Cells in Murine NK Ζ RIII by CD3 Γ Function of Fc Negative Regulation

Negative Regulation of Expression and Function of Fc γRIII by CD3ζ in Murine NK Cells

This information is current as Hisashi Arase, Tadahiro Suenaga, Noriko Arase, Yoshimitsu of September 26, 2021. Kimura, Katsuhiko Ito, Ritsuko Shiina, Hiroshi Ohno and Takashi Saito J Immunol 2001; 166:21-25; ; doi: 10.4049/jimmunol.166.1.21

http://www.jimmunol.org/content/166/1/21 Downloaded from

References This article cites 31 articles, 13 of which you can access for free at: http://www.jimmunol.org/content/166/1/21.full#ref-list-1 http://www.jimmunol.org/

Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision

• No Triage! Every submission reviewed by practicing scientists

• Fast Publication! 4 weeks from acceptance to publication by guest on September 26, 2021

*average

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2001 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. Negative Regulation of Expression and Function of Fc␥RIII by CD3␨ in Murine NK Cells1

Hisashi Arase,2 Tadahiro Suenaga, Noriko Arase,3 Yoshimitsu Kimura,4 Katsuhiko Ito, Ritsuko Shiina, Hiroshi Ohno,5 and Takashi Saito6

Fc␥RIII is involved in Ab-dependent cell-mediated cytotoxicity (ADCC) and cytokine production by NK cells. Signaling and expression of Fc␥RIII are dependent on FcR␥. Although NK cells express not only FcR␥ but also CD3␨, the role of CD3␨ in NK cell function remains unclear. Here, we found that the expression of Fc␥RIII on NK cells from CD3␨-deficient mice is unexpectedly up-regulated compared with that on cells from normal mice. Furthermore, ADCC and IFN-␥ production upon Fc␥RIII-cross- linking by NK cells from CD3␨-deficient mice were also up-regulated. Up-regulation of the surface expression of Fc␥RIII on CD3␨-deficient NK cells is not mediated by transcriptional augmentation of either Fc␥RIII or FcR␥ gene because there was no significant difference in the expression of mRNA for Fc␥RIII and FcR␥. Transfection of CD3␨ into a cell line expressing Fc␥RIII Downloaded from and FcR␥ induced a decrease in the cell surface expression of Fc␥RIII. These findings reveal a negative regulatory role of CD3␨ in Fc␥RIII-mediated function of murine NK cells. The Journal of Immunology, 2001, 166: 21–25.

atural killer cells are activated upon recognition of a mice do not express Fc␥RIII or show ADCC function (9, 10). variety of target cells and exhibit natural cytotoxicity. Furthermore, NK cells from Fc␥RIIIϪ/Ϫ mice also fail to exhibit N Recently, a number of receptors were found to be in- ADCC, confirming that Fc␥RIII is the IgG Fc receptor responsible http://www.jimmunol.org/ volved in the activation of NK cells, although the exact features of for this function in NK cells (11). the receptors responsible for natural cytotoxicity remain unclear The CD3␨-chain is one of the components of the TCR-CD3 (1, 2). NK cells also show Ab-dependent cell-mediated cytotoxic- complex and possesses three tyrosine-based activation motifs ity (ADCC)7 upon cross-linking of IgG Fc␥R with Ab (3–5). (ITAM) in its cytoplasmic domain. ITAMs of CD3␨ are rapidly Among different Fc␥Rs, NK cells mainly express the low affinity tyrosine phosphorylated upon TCR cross-linking and transduce ac- receptor for IgG termed Fc␥RIII (CD16). Recently, human tivation signals in T cells (12). In addition, CD3␨ is required for Fc␥RIII on NK cells has been shown to be involved in direct the cell surface expression of the TCR complex and plays a crucial recognition of specific targets in the absence of Ab (6), although its role in the regulation of the assembly and intracellular transport of physiological function is still unclear. Therefore, Fc␥RIII ex- the TCR-CD3 complex. Indeed, the expression of TCR is severely by guest on September 26, 2021 pressed on NK cells is involved in ADCC and partly in Ab-inde- impaired in CD3␨-deficient cells and mice (13–17). pendent natural cytotoxicity. CD3␨ is also expressed in both human and murine NK cells Fc␥RIII is expressed on the cell surface in association with despite the fact that NK cells do not express TCR and seem to be FcR␥ (Fc⑀RI␥), which was originally identified as a signaling involved in NK cell activation (18, 19). CD3␨ is phosphorylated component of the high affinity IgE receptor (Fc⑀RI) complex (7, upon cross-linking of Fc␥RIII and is thought to be involved in 8). Because Fc␥RIII cannot be expressed on the cell surface in the signal transduction through Fc␥RIII in human NK cells (20, 21). absence of FcR␥, NK cells obtained from FcR␥-deficient (Ϫ/Ϫ) However, it is known that there is a significant difference between human and murine CD3␨ in Fc␥RIII expression. Human CD3␨ as well as FcR␥ can be associated with Fc␥RIII and are involved in Department of Molecular Genetics, Chiba University Graduate School of Medicine, the surface expression of Fc␥RIII, whereas murine Fc␥RIII can Chiba, Japan associate only with FcR␥, not with CD3␨. (22). In addition, no Received for publication July 7, 2000. Accepted for publication September 27, 2000. significant functional defects have been reported in NK cells from Ϫ/Ϫ The costs of publication of this article were defrayed in part by the payment of page CD3␨ mice (17). From these analyses, it has been widely be- charges. This article must therefore be hereby marked advertisement in accordance lieved that CD3␨ does not play any important role in the activation with 18 U.S.C. Section 1734 solely to indicate this fact. of murine NK cells. 1 This work was supported by Grants-in-Aid for Scientific Research from the Ministry ␥ of Education, Science, and Culture. In the present study we found that Fc RIII expression on NK cells from CD3␨Ϫ/Ϫ mice is greatly enhanced. Furthermore, 2 Current address: Department of Microbiology and Immunology, University of Cal- ifornia San Francisco, CA 94143. Fc␥RIII-mediated functions of NK cells from CD3␨-deficient mice 3 Current address: Hooper Foundation, University of California, San Francisco, CA were also up-regulated. These findings demonstrate a novel func- 94143. tion of CD3␨ in murine NK cells in regulation of the expression 4 Current address: Mitsui Pharmaceuticals Inc., Mobara 297-0017, Japan. and function of Fc␥RIII. 5 Current address: Division of Molecular Membrane Biology, Cancer Research In- stitute, Kanazawa University, Kanazawa 920-0934, Japan. Materials and Methods 6 Address correspondence and reprint requests to Dr. Takashi Saito, Department of Mice Molecular Genetics, Chiba University Graduate School of Medicine, Chiba 260-8670, Japan. E-mail address: [email protected] The establishment and characterization of CD3␨Ϫ/Ϫ mice were described ␨Ϫ/Ϫ 7 Abbreviations used in this paper: ADCC, Ab-dependent cell-mediated cytotoxicity; previously (14). CD3 mice were maintained in our animal facility and Ϫ/Ϫ GFP, green fluorescence protein; IRES, internal ribosomal entry site; ITAM, immu- back-crossed to C57BL/6 mice seven times. FcR␥ mice were generated noreceptor tyrosine-based activation motif; sIg, surface Ig. from C57BL/6-derived embryonic stem cells as previously described (10).

Preparation of NK cells streptavidin-peroxidase (Vecstain Elite ABC kit; Vector, Burlingame, CA), an ECL system (Amersham International, Aylesbury, U.K.). NK cells were purified as previously described (23). Briefly, splenocytes were mixed with anti-CD4 mAb (GK1.5) and anti-CD8 mAb (53.6.7) fol- Transfection lowed by incubation with magnetic beads (Advanced Magnetics, Cam- bridge, MA) coupled with goat anti-mouse IgG Ab and goat anti-rat IgG cDNAs for Fc␥RIII and FcR␥ were subcloned into pMx retrovirus expres- Ab (Cappel, Organon Teknika, West Chester, PA) to remove surface Igϩ sion vector (provided by Dr. T. Kitamura, University of Tokyo, Tokyo, (sIgϩ) B cells and CD4ϩ and CD8ϩ T cells. The residual cells were then Japan). These cDNAs were transiently transfected into BOSC23 packaging incubated with PE-anti-NK1.1 mAb and FITC-anti-CD3 mAb (PharMin- cells using Lipofectamine Plus (Life Technologies, Gaithersburg, MD). gen, San Diego, CA). The stained cells were sorted into NK1.1ϩ CD3Ϫ Culture supernatants were collected at 2 days after transfection, and NIH- cells by FACStarPlus (Becton Dickinson, Mountain View, CA). The purity 3T3 cells were infected by addition of the supernatants. Fc␥RIII-expressing of the sorted cells was always Ͼ99%. cells were purified by FACStarPlus, and a single-cell clone stably expressing Fc␥RIII was obtained. CD3␨ was subcloned into internal ribosomal Cell culture and stimulation entry site (pIRES)-green fluorescence protein (EGFP) expression vector (Clontech, Palo Alto, CA). Mutant CD3␨ in which isoleucine in the trans- Purified NK cells were cultured in RPMI 1640 supplemented with 10% membrane region was substituted to leucine (I46L-CD3␨) was generated ␮ ϫ Ϫ5 FCS, kanamycin (100 g/ml), and 5 10 M 2-ME. NK cells were by recombinant PCR and subcloned into pIRES-EGFP vector. CD3␨- expanded by culturing freshly purified NK cells for 5–7 days in the pres- IRES-GFP, I46L-CD3␨-IRES-GFP, and IRES-GFP (vector only) were ence of 1000 U/ml human rIL-2 (Ajinomoto, Kawasaki, Japan) and were transiently transfected into the Fc␥RIII transfectants. At 36 h after trans- ␥ ϫ 4 used for further analysis. For the analysis of IFN- production, 5 10 NK fection, the expressions of GFP and Fc␥RIII on the transfectants were cells were stimulated with immobilized mouse IgG1 mAb (anti-biotin, analyzed. Zymed, South San Francisco, CA) or with recombinant mouse IL-12 (4.9 ϫ 106 U/mg; supplied by Genetics Institute, Cambridge, MA) for 2 days. Mouse IgG1 mAb was immobilized on a 96-well flat-bottom sterile Results Downloaded from Ϫ/Ϫ ELISA plate (Corning, Corning, NY) by incubation for2hat37°C in 0.1 Up-regulation of Fc␥RIII expression on CD3␨ NK cells M NaHCO . 3 To analyze the role of CD3␨ in NK cells, we purified NK cells Ϫ Ϫ Ϫ Ϫ Measurement of IFN-␥ from splenocytes from wild-type, CD3␨ / , and FcR␥ / mice. Purified NK cells were expanded for 5 days in the presence of The amount of IFN-␥ produced in the culture supernatants was measured ␥ IL-2, and the expression of NK1.1 and Fc␥RIII on the cell surface by ELISA using a standard protocol with rIFN- as the standard (24). Ϫ Ϫ

/ http://www.jimmunol.org/ Anti-IFN-␥ mAb (R4-6A2, PharMingen) was used to capture IFN-␥. Bi- was analyzed (Fig. 1). As previously reported, FcR␥ NK cells otinylated anti-IFN-␥ mAb (XMG1.2, PharMingen) was used to detect were deficient in Fc␥RIII expression, because FcR␥ is required for captured IFN-␥. the surface expression of Fc␥RIII (9, 10). In contrast, Fc␥RIII ␨Ϫ/Ϫ ADCC activity expression on the cell surface of CD3 NK cells was significantly higher than that on wild-type NK cells. Similar results were ADCC activity was analyzed as previously described (25). P815 cells were obtained when Fc␥RIII expression was analyzed on freshly iso- surface biotinylated (26), followed by labeling with PKH-2-green fluores- ␥ cence dye (Sigma, St. Louis, MO). Thereafter, PKH-2-labeled P815 cells lated NK cells (data not shown). In contrast to Fc RIII, the surface were cultured with various numbers of NK cells at 37°C for4hinthe expression of NK1.1, another FcR␥-associated molecule on NK presence of various concentrations of rabbit anti-biotin Ab (Rockland, Gil- cells (23), did not differ between wild-type and CD3␨Ϫ/Ϫ NK cells, by guest on September 26, 2021 bertsville, PA). Dead cells were stained with propidium iodide, and the suggesting that CD3␨ specifically down-regulates Fc␥RIII expres- proportion of dead cells in PKH-2-stained target cells was determined by flow cytometry. Data are presented as the mean Ϯ SD from triplicate sion on NK cells. cultures. Next, we addressed the question of whether the function of Fc␥RIII in NK cells from CD3␨Ϫ/Ϫ mice is affected by the ele- Flow cytometry vated expression of the surface Fc␥RIII. Because NK cells show Cells were stained with fluorescence-labeled Abs and analyzed with FAC- ADCC and are involved in Ab-mediated immune responses (4, 5), Scan or FACScalibur (Becton Dickinson). Fluorescence-labeled Abs used we first analyzed the ADCC activity by NK cells from CD3␨Ϫ/Ϫ for flow cytometry were FITC- or PE-2.4G2 (PharMingen) and PE-anti- mice. CD3␨Ϫ/Ϫ NK cells exhibited no significant difference from NK1.1 (PharMingen). wild-type NK cells in cytotoxicity against biotinylated P815 cells Ϫ Ϫ RT-PCR in the absence of anti-biotin Ab (Fig. 2A). However, CD3␨ / NK cells, which express a higher level of Fc␥RIII, showed signifi- Total cellular RNA was extracted by the guanidinium-isothiocyanate method. Single-strand cDNA was synthesized with reverse transcriptase cantly more potent cytotoxicity in the presence of the anti-biotin from 0.5 ␮g of RNA and was used for PCR. Primer sequences used were Ab than wild-type NK cells (Fig. 2B). The ADCC activity was as follows: ␤-actin: 5Ј primer, TGGAATCCTGTGGCATCCATGAAAC; correlated with the Ab concentration (Fig. 2C). Interestingly, the 3Ј primer, TAAAACGCAGCTCAGTAACAGTCCG; Fc␥RIII: 5Ј primer, differences in ADCC function between wild-type and CD3␨Ϫ/Ϫ GTTTAAGGCCACAGTCAATG; 3Ј primer, GGTTGGCTTTTGGGAT AG; and FcR␥:5Ј primer, ATGATCTCAGCCGTGATCTTG; 3Ј primer, NK cells were greater at lower concentrations of Ab. While AGTCTCATATGTCTCCTGGCT. Various amounts of cDNAs were amplified in PCR under the following conditions: 94°C for 1 min, 57°C for 1 min, and 72°C for 1.5 min with 20 cycles for ␤-actin or with 26 cycles for Fc␥RIII and FcR␥. After amplification, PCR products were separated by electrophoresis on 1.5% agarose gel containing ethidium bromide and vi- sualized by UV illumination. Surface biotinylation, immunoprecipitation, and Western blotting NK cells were surface biotinylated as previously described (26). Biotinyl- ated cells were lysed with a lysis buffer containing 1% digitonin, 50 mM Tris-HCl (pH 7.6), 150 mM NaCl, 10 ␮g/ml aprotinin, 10 ␮g/ml leupeptin, ϫ 7 1 mM PMSF, and 10 mM iodoacetamide, at a concentration of 1 10 ␥ cell/ml. Immunoprecipitation was performed with anti-CD3␨ (H146) or FIGURE 1. Expression of Fc RIII and NK1.1 on the cell surface of NK ␨Ϫ/Ϫ ␥Ϫ/Ϫ anti-Fc␥RIII (2.4G2) mAbs. Immunoprecipitates were separated on two- cells from wild-type, CD3 , and FcR mice. Purified NK cells were dimensional nonreducing (16%) and reducing (18%) SDS-PAGE and stained with FITC-2.4G2 and PE-anti-NK1.1 mAbs, and the expression of transferred onto a polyvinylidene difluoride membrane (Immobilon-P; Mil- Fc␥RIII and NK1.1 is shown. Because NK cells do not express Fc␥RII, the lipore, Bedford, MA). The biotinylated proteins were detected using anti-Fc␥RII/III mAb, 2.4G2, reacts only with Fc␥RIII on NK cells. The Journal of Immunology 23

FIGURE 2. Cytotoxicity of NK cells from wild-type and CD3␨Ϫ/Ϫ mice. Cyto- toxic activity by NK cells from wild-type (E) and CD3␨Ϫ/Ϫ mice (F). Cytotoxicity by NK cells against biotinylated P815 cells was analyzed in the absence (A)orthe presence (B) of anti-biotin Ab (3.1 ␮g/ml) and in the presence of various concentrations of anti-biotin Ab at a 3:1 E:T cell ratio (C). Cytotoxicity against YAC-1 cells was analyzed (D). Downloaded from http://www.jimmunol.org/

CD3␨Ϫ/Ϫ NK cells showed almost maximum cytotoxicity in the indicate that not only the expression level of Fc␥RIII but also its presence of 6.3 ␮g/ml of Ab, wild-type NK cells did not reach function are up-regulated in NK cells lacking CD3␨. maximum cytotoxicity with the same concentration of Ab, and the cytotoxicity continued to gradually increase as Ab concentrations Equivalent expression of the transcripts for Fc␥RIII and FcR␥ were increased. In contrast, there was no signiﬁcant difference be- in both wild-type and CD3␨Ϫ/Ϫ NK cells Ϫ/Ϫ

tween wild-type and CD3␨ NK cells in natural cytotoxicity by guest on September 26, 2021 against NK-sensitive target cells, such as YAC-1 (17) (Fig. 2D). To address the question of whether the enhanced expression of ␥ ␨Ϫ/Ϫ These results indicate that CD3␨ down-regulates ADCC activity, Fc RIII on the cell surface of CD3 NK cells can be attributed ␥ ␥ but not natural cytotoxicity by NK cells. to an increase in mRNA for Fc RIII or FcR , we analyzed the ␥ amounts of transcripts for Fc␥RIII, FcR␥, and ␤-actin in NK cells The triggering of NK cells through Fc RIII induces not only Ϫ Ϫ Ϫ Ϫ Ϫ Ϫ ␨ / ␥ / ADCC but also IFN-␥ production. Wild-type and CD3␨ / NK from wild-type, CD3 , and FcR mice by semiquantitative cells were stimulated with various concentrations of immobilized RT-PCR. As shown in Fig. 4, we could not observe any signiﬁcant ␨Ϫ/Ϫ IgG1 mAb or recombinant murine IL-12, and the amount of IFN-␥ difference between wild-type and CD3 NK cells in the ex- ␥ ␥ produced in culture supernatants was measured by ELISA 2 days pression levels of mRNA for Fc RIII and FcR . This observation ␥ ␨Ϫ/Ϫ later. As shown in Fig. 3A, the amount of IFN-␥ produced by suggests that the augmented expression of Fc RIII on CD3 CD3␨Ϫ/Ϫ NK cells upon stimulation with immobilized IgG1 mAb NK cells was not due to the increased expression of mRNA of ␥ ␥ ␨ was severalfold higher than that produced by wild-type NK cells. Fc RIII or FcR and that CD3 regulates the expression of ␥ In contrast, there was no difference in IFN-␥ production by these Fc RIII by a post-transcriptional mechanism. NK cells upon stimulation with IL-12 (Fig. 3B), demonstrating that the increased production of IFN-␥ by CD3␨Ϫ/Ϫ NK cells was not Surface expression of the CD3␨-FcR␥ heterodimer on NK cells ␥ due to an elevated capacity for IFN- production. These results FcR␥ is required for the surface expression of Fc␥RIII on mouse NK cells (8–10). Because NK cells express both CD3␨ and FcR␥, it is postulated that CD3␨ forms heterodimers with FcR␥ similarly in T cells (27, 28), and the formation of the heterodimers may affect the amount of the FcR␥ homodimers required for efﬁcient expression of Fc␥RIII. Therefore, we analyzed the expression of dimers containing CD3␨ and FcR␥ on the cell surface of NK cells. NK cells from wild-type mice were expanded in the presence of IL-2 and surface biotinylated. The cell lysates were immunoprecipitated with anti-CD3␨ and anti-Fc␥RIII mAbs, and the precip- itates were analyzed on two-dimensional SDS-PAGE. As shown in ␨ FIGURE 3. IFN-␥ production by NK cells from wild-type and Fig. 5, immunoprecipitation with anti-CD3 mAb revealed that Ϫ Ϫ ␨ ␨ ␥ CD3␨ / mice. IFN-␥ production by NK cells from wild-type (E) and CD3 was expressed mainly as CD3 -FcR heterodimers on the CD3␨Ϫ/Ϫ (F) mice. NK cells were stimulated with various concentrations surface of NK cells, and CD3␨ homodimers were barely observed. of IgG1 Ab immobilized on culture plate (A) or IL-12 (B) for 2 days, and By contrast, when Fc␥RIII was precipitated, only FcR␥ ho- the amount of IFN-␥ produced in the culture supernatants was determined. modimers, but not CD3␨-FcR␥ heterodimers, were detected. These 24 NEGATIVE REGULATION OF Fc␥RIII BY CD3␨ IN NK CELLS

FIGURE 5. Fc␥RIII associates with FcR␥ homodimers, but not CD3␨- FcR␥ heterodimers, on the cell surface of NK cells. CD3␨ and FcR␥ were immunoprecipitated from cell lysates of surface biotinylated NK cells from normal mice with anti-CD3␨ mAb (left panel) or anti-Fc␥RIII mAb (right panel). Precipitated proteins were analyzed by two-dimensional SDS- PAGE under nonreducing (NR) and reducing (R) conditions. CD3␨-FcR␥ heterodimers (␥-␨) and FcR␥ homodimers (␥-␥) are indicated. Molecular size markers are indicated at the left margin.

evidence that the down-regulation of cell surface expression of Downloaded from Fc␥RIII is dependent on the inability of CD3␨ to associate with Fc␥RIII. FIGURE 4. RT-PCR analysis of Fc␥RIII and FcR␥ mRNA expression. mRNA expression of FcR␥,Fc␥RIII, and ␤-actin in NK cells from wild- Discussion ␨Ϫ/Ϫ ␥Ϫ/Ϫ type, CD3 , and FcR mice were analyzed by semiquantitative RT- In the present study, we found that CD3␨ plays an important role PCR analysis. Sequentially diluted cDNAs from NK cells (ϫ1, ϫ3, ϫ10,

in the regulation of Fc␥RIII expression on murine NK cells. In the http://www.jimmunol.org/ and ϫ30) were amplified. absence of CD3␨, the expression and function of Fc␥RIII in NK cells were augmented. Furthermore, transfection of murine CD3␨ into transfectants expressing Fc␥RIII and FcR␥ significantly re- results indicate that Fc␥RIII associates only with FcR␥ ho- duced Fc␥RIII expression on the cell surface. modimers and that NK cells express CD3␨-FcR␥ heterodimers on Both ADCC activity and IFN-␥-producing capacity were up- the cell surface, but these heterodimers do not associate with regulated in CD3␨Ϫ/Ϫ NK cells. Particularly, CD3␨Ϫ/Ϫ NK cells Fc␥RIII, suggesting that CD3␨ regulates the level of the FcR␥ showed significant cytotoxicity even with low concentrations of homodimer through the formation of CD3␨-FcR␥ heterodimers. Ab, suggesting that the overall avidity of Fc␥RIII on CD3␨Ϫ/Ϫ NK cells toward Ab-coated target cells is up-regulated. The up-regu- by guest on September 26, 2021 ␥ ␨ ␥ Down-regulation of Fc RIII expression by CD3 on Fc RIII- lation of Fc␥RIII-mediated function could be simply attributed to ␥ and FcR -transfected NIH-3T3 cells the increased expression of Fc␥RIII on the cell surface. The alter- We next examined the direct effect of CD3␨ on Fc␥RIII expression native possibility is that the signaling capacity of Fc␥RIII was by transfection of CD3␨ into cells expressing both Fc␥RIII and up-regulated by increasing the FcR␥ homodimer in the absence of FcR␥. We transfected Fc␥RIII and FcR␥ cDNAs into NIH-3T3 CD3␨-FcR␥ heterodimers in CD3␨Ϫ/Ϫ mice on the basis that cells and isolated a clone that stably expresses Fc␥RIII on their cell Fc␥RIII associates only with FcR␥ homodimers. Contrary to our surface. Thereafter, the wild-type CD3␨ and a mutant CD3␨ con- findings, Liu et al. (17) previously reported that CD3␨Ϫ/Ϫ NK cells taining a mutation within the transmembrane region were trans- exhibit normal ADCC function. However, they measured ADCC fected into the Fc␥RIII-expressing NIH-3T3 clone. activity at a single concentration of Ab. Indeed, our data demon- It has been reported that the leucine 46 in the transmembrane strated that CD3␨Ϫ/Ϫ NK cells exhibit similar ADCC activity to region of human CD3␨ is crucial for the association with Fc␥RIII that in wild-type NK cells at high concentrations of Ab (Fig. 2C). because the substitution of leucine to isoleucine, which is an equiv- Therefore, it is likely that the previous report used such a high alent substitution to murine CD3␨, abrogated the interaction of concentration of Ab and that any significant difference in ADCC CD3␨ with Fc␥RIII (22). Indeed, the cell surface expression of activity could not be observed. mouse Fc␥RIII was induced when Fc␥RIII was transfected into Although precise mechanism for CD3␨-mediated down-regula- COS cells with murine CD3␨ possessing the substitution of iso- tion of the cell surface expression of Fc␥RIII remains unclear, our leucine 46 to leucine (I46L-CD3␨; data not shown). According to data suggest that the regulatory function is dependent on the in- these observations, wild-type CD3␨ as well as I46L-CD3␨ were ability of murine CD3␨ to associate with Fc␥RIII. FcR␥ is required transfected into an Fc␥RIII-expressing NIH-3T3 clone. for the cell surface expression of Fc␥RIII, and human, but not Because Ab against the extracellular region of CD3␨ is not murine, CD3␨ can substitute for this function of FcR␥ (8, 22). available, CD3␨ cDNAs were transfected using an expression vec- Because CD3␨ forms heterodimers with FcR␥ (27, 28), our data tor containing IRES-GFP gene to monitor CD3␨-expressing cells suggest that wild-type CD3␨ interferes with the association of by analyzing GFP expression. We confirmed that the expression Fc␥RIII with FcR␥ homodimers by the formation of CD3␨-FcR␥ level of CD3␨ was correlated with the amount of GFP in this heterodimers. system (data not shown). When wild-type CD3␨ was transfected Surface biotinylation of NK cells demonstrated that FcR␥ ho- into an Fc␥RIII-expressing NIH-3T3 clone, the surface expression modimers, but not CD3␨-FcR␥ heterodimers, were associated with of Fc␥RIII was significantly decreased in the GFPϩ population, Fc␥RIII on the cell surface despite the fact that CD3␨-FcR␥ het- but not in the GFPϪ population (Fig. 6). In contrast, transfection of erodimers were readily detected on the cell surface of NK cells I46L-CD3␨ and vector alone did not change the Fc␥RIII expres- (Fig. 5). In addition, the I46L-CD3␨ mutant failed to interfere with sion on the cell surface of GFPϩ cells. These observations provide the surface expression of Fc␥RIII, and this mutant CD3␨ exhibits The Journal of Immunology 25

6. Mandelboim, O., P. Malik, D. M. Davis, C. H. Jo, J. E. Boyson, and J. L. Strominger. 1999. Human CD16 as a lysis receptor mediating direct natural killer cell cytotoxicity. Proc. Natl. Acad. Sci. USA 96:5640. 7. Ra, C., M. H. Jouvin, U. Blank, and J. P. Kinet. 1989. A macrophage Fc␥ receptor and the mast cell receptor for IgE share an identical subunit. Nature 341:752. 8. Ravetch, J. V., and R. A. Clynes. 1998. Divergent roles for Fc receptors and complement in vivo. Annu. Rev. Immunol. 16:421. 9. Takai, T., M. Li, D. Sylvestre, R. Clynes, and J. V. Ravetch. 1994. FcR␥ chain deletion results in pleiotrophic effector cell defects. Cell 76:519. FIGURE 6. Suppression of the cell surface expression of Fc␥RIII by 10. Park, S. Y., S. Ueda, H. Ohno, Y. Hamano, M. Tanaka, T. Shiratori, T. Yamazaki, ␥ murine CD3␨, but not I46L-CD3␨. CD3␨-IRES-GFP (thick line), I46L- H. Arase, N. Arase, A. Karasawa, et al. 1998. Resistance of Fc receptor- defi- ␨ cient mice to fatal glomerulonephritis. J. Clin. Invest. 102:1229. CD3 -IRES-GFP (thin line), and IRES-GFP (dotted line) were transiently 11. Hazenbos, W. L., J. E. Gessner, F. M. Hofhuis, H. Kuipers, D. Meyer, transfected into an NIH-3T3 cell line stably transfected with both Fc␥RIII I. A. Heijnen, R. E. Schmidt, M. Sandor, P. J. Capel, M. Daeron, et al. 1996. and FcR␥. Cells were stained with PE-anti-Fc␥RIII mAb 36 h after trans- Impaired IgG-dependent anaphylaxis and Arthus reaction in Fc␥RIII (CD16) fection and analyzed by FACScaliber. The cell surface expressions of deficient mice. Immunity 5:181. ␥ 12. Weiss, A., and D. R. Littman. 1994. Signal transduction by lymphocyte antigen Fc RIII on GFP-positive and GFP-negative cells are shown. receptors. Cell 76:263. 13. Sussman, J. J., J. S. Bonifacino, J. Lippincott-Schwartz, A. M. Weissman, T. Saito, R. D. Klausner, and J. D. Ashwell. 1988. Failure to synthesize the T cell CD3-␨ chain: structure and function of a partial T cell receptor complex. Cell ␥ 52:85. an affinity sufficient to associate with Fc RIII (Fig. 6; our unpub- 14. Ohno, H., T. Aoe, S. Taki, D. Kitamura, Y. Ishida, K. Rajewsky, and T. Saito. lished observation). These observations suggest that CD3␨ down- 1993. Developmental and functional impairment of T cells in mice lacking CD3␨ ␥ ␨ ␥ chains. EMBO J. 12:4357. regulates the expression of Fc RIII by forming CD3 -FcR het- Downloaded from ␥ 15. Malissen, M., A. Gillet, B. Rocha, J. Trucy, E. Vivier, C. Boyer, F. Kontgen, erodimers that cannot associate with Fc RIII in NK cells. N. Brun, G. Mazza, and E. Spanopoulou. 1993. T cell development in mice We have previously shown that FcR␥ is also associated with lacking the CD3-␨/␩ gene. EMBO J. 12:4347. NK1.1, and this association is necessary for signal transduction 16. Love, P. E., E. W. Shores, M. D. Johnson, M. L. Tremblay, E. J. Lee, ␥ A. Grinberg, S. P. Huang, A. Singer, and H. Westphal. 1993. T cell development through NK1.1 (23). In contrast to Fc RIII, the surface expression in mice that lack the ␨ chain of the T cell antigen receptor complex. Science Ϫ Ϫ of NK1.1 did not increase on CD3␨ / NK cells (Fig. 1). Our 261:918. previous finding that NK1.1 does not require FcR␥ for its surface 17. Liu, C. P., R. Ueda, J. She, J. Sancho, B. Wang, G. Weddell, J. Loring, C. Kurahara, E. C. Dudley, A. Hayday, et al. 1993. Abnormal T cell development http://www.jimmunol.org/ expression unlike Fc␥RIII (23), may explain the reason why the in CD3-␨Ϫ/Ϫ mutant mice and identification of a novel T cell population in the surface expression of NK1.1 was not increased on CD3␨Ϫ/Ϫ NK intestine. EMBO J. 12:4863. ␨ 18. Anderson, P., M. Caligiuri, J. Ritz, and S. F. Schlossman. 1989. CD3-negative cells. Therefore, the down-regulatory effect by CD3 is specific for natural killer cells express ␨ TCR as part of a novel molecular complex. Nature receptors that require FcR␥ for their cell surface expression. 341:159. Because CD3␨ has been thought to be a signal-transducing mol- 19. Lanier, L. L., G. Yu, and J. H. Phillips. 1989. Co-association of CD3␨ with a receptor (CD16) for IgG Fc on human natural killer cells. Nature 342:803. ecule for Ag and Ab cell surface receptors, our study provides a 20. O’Shea, J. J., A. M. Weissman, I. C. Kennedy, and J. R. Ortaldo. 1991. Engage- novel negative regulatory role of the immune response by CD3␨. ment of the natural killer cell IgG Fc receptor results in tyrosine phosphorylation Recently, FcR␥ has been reported to associate with paired Ig-like of the ␨ chain. Proc. Natl. Acad. Sci. USA 88:350. 21. Vivier, E., P. Morin, C. O’Brien, B. Druker, S. F. Schlossman, and P. Anderson. receptor A (29, 30) and Ig-like transcripts 1 (31) and seems to be 1991. Tyrosine phosphorylation of the Fc␥RIII(CD16): ␨ complex in human nat- by guest on September 26, 2021 involved in transducing activation signal through these molecules. ural killer cells: induction by antibody-dependent cytotoxicity but not by natural Therefore, it might be possible that CD3␨ also negatively regulates killing. J. Immunol. 146:206. 22. Kurosaki, T., I. Gander, and J. V. Ravetch. 1991. A subunit common to an IgG the functions of these FcR␥-associated molecules in a manner sim- Fc receptor and the T-cell receptor mediates assembly through different interac- ilar to that found for Fc␥RIII. In contrast, because human CD3␨ tions. Proc. Natl. Acad. Sci. USA 88:3837. can associate with Fc␥RIII, a similar regulatory mechanism of 23. Arase, N., H. Arase, S. Y. Park, H. Ohno, C. Ra, and T. Saito. 1997. Association with FcR␥ is essential for activation signal through NKR-P1 (CD161) in natural CD3␨ observed in this study for the mouse system will not be killer (NK) cells and NK1.1ϩ T cells. J. Exp. Med. 186:1957. simply applicable in human. However, the present findings might 24. Arase, H., N. Arase, and T. Saito. 1996. Interferon ␥ production by natural killer (NK) cells and NK1.1ϩ T cells upon NKR-P1 cross-linking. J. Exp. Med. 183: contribute to develop new therapeutic methods to down-regulate 2391. the function of Fc␥RIII or other FcRs in humans. 25. Arase, H., N. Arase, Y. Kobayashi, Y. Nishimura, S. Yonehara, and K. Onoe. 1994. Cytotoxicity of fresh NK1.1ϩ T cell receptor ␣/␤ϩ thymocytes against a CD4ϩ8ϩ thymocyte population associated with intact Fas antigen expression on Acknowledgments the target. J. Exp. Med. 180:423. We thank Dr. J. Hamuro for the gift of rIL-2, Dr. J. V. Ravetch for Fc␥RIII 26. Ono, S., H. Ohno, and T. Saito. 1995. Rapid turnover of the CD3␨ chain inde- cDNA, Dr. T. Kitamura for pMx vector and for IL-12, Drs. pendent of the TCR-CD3 complex in normal T cells. Immunity 2:639. 27. Arase, H., S. Ono, N. Arase, S. Y. Park, K. Wakizaka, H. Watanabe, H. Ohno, S. Taki and L. L. Lanier for critical reading of the manuscript, and T. Saito. 1995. Developmental arrest of NK1.1ϩ T cell antigen receptor M. Sakuma for technical help, and H. Yamaguchi and Y. Kurihara for (TCR)-␣/␤ϩ T cells and expansion of NK1.1ϩ TCR-␥/␦ϩ T cell development in secretarial assistance. CD3␨-deficient mice. J. Exp. Med. 182:891. 28. Ohno, H., S. Ono, N. Hirayama, S. Shimada, and T. Saito. 1994. Preferential usage of the Fc receptor ␥ chain in the T cell antigen receptor complex by ␥/␦ T References cells localized in epithelia. J. Exp. Med. 179:365. 1. Yokoyama, W. M. 1998. Natural killer cell receptors. Curr. Opin. Immunol. 29. Kubagawa, H., C. C. Chen, L. H. Ho, T. S. Shimada, L. Gartland, C. Mashburn, 10:298. T. Uehara, J. V. Ravetch, and M. D. Cooper. 1999. Biochemical nature and 2. Lanier, L. L. 1998. Follow the leader: NK cell receptors for classical and non- cellular distribution of the paired immunoglobulin-like receptors, PIR-A and classical MHC class I. Cell 92:705. PIR-B. J. Exp. Med. 189:309. 3. Trinchieri, G., and N. Valiante. 1993. Receptors for the Fc fragment of IgG on 30. Maeda, A., M. Kurosaki, and T. Kurosaki. 1998. Paired immunoglobulin-like natural killer cells. Nat. Immun. 12:218. receptor (PIR)-A is involved in activating mast cells through its association with 4. Leibson, P. J. 1997. Signal transduction during natural killer cell activation: in- Fc receptor ␥ chain. J. Exp. Med. 188:991. side the mind of a killer. Immunity 6:655. 31. Nakajima, H., J. Samaridis, L. Angman, and M. Colonna. 1999. Human myeloid 5. Perussia, B. 1998. Fc receptors on natural killer cells. Curr. Top. Microbiol. cells express an activating ILT receptor (ILT1) that associates with Fc receptor Immunol. 230:63. ␥-chain. J. Immunol. 162:5.