16, 17,

18, 19, 20, 21, and 22 and Table 7 and 8).

Since the 25, 50, and 75 µg/mL IgA-immune complex concentrations induced similar changes in expression of the genes that were activated, the 25 µg/mL IgA- immune complex was used for future experiments to save on reagents. With this concentration, any reduction in signal induced by incubation with blocking antibodies would be able to be determined.

Varying Concentrations of IgG-immune Complexes to Induce Activation

In addition to determining the optimal concentration for the IgA-immune complex mimetics, the same experiment was repeated to determine the optimal concentration for

IgG-immune complex mimetics. The concentrations tested were 12.5, 25, 50, and 75

µg/mL biotinylated IgG with 0.35 mg/mL avidin. All concentrations induced approximately a two-fold increase in IL8 expression compared to the PBS control group

(p values = 0.001, 0.003, 0.004, and 0.002, respectively) (Figure 8). All other genes measured showed no changes when incubated with IgG-immune complexes compared to the control (Appendix, Figure 23, 24, 25, 26, 27, 28, 29, and 30 and Table 9 and 10). To remain consistent with the chosen IgA-immune complex concentration, 25 µg/mL of

IgG-immune complex was used in future experiments.

IL8 3.0 No immune complex 2.5 IgG-immune complex 2.0

p 1.5 C

 1.0  0.5 0.0 -0.5 -1.0 S in in IC IC IC IC B d t - - - - P i io G G G G v b g g g g A - I I I I G L L L L L g /m I /m /m /m /m g L g g g g u m u u u u 5 / 5 5 0 5 3 g . 2 5 7 u 2 5 1 2

Figure 8. Titration of IgG-immune complex mimetics induce increased IL8 expression. IL8 showed an increase in expression when cells were incubated with IgG-immune complex mimetics at different concentrations.

Inhibition of IgA- and IgG-immune complex Activation with Blocking Antibodies

Five different antibodies designed to bind the FcαRI receptor and block interaction with IgA were chosen to measured inhibition of the pro-inflammatory signaling that was activated by IgA- and IgG-immune complex mimetics. If these antibodies showed the ability to inhibit the signaling seen in the previous experiments, then the results would indicate that the inflammatory signaling pathway is being activated through the FcαRI receptor.

The following antibodies were used in the assays: mouse Anti-FcαRI monoclonal antibodies MIP8a, MIP7c and MIP68b were purchased from Novus Biologicals, antibody

MIP8a was obtained from LifeSpan. MIP8a and MIP7c are blocking antibodies. MIP68b is a non-blocking antibody. Incubating the cells with the synthetic immune complexes and the blocking antibodies was expected to inhibit the activation signaling of pro- inflammatory markers; thus, lead to a decrease in expression of the genes that had increased expression in the previous assays.

As previously shown, the IgA-immune complex mimetics caused an activating signal that led to increased expression of IL8 (p value = 0.08), FCAR1 (p value = 0.19),

TNFA (p value = 8.5E-08), CXCL2 (p value = 0.01), and IL1B (p value = 0.20) when compared to the PBS control group (Appendix, Figure 9). IgA-immune complex mimetics induced IL8 and CXCL2 expression to increase 6-fold compared to the control.

TNFA expression increased three times more compared to the control. IL1B ranged from a 2-fold to 5-fold increase in expression. FCAR1, which measured changes in mRNA transcripts 1, 2, or 3, had a trend of an increase in expression.

The blocking antibodies MIP8a from both commercial sources and MIP7c successfully inhibited the activation signal induced by IgA-immune complex mimetics

(Appendix, Figure 9). IL8, FCAR1, TNFA, CXCL2, and IL1B expression returned to the level of the PBS control group. The non-blocking antibody, MIP68b, did not inhibit this activation signaling, as predicted. This model showed that the pro-inflammatory signaling could be reversed with the introduction of a FcαRI receptor inhibitor. The other genes measured for expression showed no changes compared to the PBS control group

(Appendix, Figure 31, 32, 33, 34, 35, 36, and 37 and Table 11 and 12).

Additionally, IgG-immune complex activation was measured. As previously seen,

IL8 expression increased in the presence of IgG-immune complex mimetics, but with a wide range of variability (p value = 0.081) (Figure 10). The other measured for expression showed no changes compared to the PBS control group (Appendix, Figure 38,

39, 40, 41, 42, 43, 44, and 45 and Table 13 and 14).

Interestingly, the FcαRI blocking antibodies inhibited this IgG-immune complex mimetic activation as shown by the IL8 decreased expression (Figure 10). This implied that there may be a cross-talk in the ITAMi pathway and the IgG-activated signaling. If blocking IgA’s only activating Fc receptor also inhibits IgG pro-inflammatory activated signaling, then it indicates a broader importance of the FcαRI receptor. This receptor may potentially be an additional mechanism by which IgG driven inflammation occurs. It’s possible then that inflammation in those with autoimmune diseases may have an IgA and

IgG driven disease that leads to a cross-talk between the two pathways.

IL8 4

p 2 No immune complex

C 

 1 IgG-immune complex

-1 ) ) ) ) S in in c b o o C c b o o B d t 7 8 i i -I 7 8 i i P i io IP 6 B b G IP 6 B B v b IP S s g IP S s A - M L u I M L u G M ( v d M ( v g a o n d a o I 8 N a 8 ( n (N IP a C a IP 8 -I C a M -I M 8 IP G d IP Ig G n M Ig a M d IC n - a G C Ig -I G Ig

Figure 10. IgG-immune complex mimetics activation is inhibited by FcαRI blocking antibodies. IgG-immune complex mimetics induced a pro-inflammatory signal in U937 cells as seen by increases in IL8 expression. When the immune complexes were incubated with FcαRI blocking antibodies, this signal was inhibited, thus causing decreased expression of IL8.

When comparing IgA- and IgG-immune complex activation, IgG-immune complex mimetics induce activation to a small magnitude, as seen with IL8 expression

(Figure 11). IgA-immune complex mimetics caused a 5.5-fold increase in IL8 expression, whereas IgG-immune complex mimetics induced a 1.8-fold increase. This implies that the pro-inflammatory signaling induced by IgA- or IgG-immune complexes is potentially mediated by the FcαRI receptor, suggesting a crosstalk between the two mechanisms.

IL8 8 7 6

5 No immune complex p

C 4 IgA-immune complex 

 3 IgG-immune complex 2 1 0 -1 ) ) ) ) ) ) S in in in c b o o C c b o o C c b o B d t t 7 8 i i -I 7 8 i i -I 7 8 i io P i io io IP 6 B b A IP 6 B B G IP 6 B B v b b IP S s g IP S s g IP S s A - - M L u I M L u I M L u A G M ( v d M ( v d M ( v g g a o n d a o n d a o I I 8 N a 8 a 8 ( n (N n (N IP a C a IP C a IP 8 -I C a -I C a M -I M 8 -I M 8 IP A d IP G d IP Ig A n Ig G n M Ig a M Ig a M d d IC n IC n - a - a A C G C Ig -I Ig -I A G Ig Ig

Figure 11. IgA- and IgG- immune complex memetics activation and inhibition with FcαRI blocking antibodies. IgA-immune complex mimetics induce a greater activation signal in the U937 cells when compared to IgG-immune complex mimetics.

Chapter IV

Discussion

Polymeric IgA, or IgA-immune complexes, have been shown to induce pro- inflammatory signaling via the ITAM pathway in cells that have the FcRI receptor on its surface. Multiple studies illustrated that IgA-immune complexes cause increased inflammation and are linked with a range of autoimmune diseases. This was based on the presence of elevated IgA-immune complex levels in patients with these diseases (Levy et al., 1994) (Bendaoud et al., 1991) (Gupta et al., 2002). Therefore, it has been theorized that patients who do not respond to IgG targeting therapeutics may instead have an IgA driven disease or have a combination of IgG and IgA driving their disease pathophysiology. Due to this possible correlation, researchers seek to learn more about polymeric IgA’s ability to induce a pro-inflammatory pathway and determine if blocking antibodies targeting the FcRI receptor could inhibit this mechanism (Monteiro, 2014)

(Blank et al., 2009). The goal has been to design targeted therapeutics that could help those with IgA driven diseases.

Previous research has been conducted using monocytes, which express the FcRI receptor and are an important part of both the innate and adaptive immune system. When these cells were stimulated with IgA-immune complexes, pro-inflammatory signaling marked by increased IL-6 and TNF-alpha was observed (Wolf et al., 1996) (Wolf et al.,

1994). Monteiro et al. and Wolf et al. showed that inhibition with a blocking antibody prevented the engagement of the FcRI receptor and the IgA-immune complexes. Thus, this led to an inhibition of the pro-inflammatory signaling. Not only did they see this anti-

inflammatory signaling in monocytes, but they also observed no development of asthma and prevented kidney inflammation in mouse models. These observations implied that by blocking the FcRI receptor, inflammation could be inhibited and reversed in disease.

Additionally, they also observed that a blocking FcRI receptor antibody inhibited IgG- mediated phagocytosis. This implied a potential crosstalk between IgA, the FcRI receptor, and IgG in IgG-mediated pro-inflammatory activation.

Based on this previous research, this thesis sought to develop a fast, in vitro characterization tool for analyzing the effects of activation and inhibition using immune complexes and blocking antibodies in monocytic cells. First, a method for creating synthetic IgA- and IgG-immune complex memetics was designed that had not previously been reported by combining biotinylated immunoglobulins with avidin. The synthetic

IgA-immune complexes induced a pro-inflammatory response when incubated with U937 cells. This was characterized by an increase in the gene expression of chemokines and cytokines IL8, FCAR1, CXCL2, TNFA, and IL1B (Figure 8). This confirmed what was shown in the literature that pro-inflammatory signaling can be induced in the presence of immune complexes (Wolf et al., 1996) (Wolf et al., 1994). In comparison, monomeric

IgA did not cause increased expression of the genes when incubated with the cells. This was expected since the ITAM pathway is only induced by polymeric IgA.

Additionally, incubating IgG-immune complexes with the cells also caused a pro- inflammatory signal leading different activation profile than the IgA-immune complexes.

The IgG-immune complexes induced an increase in expression of IL8 only (Figure 9).

Previous research has shown that IgG1- and IgG2-immune complexes have a weak to no effect on pro-inflammatory activation in U937 cells (Kecse-Nagy, et al., 2016). In this

same experiment, scientists shown that IgG3 and IgG4 complexes could induce activation in these cells. They theorized that different IgG isotypes mediate activation through the

Fc receptors in U937 cells (Kecse-Nagy, et al., 2016). This could potentially explain why only IL8 had increased expression in the studies conducted for this thesis. The human serum IgG used to create the immune complexes contains all Ig isotypes. Therefore, the

IgG mixture may have contained more of the weaker activating isotypes, thus showing the weaker activation signal via gene expression.

In addition to developing a characterization tool to measure immune complex activation, this thesis also outlined an inhibition assay using blocking FcαRI antibodies,

MIP7c and MIP8a. Incubation with these antibodies and the IgA-immune complexes inhibited the pro-inflammatory signaling causing a decrease in gene expression of IL8,

FCAR1, TNFA, CXCL2, and IL1B (Figure 10). Interestingly, IgG-immune complex activation was also inhibited with the FcRI blocking antibodies and led to a decrease in

IL8 expression. This suggested that IgG-immune complex signaling might also be mediated through the FcRI receptor. This result implied potential cross talk between

IgA, IgG, and the FcRI receptor. It is possible that there is a convergent pathway causing pro-inflammatory signaling, rather than IgA or IgG alone driving disease. This was previously seen in Pasquier’s et al. and Monteiro’s work. Their research showed that blocking with a FcRI antibody inhibited IgG-mediated phagocytosis and IgG mediated cytokine release (Pasquier, 2005) (Monteiro, 2014). However, this mechanism of this pathway is still unknown. Pasquier theorizes that inhibiting FcRI causes a weaker phosphorylation of the Fcγ receptors, thus leading to weaker recruitment of Syk and subsequently a decreased inflammatory response (Pasquier, 2005). The assay developed

in this thesis would help to further investigate this crosstalk between the FcRI receptor,

IgA, and IgG.

This thesis confirmed a simple in vitro assay method that enables the fast characterization of IgA- and IgG-immune complex induced pro-inflammatory activation and subsequent inhibition with an antibody that blocks the IgA receptor, FcRI.

Additionally, this method modeled the crosstalk between IgA, IgG, and the FcRI receptor. This research provides a method that could be a useful tool to better characterize other inhibitors of FcRI receptor or other IgA or IgG specific receptors that are known to be a part of the pro-inflammatory pathway, as well as analyze the effects of combined IgA- and IgG-immune complex activation. Therefore, the assay can serve as an efficient screening method to identify potential therapeutic products targeting the FcRI pathway.

Appendix

Additional Tables and Figures

Table 1. Primer List for Measuring Gene Expression in Pro-Inflammatory Pathways. Gene Forward Primer Reverse Primer Symbol ACTB CCC CAG CCA TGT ACG TTG CT ACG CAC GAT TTC CCG CTC GGC C CCL2 AGC TGT GAT CTT CAA GAC CAT TG AGT GAG TGT TCA AGT CTT CGG A CCR1 AAG TCC CTT GGA ACC AGA GAG A GTA CAG AGG GGG CAG CAG TT CCR2 CCA CAA GCT GAA CAG AGA AAG T CCG CTC TCG TTG GTA TTT CTG CXCL10 GCA AGG AAA GGT CTA AAA GAT CTC GGT CAC CTT TTA GTG TAA CTG CA CXCL11 AGC AAG GCT TAT AAT CAA AAA AGT TG TTC TTG TCA TTT CAG TAG TCA CAG CXCL2 CCG AAG TCA TAG CCA CAC TC CCT TCC TTC TGG TCA GTT GG CXCL9 CCA GTA GTG AGA AAG GGT CGC AGG GCT TGG GGC AAA TTG TT CXCR1 GGT GCT TCA GTT AGA TCA AAC C GTG TCT CAG TTT CTA GCA TAC AG CXCR2 GCG ACC CAG TCA GGA TTT AAG ACA TGG GGC GGC ATC TAG TA CXCR4 TTC GCC TGT TGG CTG CCT T ACA ACA GTG GAA GAA AGC TAG G FCAR1 TGTCTTGTGCTCTGTCTGGG GCCTGGCACTGGATTTTCAC FCAR2 CCTCCTGTGTCTTGGGGACT AATGGCCTGGCACTGGATTT FCAR3 TGTGTCTTGGCTTGTATGGCA CCCTCCTTGGCCAGTGAAAA FCER1G AGCAGTGGTCTTGCTCTTACT TGCCTTTCGCACTTGGATCTT GUSB GGATGCTGTACCCCCAGGAG GGGGCCTGACTCCCACAG FCGR2A GCG GAT TTC AGC CAA TTC CAC TCA TGT AGC CGC CGT CAG C ICOS GGG ATG CAT ACT TAT TTG TTG GC GGA AAA CTG GCC AAC GTG CT IFNG CTG ACT AAT TAT TCG GTA ACT GAC CCT CGA AAC AGC ATC TGA CTC IL10 CTA CGG CGC TGT CAT CGA TT CGT ATC TTC ATT GTC ATG TAG GC IL17A GGA TGC CCA AAT TCT GAG GAC CCT CAT TGC GGT GGA GAT TC IL1B GGA GCA ACA AGT GGT GTT CTC GGA TCT ACA CTC TCC AGC TG IL1RN TCC AGC TGG AGG CAG TTA AC TTC CAT CGC TGT GCA GAG GA IL33 CAG GTG ACG GTG TTG ATG GT GAA GGC CTG GTC TGG CAG IL6 ATT CAA TGA GGA GAC TTG CCT G CTC TGG CTT GTT CCT CAC TAC IL8 GAT TGA GAG TGG ACC ACA CTG TTT TAT GAA TTC TCA GCC CTC TTC RPS14 CACTTTTGTCCATGTCACTGATC AGCAGCATATGGTGAGGATTC TNFA CCA GGC AGT CAG ATC ATC TTC TAG ATG AGG TAC AGG CCC TC TGFB1 TGC TGG CAC CCA GCG ACT GGC CGG TAG TGA ACC CGT TGFB2 CTT TGG ATG CGG CCT ATT GC CAG GAC CCT GCT GTG CTG TNFRSF13B CAG AAG CAA GTC CAG CTC TC GTG ATC CTG GGA AGA CTT GG TNFSF13 TGT ATA GCC AGG TCC TGT TTC A TGG GAG GGC ATA CTT CTT ATA C TNFSF13B CTA TTC AGC TGG CAT TGC AAA AC GGT GTA AGT AGG TCA CAG CAG

Table 2. Gene Array for Measuring Gene Expression Changes in Pro-Inflammatory Pathways with qPCR. Gene Symbol Class Gene Name ACTB housekeeping B-actin CCL2 Chemokine MCP1, C-C motif chemokine 2 CCR1 Chemokine (Receptor) Chemokine (C-C motif) receptor 1 CCR2 Chemokine (Receptor) C-C motif chemokine Receptor 2 CXCL10 Chemokine IP10, C-X-C motif chemokine 10 CXCL11 Chemokine ITAC, C-X-C motif chemokine 11 CXCL2 Chemokine GRO Beta, C-X-C motif chemokine 2 CXCL9 Chemokine Homo sapiens chemokine (C-X-C motif) ligand 9 CXCR1 Chemokine (Receptor) C-X-C motif chemokine Receptor 1 CXCR2 Chemokine (Receptor) C-X-C motif chemokine Receptor 2 CXCR4 Chemokine (Receptor) C-X-C motif chemokine Receptor 4 FCAR1 Fc receptor Fc fragment of IgA receptor, transcripts 1, 2, 3 FCAR2 Fc receptor Fc fragment of IgA receptor, transcripts 4, 5, 6, 8 FCAR3 Fc receptor Fc Fragment of IgA receptor, transcript 7 FCER1G Fc receptor FC Fragment of IgE receptor Ig FCGR2A Fc receptor Fc fragment of IgG, low affinity IIa, receptor (CD32a) FCGR2B Fc receptor FC Gamma Receptor 2B GUSB housekeeping Beta-glucuronidase ICOS Activation inducible T cell co-stimulator IFNG Interferons Interferon Gamma IL10 Interleukins Interleukin 10 IL17A Interleukin Interleukin 17A IL1B Interleukin Interleukin 1B IL1RN Interleukin (Receptor) Interleukin 1 receptor antagonist IL33 Interleukin Interleukin 33 IL6 Interleukin Interleukin 6 IL8 Interleukin Interleukin 8 RPS14 housekeeping Ribosomal Protein S14 TNFA Cytokine Tumor necrosis factor alpha TGFB1 TGF-beta receptor Transforming growth factor, beta 1 TGFB2 TGF-beta receptor Transforming growth factor, beta 2 TNFRSF13B TNF superfamily Tumor necrosis factor receptor 13B TNFSF13 TNF superfamily TNF superfamily member 13 TNFSF13B TNF superfamily TNF superfamily member 13b

IL8 TNFA 8 3.0 7 2.5 6 2.0 5

1.5

p p

C 4

C 

 1.0  3  2 0.5 1 0.0 0 -0.5 -1 -1.0 n n S i i IC IC IC IC S in in IC IC IC IC B d t - - - - B d t - - - - P i io A A A A P i o A A A A v b g g g g v i A - I I I I A -b Ig Ig Ig Ig A L L L L L g L A L L L L m I /m /m /m /m m Ig m m m m / L g g g g / / / / / g u u u u g L g g g g u /m u m u u u u 0 g .5 5 0 5 0 / 5 5 0 5 5 u 2 2 5 7 g . 2 5 7 1 5 u 2 0 0 1 5 5

CXCL2 IL1B 5 4

4 3 2

3 p

p 1

C 

 2   0 1 -1

0 -2

-1 -3

S in in IC IC IC IC S in in IC IC IC IC B d t - - - - B d t - - - - P i io A A A A P i io A A A A v g g g g v g g g g A -b I I I I A -b I I I I A L L L L A L L L L L g L g /m I /m /m /m /m /m I /m /m /m /m g L g g g g g L g g g g u m u u u u u m u u u u / 5 5 0 5 / 5 5 0 5 0 g . 2 5 7 0 g . 2 5 7 5 u 2 5 u 2 0 1 0 1 5 5

FCAR1 2.5

2.0

1.5

p 1.0 C

 No immune complex  0.5 IgA-immune complex 0.0

-0.5

-1.0

S in in IC C C C B d t - -I -I -I P i io A A A A v b g g g g A - I I I I A L L L L L g /m I /m /m /m /m g L g g g g u m u u u u / 5 5 0 5 0 g . 2 5 7 5 u 2 0 1 5

Figure 7. Titration of IgA-immune complex mimetics induce activation in U937 cells. IL8, CXCL2, TNFA, IL1B, and FCAR1 showed increases in expression when cells were incubated with IgA-immune complexes at different concentrations.

IL8 FCAR1 8 2.0 7 1.5 6 1.0

5 p

p 0.5 C

C 4 

 0.0   3 2 -0.5 1 -1.0 0 -1.5 -1 -2.0 ) ) ) ) ) ) ) ) S in in c b o o IC c b o o S in in c b o o C c b o o B d t 7 8 i i - 7 8 i i B d t 7 8 i i -I 7 8 i i P i io IP 6 B b A IP 6 B B P i io IP 6 B b A IP 6 B B v b IP S s g IP S s v b IP S s g IP S s A - M L u I M L u A - M L u I M L u A M ( v d M ( v A M ( v d M ( v g a o n d a o g a o n d a o I 8 N a n 8 N I 8 N a n 8 N P ( a P ( ( ( I a C I IP a C a IP 8 -I C a -I C a M -I M 8 M 8 I M 8 IP A d IP IP A - d IP M Ig A n Ig A n Ig a M M Ig a M d d IC n C - a -I n A a g C A C I -I Ig -I A A Ig Ig

TNFA CXCL2 4 7 6 3

5 p

p 2 4

C   3

1   2 0 1 -1 0 -1 ) ) ) ) ) ) ) ) S in in c b o o IC c b o o S in in c b o o C c b o o B d t 7 8 i i - 7 8 i i B d t 7 8 i i -I 7 8 i i P i io IP 6 B b A IP 6 B B P i io IP 6 B b A IP 6 B B v b IP S s g IP S s v b IP S s g IP S s A - M L u I M L u A - M L u I M L u A M ( v d M ( v A M ( v d M ( v g a o n d a o g a o n d a o I 8 N a n 8 N I 8 N a n 8 N ( a ( ( ( IP a C IP IP a C a IP 8 -I C a 8 -I C a M -I M 8 M I M 8 IP A d IP IP A - d IP Ig A n Ig A n M Ig a M M Ig a M d d IC n IC n - a - a A C A C Ig -I Ig -I A A Ig Ig

IL1B 6 5 4

3 p

C 2 No immune complex 

 1 0 IgA-immune complex -1 -2 -3 ) ) ) ) S in in c b o o C c b o o B d t 7 8 i i -I 7 8 i i P i io IP 6 B b A IP 6 B B v b IP S s g IP S s A - M L u I M L u A M ( v d M ( v g a o n d a o I 8 N a n 8 N P ( a P ( I a IC I a M 8 - IC M 8 IP A - d IP Ig A n M Ig a M d IC n - a A C Ig -I A Ig

Figure 9. IgA-immune complex mimetics activation is inhibited by FcαRI blocking antibodies. IgA-immune complex mimetics induced a pro-inflammatory signal in U937 cells as seen by increases in IL8, FCAR1, TNFA, CXCL2, and IL1B expression. When the immune complexes were incubated with FcαRI blocking antibodies, this signal was inhibited, thus causing decreased expression of IL8, FCAR1, TNFA, CXCL2, and IL1B.

ACTB RPS14 1.0 2.0 30 Minutes 1 Hour 30 Minutes 1 Hour 0.5 1.5

0.0 p

p 1.0

C 

 -0.5   0.5 -1.0 0.0 -1.5

-2.0 -0.5 S n n C S n n C S n n C S n n C S n n C S n n C S n n C S n n C i ti -I i ti -I i ti -I i ti -I i ti -I i ti -I i ti -I i ti -I B id o B id o B id o B id o B id o B id o B id o B id o P v i A P v i A P v i A P v i A P v i A P v i A P v i A P v i A A -b Ig A -b Ig A -b Ig A -b Ig A -b Ig A -b Ig A -b Ig A -b Ig A A A A A A A A Ig Ig Ig Ig Ig Ig Ig Ig

CCL2 IL1B 30 Minutes 1 Hour 2.0 30 Minutes 1 Hour 1.5

1.5 1.0 0.5

1.0 p

p 0.0

C 

 0.5   -0.5 0.0 -1.0

-0.5 -1.5

-1.0 -2.0 S n in C S n in C S n in C S n in C S in in IC S in in IC S in in IC S in in IC B i t -I B i t -I B i t -I B i t -I B d t - B d t - B d t - B d t - id o id o id o id o P i io A P i io A P i io A P i io A P v i A P v i A P v i A P v i A v g v g v g v g A -b Ig A -b Ig A -b Ig A -b Ig A -b I A -b I A -b I A -b I A A A A A A A A Ig Ig Ig Ig Ig Ig Ig Ig

RPMI 1640,10% FBS RPMI 1640, 2% FBS, low serum IgG

Supplemental Figure 12: Time Course and Cell Culture Media Effects After IgA-immune complex Mimetics Activation as Measured Via ACTB, RPS14, CCL2, and IL1B Expression. Measured expression of CCR2, ACTB, RPS14, CCL2, and IL1B to determine the appropriate time point and cell culture media to be used in future experiments.

GUSB 30 Minutes 1 Hour FCER1G 2.5 30 Minutes 1 Hour 1.5 2.0

1.5 1.0

p 1.0 C

p 0.5



C  0.5   0.0 0.0

-0.5 -0.5

-1.0 -1.0 S in in C S in in C S in in C S in in C B t -I B t -I B t -I B t -I S n n S n n S n n S n n id o id o id o id o i ti IC i ti IC i ti IC i ti IC P v i A P v i A P v i A P v i A B id o - B id o - B id o - B id o - A -b Ig A -b Ig A -b Ig A -b Ig P v i A P v i A P v i A P v i A A A A A A -b Ig A -b Ig A -b Ig A -b Ig Ig Ig Ig Ig A A A A Ig Ig Ig Ig

FCAR2 FCGR2A 30 Minutes 1 Hour 30 Minutes 1 Hour 3.0 3

2.5 2 1 2.0

0 p

p 1.5

C C

 -1

   1.0 -2 0.5 -3 0.0 -4

-0.5 -5 S in in C S in in C S in in C S in in C S in in IC S in in IC S in in IC S in in IC B d t -I B d t -I B d t -I B d t -I B d t - B d t - B d t - B d t - P i io A P i io A P i io A P i io A P i io A P i io A P i io A P i io A v g v g v g v g v b g v b g v b g v b g A -b I A -b I A -b I A -b I A - I A - I A - I A - I A A A A A A A A Ig Ig Ig Ig Ig Ig Ig Ig

RPMI 1640,10% FBS RPMI 1640, 2% FBS, low serum IgG

Supplemental Figure 13. Time Course and Cell Culture Media Effects on IgA-immune complex Mimetics Activation as Measured Via GUSB, FCER1G, FCAR2, and FCGR2A Expression. Measured expression of GUSB, FCER1G, FCAR2, and FCGR2A to determine the appropriate time point and cell culture media to be used in future experiments.

IL6 30 Minutes 1 Hour FCAR1 2 30 Minutes 1 Hour 1 5 0 4 -1 3

p -2

C p

 -3

C 2

 

-4  -5 1 -6 0 -7 -8 -1 S in in C S in in C S in in C S in in C B t -I B t -I B t -I B t -I S n n S n n S n n S n n id o id o id o id o i ti IC i ti IC i ti IC i ti IC P v i A P v i A P v i A P v i A B id - B id - B id - B id - A -b Ig A -b Ig A -b Ig A -b Ig P v io A P v io A P v io A P v io A A A A A A -b Ig A -b Ig A -b Ig A -b Ig Ig Ig Ig Ig A A A A Ig Ig Ig Ig

TGFB2 FCAR3 30 Minutes 1 Hour 30 Minutes 1 Hour 4 4 3 3 2 2 1

1 p

p 0

C C

 0

 -1

  -2 -1 -3 -2 -4 -3 -5 -6 -4 S in in IC S in in IC S in in IC S in in IC S in in IC S in in IC S in in IC S in in IC B d t - B d t - B d t - B d t - B d t - B d t - B d t - B d t - P i io A P i io A P i io A P i io A P i io A P i io A P i io A P i io A v b g v b g v b g v b g v g v g v g v g A - I A - I A - I A - I A -b I A -b I A -b I A -b I A A A A A A A A Ig Ig Ig Ig Ig Ig Ig Ig

RPMI 1640,10% FBS RPMI 1640, 2% FBS, low serum IgG

Supplemental Figure 14. Time Course and Cell Culture Media Effects on IgA-immune complex mimetics Activation as Measured Via IL6, FCAR1, TGFB2, and FCAR3 Expression. Measured expression of IL6, FCAR1, TGFB2, and FCAR3 to determine the appropriate time point and cell culture media to be used in future experiments.

CCR1 30 Minutes 1 Hour CCR2 2 30 Minutes 1 Hour 1 2 0 1 -1 0 -1

p -2 C

p -2

 -3

C 

 -3

-4  -4 -5 -5 -6 -6 -7 -7 -8 -8 S in in C S in in C S in in C S in in C B t -I B t -I B t -I B t -I S n n S n n S n n S n n id o id o id o id o i ti IC i ti IC i ti IC i ti IC P v i A P v i A P v i A P v i A B id o - B id o - B id o - B id o - A -b Ig A -b Ig A -b Ig A -b Ig P v i A P v i A P v i A P v i A A A A A A -b Ig A -b Ig A -b Ig A -b Ig Ig Ig Ig Ig A A A A Ig Ig Ig Ig

RPMI 1640,10% FBS RPMI 1640, 2% FBS, low serum IgG

Supplemental Figure 15. Time Course and Cell Culture Media Effects on IgA-immune complex mimetics Activation as Measured Via CCR1 and CCR2 Expression. Measured expression of CCR1 and CCR2 to determine the appropriate time point and cell culture media to be used in future experiments.

Table 3. Statistical analysis (p values) of all genes measured for expression and the effects of cell culture media at 30 minutes incubation with IgA-immune complex mimetics.

Group Avidin IgA-biotin IgA-IC PBS Avidin IgA-biotin IgA-IC RPMI 1640 RPMI 1640 RPMI 1640 RPMI 1640 RPMI RPMI RPMI with 2% with 2% with 2% with 2% Media Type 1640 plus 1640 plus 1640 plus FBS, low FBS, low FBS, low FBS, low 10% FBS 10% FBS 10% FBS serum IgG serum IgG serum IgG serum IgG Incubation 30 minutes p value p value p value p value p value p value p value ACTB 0.499 0.092 0.235 0.379 0.294 0.281 0.227 CCL2 0.590 0.905 0.074 0.221 0.262 0.047 0.183 RPS14 0.499 0.092 0.235 0.379 0.294 0.281 0.227 IL1B 0.794 0.844 0.858 0.287 0.082 0.050 0.679 GUSB 0.542 0.037 0.548 0.917 0.326 0.732 0.137 IL8 0.158 0.727 0.000 0.002 0.120 0.102 0.001 FCER1G 0.369 0.082 0.217 0.989 0.671 0.265 0.616 FCAR2 0.527 0.047 0.039 0.926 0.113 0.092 0.093 FCGR2A 0.295 0.297 0.198 0.343 0.547 0.871 1.000 IL6 0.691 0.199 0.663 0.688 0.189 0.945 0.432 FCAR1 0.579 0.294 0.026 0.547 0.574 0.335 0.173 TNFRSF13B 0.363 0.369 0.911 0.892 0.711 0.473 0.647 FCAR3 0.591 0.907 0.836 0.688 0.399 0.299 0.636 CCR1 0.487 0.230 0.210 0.081 0.184 0.723 1.000 CCR2 0.542 0.897 0.522 0.937 0.665 0.414 1.000

Note. Statistical analysis is calculated compared to the control PBS group.

Table 4. Statistical analysis (fold change log2) of all genes measured for expression and the effects of cell culture media at 30 minutes incubation with IgA-immune complex mimetics.

IgA- Group Avidin IgA-IC PBS Avidin IgA-biotin IgA-IC biotin RPMI 1640 RPMI 1640 RPMI 1640 RPMI 1640 RPMI RPMI RPMI with 2% with 2% with 2% with 2% Media Type 1640 plus 1640 plus 1640 plus FBS, low FBS, low FBS, low FBS, low 10% FBS 10% FBS 10% FBS serum IgG serum IgG serum IgG serum IgG Incubation 30 minutes FC FC FC FC FC FC FC ACTB -0.154 -0.196 -0.186 -0.095 -0.408 -0.104 -0.703 CCL2 0.195 0.014 0.242 0.078 0.461 0.349 0.862 RPS14 0.154 0.196 0.186 0.095 0.408 0.104 0.703 IL1B 0.106 0.054 -0.047 -0.297 -0.484 -0.274 -0.216 GUSB 0.122 0.478 0.236 0.021 0.626 0.160 0.921 IL8 0.475 -0.100 4.107 1.323 2.696 1.086 4.581 FCER1G 0.328 0.133 0.194 0.001 0.156 0.102 0.267 FCAR2 0.135 0.310 0.450 -0.014 0.815 0.409 0.998 FCGR2A 0.385 -0.540 -2.403 -0.115 0.529 -0.017 -0.642 IL6 -0.301 -1.480 0.128 -0.123 -2.052 -0.021 -2.076 FCAR1 0.181 0.153 0.471 0.774 0.363 0.357 2.657 TNFRSF13B -0.916 -0.902 0.114 0.125 0.396 -0.692 -0.419 FCAR3 0.853 -0.179 0.390 0.568 1.319 1.696 0.868 CCR1 0.333 0.207 -1.806 -0.328 -1.221 -0.051 -0.490 CCR2 0.434 0.032 0.146 -0.013 0.085 0.237 -0.320

Note. Statistical analysis is calculated compared to the control PBS group.

Table 5. Statistical analysis (p values) of all genes measured for expression and the effects of cell culture media at 60 minutes incubation with IgA-immune complex mimetics.

Group Avidin IgA-biotin IgA-IC PBS Avidin IgA-biotin IgA-IC RPMI RPMI RPMI RPMI 1640 RPMI 1640 RPMI 1640 RPMI 1640 Media Type 1640 plus 1640 plus 1640 plus with 2% FBS, with 2% FBS, with 2% FBS, with 2% FBS, 10% FBS 10% FBS 10% FBS low serum IgG low serum IgG low serum IgG low serum IgG

Incubation 60 mins

p value p value p value p value p value p value p value ACTB 0.455 0.461 0.098 0.853 0.281 0.116 0.258 CCL2 0.193 0.841 0.012 0.387 0.247 0.176 0.245 RPS14 0.455 0.461 0.098 0.853 0.281 0.116 0.258 IL1B 0.701 0.627 0.067 0.168 0.384 0.364 0.829 GUSB 0.329 0.021 0.042 0.356 0.324 0.323 0.103 IL8 0.039 0.150 0.000 0.017 0.085 0.139 0.032 FCER1G 0.088 0.652 0.197 0.134 0.750 0.593 0.288 FCAR2 0.252 0.779 0.004 0.190 0.320 0.018 0.174 FCGR2A 0.728 0.578 0.238 0.437 0.526 1.000 0.258 IL6 0.928 0.850 0.450 0.963 0.562 1.000 0.721 FCAR1 0.093 0.675 0.003 0.520 0.761 0.523 0.301 TNFRSF13B 0.725 0.232 0.554 0.202 0.411 1.000 0.151 FCAR3 0.846 0.224 0.262 0.830 0.673 0.216 0.367 CCR1 0.223 0.250 0.077 0.314 0.304 1.000 0.012 CCR2 0.545 1.000 0.318 0.409 0.937 1.000 0.311

Note. Statistical analysis is calculated compared to the control PBS group.

Table 6. Statistical analysis (fold change log2) of all genes measured for expression and the effects of cell culture media at 60 minutes incubation with IgA-immune complex mimetics.

Incubation 60 mins

FC FC FC FC FC FC FC ACTB 0.079 -0.174 -0.511 -0.037 -0.308 -0.864 -0.254 CCL2 -0.269 0.058 0.760 0.126 0.496 0.742 0.576 RPS14 -0.079 0.174 0.511 0.037 0.308 0.864 0.254 IL1B -0.206 -0.165 0.825 -0.529 -0.272 -0.288 -0.069 GUSB 0.438 1.286 1.055 0.450 0.658 0.887 0.931 IL8 0.589 1.154 7.466 0.561 0.867 1.777 5.094 FCER1G -0.166 0.118 0.348 -0.253 -0.120 -0.115 -0.215 FCAR2 -0.202 0.098 1.453 -0.194 0.247 0.748 0.745 FCGR2A 0.112 0.188 0.474 -1.016 -0.327 -1.793 -0.448 IL6 -0.238 -0.588 1.596 -0.118 1.211 NA 0.735 FCAR1 -0.724 -0.135 1.222 0.581 0.102 0.099 0.773 TNFRSF13B 0.741 2.662 1.187 2.854 1.606 NA 3.449 FCAR3 -0.242 -2.088 1.511 -0.387 0.548 -1.741 1.190 CCR1 -0.283 -3.254 -0.199 -0.499 -1.972 NA -0.573 CCR2 0.098 0.393 -0.365 -2.526 -0.041 NA -0.161

Note. Statistical analysis is calculated compared to the control PBS group.

ACTB FCGR2A 1.0 1.0

0.5 0.5

C 

0.0  0.0

 

-0.5 -0.5

-1.0 -1.0 S in in IC IC IC IC S n n C C C C B d t - - - - i ti -I -I -I -I P i io A A A A B id o v g g g g P v i A A A A A -b I I I I b Ig Ig Ig Ig A L L L L A - L g L A L L L L m I /m /m /m /m Ig m m m m / L g g g g /m / / / / g u u u u g L g g g g u /m u m u u u u 0 g .5 5 0 5 / 5 5 0 5 5 u 2 2 5 7 0 g . 2 5 7 1 5 u 2 0 0 1 5 5

CCL2 IL6 1.5 1.0

0.5

1.0 p

p 0.0

C C 

 0.5   -0.5 0.0 -1.0

-0.5 -1.5

No immune complex IgA-immune complex

Supplemental Figure 16. Titration of IgA-immune complex mimetics effects on ACTB, FCGR2A, CCL2, and IL6 expression. Measured expression of ACTB, FCGR2A, CCL2, and IL6 to determine the optimal IgA-immune complex concentration.

RPS14 TNFRSF13 0.5 6 5 4

3 p

p 2

C 

 0.0 1   0 -1 -2 -3 -0.5 -4

S in in IC IC IC IC S in in IC IC IC IC B d t - - - - B d t - - - - P i io A A A A P i io A A A A v b g g g g v b g g g g A - I I I I A - I I I I A L L L L A L L L L L g L g /m I /m /m /m /m /m I /m /m /m /m g L g g g g g L g g g g u m u u u u u m u u u u 0 / 5 5 0 5 0 / 5 5 0 5 g . 2 5 7 5 g . 2 5 7 5 u 2 u 2 0 1 0 1 5 5

GUSB FCAR3 1.0 1.5

0.5 1.0 p

p 0.0 0.5

C C

    -0.5 0.0

-1.0 -0.5

-1.5 -1.0

No immune complex IgA-immune complex

Supplemental Figure 17. Titration of IgA-immune complex mimetics effects on RPS14, TNFRSF13, GUSB, and FCAR3 expression. Measured expression of RPS14, TNFRSF13, GUSB, and FCAR3 to determine the optimal IgA-immune complex concentration.

FCER1G CCR1 0.5 1.0

0.5

C 

 0.0 0.0

 

-0.5

-0.5 -1.0

FCAR2 CCR2 2.0 1.0 1.5

1.0 0.5

p p C

C 0.5 

 0.0   0.0 -0.5 -0.5 -1.0 -1.5 -1.0

No immune complex IgA-immune complex

Supplemental Figure 18. Titration of IgA-immune complex mimetics effects on FCER1G, CCR1, FCAR2, and CCR2 expression. Measured expression of FCER1G, CCR1, FCAR2, and CCR2 to determine the optimal IgA-immune complex concentration.

IL10 IL33 2.5 2.5 2.0 2.0 1.5 1.5

1.0 1.0

p C

C 0.5 0.5



   0.0 0.0 -0.5 -0.5 -1.0 -1.0 -1.5 -1.5 -2.0 -2.0

IL1RN CXCL10 1.0 1.5

1.0

0.5 p

p 0.5

C C 

 0.0   0.0 -0.5 -0.5

-1.0 -1.0

No immune complex IgA-immune complex

Supplemental Figure 19. Titration of IgA-immune complex mimetics effects on IL10, IL33, IL1RN, and CXCL10 expression. Measured expression of IL10, IL33, IL1RN, and CXCL10 to determine the optimal IgA-immune complex concentration.

CXCL11 CXCL9 2.0 1.5

1.5 1.0

1.0 p

p 0.5

C 

 0.5   0.0 0.0 -0.5 -0.5 -1.0 -1.0

CXCR1 CXCR2 2.0 1.0 1.5

1.0 0.5

p p C

C 0.5 

 0.0   0.0 -0.5 -0.5 -1.0 -1.5 -1.0

No immune complex IgA-immune complex

Supplemental Figure 20. Titration of IgA-immune complex mimetics effects on CXCL11, CXCL9, CXCR1, and CXCR2 expression. Measured expression of CXCL11, CXCL9, CXCR1, and CXCR2 to determine the optimal IgA-immune complex concentration.

CXCR4 TNFSF13 1.0 1.0

0.5 0.5

C 

 0.0 0.0

 

-0.5 -0.5

-1.0 -1.0

TNFSF13B TGFB1 1.0 1.0

0.5 0.5

C 

0.0  0.0

 

-0.5 -0.5

-1.0 -1.0

No immune complex IgA-immune complex

Supplemental Figure 21. Titration of IgA-immune complex mimetics effects on CXCR4, TNFSF13, TNFSF13B, and TGFB1 expression. Measured expression of CXCR4, TNFSF13, TNFSF13B, and TGFB1 to determine the optimal IgA-immune complex concentration.

TGFB1 1.0

0.5 p

C No immune complex

 0.0  IgA-immune complex -0.5

-1.0 S in in IC IC IC IC B d t - - - - P i io A A A A v b g g g g A - I I I I A L L L L L g /m I /m /m /m /m g L g g g g u m u u u u / 5 5 0 5 0 g . 2 5 7 5 u 2 0 1 5

Supplemental Figure 22. Titration of IgA-immune complex mimetics effects on TGFB2 expression. Measured expression of TGFB2 to determine the optimal IgA-immune complex concentration.

Table 7. Statistical analysis (p value) of all genes measured for expression after incubation with a titration of IgA-immune complex mimetics.

12.5 µg/mL 25 µg/mL 50 µg/mL 75 µg/mL Avidin IgA-Biotin IgA-IC IgA-IC IgA-IC IgA-IC

p value p value p value p value p value p value ACTB 0.389 0.338 0.622 0.092 0.217 0.800 FCGR2A 0.602 0.352 0.682 0.873 0.055 0.656 CCL2 0.033 0.763 0.105 0.003 0.000 0.000 IL6 0.316 0.060 0.640 0.332 0.057 0.351 RPS14 0.389 0.338 0.622 0.092 0.217 0.800 FCAR1 0.168 0.133 0.058 0.001 0.001 0.001 IL1B 0.950 0.500 0.092 0.079 0.091 0.051 TNFRSF13B 1.000 0.409 0.239 0.750 0.534 0.201 GUSB 0.002 0.219 0.405 0.299 0.104 0.667 FCAR3 0.265 0.326 0.691 0.139 0.091 0.018 IL8 0.993 0.806 0.000 0.000 0.000 0.000 FCER1G 0.899 0.088 0.218 0.359 0.008 0.088 CCR1 0.430 0.103 0.188 0.281 0.019 0.038 FCAR2 0.428 0.153 0.975 0.214 0.006 0.003 CCR2 0.952 0.144 0.789 0.144 0.456 0.840 TNFA 0.849 0.345 0.003 0.001 0.000 0.000 IL10 0.223 0.229 0.199 0.766 0.762 0.310 IL33 0.697 0.640 0.180 0.200 0.534 0.131 IL1RN 0.831 0.282 0.998 0.461 0.799 0.000 CXCL10 0.937 0.482 0.971 0.222 0.854 0.184 CXCL11 0.699 0.996 0.984 0.310 0.023 0.066 CXCL2 0.478 0.556 0.000 0.002 0.000 0.000 CXCL9 0.647 0.453 0.923 0.884 0.174 0.325 CXCR1 0.864 0.508 0.682 0.602 0.226 0.097 CXCR2 0.328 0.143 0.856 0.342 0.064 0.242 CXCR4 0.556 0.784 0.129 0.037 0.092 0.003 TNFSF13 0.146 0.590 0.510 0.826 0.160 0.308 TNFSF13B 0.770 0.450 0.838 0.741 0.019 0.707 TGFB1 0.461 0.530 0.871 0.362 0.259 0.547 TGFB2 0.412 0.160 0.064 0.053 0.056 0.063

Note. Statistical analysis is calculated compared to the control PBS group.

Table 8. Statistical analysis (fold change log2) of all genes measured for expression after incubation with a titration of IgA-immune complex mimetics.

12.5 µg/mL 25 µg/mL 50 µg/mL 75 µg/mL Avidin IgA-Biotin IgA-IC IgA-IC IgA-IC IgA-IC

FC FC FC FC FC FC ACTB -0.045 -0.060 -0.038 -0.102 -0.068 0.037 FCGR2A -0.149 -0.131 0.018 0.006 -0.225 0.034 CCL2 0.146 0.025 0.137 0.704 0.757 1.157 IL6 -0.450 -0.435 -0.083 -0.103 -0.626 0.355 RPS14 0.045 0.060 0.038 0.102 0.068 -0.037 FCAR1 0.297 0.337 0.652 1.583 1.704 2.118 IL1B -0.067 0.859 2.361 2.543 2.358 3.082 TNFRSF13B -1.764 2.511 3.370 1.297 1.924 3.803 GUSB -0.660 -0.335 -0.137 -0.733 -0.467 -0.118 FCAR3 -0.311 -0.271 -0.100 0.449 0.600 0.960 IL8 -0.004 -0.075 4.663 6.850 6.851 7.188 FCER1G -0.015 -0.080 -0.130 -0.082 -0.193 -0.113 CCR1 -0.067 -0.147 -0.141 -0.214 -0.322 -0.213 FCAR2 -0.179 -0.493 0.005 0.477 0.786 1.129 CCR2 0.011 0.328 -0.118 -0.368 -0.147 0.067 TNFA 0.051 0.213 1.217 2.420 2.354 2.310 IL10 1.157 1.145 1.235 0.272 -0.282 0.917 IL33 -0.247 0.338 0.571 0.950 -0.356 0.890 IL1RN 0.099 -0.070 0.000 0.335 -0.057 0.440 CXCL10 -0.020 -0.061 -0.004 0.298 0.036 0.452 CXCL11 0.216 0.002 -0.007 0.595 1.104 0.978 CXCL2 0.191 0.141 2.116 3.653 3.949 4.085 CXCL9 0.090 -0.074 -0.011 0.026 -0.289 0.386 CXCR1 0.046 0.173 -0.105 -0.134 -0.577 0.662 CXCR2 0.081 -0.131 -0.026 -0.130 -0.242 -0.133 CXCR4 -0.071 0.044 0.253 0.273 0.217 0.495 TNFSF13 0.089 -0.076 -0.104 0.011 -0.217 0.256 TNFSF13B -0.033 -0.053 -0.018 0.034 -0.188 -0.029 TGFB1 -0.079 -0.068 -0.025 -0.056 -0.164 0.054 TGFB2 1.820 -4.146 -5.427 -5.899 -5.705 -5.420

Note. Statistical analysis is calculated compared to the control PBS group.

ACTB FCGR2A 1.0 1.0

0.5 0.5

C 

0.0  0.0

 

-0.5 -0.5

-1.0 -1.0 S in in IC IC IC IC S in in C C C C B d t - - - - B t -I -I -I -I P i io G G G G id o v b g g g g P v i G G G G A - I I I I A -b Ig Ig Ig Ig L G L L L L g L G L L L L /m I /m /m /m /m m Ig m m m m g L g g g g / / / / / u u u u u g L g g g g /m u m u u u u 5 g .5 5 0 5 5 / 5 5 0 5 3 u 2 2 5 7 3 g . 2 5 7 1 u 2 5 5 1 2 2

CCL2 IL6 1.5 1.5

1.0 1.0 p

p 0.5 0.5

C C

    0.0 0.0

-0.5 -0.5

-1.0 -1.0

S in in IC IC IC IC S in in IC IC IC IC B d t - - - - B d t - - - - P i io G G G G P i io G G G G v b g g g g v b g g g g A - I I I I A - I I I I L G L L L L L G L L L L g g /m I /m /m /m /m /m I /m /m /m /m g L g g g g g L g g g g u m u u u u u m u u u u 5 / 5 5 0 5 5 / 5 5 0 5 3 g . 2 5 7 3 g . 2 5 7 u 2 u 2 5 1 5 1 2 2

No immune complex IgA-immune complex

Supplemental Figure 23. Titration of IgG-immune complex mimetics effects on ACTB, FCGR2A, CCL2, and IL6 expression. Measured expression of ACTB, FCGR2A, CCL2, and IL6 to determine the optimal IgG-immune complex concentration.

RPS14 FCAR1 1.0 1.5

1.0

0.5 p

p 0.5



   0.0 0.0 -0.5

-0.5 -1.0

IL1B TNFRSF13 1.0 2.0 1.5

0.5 1.0 p

p 0.5

C 

0.0  0.0   -0.5 -0.5 -1.0 -1.5 -1.0 -2.0

No immune complex IgA-immune complex

Supplemental Figure 24. Titration of IgG-immune complex mimetics effects on RPS14, FCAR1, IL1B, and TNFRSF13 expression. Measured expression of RPS14, FCAR1, IL1B, and TNFRSF13 to determine the optimal IgG-immune complex concentration.

GUSB FCAR3 1.5 1.5

1.0 1.0 p

p 0.5 0.5

C C

    0.0 0.0

-0.5 -0.5

-1.0 -1.0

FCER1G CCR1 1.5 1.0

1.0

0.5 p

p 0.5

C C 

 0.0   0.0 -0.5 -0.5

-1.0 -1.0

No immune complex IgA-immune complex

Supplemental Figure 25. Titration of IgG-immune complex mimetics effects on GUSB, FCAR3, FCER1G, and CCR1 expression. Measured expression of GUSB, FCAR3, FCER1G, and CCR1 to determine the optimal IgG-immune complex concentration.

FCAR2 CCR2 2.0 1.0 1.5 0.5

1.0

p p

C C 

 0.5 0.0

  0.0 -0.5 -0.5 -1.0 -1.0

TNFA IL10 2.0 2.0 1.5 1.5 1.0

1.0 0.5

p p

C 0.0

C 

 0.5 

 -0.5 0.0 -1.0 -1.5 -0.5 -2.0 -1.0 -2.5 S n n S in in IC IC IC IC i i IC IC IC IC B d t - - - - B d t - - - - P i io G G G G P i io G G G G v b g g g g v b g g g g A - I I I I A - I I I I L G L L L L L G L L L L g g /m I /m /m /m /m /m I /m /m /m /m g L g g g g L g g g g u m u u u u g 5 / 5 5 0 5 u m u u u u 3 g . 2 5 7 5 / 5 5 0 5 u 2 3 g . 2 5 7 5 1 u 2 2 5 1 2

No immune complex IgA-immune complex

Supplemental Figure 26. Titration of IgG-immune complex mimetics effects on FCAR2, CCR2, TNFA, and IL10 expression. Measured expression of FCAR2, CCR2, TNFA, and IL10 to determine the optimal IgG-immune complex concentration.

IL33 IL1RN 3.0 1.0 2.5 2.0 0.5

1.5 p

1.0 p

C C 

0.5  0.0   0.0 -0.5 -0.5 -1.0 -1.5 -2.0 -1.0

CXCL10 CXCL11 1.5 1.5 1.0 1.0

0.5 p

p 0.5 0.0

C C

    0.0 -0.5 -1.0 -0.5 -1.5 -1.0 -2.0

No immune complex IgA-immune complex

Supplemental Figure 27. Titration of IgG-immune complex mimetics effects on IL33, IL1RN, CXCL10, and CXCL11 expression. Measured expression of IL33, IL1RN, CXCL10, and CXCL11 to determine the optimal IgG-immune complex concentration.

CXCL2 CXCL9 2.5 2.0 2.0 1.5

1.5 1.0 p

1.0 p 0.5



  0.5  0.0 0.0 -0.5 -0.5 -1.0 -1.0 -1.5

CXCR1 CXCR2 1.0 2 1 0.5

0 p

p 0.0 C

C -1



   -0.5 -2

-1.0 -3 -4 -1.5

No immune complex IgA-immune complex

Supplemental Figure 28. Titration of IgG-immune complex mimetics effects on CXCL2, CXCL9, CXCR1, and CXCR2 expression. Measured expression of CXCL2, CXCL9, CXCR1, and CXCR2 to determine the optimal IgG-immune complex concentration.

CXCR4 TNFSF13 1.5 1.0

1.0

0.5 p

C C 

 0.0   0.0 -0.5 -0.5

-1.0 -1.0

TNFSF13B TGFB1 1.0 1.0

0.5 0.5

p p

C C 

 0.0 0.0

 

-0.5 -0.5

-1.0 -1.0

No immune complex IgA-immune complex

Supplemental Figure 29. Titration of IgG-immune complex mimetics effects on CXCR4, TNFSF13, TNFSF13B, and TGFB1 expression. Measured expression of CXCR4, TNFSF13, TNFSF13B, and TGFB1 to determine the optimal IgG-immune complex concentration.

TGFB2 1.0

0.5

p 0.0

C No immune complex   -0.5 IgA-immune complex -1.0

-1.5

S in in IC IC IC IC B d t - - - - P i io G G G G v b g g g g A - I I I I L G L L L L g /m I /m /m /m /m g L g g g g u m u u u u 5 / 5 5 0 5 3 g . 2 5 7 u 2 5 1 2

Supplemental Figure 30. Titration of IgG-immune complex mimetics effects on CXCR4, TNFSF13, TNFSF13B, and TGFB1 expression. Measured expression of CXCR4, TNFSF13, TNFSF13B, and TGFB1 to determine the optimal IgG-immune complex concentration.

Table 9. Statistical analysis (p value) of all genes measured for expression after incubation with a titration of IgG-immune complex mimetics.

12.5 µg/mL 25 µg/mL 50 µg/mL 75 µg/mL Avidin IgG-biotin IgG-IC IgG-IC IgG-IC IgG-IC

p p value p value p value p value p value value ACTB 0.118 0.029 0.748 0.787 0.374 0.101 FCGR2A 0.348 0.310 0.682 0.392 0.811 0.119 CCL2 0.412 0.351 0.068 0.173 0.371 0.033 IL6 0.215 0.547 0.011 0.503 0.984 0.409 RPS14 0.118 0.029 0.748 0.787 0.374 0.101 FCAR1 0.397 0.399 0.017 0.188 0.332 0.031 IL1B 0.966 0.964 0.200 0.958 0.691 0.882 TNFRSF13B 0.842 0.200 0.408 0.575 0.565 0.368 GUSB 0.389 0.411 0.197 0.330 0.736 0.493 FCAR3 0.423 0.467 0.009 0.077 0.176 0.020 IL8 0.429 0.311 0.001 0.003 0.004 0.002 FCER1G 0.146 0.170 0.357 0.606 0.762 0.077 CCR1 0.270 0.325 0.478 0.889 0.852 0.128 FCAR2 0.188 0.131 0.018 0.069 0.117 0.032 CCR2 0.224 0.133 0.762 0.381 0.396 0.206 TNFA 0.842 0.589 0.000 0.001 0.000 0.003 IL10 0.224 0.786 0.406 0.912 0.402 0.903 IL33 0.609 0.798 0.858 0.562 0.982 0.597 IL1RN 0.755 0.448 0.021 0.623 0.358 0.009 CXCL10 0.175 0.672 0.039 0.440 0.719 0.083 CXCL11 0.461 0.868 0.252 0.291 0.190 0.556 CXCL2 0.157 0.018 0.001 0.002 0.010 0.000 CXCL9 0.145 0.960 0.041 0.449 0.810 0.251 CXCR1 0.800 0.068 0.145 0.480 0.494 0.976 CXCR2 0.214 0.246 0.452 0.437 0.669 0.205 CXCR4 0.367 0.254 0.164 0.397 0.862 0.093 TNFSF13 0.212 0.374 0.126 0.406 0.850 0.190 TNFSF13B 0.289 0.436 0.497 0.523 0.753 0.207 TGFB1 0.547 0.421 0.416 0.618 0.639 0.291 TGFB2 0.934 0.920 0.974 0.644 0.595 0.514

Note. Statistical analysis is calculated compared to the control PBS group.

Table 10. Statistical analysis (fold change log2) of all genes measured for expression after incubation with a titration of IgG-immune complex mimetics.

IgG- 12.5 µg/mL 25 µg/mL 50 µg/mL 75 µg/mL Avidin biotin IgG-IC IgG-IC IgG-IC IgG-IC

FC FC FC FC FC FC - ACTB -0.396 -0.075 0.044 -0.120 -0.308 0.383 FCGR2A 0.339 0.302 0.130 -0.235 -0.083 0.493 CCL2 0.330 0.329 0.732 0.447 0.340 0.841 - IL6 0.301 0.867 0.203 0.007 0.301 0.184 RPS14 0.396 0.383 0.075 -0.044 0.120 0.308 FCAR1 0.316 0.270 0.994 0.459 0.399 0.824 IL1B -0.012 0.012 0.182 0.009 0.081 0.026 - TNFRSF13B -0.110 0.499 -0.235 -0.333 0.427 0.743 GUSB 0.262 0.239 0.509 0.439 -0.065 0.131 FCAR3 0.198 0.204 0.850 0.414 0.351 0.669 IL8 0.341 0.350 2.067 1.871 1.825 2.163 FCER1G 0.531 0.460 0.326 -0.130 0.101 0.581 CCR1 0.389 0.308 0.243 -0.040 -0.066 0.495 FCAR2 0.512 0.532 1.040 0.704 0.643 0.892 CCR2 0.481 0.606 0.128 -0.306 -0.315 0.467 TNFA 0.021 0.084 1.012 1.231 1.010 0.925 IL10 0.777 0.163 -0.523 0.064 -0.671 0.073 - IL33 -0.215 0.091 0.587 -0.008 0.148 0.133 IL1RN 0.062 0.110 0.444 0.102 0.106 0.470 CXCL10 0.255 0.092 0.534 0.191 0.101 0.497 - CXCL11 0.370 -0.426 -0.679 -0.495 -0.156 0.065 CXCL2 0.443 0.533 1.316 1.366 1.361 1.337 CXCL9 0.538 0.020 0.908 0.236 -0.115 0.412 - CXCR1 0.065 0.330 0.168 -0.293 -0.008 0.472 CXCR2 0.429 0.346 -0.898 -0.200 -0.128 0.354 CXCR4 0.460 0.467 0.584 0.292 0.097 0.716 TNFSF13 0.433 0.302 0.537 0.232 0.057 0.397 TNFSF13B 0.365 0.247 0.203 -0.157 -0.102 0.347 TGFB1 0.193 0.232 0.214 -0.111 -0.120 0.257 - TGFB2 -0.033 -0.007 0.164 0.082 -0.188 0.031

Note. Statistical analysis is calculated compared to the control PBS group.

ACTB FCGR2A 1.0 1.0 0.5 0.5

0.0 p

-0.5 p 0.0



  -1.0  -0.5 -1.5 -1.0 -2.0 -2.5 -1.5 S n n c b ) ) C c b ) ) ) ) ) ) i ti 7 8 io io I 7 8 io io S in in c b o o IC c b o o B id o P 6 - P 6 B d t 7 8 i i - 7 8 i i P v i I B b A I B B P i o IP 6 B b A IP 6 B B b IP S s g IP S s v i P S s P S s A - M L u I M L u A -b M I u Ig M I u A M ( v d M ( v M (L v M (L v g a o n d a o A o d I 8 N a n 8 N Ig a n d a o ( ( 8 (N a n 8 N IP a C a IP P a P ( 8 -I C a I a IC I a M -I M 8 M 8 - IC M 8 IP A d IP P A - P Ig A n I g A d I M Ig a M M I g n M d I a IC n d - a IC n A - a g IC A I - Ig IC A - g A I Ig CCL2 IL6 1.5 2.0 1.0 1.5 1.0

0.5 p

p 0.5

C 

0.0  0.0

  -0.5 -0.5 -1.0 -1.0 -1.5 -1.5 -2.0 ) ) ) ) ) ) ) ) S in in c b o o IC c b o o S in in c b o o C c b o o B d t 7 8 i i - 7 8 i i B d t 7 8 i i -I 7 8 i i P i io IP 6 B b A IP 6 B B P i io IP 6 B b A IP 6 B B v b IP S s g IP S s v b IP S s g IP S s A - M L u I M L u A - M L u I M L u A M ( v d M ( v A M ( v d M ( v g a o n d a o g a o n d a o I 8 N a n 8 N I 8 N a n 8 N ( a ( ( ( IP a C IP IP a C a IP 8 -I C a 8 -I C a M -I M 8 M I M 8 IP A d IP IP A - d IP Ig A n Ig A n M Ig a M M Ig a M d d IC n IC n - a - a A C A C Ig -I Ig -I A A Ig Ig

No immune complex IgA-immune complex

Supplemental Figure 31. IgA-immune complex mimetics activation and inhibition by FcαRI blocking antibodies effects on ACTB, FCGR2A, CCL2, and IL6 expression. Measured expression of ACTB, FCGR2A, CCL2, and IL6 to analyze the activation of signaling with IgA-immune complex mimetics and subsequent inhibition with blocking antibodies targeting FcαRI.

RPS14 GUSB 2.5 2.0 2.0 1.5 1.5

1.0 p

C C 

 0.5   0.5 0.0 0.0 -0.5 -0.5 -1.0 -1.0 ) ) ) ) ) ) ) ) S in in c b o o C c b o o S in in c b o o C c b o o B d t 7 8 i i -I 7 8 i i B d t 7 8 i i -I 7 8 i i P i io IP 6 B b A IP 6 B B P i io IP 6 B b A IP 6 B B v b IP S s g IP S s v b IP S s g IP S s A - M L u I M L u A - M L u I M L u A M ( v d M ( v A M ( v d M ( v g a o n d a o g a o n d a o I 8 N a n 8 N I 8 N a n 8 N P ( a P ( P ( a P ( I a IC I a I a IC I a M 8 - IC M 8 M 8 - IC M 8 IP A - d IP IP A - d IP Ig A n Ig A n M Ig a M M Ig a M d d IC n IC n - a - a A C A C Ig -I Ig -I A A Ig Ig FCAR3 FCER1G 2.0 1.0

1.5 0.5

1.0 p

p 0.0

C 

0.5    -0.5 0.0 -0.5 -1.0 -1.0 -1.5 ) ) ) ) ) ) ) ) S in in c b o o IC c b o o S in in c b o o C c b o o B d t 7 8 i i - 7 8 i i B d t 7 8 i i -I 7 8 i i P i io IP 6 B b A IP 6 B B P i io IP 6 B b A IP 6 B B v b IP S s g IP S s v b IP S s g IP S s A - M L u I M L u A - M L u I M L u A M ( v d M ( v A M ( v d M ( v g a o n d a o g a o n d a o I 8 N a n 8 N I 8 N a n 8 N ( a ( ( ( IP a C IP IP a C a IP 8 -I C a 8 -I C a M -I M 8 M I M 8 IP A d IP IP A - d IP Ig A n Ig A n M Ig a M M Ig a M d d IC n IC n - a - a A C A C Ig -I Ig -I A A Ig Ig

No immune complex IgA-immune complex

Supplemental Figure 32. IgA-immune complex mimetics activation and inhibition by FcαRI blocking antibodies effects on RPS14, GUSB, FCAR3, and FCER1G expression. Measured expression of RPS14, GUSB, FCAR3, and FCER1G to analyze the activation of signaling with IgA-immune complex mimetics and subsequent inhibition with blocking antibodies targeting FcαRI.

CCR1 FCAR2 1.0 2.5 0.5 2.0 1.5

0.0 p

p 1.0

C 

-0.5    0.5 -1.0 0.0 -1.5 -0.5 -2.0 -1.0 ) ) ) ) ) ) ) ) S in in c b o o IC c b o o S in in c b o o C c b o o B d t 7 8 i i - 7 8 i i B d t 7 8 i i -I 7 8 i i P i io IP 6 B b A IP 6 B B P i io IP 6 B b A IP 6 B B v b IP S s g IP S s v b IP S s g IP S s A - M L u I M L u A - M L u I M L u A M ( v d M ( v A M ( v d M ( v g a o n d a o g a o n d a o I 8 N a n 8 N I 8 N a n 8 N ( a ( ( ( IP a C IP IP a C a IP 8 -I C a 8 -I C a M -I M 8 M I M 8 IP A d IP IP A - d IP Ig A n Ig A n M Ig a M M Ig a M d d IC n IC n - a - a A C A C Ig -I Ig -I A A Ig Ig CCR2 IL10 1.5 5 4 1.0 3

0.5 2

p C

C 1 

 0.0   0 -0.5 -1 -2 -1.0 -3 -1.5 -4 ) ) ) ) ) ) ) ) S in in c b o o C c b o o S in in c b o o C c b o o B d t 7 8 i i -I 7 8 i i B d t 7 8 i i -I 7 8 i i P i io IP 6 B b A IP 6 B B P i io IP 6 B b A IP 6 B B v b IP S s g IP S s v b IP S s g IP S s A - M L u I M L u A - M L u I M L u A M ( v d M ( v A M ( v d M ( v g a o n d a o g a o n d a o I 8 N a n 8 N I 8 N a n 8 N P ( a P ( P ( a P ( I a IC I a I a IC I a M 8 - IC M 8 M 8 - IC M 8 IP A - d IP IP A - d IP Ig A n Ig A n M Ig a M M Ig a M d d IC n IC n - a - a A C A C Ig -I Ig -I A A Ig Ig

No immune complex IgA-immune complex

Supplemental Figure 33. IgA-immune complex mimetics activation and inhibition by FcαRI blocking antibodies effects on CCR1, FCAR2, CCR2, and IL10 expression. Measured expression of CCR1, FCAR2, CCR2, and IL10 to analyze the activation of signaling with IgA-immune complex mimetics and subsequent inhibition with blocking antibodies targeting FcαRI.

IL33 IL1RN 5 2.5 4 2.0 3 1.5

2 1.0 p

p 0.5 C

C 1 

 0.0   0 -0.5 -1 -1.0 -2 -1.5 -3 -2.0 -4 -2.5 ) ) ) ) ) ) ) ) S in in c b o o C c b o o S in in c b o o IC c b o o B d t 7 8 i i -I 7 8 i i B d t 7 8 i i - 7 8 i i P i io IP 6 B b A IP 6 B B P i io IP 6 B b A IP 6 B B v b IP S s g IP S s v b IP S s g IP S s A - M L u I M L u A - M L u I M L u A M ( v d M ( v A M ( v d M ( v g a o n d a o g a o n d a o I 8 N a n 8 N I 8 N a n 8 N ( ( ( a ( IP a C a IP IP a C IP 8 -I C a 8 -I C a M I M 8 M -I M 8 IP A - d IP IP A d IP Ig A n Ig A n M Ig a M M Ig a M d d IC n IC n - a - a A A C g C Ig -I I -I A A Ig Ig CXCL11 CXCL10 3 2.0 2 1.5

1 1.0

C 

0  0.5

  -1 0.0 -2 -0.5 -3 -1.0 ) ) ) ) ) ) ) ) S in in IC c b o o c b o o S in in c b o o C c b o o B d t - 7 8 i i 7 8 i i B d t 7 8 i i -I 7 8 i i P i io A IP 6 B b IP 6 B B P i io IP 6 B b A IP 6 B B v b g IP S s IP S s v b IP S s g IP S s A - I M L u M L u A - M L u I M L u A M ( v d M ( v A M ( v d M ( v g a o n d a o g a o n d a o I 8 N a n 8 N I 8 N a n 8 N P ( a ( ( ( I a C IP IP a C a IP 8 -I C a 8 -I C a M -I M 8 M I M 8 IP A d IP IP A - d IP Ig A n Ig A n M Ig a M M Ig a M d d IC n IC n - a - a A A g C C I -I Ig -I A A Ig Ig

No immune complex IgA-immune complex

Supplemental Figure 34. IgA-immune complex mimetics activation and inhibition by FcαRI blocking antibodies effects on IL33, IL1RN, CXCL11, and CXCL10 expression. Measured expression of IL33, IL1RN, CXCL11, and CXCL10 to analyze the activation of signaling with IgA-immune complex mimetics and subsequent inhibition with blocking antibodies targeting FcαRI.

CXCL9 CXCR1 2 2.0 1.5 1 1.0

0 p

p 0.5

C C 

 0.0   -1 -0.5 -2 -1.0 -3 -1.5 -2.0 ) ) ) ) ) ) ) ) S in in c b o o C c b o o S in in c b o o C c b o o B d t 7 8 i i -I 7 8 i i B d t 7 8 i i -I 7 8 i i P i io IP 6 B b A IP 6 B B P i io IP 6 B b A IP 6 B B v b IP S s g IP S s v b IP S s g IP S s A - M L u I M L u A - M L u I M L u A M ( v d M ( v A M ( v d M ( v g a o n d a o g a o n d a o I 8 N a n 8 N I 8 N a n 8 N P ( a P ( P ( a P ( I a IC I a I a IC I a M 8 - IC M 8 M 8 - IC M 8 IP A - d IP IP A - d IP Ig A n Ig A n M Ig a M M Ig a M d d IC n IC n - a - a A C A C Ig -I Ig -I A A Ig Ig CXCR2 CXCR4 1.0 1.5 0.5 1.0

0.0 p

p -0.5 0.5



   -1.0 0.0 -1.5 -0.5 -2.0 -2.5 -1.0 ) ) ) ) ) ) ) ) S in in c b o o C c b o o S in in c b o o IC c b o o B d t 7 8 i i -I 7 8 i i B d t 7 8 i i - 7 8 i i P i io IP 6 B b A IP 6 B B P i io IP 6 B b A IP 6 B B v b IP S s g IP S s v b IP S s g IP S s A - M L u I M L u A - M L u I M L u A M ( v d M ( v A M ( v d M ( v g a o n d a o g a o n d a o I 8 N a n 8 N I 8 N a n 8 N ( ( P ( a ( IP a C a IP I a C IP 8 -I C a 8 -I C a M I M 8 M -I M 8 IP A - d IP IP A d IP Ig A n Ig A n M Ig a M M Ig a M d d IC n IC n - a - a A A C g C Ig -I I -I A A Ig Ig

No immune complex IgA-immune complex

Supplemental Figure 35. IgA-immune complex mimetics activation and inhibition by FcαRI blocking antibodies effects on CXCL9, CXCR1, CXCR2, and CXCR4 expression. Measured expression of CXCL9, CXCR1, CXCR2, and CXCR4 to analyze the activation of signaling with IgA-immune complex mimetics and subsequent inhibition with blocking antibodies targeting FcαRI.

TNFSF13 TNFSF13B 1.0 1.5 0.5 1.0

0.0 0.5

C 

 -0.5 0.0

  -1.0 -0.5 -1.5 -1.0 -2.0 -1.5 ) ) ) ) ) ) ) ) S in in c b o o C c b o o S in in c b o o IC c b o o B d t 7 8 i i -I 7 8 i i B d t 7 8 i i - 7 8 i i P i io IP 6 B b A IP 6 B B P i io IP 6 B b A IP 6 B B v b IP S s g IP S s v b IP S s g IP S s A - M L u I M L u A - M L u I M L u A M ( v d M ( v A M ( v d M ( v g a o n d a o g a o n d a o I 8 N a n 8 N I 8 N a n 8 N ( ( ( a ( IP a C a IP IP a C IP 8 -I C a 8 -I C a M I M 8 M -I M 8 IP A - d IP IP A d IP Ig A n Ig A n M Ig a M M Ig a M d d IC n IC n - a - a A C A C Ig -I Ig -I A A Ig Ig TGFB1 TGFB2 1.5 3 1.0 2 1

0.5 p

p 0

C C 

 0.0 -1

  -0.5 -2 -3 -1.0 -4 -1.5 -5 ) ) ) ) ) ) ) ) S in in c b o o C c b o o S in in c b o o C c b o o B d t 7 8 i i -I 7 8 i i B d t 7 8 i i -I 7 8 i i P i io IP 6 B b A IP 6 B B P i io IP 6 B b A IP 6 B B v b IP S s g IP S s v b IP S s g IP S s A - M L u I M L u A - M L u I M L u A M ( v d M ( v A M ( v d M ( v g a o n d a o g a o n d a o I 8 N a n 8 N I 8 N a n 8 N P ( a P ( P ( a P ( I a IC I a I a IC I a M 8 - IC M 8 M 8 - IC M 8 IP A - d IP IP A - d IP Ig A n Ig A n M Ig a M M Ig a M d d IC n IC n - a - a A C A C Ig -I Ig -I A A Ig Ig

No immune complex IgA-immune complex

Supplemental Figure 36. IgA-immune complex mimetics activation and inhibition by FcαRI blocking antibodies effects on TNFSF13, TNFSF13B, TFB1, and TGFB2 expression. Measured expression of TNFSF13, TNFSF13B, TFB1, and TGFB2 to analyze the activation of signaling with IgA-immune complex mimetics and subsequent inhibition with blocking antibodies targeting FcαRI.

TNFRSF13 3

p 1 No immune complex

C   0 IgA-immune complex

-1

-2 ) ) ) ) S in in c b o o C c b o o B d t 7 8 i i -I 7 8 i i P i io IP 6 B b A IP 6 B B v IP S s g IP S s A -b M L u I M L u A M ( v d M ( v g a o n d a o I 8 N a n 8 N P ( a P ( I a IC I a M 8 - IC M 8 IP A - d IP Ig A n M Ig a M d IC n - a A C Ig -I A Ig

Supplemental Figure 37. IgA-immune complex mimetics activation and inhibition by FcαRI blocking antibodies effects on TNFRSF13 expression. Measured expression of TNFRSF13 to analyze the activation of signaling with IgA-immune complex mimetics and subsequent inhibition with blocking antibodies targeting FcαRI.

Table 11. Statistical analysis (p value) of all genes measured for expression after incubation with IgA-immune complex mimetics and subsequent inhibition with FcαRI blocking antibodies.

biotion and IC and IC and IC and IC

- - - - -

Avidin MIP7c MIP7c

MIP8a MIP8a MIP8a MIP8a MIP8a

IgA

(LSBio) (LSBio)

MIP68b MIP68b

(Novusbio) (Novusbio)

IgA IgA IgA IgA IgA

p p p p p p p p p p p value value value value value value value value value value value ACTB 0.886 0.378 0.356 0.441 0.774 0.483 0.921 0.848 0.507 0.349 0.038 FCGR2A 0.926 0.993 0.631 0.066 0.203 0.016 0.014 0.588 0.211 0.075 0.495 CCL2 0.992 0.876 0.730 0.368 0.437 0.615 0.718 0.777 0.743 0.127 0.144 IL6 0.613 0.583 0.257 0.010 0.083 0.844 0.839 0.294 0.035 0.425 0.735 RPS14 0.886 0.378 0.356 0.441 0.774 0.483 0.921 0.848 0.507 0.349 0.038 FCAR1 0.827 0.865 0.193 0.470 0.258 0.021 0.053 0.235 0.222 0.011 0.862 IL1B 0.650 0.354 0.198 0.818 0.955 0.666 0.521 0.385 0.000 0.473 0.574 TNFRSF13 B 0.984 0.191 0.616 0.391 0.791 0.869 0.110 0.304 0.062 0.482 0.012 GUSB 0.512 0.620 0.134 0.253 0.475 0.222 0.122 0.499 0.094 0.289 0.145 FCAR3 0.344 0.559 0.295 0.648 0.936 0.351 0.824 0.742 0.004 0.444 0.799 IL8 0.179 0.286 0.081 0.002 0.758 0.035 0.033 0.124 0.000 0.019 0.003 FCER1G 0.944 0.996 0.710 0.106 0.178 0.006 0.016 0.282 0.225 0.012 0.863 CCR1 0.882 0.948 0.770 0.116 0.029 0.004 0.001 0.019 0.074 0.003 0.249 FCAR2 0.947 0.723 0.072 0.691 0.493 0.147 0.152 0.252 0.031 0.304 0.202 CCR2 0.846 0.892 0.336 0.279 0.216 0.094 0.050 0.907 0.351 0.138 0.740 TNFA 0.636 0.487 0.000 0.010 0.723 0.045 0.448 0.557 0.000 0.144 0.067 IL10 0.399 0.870 0.009 0.978 0.855 0.308 0.121 1.000 0.061 0.906 0.856 IL33 0.501 0.218 0.322 0.350 0.877 0.422 0.099 0.110 0.052 0.584 0.015 IL1RN 0.977 0.553 0.965 0.960 0.532 0.023 0.005 0.107 0.090 0.364 0.504 CXCL10 0.773 0.547 0.266 0.222 0.694 0.631 0.130 0.396 0.007 0.681 0.412 CXCL11 0.337 0.359 1.000 0.365 0.133 0.041 0.019 0.118 0.206 0.028 0.154 CXCL2 0.574 0.245 0.013 0.056 0.311 0.020 0.030 0.095 0.000 0.680 0.017 CXCL9 0.670 0.660 0.524 0.129 0.814 0.909 0.253 0.324 0.076 0.720 0.152 CXCR1 0.614 0.374 0.235 0.079 0.641 0.068 0.065 0.140 0.012 0.222 0.339 CXCR2 0.576 0.782 0.669 0.035 0.030 0.000 0.002 0.012 0.051 0.001 0.272 CXCR4 0.913 0.959 0.382 0.293 0.446 0.167 0.153 0.970 0.499 0.166 0.350 TNFSF13 0.867 0.625 0.944 0.569 0.779 0.672 0.229 0.090 0.370 0.435 0.167 TNFSF13B 0.827 0.916 0.687 0.084 0.164 0.004 0.004 0.219 0.168 0.014 0.877 TGFB1 0.832 0.871 0.926 0.272 0.443 0.276 0.484 0.329 0.743 0.483 0.406 TGFB2 0.544 0.412 1.000 0.094 0.919 0.024 0.079 0.039 0.515 0.190 0.999

Note. Statistical analysis is calculated compared to the control PBS group.

Table 12. Statistical analysis (fold change log2) of all genes measured for expression after incubation with IgA-immune complex mimetics and subsequent inhibition with FcαRI blocking antibodies.

biotion and IC and IC and IC and IC

- - - - -

Avidin MIP7c MIP7c

MIP8a MIP8a MIP8a MIP8a MIP8a

IgA

(LSBio) (LSBio)

MIP68b MIP68b

(Novusbio) (Novusbio)

IgA IgA IgA IgA IgA

FC FC FC FC FC FC FC FC FC FC FC ACTB 0.028 -0.248 -1.051 0.130 0.058 0.121 0.019 -0.040 -0.208 0.221 -0.589 FCGR2A 0.018 -0.004 -0.413 -0.409 -0.279 -0.476 -0.502 -0.127 -0.467 -0.457 -0.150 CCL2 0.002 -0.075 0.290 -0.191 -0.171 -0.092 -0.081 -0.069 -0.120 -0.427 0.321 IL6 -0.087 0.250 -0.912 -0.391 -0.229 -0.036 0.051 0.373 0.771 -0.355 0.177 RPS14 -0.028 0.248 1.051 -0.130 -0.058 -0.121 -0.019 0.040 0.208 -0.221 0.589 FCAR1 -0.036 -0.065 1.112 -0.136 -0.216 -0.386 -0.447 -0.239 0.558 -0.498 -0.032 IL1B 0.120 0.322 3.532 -0.062 -0.015 0.110 -0.164 -0.222 2.015 -0.195 -0.292 TNFRSF13B -0.007 0.743 0.869 -0.272 0.084 0.051 0.707 0.345 1.008 0.208 1.621 GUSB -0.123 0.124 1.423 -0.236 -0.165 -0.247 0.335 -0.199 0.757 -0.334 0.300 FCAR3 0.138 0.214 1.003 0.059 0.011 -0.113 0.035 0.081 1.093 -0.117 0.070 IL8 0.264 0.409 5.535 0.699 -0.057 0.382 0.460 0.345 4.797 0.496 0.722 FCER1G 0.014 0.003 0.150 -0.337 -0.292 -0.584 -0.542 -0.329 -0.480 -0.593 -0.036 CCR1 -0.029 -0.029 -0.217 -0.355 -0.465 -0.607 -0.830 -0.506 -0.732 -0.775 -0.310 FCAR2 0.012 0.163 1.716 0.078 0.142 -0.285 0.267 0.329 1.121 -0.226 0.506 CCR2 -0.054 -0.062 0.682 -0.300 -0.377 -0.462 -0.584 0.044 -0.362 -0.594 -0.087 TNFA -0.058 -0.182 3.013 0.319 -0.031 0.295 0.104 -0.214 2.474 0.170 0.621 IL10 0.394 0.159 3.471 -0.015 -0.101 0.482 -0.955 0.334 1.006 -0.101 0.115 IL33 0.287 0.618 2.175 -0.606 0.072 0.397 1.048 0.857 0.968 0.260 2.130 IL1RN -0.004 -0.159 -0.085 -0.006 -0.096 -0.334 -0.446 -0.148 0.456 -0.145 -0.497 CXCL10 -0.063 0.279 0.789 -0.220 0.083 0.095 0.344 0.377 1.147 -0.167 0.513 CXCL11 -0.370 0.522 1.669 -0.287 -0.605 -0.731 -1.113 -0.683 0.823 -1.065 1.259 CXCL2 0.158 0.551 6.120 0.463 0.222 0.570 0.636 0.602 4.537 0.170 1.363 CXCL9 -0.091 0.219 -1.267 -0.307 -0.062 -0.023 0.315 0.447 0.730 -0.164 0.508 CXCR1 0.128 0.408 -0.743 -0.559 0.089 0.337 0.522 0.610 0.835 0.250 0.585 CXCR2 -0.100 -0.115 -0.285 -0.421 -0.445 -0.865 -1.028 -0.582 -0.741 -0.783 -0.639 CXCR4 -0.024 -0.025 0.552 -0.242 -0.183 -0.279 -0.312 0.009 0.251 -0.367 0.321 TNFSF13 0.028 0.196 0.048 -0.092 -0.049 -0.062 -0.199 0.295 0.262 -0.204 0.578 TNFSF13B -0.039 -0.044 -0.424 -0.330 -0.268 -0.586 -0.606 -0.292 -0.423 -0.539 0.036 TGFB1 0.034 -0.056 -0.079 -0.196 -0.134 -0.164 -0.107 0.197 -0.086 -0.166 0.275 TGFB2 -0.164 0.130 0.309 -0.986 -0.020 -1.020 -0.594 -0.989 -0.241 -0.663 -0.002

Note. Statistical analysis is calculated compared to the control PBS group.

ACTB CXCL2 1.0 5 4 0.5 3

0.0 p p

C 2



C 

 -0.5 1  -1.0 0 -1.5 -1

) ) ) ) S in in c b o o C c b o -2.0 B d t 7 8 i i -I 7 8 i io P i io IP 6 B b G IP 6 B B v b IP S s g IP S s ) ) ) ) A - M L u I M L u S n n c b C c b G M ( v d M ( v i ti 7 8 io io I 7 8 io io g a o n d a o B d - I 8 N a 8 P i o IP 6 B b IP 6 B B ( n (N v i P s G P s IP a C a IP b M I S g M I S 8 -I C a A - L u I L u M -I M 8 M ( v d M ( v IP G d IP G o Ig G n g a n d a o M Ig a M I 8 N a n 8 N d P ( a P ( IC n I a C I - a -I C a G M 8 I M 8 g IC IP G - d IP I - Ig G n G M Ig a M Ig d IC n - a G C Ig -I G Ig FCAR1 TNFA 2.0 2.5 1.5 2.0 1.5 1.0

1.0 p

p 0.5 0.5

C C 

 0.0 0.0   -0.5 -0.5 -1.0 -1.0 -1.5 -1.5 -2.0 -2.0 -2.5 ) ) ) ) ) ) ) ) S in in c b o o IC c b o o S in in c b o o IC c b o o B d t 7 8 i i - 7 8 i i B d t 7 8 i i - 7 8 i i P i io IP 6 B b G IP 6 B B P i io IP 6 B b G IP 6 B B v b IP S s IP S s v b IP S s IP S s A - M L u Ig M L u A - M L u Ig M L u G M ( v d M ( v G M ( v d M ( v g a o n d a o g a o n d a o I 8 N a n 8 N I 8 N a n 8 N P ( a P ( P ( a P ( I a IC I a I a IC I a M 8 - IC M 8 M 8 - IC M 8 IP G - d IP IP G - d IP Ig G n Ig G n M Ig a M M Ig a M d d IC n IC n - a - a G C G C Ig -I Ig -I G G Ig Ig

No immune complex IgG-immune complex

Supplemental Figure 38. IgG-immune complex mimetics activation and inhibition by FcαRI blocking antibodies effects on ACTB, CXCL2, FCAR1, and TNFA expression. Measured expression of ACTB, CXCL2, FCAR1, and TNFA to analyze the activation of signaling with IgG-immune complex mimetics and subsequent inhibition with blocking antibodies targeting FcαRI.

FCGR2A IL6 1.0 8 7 0.5 6

5 p

0.0 p 4 C

C 3



   -0.5 2 1 -1.0 0 -1 -2 -1.5 ) ) ) ) ) ) ) ) S in in c b o o IC c b o o S in in c b o o IC c b o o B d t 7 8 i i - 7 8 i i B d t 7 8 i i - 7 8 i i P i io IP 6 B b G IP 6 B B P i io IP 6 B b G IP 6 B B v b IP S s IP S s v b IP S s IP S s A - M L u Ig M L u A - M L u Ig M L u G M ( v d M ( v G M ( v d M ( v g a o n d a o g a o n d a o I 8 N a n 8 N I 8 N a n 8 N P ( a P ( P ( a P ( I a IC I a I a IC I a M 8 - IC M 8 M 8 - IC M 8 IP G - d IP IP G - d IP Ig G n Ig G n M Ig a M M Ig a M d d IC n IC n - a - a G C G C Ig -I Ig -I G G Ig Ig CCL2 RPS14 2.0 2.0 1.5 1.5 1.0

1.0 p

p 0.5

C C 

 0.5   0.0 0.0 -0.5 -1.0 -0.5 -1.5 -1.0 ) ) ) ) ) ) ) ) S in in c b o o IC c b o o S in in c b o o IC c b o o B d t 7 8 i i - 7 8 i i B d t 7 8 i i - 7 8 i i P i io IP 6 B b G IP 6 B B P i io IP 6 B b G IP 6 B B v b IP S s IP S s v b IP S s IP S s A - M L u Ig M L u A - M L u Ig M L u G M ( v d M ( v G M ( v d M ( v g a o n d a o g a o n d a o I 8 N a n 8 N I 8 N a n 8 N P ( a P ( P ( a P ( I a IC I a I a IC I a M 8 - IC M 8 M 8 - IC M 8 IP G - d IP IP G - d IP Ig G n Ig G n M Ig a M M Ig a M d d IC n IC n - a - a G C G C Ig -I Ig -I G G Ig Ig

No immune complex IgG-immune complex

Supplemental Figure 39. IgG-immune complex mimetics activation and inhibition by FcαRI blocking antibodies effects on FCGR2A, IL6, CCL2, and RPS14 expression. Measured expression of FCGR2A, IL6, CCL2, and RPS14 to analyze the activation of signaling with IgG-immune complex mimetics and subsequent inhibition with blocking antibodies targeting FcαRI.

IL1B GUSB 2.0 5 1.5 1.0 4 0.5 3

0.0

p C

C -0.5 2



   -1.0 -1.5 1 -2.0 0 -2.5 -3.0 -1 -3.5 ) ) ) ) ) ) c ) ) S in in c b o o IC c b o o S in in c b o o IC b o o B d t 7 8 i i - 7 8 i i B d t 7 8 i i - 7 8 i i P i io IP 6 B b G IP 6 B B P i io IP 6 B b G IP 6 B B v b IP S s IP S s v b IP S s g IP S s A - M L u Ig M L u A - M L u I M L u G M ( v d M ( v G M ( v d M ( v g a o n d a o g a o n d a o I 8 N a n 8 N I 8 N a n 8 N P ( a P ( P ( a P ( I a IC I a I a IC I a M 8 - IC M 8 M 8 - IC M 8 P G - P P G - P I g G d I I g G d I M I n M M I g n M Ig a I a C d C d I n -I n - a a G C G C Ig -I Ig -I G G Ig Ig FCAR3 FCER1G 1.0 4 0.5 3

0.0

p C

C 2 

 -0.5

  1 -1.0 0 -1.5 -1 -2.0 ) ) ) ) ) ) ) ) S in in c b o o IC c b o o S in in c b o o IC c b o o B d t 7 8 i i - 7 8 i i B d t 7 8 i i - 7 8 i i P i io IP 6 B b G IP 6 B B P i io IP 6 B b G IP 6 B B v b IP S s IP S s v b IP S s IP S s A - M L u Ig M L u A - M L u Ig M L u G M ( v d M ( v G M ( v d M ( v g a o n d a o g a o n d a o I 8 N a n 8 N I 8 N a n 8 N P ( a P ( P ( a P ( I a IC I a I a IC I a M 8 - IC M 8 M 8 - IC M 8 IP G - d IP IP G - d IP Ig G n Ig G n M Ig a M M Ig a M d d IC n IC n - a - a G C G C Ig -I Ig -I G G Ig Ig

No immune complex IgG-immune complex

Supplemental Figure 40. IgG-immune complex mimetics activation and inhibition by FcαRI blocking antibodies effects on IL1B, GUSB, FCAR3, and FCER1G expression. Measured expression of IL1B, GUSB, FCAR3, and FCER1G to analyze the activation of signaling with IgG-immune complex mimetics and subsequent inhibition with blocking antibodies targeting FcαRI.

CCR1 FCAR2 1.0 3.5 3.0 0.5 2.5

0.0 2.0

p C

C 1.5 

 -0.5   1.0 -1.0 0.5 0.0 -1.5 -0.5 -2.0 -1.0 ) ) ) ) ) ) ) ) S in in c b o o IC c b o o S in in c b o o IC c b o o B d t 7 8 i i - 7 8 i i B d t 7 8 i i - 7 8 i i P i io IP 6 B b G IP 6 B B P i io IP 6 B b G IP 6 B B v b IP S s IP S s v b IP S s g IP S s A - M L u Ig M L u A - M L u I M L u G M ( v d M ( v G M ( v d M ( v g a o n d a o g a o n d a o I 8 N a n 8 N I 8 N a n 8 N ( a ( ( a ( IP a C IP IP a C IP 8 -I C a 8 -I C a M I M 8 M -I M 8 IP G - d IP IP G d IP Ig G n Ig G n M Ig a M M Ig a M d d IC n IC n - a - a G C G C Ig -I Ig -I G G Ig Ig CCR2 IL10 2.0 3 1.5 2

1.0 1 p 0.5 p

C 

0.0    -1 -0.5 -1.0 -2 -1.5 -3 -2.0 -4 ) ) ) ) ) ) ) ) S in in c b o o IC c b o o S in in c b o o IC c b o o B d t 7 8 i i - 7 8 i i B d t 7 8 i i - 7 8 i i P i io IP 6 B b G IP 6 B B P i io IP 6 B b G IP 6 B B v b IP S s g IP S s v b IP S s IP S s A - M L u I M L u A - M L u Ig M L u G M ( v d M ( v G M ( v d M ( v g a o n d a o g a o n d a o I 8 N a n 8 N I 8 N a n 8 N ( a ( ( a ( IP a C IP IP a C IP 8 -I C a 8 -I C a M -I M 8 M I M 8 IP G d IP IP G - d IP Ig G n Ig G n M Ig a M M Ig a M d d IC n IC n - a - a G C G C Ig -I Ig -I G G Ig Ig

No immune complex IgG-immune complex

Supplemental Figure 41. IgG-immune complex mimetics activation and inhibition by FcαRI blocking antibodies effects on CCR1, FCAR2, CCR2, and IL10 expression. Measured expression of CCR1, FCAR2, CCR2, and IL10 to analyze the activation of signaling with IgG-immune complex mimetics and subsequent inhibition with blocking antibodies targeting FcαRI.

IL33 IL1RN 7 1.0 6 5 0.5 4

3 p

p 0.0 C

C 2



   1 0 -0.5 -1 -2 -1.0 -3 -4 -1.5 ) ) ) ) ) ) ) ) S in in c b o o IC c b o o S in in c b o o C c b o o B d t 7 8 i i - 7 8 i i B d t 7 8 i i -I 7 8 i i P i io IP 6 B b G IP 6 B B P i io IP 6 B b A IP 6 B B v b IP S s IP S s v b IP S s g IP S s A - M L u Ig M L u A - M L u I M L u G M ( v d M ( v A M ( v d M ( v g a o n d a o g a o n d a o I 8 N a n 8 N I 8 N a n 8 N P ( a P ( P ( a P ( I a IC I a I a IC I a M 8 - IC M 8 M 8 - IC M 8 IP G - d IP IP A - d IP Ig G n Ig A n M Ig a M M Ig a M d d IC n IC n - a - a G C A C Ig -I Ig -I G A Ig Ig CXCL10 CXCL11 7 2.0 6 1.5 5 1.0

4 0.5 p

p 0.0 C

C 3 

 -0.5   2 -1.0 1 -1.5 0 -2.0 -1 -2.5 -2 -3.0 ) ) ) ) ) ) ) ) S in in c b o o IC c b o o S in in c b o o IC c b o o B d t 7 8 i i - 7 8 i i B d t 7 8 i i - 7 8 i i P i io IP 6 B b G IP 6 B B P i io IP 6 B b G IP 6 B B v b IP S s IP S s v b IP S s IP S s A - M L u Ig M L u A - M L u Ig M L u G M ( v d M ( v G M ( v d M ( v g a o n d a o g a o n d a o I 8 N a n 8 N I 8 N a n 8 N P ( a P ( P ( a P ( I a IC I a I a IC I a M 8 - IC M 8 M 8 - IC M 8 IP G - d IP IP G - d IP Ig G n Ig G n M Ig a M M Ig a M d d IC n IC n - a - a G C G C Ig -I Ig -I G G Ig Ig

No immune complex IgG-immune complex

Supplemental Figure 42. IgG-immune complex mimetics activation and inhibition by FcαRI blocking antibodies effects on IL33, IL1RN, CXCL10, and CXCL11 expression. Measured expression of IL33, IL1RN, CXCL10, and CXCL11 to analyze the activation of signaling with IgG-immune complex mimetics and subsequent inhibition with blocking antibodies targeting FcαRI.

CXCL9 CXCR1 7 6 6 5 5 4

4 3 p

3 p C

C 2 

2    1 1 0 0 -1 -1 -2 -2 -3 ) ) ) ) ) ) ) ) S in in c b o o IC c b o o S in in c b o o IC c b o o B d t 7 8 i i - 7 8 i i B d t 7 8 i i - 7 8 i i P i io IP 6 B b G IP 6 B B P i io IP 6 B b G IP 6 B B v b IP S s IP S s v b IP S s IP S s A - M L u Ig M L u A - M L u Ig M L u G M ( v d M ( v G M ( v d M ( v g a o n d a o g a o n d a o I 8 N a n 8 N I 8 N a n 8 N P ( a P ( P ( a P ( I a IC I a I a IC I a M 8 - IC M 8 M 8 - IC M 8 IP G - d IP IP G - d IP Ig G n Ig G n M Ig a M M Ig a M d d IC n IC n - a - a G C G C Ig -I Ig -I G G Ig Ig

CXCR2 CXCR4 1.0 2.5 0.5 2.0

0.0 1.5 p -0.5 p

1.0

C 

-1.0    0.5 -1.5 -2.0 0.0 -2.5 -0.5 -3.0 -1.0 ) ) ) ) ) ) ) ) S in in c b o o IC c b o o S in in c b o o IC c b o o B d t 7 8 i i - 7 8 i i B d t 7 8 i i - 7 8 i i P i io IP 6 B b G IP 6 B B P i io IP 6 B b G IP 6 B B v b IP S s g IP S s v b IP S s IP S s A - M L u I M L u A - M L u Ig M L u G M ( v d M ( v G M ( v d M ( v g a o n d a o g a o n d a o I 8 N a n 8 N I 8 N a n 8 N ( a ( ( a ( IP a C IP IP a C IP 8 -I C a 8 -I C a M -I M 8 M I M 8 IP G d IP IP G - d IP Ig G n Ig G n M Ig a M M Ig a M d d IC n IC n - a - a G C G C Ig -I Ig -I G G Ig Ig

No immune complex IgG-immune complex

Supplemental Figure 43. IgG-immune complex mimetics activation and inhibition by FcαRI blocking antibodies effects on CXCL9, CXCR1, CXCR2, and CXCR4 expression. Measured expression of CXCL9, CXCR1, CXCR2, and CXCR4 to analyze the activation of signaling with IgG-immune complex mimetics and subsequent inhibition with blocking antibodies targeting FcαRI.

TNFSF13 TNFSF13B 6 1.5 5 1.0 4 0.5

p 3

C 

2  0.0

  1 -0.5 0 -1 -1.0 -2 -1.5 ) ) ) ) ) ) ) ) S in in c b o o IC c b o o S in in c b o o IC c b o o B d t 7 8 i i - 7 8 i i B d t 7 8 i i - 7 8 i i P i io IP 6 B b G IP 6 B B P i io IP 6 B b G IP 6 B B v b IP S s IP S s v b IP S s IP S s A - M L u Ig M L u A - M L u Ig M L u G M ( v d M ( v G M ( v d M ( v g a o n d a o g a o n d a o I 8 N a n 8 N I 8 N a n 8 N P ( a P ( P ( a P ( I a IC I a I a IC I a M 8 - IC M 8 M 8 - IC M 8 IP G - d IP IP G - d IP Ig G n Ig G n M Ig a M M Ig a M d d IC n IC n - a - a G C G C Ig -I Ig -I G G Ig Ig

TGFB1 TGFB2 1.0 2 0.5 1

0.0 0

p C

C -1 

-0.5    -2 -1.0 -3 -1.5 -4 -2.0 ) ) ) ) ) ) ) ) S in in c b o o IC c b o o S in in c b o o IC c b o o B d t 7 8 i i - 7 8 i i B d t 7 8 i i - 7 8 i i P i io IP 6 B b G IP 6 B B P i io IP 6 B b G IP 6 B B v b IP S s IP S s v b IP S s IP S s A - M L u Ig M L u A - M L u Ig M L u G M ( v d M ( v G M ( v d M ( v g a o n d a o g a o n d a o I 8 N a n 8 N I 8 N a n 8 N ( a ( ( a ( IP a C IP IP a C IP 8 -I C a 8 -I C a M -I M 8 M I M 8 IP G d IP IP G - d IP Ig G n Ig G n M Ig a M M Ig a M d d IC n IC n - a - a G C G C Ig -I Ig -I G G Ig Ig

No immune complex IgG-immune complex

Supplemental Figure 44. IgG-immune complex mimetics activation and inhibition by FcαRI blocking antibodies effects on TNFSF13, TNFSF13B, TGFB1, and TGFB2 expression. Measured expression of TNFSF13, TNFSF13B, TGFB1, and TGFB2 to analyze the activation of signaling with IgG-immune complex mimetics and subsequent inhibition with blocking antibodies targeting FcαRI.

TNFRSF13B 6 5 4

p C

 2 No immune complex  1 IgG-immune complex 0 -1 -2 ) ) ) ) S in in c b o o IC c b o o B d t 7 8 i i - 7 8 i i P i io IP 6 B b G IP 6 B B v b IP S s IP S s A - M L u Ig M L u G M ( v d M ( v g a o n d a o I 8 N a n 8 N ( a ( IP a C IP 8 -I C a M -I M 8 IP G d IP Ig G n M Ig a M d IC n - a G C Ig -I G Ig

Supplemental Figure 45. IgG-immune complex mimetics activation and inhibition by FcαRI blocking antibodies effects on TNFRSF13 expression. Measured expression of TNFRSF13 to analyze the activation of signaling with IgG-immune complex mimetics and subsequent inhibition with blocking antibodies targeting FcαRI.

Table 13. Statistical analysis (p value) of all genes measured for expression after incubation with IgG-immune complex mimetics and subsequent inhibition with FcαRI blocking antibodies.

biotin

IC and and IC and IC and IC and IC

- - - -

Avidin MIP7c

MIP8a MIP8a MIP8a MIP8a MIP8a

IgG

MIP7C

(LSBio) (LSBio)

MIP68b MIP68b

IgG

(Novusbio) (Novusbio)

IgG IgG IgG IgG

p p p p p p p p value value value value value value p value value value p value p value ACTB 0.886 0.718 0.087 0.441 0.774 0.483 0.921 0.265 0.637 0.868 0.794 FCGR2A 0.926 0.236 0.519 0.066 0.203 0.016 0.014 0.656 0.005 0.410 0.032 CCL2 0.992 0.263 0.021 0.368 0.437 0.615 0.718 0.467 0.009 0.499 0.045 IL6 0.613 0.177 0.341 0.010 0.083 0.844 0.839 0.143 0.514 0.131 0.164 RPS14 0.886 0.718 0.087 0.441 0.774 0.483 0.921 0.265 0.637 0.868 0.794 FCAR1 0.827 0.390 0.775 0.470 0.258 0.021 0.053 0.654 0.081 0.181 0.086 IL1B 0.650 0.569 0.156 0.818 0.955 0.666 0.521 0.591 0.301 0.264 0.003 TNFRSF1 3B 0.984 0.848 0.046 0.391 0.791 0.869 0.110 0.399 0.275 0.061 0.273 GUSB 0.512 0.399 0.141 0.253 0.475 0.222 0.122 0.126 0.826 0.045 0.020 FCAR3 0.344 0.325 0.205 0.648 0.936 0.351 0.824 0.139 0.388 0.079 0.133 IL8 0.179 0.023 0.101 0.002 0.758 0.035 0.033 0.002 0.000 0.000 0.032 FCER1G 0.944 0.201 0.860 0.106 0.178 0.006 0.016 0.333 0.006 0.256 0.076 CCR1 0.882 0.269 0.797 0.116 0.029 0.004 0.001 0.191 0.034 0.265 0.025 FCAR2 0.947 0.289 0.008 0.691 0.493 0.147 0.152 0.104 0.745 0.132 0.206 CCR2 0.846 0.486 0.089 0.279 0.216 0.094 0.050 0.400 0.093 0.268 0.099 TNFA 0.636 1.000 0.242 0.010 0.723 0.045 0.448 0.001 0.398 0.000 0.152 IL10 0.399 0.648 1.000 0.978 0.855 0.308 0.121 0.884 0.200 0.095 0.114 IL33 0.501 0.866 0.031 0.350 0.877 0.422 0.099 0.112 0.999 0.073 0.171 IL1RN 0.977 0.366 0.678 0.960 0.532 0.023 0.005 0.509 0.050 0.007 0.107 CXCL10 0.773 0.122 0.265 0.222 0.694 0.631 0.130 0.028 0.815 0.082 0.122 CXCL11 0.337 0.293 1.000 0.365 0.133 0.041 0.019 0.399 0.897 0.387 0.605 CXCL2 0.574 0.109 0.001 0.056 0.311 0.020 0.030 0.006 0.097 0.005 0.222 CXCL9 0.670 0.103 0.195 0.129 0.814 0.909 0.253 0.099 0.912 0.316 0.115 CXCR1 0.614 0.286 0.538 0.079 0.641 0.068 0.065 0.099 0.610 0.006 0.184 CXCR2 0.576 0.130 0.109 0.035 0.030 0.000 0.002 0.051 0.025 0.019 0.009 CXCR4 0.913 0.382 0.060 0.293 0.446 0.167 0.153 0.545 0.090 0.447 0.312 TNFSF13 0.867 0.077 0.304 0.569 0.779 0.672 0.229 0.043 0.752 0.247 0.139 TNFSF13 B 0.827 0.178 0.972 0.084 0.164 0.004 0.004 0.240 0.004 0.396 0.016 TGFB1 0.832 0.313 0.254 0.272 0.443 0.276 0.484 0.299 0.232 0.697 0.115 TGFB2 0.544 0.513 0.454 0.094 0.919 0.024 0.079 0.080 0.141 0.003 0.015

Note. Statistical analysis is calculated compared to the control PBS group.

Table 14. Statistical analysis (fold change log2) of all genes measured for expression after incubation with IgG-immune complex mimetics and subsequent inhibition with FcαRI blocking antibodies.

IC IC IC IC IC

- - - -

) )

b b

and and and and and

bio) bio)

IgG

biotin

Avidin MIP7c

MIP68 MIP8a MIP8a MIP68 MIP8a MIP8a

(LSBio (Novus (LSBio (Novus

IgG

IgG IgG IgG IgG

MIP7C

FC FC FC FC FC FC FC FC FC FC FC ACTB 0.028 0.074 -0.845 0.130 0.058 0.121 0.019 -0.215 0.104 -0.038 0.066 - FCGR2A 0.018 -0.319 -0.314 -0.409 -0.279 0.476 -0.502 -0.134 -0.636 -0.243 -0.637 - CCL2 0.002 -0.312 1.127 -0.191 -0.171 0.092 -0.081 0.242 -0.578 0.218 -0.742 - IL6 -0.087 -0.196 2.693 -0.391 -0.229 0.036 0.051 0.630 -0.123 0.581 -1.040 - RPS14 -0.028 -0.074 0.845 -0.130 -0.058 0.121 -0.019 0.215 -0.104 0.038 -0.066 - FCAR1 -0.036 -0.161 0.222 -0.136 -0.216 0.386 -0.447 0.118 -0.412 0.278 -0.369 IL1B 0.120 0.160 0.772 -0.062 -0.015 0.110 -0.164 -0.155 -0.877 0.281 -1.324 TNFRSF13 B -0.007 0.068 3.686 -0.272 0.084 0.051 0.707 0.486 0.708 1.232 -0.710 - GUSB -0.123 -0.148 2.094 -0.236 -0.165 0.247 0.335 0.395 0.127 0.413 -0.489 - FCAR3 0.138 -0.134 1.514 0.059 0.011 0.113 0.035 0.358 -0.102 0.631 -0.399 IL8 0.264 0.425 1.862 0.699 -0.057 0.382 0.460 1.723 0.910 2.026 0.777 - FCER1G 0.014 -0.364 -0.099 -0.337 -0.292 0.584 -0.542 -0.253 -0.712 -0.348 -0.735 - CCR1 -0.029 -0.301 0.135 -0.355 -0.465 0.607 -0.830 -0.335 -0.882 -0.370 -1.056 - FCAR2 0.012 -0.283 2.137 0.078 0.142 0.285 0.267 0.535 0.059 0.617 0.458 - CCR2 -0.054 -0.201 0.899 -0.300 -0.377 0.462 -0.584 -0.301 -0.746 -0.352 -0.696 TNFA -0.058 0.000 0.885 0.319 -0.031 0.295 0.104 0.507 0.154 0.881 -1.232 IL10 0.394 -0.342 2.040 -0.015 -0.101 0.482 -0.955 -0.092 1.009 0.971 -1.862 IL33 0.287 -0.082 4.186 -0.606 0.072 0.397 1.048 1.569 -0.002 1.009 -0.797 - IL1RN -0.004 -0.166 -0.287 -0.006 -0.096 0.334 -0.446 0.135 -0.194 0.421 -0.516 CXCL10 -0.063 -0.303 2.040 -0.220 0.083 0.095 0.344 0.728 0.056 0.634 -1.020 - CXCL11 -0.370 -0.748 -1.751 -0.287 -0.605 0.731 -1.113 -0.552 -0.118 0.461 -0.349 CXCL2 0.158 0.372 4.003 0.463 0.222 0.570 0.636 1.131 0.444 1.468 0.340 - CXCL9 -0.091 -0.334 2.307 -0.307 -0.062 0.023 0.315 0.780 -0.040 0.476 -1.173 CXCR1 0.128 -0.183 1.626 -0.559 0.089 0.337 0.522 0.683 0.200 0.886 -1.069 - CXCR2 -0.100 -0.365 -1.321 -0.421 -0.445 0.865 -1.028 -0.655 -0.905 -0.623 -1.037 - CXCR4 -0.024 -0.244 1.077 -0.242 -0.183 0.279 -0.312 0.199 -0.334 0.243 -0.354 - TNFSF13 0.028 -0.316 1.487 -0.092 -0.049 0.062 -0.199 0.386 -0.057 0.209 -0.706 - TNFSF13B -0.039 -0.291 0.017 -0.330 -0.268 0.586 -0.606 -0.349 -0.575 -0.222 -0.703 - TGFB1 0.034 -0.251 -0.701 -0.196 -0.134 0.164 -0.107 0.242 -0.171 0.093 -0.334 - TGFB2 -0.164 -0.228 0.236 -0.986 -0.020 1.020 -0.594 -1.172 -0.521 -1.046 -1.437

Note. Statistical analysis is calculated compared to the control PBS group.

References

Abolhassani, H., Gharib, B., Shahinpour, S., Massom, S.N., Havaei, A., Mirminachi, B., Arandi, N., Torabi-Sagvand, B., Khazaei, H.A., Mohammadi, J., Rezai, N., and Aghamohammadi, A. (2015). Autoimmunity in Patients With Selective IgA Deficiency. Journal of Investigational Allergology and Clinical Immunology, 25(2):112-119.

Arikawa, E., Quellhorst, G., Han, Y., Hongguang, P., and Yang, J. (2011). RT2 ProfileTM PCR Arrays: Pathway-Focused Gene Expression Profiling with qRT-PCR. SABiosciences Technical Article.

Bakema, J.E. & van Egmond, M. (2011). Immunoglobulin A: A next generation of therapeutic antibodies? mAbs, 3(4):352-361.

Bakema, J.E. & van Egmond M. (2011). The human immunoglobulin A Fc receptor FcαRI: a multifaceted regulator of mucosal immunity. Mucosal Immunology, 4(6):612-624. doi: 10.1038/mi.2011.36.

Bakema, J.E., & van Egmond, M. (2001). The human immunoglobulin A Fc receptor FcαRI: a multifaceted regulator of mucosal immunity. Mucosal Immunology, 4(6):612-24. doi: 10.1038/mi.2011.36.

Bendaoud, B., Pennec, Y.L., Lelong, A., Le Noac’h, J., Magadur, G., Jouquan, J., & Youinou, P. (1991). IgA-containing immune complexes in the circulation of patients with primary Sjögren’s syndrome. Journal of Autoimmunity, 4(1):177- 184. doi: 10.1016/0896-8411(91)90016-6.

Blank, U., Launay, P., Benhamou, M., & Monteiro, R.C. (2009). Inhibitory ITAMs as novel regulators of immunity. Immunological Reviews, 232(1):59-71. doi: 10.1111/j.1600-065X.2009.00832.x.

Donadio, J.V. and Grande, J.P. (2002). IgA Nephropathy. New England Journal of Medicine, 347:738-748. doi: 10.1056/NEJMra020109.

Downie, M.L., Manlhoit, C., Latino, G.A., Collins, T.H., Chahal, N., Yeung, R.S., & McCrindle, B.W. (2016). Variability in Response to Intravenous Immunoglobulin in the Treatment of Kawasaki Disease. Journal of Pediatrics, 179(1): 124-130. doi: 10.1016/j.jpeds.2016.08.060.

Gene [Internet]. Bethsda (MD): National Library of Medicine (US), National Center for Biotechnology Information; 2004 – [cited 2018 November]. Available from: https://www.ncbi.nlm.nih.gov/gene/

Gupta, M., Johann-Liang, R., Bussel, J.B., Gersony, W.M., & Lehman, T.J. (2002). Elevated IgA and IgM anticardiolipin antibodies in acute Kawasaki disease. Cardiology, 97(4):180-182. doi: 10.1159/000063118.

Hansen, I.S., Hoepel, W., Zaat, S.A.J, Baeten, D.L.P., & den Dunnen, J. (2017). Serum IgA Immune Complexes Promote Proinflammatory Cytokine Production by Human Macrophages, Monocytes, and Kupffer Cells through FcαRI-TLR Cross- Talk. Journal of Immunology, 199(12):4124-4131. doi: 10.4049/jimmunol.1700883.

Hwang, J.Y., Lee, K.Y., Rhim, J.W., Youn, Y.S., Oh, J.H., Han, J.W., Lee, J.S., & Burgner, D. (2011). Assessment of intravenous immunoglobulin non-responders in Kawasaki disease. Archives of Disease in Childhood, 96(11):1088-1090. doi: 10.1136/adc.2010.184101.

Ivashkiv, L.B. (2009). Cross-regulation of signaling by ITAM-associated receptor. Nature Immunology, 10(4):340-7. doi: 10.1038/ni.1706.

Kanamaru, Y., Pfirsch, S., Aloulou, M., Vrtovsnik, F., Essig, M., Loirat, C., Deschenes, G., Guerin-Marchand, C., Blank, U., & Monteiro, R.C. (2008). Inhibitory ITAM signaling by Fc alpha RI-FcR gamma chain controls multiple activating responses and prevents renal inflammation. Journal of Immunology, 180(4):2669-2678.

Kecse-Nagy, C., Szittner, Z., Papp, K., Hegyi, Z., Rovero, P., Migliorini, P., Lóránd, V., Homolya, L., & Prechl, J. (2016). Characterizatio nof NF-ĸß Reporter U937 Cells and Their Application for Detection of Inflammatory Immune-Complexes. Plos One, 1-15. doi: 10.1371/journal.pone.0156328.

Kerr, M.A. (1990). The structure and function of human IgA. Biochemical Journal, 271(2):285-296.

Kim, B.Y., Kim, D., Kim, Y.H., Ryoo, E., Sun, Y.H., Jeon, I.S., Jung, M.J., Cho, H.K., Tchah, H., Choi, D.Y., & Kim, N.Y. (2016) Non-Responders to Intravenous Immunoglobulin and Coronary Artery Dilatation in Kawasaki Disease: Predictive Parameters in Korean Children. Korean Circulation Journal, 46(4): 542-549. doi: 10.4070/kcj.2016.46.4.542.

Lang, M.L., Chen, Y.W., Shen, L., Gao, H., Lang, G.A., Wade, T.K., & Wade, W.F. (2002). IgA Fc receptor (FcalphaR) cross-linking recruits tyrosine kinases, phosphoinositide kinases and serine/threonine kinases to glycolipid rafts. Biochemical Journal, 364(Pt2):517-525. doi: 10.1042/BJ20011696.

Leman, Y. (2010). Selective IgA Deficiency. Journal of Clinical Immunology, 30(1):10- 16. doi: 10.1007/s10875-009-9357-x.

Levy, Y., Dueymes, M., Pennec, Y.L., Shoenfeld, Y., & Youinou, P. (1994). IgA in Sjögren's syndrome. Clinical and Experimental Rheumatology, 12(5):543-551.

Li, X. and Kimberly, R.P. (2014). Targeting the Fc receptor in autoimmune disease. Expert Opinion on Therapeutic Targets, 18(3):335-350/ doi: 10.1517/14728222.2014.877891

Ludvigsson, J.F., Neovius, M., & Hammarstrom, L. (2014). Association Between IgA Deficiency & Other Autoimmune Conditions: A Population-Based Matched Cohort Study. Journal of Clinical Immunology, 34:444-451. doi: 10.1007/s10875- 014-009-4.

Maeß, M. B., Sendelbach, S., & Lorkowski, S. (2010). Selection of reliable reference genes during THP-1 monocyte differentiation into macrophages. BMC Molecular Biology, 11:90. doi: 10.1186/1471-2199-11-90.

Monteiro, R.C. (2014). Immunoglobulin A as an anti-inflammatory agent. Clinical and Experimental Immunology, 178(1):108-110. doi: 10.1111/cei.12531.

Monteiro, R.C., Kubagawa, H., & Cooper, M.D. (1990). Cellular distribution, regulation, and biochemical nature of an Fc alpha receptor in humans. Journal of Experimental Medicine, 171(3):597-613.

Monteiro, R. C. (2010). Role of IgA and IgA Fc Receptors in Inflammation. Journal of Clinical Immunology, 30.1:1-9. doi: 10.1007/s10875-009-9338-0.

Murphy, K. & Weaver, C. (2016). Janeway’s Immunobiology, 9th edition. Garland Science.

Olas, K., Butterweck, H., Teschner, W., Schwarz, H.P., & Reipert, B.M. (2005). Immunomodulatory properties of human serum immunoglobulin A: anti- inflammatory and pro-inflammatory activities in human monocytes and peripheral blood mononuclear cells. Clinical and Experimental Immunology, 140(3):478-90. doi: 10.1111/j.1365-2249.2005.02779.x.

Pasquier, B., Launay, P., Kanamaru, Y., Moura, I.C., Pfirsch, S., Ruffié, C., Hénin, D., Benhamou, M., Pretolani, M., Blank, U., & Monteiro, R.C. (2005). Identification of FcalphaRI as an inhibitory receptor that controls inflammation: dual role of FcRgamma ITAM. Immunity, 22(1):31-42. doi: 10.1016/j.immuni.2004.11.017.

Pfefferkorn, L.C., & Yeaman, G.R. (1994). Association of IgA-Fc receptors (Fc alpha R) with Fc epsilon RI gamma 2 subunits in U937 cells. Aggregation induces the tyrosine phosphorylation of gamma 2. Journal of Immunology, 153(7):3228-36.

Reinholdt, J. & Husby, S. (2013). IgA and Mucosal Homeostasis. Madame Curie Bioscience Database [Internet]. Austin (TX): Landes Bioscience; 2000-2013. Available from: https://www.ncbi.nlm.nih.gov/books/NBK6628/

Shen, L., Collins, J.E., Schoenborn, M.A., & Maliszewski, C. R. (1994). Lipopolysaccharide and cytokine augmentation of human monocyte IgA receptor expression and function. Journal of Immunology, 152(8):4080-6.

Wang, N., Shen, N., Vyse, T.J., Anand, V., Gunnarson, I., Sturfelt, G., Rantapaa- Dahlquvist, S., Elvin, K., Truedsson, L., Andersson, B.A., Dahle, C., Ortqvist, E., Gregersen, P.K., Behrens, T.W., and Hammarstrom, L. (2011). Selective IgA Deficiency in Autoimmune Diseases. Moleuclar Medicine, 17(11-12):1383-1396. doi: 10.2119/molmed.2011.00195.

Wolf, H.M., Fischer, M.B., Pühringer, H., Samstag, A., Vogel, E., & Eibl, M. M. (1994). Human serum IgA downregulates the release of inflammatory cytokines (tumor necrosis factor-alpha, interleukin-6) in human monocytes. Blood, 83(5):1278-88.

Wolf, H.M, Hauber, I., Gulle, H., Samstag, A., Fischer, M.B., Ahmad, R.U., & Eibl, M. M. (1996). Anti-inflammatory properties of human serum IgA: induction of IL-1 receptor antagonist and Fc alpha R (CD89)-mediated down-regulation of tumour necrosis factor-alpha (TNF-alpha) and IL-6 in human monocytes. Clinical and Experimental Immunology, 105(3):537-43. doi: 10.1046/j.1365-2249.1996.d01- 793.x.

Woof, J. M., & Kerr, M.A. (2006). The Function of Immunoglobulin A in Immunity. The Journal of Pathology, 208(2):270-282. doi: 10.1002/path.1877.

Wyatt, R.J. and Julian, B.A. (2013). IgA Nephropathy. The New England Journal of Medicine, 368:2402-2414. doi: 10.1056/NEJMra1206793.

Yel, L. (2010) Selective IgA Deficiency. Journal of Clinical Immunology, 30(1):10-16. doi: 10.1007/s10875-009-9357-x.

Zhan, C. Zhang, Y., Ma, J., Wang, L., Jiang, W., Shi, Y., & Wang, Q. (2014). Identification of reference genes for qRT-PCR in human lung squamous-cell carcinoma by RNA-Seq. Acta Biochimica et Biophysica Sinica, 46(4): 330-337. doi: 10.1093/abbs/gmt153.