Malignant Pleural Mesothelioma–Targeted CREBBP/EP300 Inhibitory Protein 1 Promoter System for Gene Therapy and Virotherapy

Research Article

Malignant Pleural Mesothelioma–Targeted CREBBP/EP300 Inhibitory Protein 1 Promoter System for Gene Therapy and Virotherapy Takuya Fukazawa,1 Junji Matsuoka,1 Yoshio Naomoto,1 Yutaka Maeda,2 Mary L. Durbin,3 and Noriaki Tanaka1

1Department of Gastroenterological Surgery, Okayama University Graduate School of Medicine, Dentistry and Pharmaceutical Sciences, Okayama, Japan; 2Division of Pulmonary Biology, Cincinnati Children’s Hospital Medical Center, Cincinnati, Ohio; and 3Department of Ecology and Evolutionary Biology, University of California, Irvine, California

Abstract lioma has proven curative (6, 7). Moreover, the diffuse nature of Gene therapy and virotherapy are one of the approaches used pleural mesothelioma, which often covers most of the lung and the to treat malignant pleural mesothelioma. To improve the interlobular fissures, is the principal limitation to radiotherapy (8). efficiency of targeting malignant mesothelioma cells, we Long-term survival (>5 years) with any treatment modality is designed a novel system using the promoter of the CREBBP/ exceedingly rare in malignant pleural mesothelioma. Thus, there is EP300 inhibitory protein 1 (CRI1), a gene specifically expressed an urgent need for new therapeutic options for mesothelioma. in malignant pleural mesothelioma. Four tandem repeats of The first human gene therapy trial approved in the United States À the CRI1promoter (CRI1 138 4x) caused significantly high as a primary cancer treatment was aimed at mesothelioma. At least promoter activity in malignant pleural mesothelioma cells but four gene therapy trials have been carried out in mesothelioma patients using different vector systems (adenovirus and vaccinia little promoter activity in normal mesothelial cells and virus) and transgenes [herpes simplex virus thymidine kinase (HSV- normal fibroblasts. The recombinant adenoviral vector h expressing proapoptotic BH3-interacting death agonist or tk) combined with ganciclovir, interleukin-2, and IFN- ;ref.9]. À early region 1A driven by the CRI1 138 4x promoter induced However, no significant clinical responses were observed, indicat- cell death in malignant mesothelioma cells but not in normal ing that improvements are critically needed in gene therapy cells. Moreover, these viruses showed antitumor effects in a approaches for the treatment of mesothelioma (10). mesothelioma xenograft mouse model. Here, we describe a Another attractive method to treat malignant pleural mesothe- novel strategy to target malignant mesothelioma using the lioma is to induce apoptosis by the introduction of proapoptotic À138 4x genes (11, 12) or cell lysis by the replicative oncolytic adenovirus CRI1 promoter system. [Cancer Res 2008;68(17):7120–9] (13). To use these approaches, the development of a specific promoter system targeting mesothelioma but not normal cells is Introduction essential considering the side effects of proapoptotic genes and the Malignant pleural mesothelioma is an aggressive tumor of replicating adenovirus. To design a system for specific gene therapy mesenchymal origin and is increasing worldwide as a result of and virotherapy to treat malignant mesothelioma, we evaluated the widespread exposure to asbestos that was widely used in specificity of the promoters of four different mesothelioma-specific industrialized countries until approximately 1970. There is genes: calretinin (14), Wilms’ tumor suppressor gene (WT1; ref. 15), substantial interest in this disease because millions of people have mesothelin (16), and CREBBP/EP300 inhibitory protein 1 (CRI1; been exposed to asbestos fibers, and there are more than 3,000 ref. 17). Transient transfection assay showed that the CRI1 cases of mesothelioma seen annually in the United States (1). The promoter is highly active in malignant pleural mesothelioma cells median survival of patients with mesothelioma from time of (H2452, MSTO-211H, H2052, and H28) but much less active in diagnosis ranges between 1 and 2years (2,3). The mortality is normal mesothelial cells and pleural cells. However, the other three expected to increase, at least until 2020, which is mainly due to the promoters of mesothelioma-specific genes (calretinin, WT1, and long latency (30–50 years) of the disease (4). mesothelin) showed high promoter activity not only in the Despite considerable advances in the understanding of its mesothelioma cells but also in normal cells. pathogenesis and etiology, malignant mesothelioma remains In the present study, we have assessed the capability of largely unresponsive to standard modalities of cancer therapy (5). adenovirus-mediated transgene expression induced by the CRI1 In some cases, extrapleural pneumonectomy can prolong the promoter specifically in mesothelioma cells in vitro and the median survival time of more than 2years; however, this approach feasibility of targeting malignant mesothelioma in both in vitro cell is suitable for only a few patients. Most surgical intervention is culture and in vivo in a mesothelioma xenograft mouse model. often impossible because of intrapleural spread. Although chemotherapy can ameliorate the symptoms of the disease, including pain and breathlessness with pleural effusion, no regimen for mesothe- Materials and Methods Tissues and cell lines. The human malignant mesothelioma cells H2452, MSTO-211H, H2052, and H28, the human lung adenocarcinoma cells H322 and A549, and the human breast cancer cells MCF7 were obtained from the Note: Supplementary data for this article are available at Cancer Research Online (http://cancerres.aacrjournals.org/). American Type Culture Collection (ATCC) and grown in Ham’s F12(A549 Requests for reprints: Takuya Fukazawa, Department of Gastroenterological cells), RPMI 1640 (H2452, MSTO-211H, H2052, H28, and H322 cells), or Surgery, Okayama University Graduate School of Medicine, Dentistry and DMEM high glucose (MCF7) supplemented with 10% heat-inactivated fetal Pharmaceutical Sciences, 2-5-1 Shikata-cho, Okayama 700-8558, Japan. Phone: 81-86- bovine serum (FBS). Normal pleural rat cells 4/4 R.M.-4 obtained from 235-7257; Fax: 81-86-221-8775; E-mail: [email protected]. I2008 American Association for Cancer Research. ATCC were grown in Ham’s F12K supplemented with 15% heat-inactivated doi:10.1158/0008-5472.CAN-08-0047 FBS. The human hepatoblastoma cells Hep3B obtained from ATCC were

Cancer Res 2008; 68: (17). September 1, 2008 7120 www.aacrjournals.org

À À À grown in Eagle’ MEM supplemented with 1 mmol/L sodium pyruvate, 0.1% Ad-CRI1 2586/GFP, Ad-CRI1 138 4x/GFP, Ad-CRI1 138 4x/HA-BID, and Ad- À nonessential amino acids, and 10% heat-inactivated FBS. The normal CRI1 138 4x/E1A were generated by homologous recombination (18, 19). human lung fibroblasts (NHLF) obtained from Clonetics and the normal The viral titer for each vector was determined by plaque assay and the human mesothelial cells obtained from Dominion Pharmakine were grown optimal multiplicity of infection (MOI) was determined by infecting each in culture medium supplied by the manufacturer. All cell lines were cultured cell line with Ad-CMV/GFP and assessing the expression of GFP by flow j in 10% CO2 at 37 C. Additionally, normal human pleura specimens were cytometric analysis. H2452 cells were infected with the recombinant obtained from a consenting patient undergoing treatment for diseases other adenoviral vectors at a MOI of 50 plaque-forming units (pfu)/cell, and all than mesothelioma (84-y-old male). The lysates of normal human lung other human cells were infected at a MOI of 20 pfu/cell. For infection of the protein were obtained from Chemicon International. conditionally replicating adenovirus (CRAd), H2452 cells were infected with À Plasmids. The human CRI1, calretinin, WT1, and mesothelin promoters Ad-CRI1 138 4x/E1A at a MOI of 10 pfu/cell, and all other human cells were À were obtained from purified human genomic DNA (Clontech) by PCR. The infected at a MOI of 4 pfu/cell. Ad-CRI1 138 4x/GFP was used as control. The position of the transcription initiation site (+1) was determined by the human CRI1 short hairpin RNA (shRNA) lentiviral transfer vector for human Ensembl Human Genome browser.4 The luciferase reporter construct CRI1 gene was obtained from Sigma (MISSION shRNA Bacterial Glycerol À pGL.Calretinin 2179 was generated by subcloning the promoter region of Stock). The transformed human embryonic kidney 293T cells (1 Â 106) were calretinin À2179/+70 from the genomic DNA using PCR primers (5¶- plated in a 10-cm dish and cotransfected the following day with 26 AL of the tttggtaccKpnIaatacttttacacaaagcgtggcctg and 5¶-aaaHindIIIaagcttgagctggtgc- Lentivirus Packaging Mix (Sigma) and the shRNA transfer vector (2.6 Ag) by cgaccaccacacccgggagccggcgg). The PCR-generated fragment was digested lipofection. Twenty-four and 48 h later, viral supernatants were collected in with KpnI and HindIII and subcloned directly into the pGL3-Basic luciferase serum-free medium and filtered through 0.45-Am pore size filters. The À À reporter construct (Promega). pGL.WT1 1887, pGL.Mesothelin 2310, and nontarget shRNA lentiviral (Sigma) vector was used as a control. The viral À pGL.CRI1 2586 were constructed in the same manner using the following titer was measured by HIV p24 Antigen ELISA kit (ZeptMetrix; refs. 20–22). primers: mesothelin, 5¶-tttctcgagggggtcaggcttgtgctcccgggagtcctg and 5¶- Cells were infected with the recombinant shRNA lentiviral vector at a aaaaagcttggtctgtgtctgtggagggcagtgactcag; WT1, 5¶-tttggtacctgtctcga- concentration of MOI of 2.5 transducing units/cell. gagtcctttctccactcaaaaa and 5¶-aaaacgcgtttgctgcggctcagacccggacgccccgc; Immunoblot analysis. Tissues and cells were washed once with ice-cold and CRI1, 5¶-tttacgcgtaacatgtagcaagtggctatctaaca and 5¶-tataagctt- PBS containing 5 mmol/L EDTA and 1 mmol/L sodium orthovanadate, gagggctgctgggccccc. The CRI1 promoter deletion constructs were generated homogenized, and lysed in ice-cold lysis buffer [1% Triton X-100, 20 mmol/L by subcloning multiple parts of the CRI1 promoter region À1849/+84, Tris-HCl (pH 8.0), 137 mmol/L NaCl, 10% (v/v) glycerol, 2mmol/L EDTA, À1674/+84, À1587/+84, À1083/+84, À766/+84, À567/+84, À366/+84, À296/ 1 mmol/L (v/v) sodium orthovanadate, 1 mmol/L phenylmethylsulfonyl À +84, À138/+84, À74/+84, and +1/+84, amplified from pGL.CRI1 2586, fluoride, 10 Ag/mL aprotinin, 10 Ag/mL leupeptin]. Cell lysates were using the following oligonucleotides, digested with NheI and XhoI and clarified by centrifugation (10 min at 15,000 Â g at 4jC) and protein À subcloned into pGL3-Basic: 5¶-tttNheIgctagc 1849tggaatcatgcgggtgacaa- concentration was determined using the detergent-compatible protein À ataacactgg, 5¶-tttNheIgctagc 1674gcacagaactaatggaatatatacatat- assay (Bio-Rad). Equal amounts of protein were separated on a SDS-PAGE À ata, 5¶-tttNheIgctagc 1587tgtatatatatgtaaaggggagttcaataag, 5¶-tttNheIgct- gel. The gel was electrophoretically transferred to a Hybond polyvinylidene À À agc 1083gatattgcaaatgacggtggccttaaaagta, 5¶-tttNheIgctagc 752taataataatag- difluoride transfer membrane (Amersham). The membrane was incubated À aaataaagtgcaga, 5¶-tttNheIgctagc 567atacatgtaaatgcaaataaaaagaatt- with primary and secondary antibodies according to the SuperSignal West À À caa, 5¶-tttNheIgctagc 366atatgctgatctgtggttatggatgt, 5¶-tttNheIgctagc 296taaa- Pico chemiluminescence protocol (Pierce) to detect secondary antibody À ttgcccaggggaagaggaa, 5¶-tttNheIgctagc 138cgaatcgatggaaacgtagctcaaaaggcga, binding. Antibody specific for calretinin was purchased from BD À 5¶-tttNheIgctagc 73aaccacagtggcgcgccaagtaggag, and 5¶-tttNheIgctagc+1gccttt- Transduction Laboratories. Antibodies against CRI1 and GFP were obtained gcgcacgcgcacgaacgcac. The human CRI1 region À138/À1 was generated from Abcam. Antibody specific for WT1 was obtained from Invitrogen Life À À from pGL.CRI1 1083 and subcloned into pGL.CRI1 138(À138 1x), termed Technologies. Antibody specific for adenovirus type 5 E1A was obtained pGL.CRI1À138 2x. The plasmids pGL.CRIÀ138 3x and pGL.CRIÀ138 4x were from PharMingen. Anti-mesothelin was kindly provided by Dr. Ira Pastan constructed in the same manner. All recombinant plasmids were sequenced (Center for Cancer Research, National Cancer Institute, NIH, Bethesda, MD; to ensure the identity and proper orientation of the insert. ref. 23). Anti-actin was obtained from Sigma. Secondary horseradish Transient transfection reporter assays. All transfections were carried peroxidase–conjugated goat anti-rabbit antibody and anti-mouse antibody out in six-well plates. Cells were seeded 24 h before transfection at the were obtained from Jackson ImmunoResearch Laboratories. following densities: 5 Â 105 per well for NHLF and normal human Flow cytometric analysis for apoptosis. Cells were plated in 24-well mesothelial cells and 3 Â 105 per well for all other cells. Transfections plates at a density of 2 Â 105 per well 1 d before the recombinant adenoviral were carried out with Lipofectin (Invitrogen Life Technologies) in vector infection. After 72h, cells were harvested and washed once with PBS. accordance with the manufacturer’s protocol. Transfected cells were Cells were resuspended in PBS containing 0.2% Triton X-100 and 1 mg/mL harvested 24 h after lipofection. The results of one representative RNase for 5 min at room temperature and then stained with propidium experiment are presented as fold induction of relative light units iodide at 50 Ag/mL to determine subdiploid DNA content using a FACScan. h normalized to -galactosidase activity relative to that observed for the Doublets, cell debris, and fixation artifacts were gated out, and sub-G0-G1 control vectors. Each experiment was repeated at least thrice. Error bars DNA content was determined using CellQuest version 3.3 software. indicate the SD from the average of the triplicate samples in one Animal experiments. The experimental protocol was approved by the experiment. Ethics Review Committee for Animal Experimentation of Okayama Construction of the recombinant adenoviral and lentiviral vectors. University Graduate School of Medicine and Dentistry. Human mesothe- À À À The plasmids pCalretinin 2179/GFP3, pCRI1 2586/GFP, and pCRI1 2586/HA- lioma xenografts were established in 6-wk-old female BALB/c nude mice BID were constructed by ligating green fluorescent protein (GFP) or HA-BID (Charles River Laboratories, Inc.) by s.c. inoculation of 2.5 Â 106 MSTO- À À À into pGL.Calretinin 2179, pGL.CRI1 2586, and pGL.CRI1 138 4x after excising 211H cells into the dorsal flank. The mice were randomly assigned into four the luciferase gene. The cDNA of adenovirus type 5 early region 1A (E1A) groups (n = 8 per group). Each group of the mice was injected with 200 AL À À was synthesized by reverse transcription-PCR from total cellular RNA of solution containing PBS, Ad-CRI1 138 4x/GFP, Ad-CRI1 138 4x/HA-BID, or À human embryonic kidney 293 cells using specific primers 5¶-tttHindIII- Ad-CRI1 138 4x/E1A by 27-gauge needle for the first 3 d. Animals were then aagcttctgaaaatgagacatattatctgccacggaggtgt and 5¶-aaaEco R5gatatcttatggcc- observed closely and survival studies were performed. Tumors were À tggggcgttta. The recombinant adenovirus vectors Ad-Calretinin 2179/GFP, measured two to three times a week, and tumor volume was calculated as a Â b2 Â 0.5, where a and b were large and small diameters, respectively. Histochemical study. Tissue or tumor sectioning and staining were performed in the Histology Laboratory in the Department of Gastroenter- 4 http://www.ensembl.org/Homo_Sapiens/index.html ological Surgery in Okayama University Graduate School of Medicine and www.aacrjournals.org 7121 Cancer Res 2008; 68: (17). September 1, 2008

Figure 1. Analysis of human CRI1, calretinin, WT1, and mesothelin protein expression and promoter activities in thoracic normal and tumor cells. A, immunoblot analysis of CRI1, calretinin, WT1, and mesothelin expressions in indicated cells and tissues. The expression level of actin is shown as a control. B, schematic representation of luciferase reporter construct. The promoters were cloned upstream of the luciferase (Luc) gene (pGL)as shown by nucleotide positions. The name of each reporter construct was assigned according to the 5¶-end of the nucleotide number of the inserted promoter sequences. C, transient transfection reporter assays in mesothelioma and pulmonary adenocarcinoma cells with the indicated luciferase reporter constructs (2 Ag, pGL) and pCMV.h-gal (2 Ag). Results are presented as fold induction of relative light units normalized to h-galactosidase activity relative to that observed for control constructs. D, transient transfection reporter assays in normal thoracic cells with the indicated luciferase reporter constructs (2 Ag, pGL)and pCMV. h-gal (2 Ag). Results are indicated as in C.

Dentistry. For immunohistochemical analysis of the E1A protein, tumors (H2452, MSTO-211H, H2052, and H28) and A549 pulmonary were fixed in 20% formalin, embedded in paraffin, and then cut into 4-Am adenocarcinoma cells, whereas no expression was seen in H322 sections. To retrieve antigens, the sections were baked, deparaffinized, and pulmonary adenocarcinoma cells, normal mesothelial cell, normal heated in citrate buffer [10 mmol/L citric acid (pH 6.0)] in a steamer. After pleura, or normal lung tissue extracts. Calretinin expression was endogenous peroxidase was inactivated with 1.5% H O /methanol for 2 2 detected in H2452, MSTO-211H, and H2052 malignant mesotheli- 10 min, the sections were incubated with rabbit anti-E1A polyclonal antibody (1:50 dilution; PharMingen) or rabbit anti-GFP polyclonal antibody oma cells, A549 pulmonary adenocarcinoma cells, and normal (1:500 dilution; Abcam) for 1 h and then biotinylated goat anti-rabbit IgG mesothelial cells. WT1 expression was strongly detected in all types antibody (DAKO) for 30 min. The specific binding was visualized with an of malignant mesothelioma cells (H2452, H2052, MSTO-211H, and avidin-biotin-peroxidase reagent and its substrate diaminobenzidine H28) and normal mesothelial cells. Mesothelin expression was seen tetrachloride (DAKO) and subsequent counterstaining with Mayer’s in H2052 malignant mesothelioma cells, A549 pulmonary adeno- hematoxylin. carcinoma cells, normal mesothelial cells, normal pleura, and Statistical analysis. All of the in vitro experiments in Figs. 1 to 5 were normal lung extracts. Significantly, the expression of calretinin, performed at least thrice. The results of one representative experiment are WT1, and mesothelin was detectable in normal human mesothelial presented. For quantitative results, error bars indicate the SD from the cells and extracts of normal human pleura and lung, whereas the average of at least triplicate samples in one experiment. For the in vivo expression of CRI1 was not seen in these normal human cells and experiments in Fig. 6, statistical differences were determined using unpaired two-tailed Student’s t tests or ANOVA. tissues. These results suggest that CRI1 is the most specific malignant mesothelioma marker that distinguishes malignant pleural mesothelioma cells from normal mesothelial cells. Results The human CRI1promoter generates high promoter activity Analysis of CRI1, calretinin, WT1, and mesothelin protein in pleural malignant mesothelioma cells. To analyze the expression in normal cells and in tumor cells. To investigate the promoter activity of the mesothelioma markers and CRI1, 5¶ expression of the mesothelioma markers (calretinin, WT1, and flanking regions of these marker genes were cloned into pGL3- mesothelin) and CRI1, immunoblot analysis was performed using Basic luciferase reporter constructs (Fig. 1B). The ability of these nine kinds of thoracic neoplasm, normal cells, and tissues, constructs to promote the expression of the luciferase gene was including malignant pleural mesothelioma cells. As shown in Fig. measured in four malignant mesothelioma cell lines and two 1A, CRI1 was detected in all types of malignant mesothelioma cells pulmonary adenocarcinoma cells in transient transfection reporter

Cancer Res 2008; 68: (17). September 1, 2008 7122 www.aacrjournals.org

À assay (Fig. 1C). The pGL.CRI1 2586/Luc generated significantly high higher promoter activity than that of the other three mesothelioma transcriptional activity in all kinds of malignant mesothelioma cells marker genes (calretinin, WT1, and mesothelin) in all types of (H2452, MSTO-211H, H2052, and H28; 42.01- to 86.77-fold) and malignant pleural mesothelioma cells. A549 pulmonary adenocarcinoma cells (22.79-fold), with low The human CRI1promoter generates little promoter activity in H322 pulmonary adenocarcinoma cells (9.22-fold). The activity in normal mesothelial cells and pleural cells. To À pGL.Calretinin 2179/Luc generated significantly high promoter determine the tumor specificity of the transcriptional activity of activity in H2452, MSTO-211H, and H2052 malignant mesothelioma the 5¶ flanking region of the mesothelioma marker genes, we also cells and A549 pulmonary adenocarcinoma cells (15.90- to 45.38- performed a transient transfection reporter assay in normal human À fold). The pGL.WT1 1877/Luc construct generated significant mesothelial cells, normal rat pleural 4/4 R.M.-4 cells, and NHLF transcriptional activity in all types of malignant mesothelioma cells (Fig. 1D). In these normal cells, the promoter activity of À cells (H2452, MSTO-211H, H2052, and H28; 25.76- to 51.57-fold) pGL.CRI1 2586/Luc was less than (8.29- to 9.02-fold) that of the À À with less activity in H322 and A549 pulmonary adenocarcinoma reporter constructs pGL.Calretinin 2250/Luc, pGL.WT1 2288/Luc, À À cells (4.57- to 4.87-fold). The pGL.Mesothelin 2355/Luc construct and pGL.Mesothelin 2355/Luc (10.26- to 27.19-fold). These data showed significantly high promoter activity in H2052 malignant suggest that the 5¶ flanking region of the CRI1 promoter generated pleural mesothelioma cells and A549 pulmonary adenocarcinoma the least promoter activity in normal mesothelial cells and pleural cells (22.25- to 47.24-fold) but little activity in other kinds of cells cells among the four different mesothelioma marker genes. (H2452, MSTO-211H, H28, and H322; 8.29- to 12.74-fold). These CRI1 is involved in cell viability of MSTO-211H mesotheli- results suggest that the 5¶ flanking region of the CRI gene generates oma cells. To determine the function of CRI1 in mesothelioma

Figure 2. Characterization of human CRI1 promoter. A, schematic representation of CRI1 promoter deletion reporter constructs. The name of each reporter construct was assigned according to the 5¶-end of the nucleotide number of the inserted promoter sequences. B, transient transfection reporter assays in mesothelioma (211H and H2452), pulmonary adenocarcinoma (A549 and H322), and normal (mesothelial cell and NHLF)cells with indicated CRI1 deletion luciferase reporter constructs (2 Ag, pGL) and pCMV.h-gal (2 Ag). Results are indicated as in Fig. 1C.

www.aacrjournals.org 7123 Cancer Res 2008; 68: (17). September 1, 2008

Figure 3. Analysis of tandem CRI1 À138 promoter. A, schematic representation of CRI1 tandem copies reporter constructs. One to three tandem copies of CRI1 promoter region from À138 to À1weresubcloned into pGL.CRI1À138 1x. B, transient transfection reporter assays in thoracic tumor and normal cells, with indicated luciferase reporter constructs (2 Ag, pGL)and pCMV. h-gal (2 Ag). Results are indicated as in Fig. 1C. C, schematic representation of Ad-CalretininÀ2179/GFP, Ad-CRI1À2586/GFP, and Ad-CRI1À138 4x/GFP. D, fluorescent microscopic analysis of GFP expression induced by Ad-CalretininÀ2179/GFP, Ad-CRI1À2586/GFP,and Ad-CRI1À138 4x/GFP in malignant mesothelioma MSTO-211H cells, normal human mesothelial cells, and NHLF.

cells, cell viability was observed in the presence/absence of Identification of the region in the CRI1promoter that CRI1. CRI1 expression was suppressed by lentiviral vector confers mesothelioma-specific transactivation. To identify expressing shRNA for human CRI1 (LV/shCRI1) in MSTO-211H the region of the CRI1 promoter that confers mesothelioma- mesothelioma. As shown in Supplementary Fig. S1A, immunoblot specific transactivation, we made deletion constructs of the CRI1 analysis showed that endogenous CRI1 expression level was promoter (Fig. 2A) and compared their promoter activities. These suppressed after 4 days of LV/shCRI1 infection compared with constructs were used in transient transfection reporter assays in lentiviral vector expressing nontarget shRNA (LV/shNon-target). MSTO-211H and H2452 human mesothelioma cells, A549 and H322 The 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)- human pulmonary adenocarcinoma cells, normal human meso- 2-(4-sulfophenyl)-2H-tetrazolium salt (MTS) assay (24) showed thelial cells, and NHLF (Fig. 2B). The ideal construct would have that MSTO-211H cells infected with LV/shCRI1 lentivirus minimal activity in nonmesothelioma cells but high activity in had decreased cell viability compared with control LV/ MSTO-211H and H2452 human mesothelioma cells. In all types of shNon-target lentivirus (Supplementary Fig. S1B). These data cells, the proximal 1,849-bp fragment of the CRI1 promoter suggest that CRI1 is essential for MSTO-211H mesothelioma cell exhibited higher activity than the 2,586-bp fragment. The proximal viability. 1,587-bp fragment showed lower transcriptional activity than the

Cancer Res 2008; 68: (17). September 1, 2008 7124 www.aacrjournals.org

1,674- and 1,083-bp fragment. The proximal 766-bp fragment of the in normal human mesothelial cells, NHLF, nonmesothelioma Hep3B CRI1 promoter exhibited the highest activity (100.29-fold) in hepatocellular carcinoma cells, and MCF7 breast cancer cells. The À MSTO-211H mesothelioma cells. Promoter deletions of À567, cell death/apoptosis caused by the Ad-CRI1 138 4x/HA-BID con- À À À À 366, 296, 138, and 73 showed stepwise decreases in struct was examined by sub-G0-G1 DNA content using propidium À transcriptional activity in all types of cells indicated. The +1-bp iodide staining and flow cytometry 72h after Ad-CRI1 138 4x/HA-BID À fragment (pGL.CRI1 +1) conferred no activity above control levels infection. As shown in Fig. 4C, infection with the Ad-CRI1 138 4x/GFP in all types of cells. The À138 construct showed the most promise control caused little DNA fragmentation (range, 0.50–3.79%) as a mesothelioma-specific promoter as it had high transcriptional in all types of cells as indicated (top). On the other hand, À activity in mesothelioma cells with little activity in the other types Ad-CRI1 138 4x/HA-BID infection caused a marked increase in sub- of cells, including normal mesothelial cells. G1 DNA content only in H2452 (25.91%) and MSTO-211H Analysis of the effect of a tandem human CRI1promoter. mesothelioma cells (45.77%) but not in the other types of cancer To enhance the level of transcriptional activity sufficient for the cells or normal cells (1.24–7.62%; bottom). These results are use of gene therapy, we tested the effect of additional tandem consistent with the BID expression in Fig. 4B. These data suggest À copies of the CRI1 À138/À1 promoter region to the construct that Ad-CRI1 138 4x/HA-BID induces exogenous BID expression pGL3.CRI1À138/+84 in a transient transfection reporter assay and cell death/apoptosis only in mesothelioma cells. À (Fig. 3A). In MSTO-211H cells, transcriptional activity increased Ad-CRI1 138 4x/E1A induced viral proliferation and cell significantly (169.7-fold) with the addition of one extra CRI1 death only in mesothelioma cells. The CRAd that spreads and cassette À138/À1 (pGL.CRI1À138 2x). Moreover, with double to replicates only in cancer cells is suitable for diffused or triple tandem copies (pGL.CRI1À138 3x to 4x), the activity metastasized pleural mesothelioma (13). To test the applicability increased up to 216.1- to 251.1-fold. In H2452 mesothelioma cells, of CRAd in combination with the mesothelioma-specific À À with single to triple tandem copies (pGL.CRI1À138 2x to 4x), the CRI1 138 4x promoter system, we also made Ad-CRI1 138 4x/E1A activity increased up to 99.6- to 181.3-fold. However, in H322 and that expresses cytotoxic E1A (adenoviral replication-programming À A549 pulmonary adenocarcinoma cells, normal human mesothelial protein) driven by the CRI1 138 4x promoter system (Fig. 4A). As À cells, and NHLF, these tandem copies showed no enhanced shown in Fig. 5A, Ad-CRI1 138 4x/E1A induced cell death/lysis in transcriptional activity (1.52- to 8.24-fold; Fig. 3B). These results H2452 and MSTO-211H mesothelioma cells but not in normal show that four tandem copies of the CRI1 cassette À138/À1 human mesothelial cells or NHLF 4 days after infection. The control À (pGL.CRI1À138 4x) generate the highest mesothelioma-specific vector (Ad-CRI1 138 4x/GFP) did not induce any cell death in these À transactivation. cells. A cell viability assay revealed that Ad-CRI1 138 4x/E1A À Ad-CRI1 138 4x/GFP expresses GFP in MSTO-211H malignant drastically induced cell death/lysis after 3 to 4 days of infection mesothelioma cells but not in normal human mesothelial cells in H2452 and MSTO-211H cells but not in normal human or NHLFs. To evaluate gene expression mediated by the CRI1À138 mesothelial cells or NHLF (Fig. 5B). Immunoblot analysis showed 4x promoter in adenovirus-mediated delivery system, we examined that E1A expression was drastically increased in H2452 and MSTO- À GFP expression induced by a recombinant adenoviral vector that 211H mesothelioma cells by Ad-CRI1 138 4x/E1A after 96 h of À expressed GFP driven by the CRI1 138 4x promoter system (Ad- infection. However, E1A expression was minimal in NHLF and À CRI1 138 4x/GFP; Fig. 3C) in MSTO-211H mesothelioma cells, normal human mesothelial cells. No significant increase of GFP normal human mesothelial cell, and NHLF. Recombinant adeno- expression was seen in MSTO-211H mesothelioma cells between 24 À viral vectors that expressed GFP driven by promoters of and 96 h after Ad-CRI1 138 4x/GFP infection (Fig. 5C). These results À À À cytomegalovirus (CMV), calretinin 2179, and CRI1 2586 were used suggest that Ad-CRI1 138 4x/E1A (a CRAd) replicates and induces À as controls (termed Ad-CMV/GFP, Ad-Calretinin 2179/GFP, cell death/lysis in mesothelioma cells. À À and Ad-CRI1 2586/GFP; Fig. 3C). As shown in Fig. 3D, Ad-CMV/ Ad-CRI1 138 4x/E1A or HA-BID suppressed mesothelioma GFP strongly induced GFP in all three kinds of cells. xenograft tumors and extended the survival of mesothelioma À Ad-Calretinin 2179/GFP induced GFP not only in MSTO-211H xenograft mice. To analyze the therapeutic efficacy of Ad- À mesothelioma cells but also in normal human mesothelial cells. CRI1 138 4x/E1A or HA-BID against human tumor cells in vivo, À Ad-CRI1 2586/GFP weakly induced GFP in MSTO-211H cells and we established mesothelioma xenograft tumors derived from little expression was seen in normal human mesothelial cells and MSTO-211H cells in nude mice. After the tumors had reached a À À NHLF. On the other hand, Ad-CRI1 138 4x/GFP did not show any diameter of about 0.5 cm, 5 Â 107 pfu of Ad-CRI1 138 4x/E1A, À À significant fluorescent population in normal human mesothelial Ad-CRI1 138 4x/HA-BID, Ad-CRI1 138 4x/GFP, or PBS were cells and NHLF but strongly induced GFP in MSTO-211H administered intratumorally for 3 days. Tumor growth was signifi- À À À mesothelioma cells. These data suggest that the CRI1 138 4x cantly suppressed by Ad-CRI1 138 4x/E1A or Ad-CRI1 138 4x/HA-BID À promoter is able to induce target gene expression in mesothelioma injection compared with Ad-CRI1 138 4x/GFP or PBS (P < 0.001; À cells and does not target normal cells, including normal Fig. 6A). The mouse group treated with PBS or Ad-CRI1 138 4x/GFP mesothelial cells, in the adenovirus-mediated delivery system. died within 75 days after tumor inoculations (Fig. 6B), whereas À Ad-CRI1 138 4x/HA-BID induced BH3-interacting death seven of eight mice from the mouse group treated with Ad- À agonist expression and cell death/apoptosis in the malignant CRI1 138 4x/HA-BID and all mice from the mouse group treated À pleural mesothelioma. To induce cell death in the mesothelioma with Ad-CRI1 138 4x/E1A were still alive. Adenoviral E1A expression À À by the CRI1 138 4x promoter system, the proapoptotic was increased and spread in Ad-CRI1 138 4x/E1A–administered BH3-interacting death agonist (BID) gene was inserted into the tumors, whereas GFP expression was localized (no spread) in Ad- À À À CRI1 138 4x system in place of GFP (Ad-CRI1 138 4x/HA-BID; CRI1 138 4x/GFP–administered tumors at 14 days after treat- À À Fig. 4A; refs. 19, 25, 26). As shown in Fig. 4B, Ad-CRI1 138 4x/HA- ment (Fig. 6C). These results indicate that Ad-CRI1 138 4x/E1A BID strongly induced exogenous BID in H2452 and MSTO-211H (a CRAd) replicates and induces cell lysis in a mesothelioma- mesothelioma cells. On the other hand, there was little expression specific manner in vivo. www.aacrjournals.org 7125 Cancer Res 2008; 68: (17). September 1, 2008

Discussion mesothelioma (29). However, mesothelin expression was also Several protein markers for diagnosing mesothelioma have detectable in normal mesothelium (30, 31). Another mesothelioma recently become available (27). One of the calcium-binding marker, WT1 is a zinc finger DNA-binding protein and acts as a proteins, calretinin is the most sensitive mesothelioma-positive transcription activator or repressor depending on the cellular or marker and is frequently expressed in all the logic types of chromosomal context. WT1 is useful to diagnose epithelioid mesothelioma (27). However, Lugli and colleagues (28) reported mesothelioma (27). However, the expression of WT1 is also seen that calretinin is also expressed in normal tissues, including Leydig in normal tissues, including normal mesothelium (32, 33). Taken cells of the testis, neurons of the brain, theca-lutein and theca together, these mesothelioma markers are pathologically important interna cells of the ovary, and normal mesothelium. The other to distinguish mesothelioma from the other kinds of tumors (e.g., mesothelioma marker mesothelin is a 40-kDa cell surface pulmonary adenocarcinoma; ref. 27), but they are also expressed in glycoprotein that is highly expressed in epithelioid mesothelioma. normal pleura and mesothelium. Gordon and colleagues (17) Mesothelin is useful to diagnose epithelioid mesothelioma and profiled the gene expression pattern of malignant pleural sarcomatoid mesothelioma (16, 23). Hassan and colleagues mesothelioma, normal lung, and pleural tissues using cDNA reported that serum mesothelin levels are elevated in patients microarrays. They reported that the CRI1 gene was one of the with mesothelioma compared with normal healthy volunteers. malignant pleural mesothelioma-specific markers. In our study, Serum mesothelin is decreased after surgical dissection of CRI1 protein was observed specifically in mesothelioma cells but

Figure 4. Malignant mesothelioma- specific proapoptotic BID gene expression and cell death induced by the CRI1À138 4x promoter system. A, schematic representation of Ad-CRI1À138 4x/HA-BID and Ad-CRI1À138 4x/E1A. B, detection of HA-BID expression induced by Ad-CRI1À138 4x/HA-BID. Cells were treated with the same dosage of Ad-CRI1À138 4x/GFP or Ad-CRI1À138 4x/HA-BID as described in Materials and Methods. Expressions of HA-BID were analyzed by immunoblot 36 h after infections. Exogenous HA-BID protein expression was detected with anti-HA antibody. C, flow cytometric analysis of apoptosis induced by Ad-CRI1À138 4x/HA-BID. Cells were infected with Ad-CRI1À138 4x/GFP (GFP, top)or Ad-CRI1 À138 4x/HA-BID (HA-BID, bottom)for 72 h and sub-G 0-G1 DNA content was measured by propidium iodide stain and flow cytometric analysis.

Cancer Res 2008; 68: (17). September 1, 2008 7126 www.aacrjournals.org

Figure 5. Induction of mesothelioma- specific cell death by CRAd combined with the CRI1À138 4x promoter system. A, phase-contrast photomicrographs of H2452, MSTO-211H mesothelioma cells, normal human mesothelial cells, and NHLF infected with Ad-CRI1À138 4x/E1A or Ad-CRI1À138 4x/GFP. Cell morphology was evaluated 4 d after infection. Photomicrographs were taken at a magnification of Â100. B, oncolytic efficacy induced by Ad-CRI1À138 4x/E1A infection in vitro. Cells were plated in 96-well plates at a density of 2 Â 103 per well 24 h before infections. Cell viability was evaluated at 0, 1, 2, 3, and 4 d following Ad-CRI1À138 4x/GFP or Ad-CRI1À138 4x/E1A infection by MTS assay (CellTiter 96, Promega)according to the manufacturer’s protocol. C, immunoblot analysis of adenoviral E1A protein or GFP expression at 0, 24, and 96 h after infection of Ad-CRI1À138 4x/E1A (left)or Ad-CRI1À138 4x/GFP (right)in indicated cells. h-Actin was shown as a control.

not in normal mesothelium cells (Fig. 1A), which agrees with the mesothelioma-specific activity is not understood yet. Mesothelio- microarray data (17). ma-specific transcription factors and/or cofactors might also be Gene therapy approaches using mesothelioma-specific pro- involved in the CRI1 transcriptional regulation. moters combined with suicide genes have previously been tried. Mesothelioma cells are more resistant to apoptosis than normal Inase and colleagues (34) constructed a system that expressed the mesothelial cells, although most of them have the wild-type p53 HSV-tk gene driven by the calretinin promoter. However, in our tumor suppressor (35). To explain this paradox, Cao and colleagues À study, Ad-Calretinin 2179/GFP expressed GFP in normal human (36) postulate that the antiapoptotic protein Bcl-xL might play a mesothelial cells. Thus, HSV-tk driven by the calretinin promoter role in increased resistance to apoptosis by mesothelioma cells, as might be expressed in normal mesothelial cells and induce side Bcl-xL seems to have increased expression in malignant mesothe- toxicity in normal cells as well as mesothelioma cells. The ideal lioma cells. In this study, overexpression of the proapoptotic BID À promoter system would have minimal activity in nonmesothelioma protein by Ad-CRI1 138 4x/HA-BID induced apoptosis in mesothe- cells but high activity in mesothelioma cells. In the present study, lioma cells, indicating that the overexpressed BID escaped the À the CRI1 138 4x promoter generated the most specific transcrip- antiapoptotic effect by Bcl-xL in the mesothelioma cells. The use of tional activity in malignant pleural mesothelioma cells compared BID as a suicide gene may thus be useful for localized with the other three promoters of calretinin, mesothelin, and WT1 mesothelioma gene therapy. À genes. Thus, the CRI1 138 4x promoter should be useful for A problem for mesothelioma gene therapy is the inefficient vector targeting mesothelioma cells. The molecular mechanism by which and gene delivery systems. In advanced stages, pleural mesotheli- the 5¶ flanking region of the CRI1 promoter À138/+84 confers oma invades the chest wall or mediastinal tissues or structures www.aacrjournals.org 7127 Cancer Res 2008; 68: (17). September 1, 2008

(e.g., esophagus, trachea, great vessels, and lymph nodes) and could preexisting antivector immunity. In the use of the hexon-chimeric penetrate diaphragmatic muscle, peritoneum, retroperitoneal adenovirus vector, selected promoters, including the CRI1 promoter space, opposite pleura, or lymph nodes outside the chest (37). For system, are required to limit the cell killing in mesothelioma but not À the treatment of advanced-stage mesothelioma, the efficiency of surrounding normal cells. The combination of CRI1 138 4x/E1A À nonreplicating adenovirus vector, including Ad-CRI1 138 4x/HA- system with the hexon-chimeric adenovirus would be an attractive BID, by local injection might be limited. In recent cancer gene approach to treat immunocompetent mesothelioma. therapy studies, the CRAd has been considered as an approach to To enhance the efficacy of CRAds, the combination of CRAds with target metastasized cancer, including mesothelioma, because it volume reduction surgery and/or chemotherapy has been reported replicates and chases the metastasized tumors (38–42). In our study, to be more effective than single treatment of surgery or chemo- À Ad-CRI1 138 4x/E1A, a CRAd, showed mesothelioma-specific cell therapy (44, 45). To reduce the side effect to normal cells by che- À death/lysis in vitro and a strong antitumor effect in a mesothelioma motherapy or surgical stress, the use of Ad-CRI1 138 4x/E1A that À xenograft tumor mouse model, suggesting that Ad-CRI1 138 4x/E1A selectively targets mesothelioma is desirable for the combination is useful for the treatment of advanced-stage mesothelioma. therapy. Another problem for mesothelioma gene therapy with viral In this study, a mesothelioma-specific CRI gene promoter was vectors, including CRAds, is a possibility that the therapeutic virus cloned and characterized as the most mesothelioma-specific might be removed by host immunity, which might possibly limit promoter compared with the promoters of mesothelioma markers, CRAd replication. However, Robert and colleagues (43) have recently including calretinin, WT1, and mesothelin. The element of the reported a new hexon-chimeric adenovirus vector that circumvents promoter that confers mesothelioma specificity (CRI1 À138/À1)

Figure 6. Reduction of mesothelioma tumor grown in nu/nu mice by CRAd combined with the CRI1À138 4x promoter system A, suppression of tumor growth by Ad-CRI1À138 4x/E1A infection. Volume of tumor derived from MSTO-211H malignant mesothelioma cells treated with PBS (y), Ad-CRI1À138 4x/GFP (n), Ad-CRI1À138 4x/HA-BID (E),and Ad-CRI1À138 4x/E1A (Â)is shown. The volume was monitored over time (days) after inoculation of tumor cells. Arrows, time point where treatment was given. Eight mice were used for each group. Points, tumor growth expressed as mean tumor volume; bars, SD. Statistical significance was defined as P < 0.01 (*) and P < 0.001 (**). B, survival of xenograft mice inoculated with mesothelioma cells after PBS, Ad-CRI1À138 4x/GFP, Ad- CRI1À138 4x/HA-BID, or Ad-CRI1À138 4x/E1A infection. At 75 d after mesothelioma cell inoculation, the number of surviving mice from the mouse groups administered with PBS, Ad-CRI1À138 4x/GFP, Ad- CRI1À138 4x/HA-BID, or Ad-CRI1À138 4x/E1A was counted. C, amplified E1A expression in mesothelioma tumors after Ad-CRI1À138 4x/E1A infection. Paraffin sections of tumors derived from MSTO-211H mesothelioma cells 14 d after Ad-CRI1À138 4x/E1A or GFP infection were immunostained with anti-E1A or GFP antibody. Top right, amplified E1A protein expression was observed in mesothelioma tumor. Photomicrographs were obtained at a magnification of Â100.

Cancer Res 2008; 68: (17). September 1, 2008 7128 www.aacrjournals.org

Downloaded from cancerres.aacrjournals.org on September 24, 2021. © 2008 American Association for Cancer Research. CRI1 for Gene Therapy and Virotherapy was identified by deletion mapping and the element was tandema- Disclosure of Potential Conflicts of Interest À rized (CRI1 138 4x) to enhance the promoter activity to further target À No potential conflicts of interest were disclosed. mesothelioma by gene therapy. The CRI1 138 4x promoter-driven E1A or HA-BID in the adenovirus induced cell death only in Acknowledgments human mesothelioma cell lines but not in normal mesothelial cells or NHLF. The efficacy of the mesothelioma cell death was Received 1/8/2008; revised 5/13/2008; accepted 7/2/2008. Grant support: The Ministry of Education, Science, and Culture, Japan. further confirmed by an in vivo xenograft model. Thus, our The costs of publication of this article were defrayed in part by the payment of page adenovirus-mediated gene therapy system expressing HA-BID or charges. This article must therefore be hereby marked advertisement in accordance E1A gene driven by the mesothelioma-specific CRI1 promoter with 18 U.S.C. Section 1734 solely to indicate this fact. We thank T. Nakai and T. Yamanishi for technical advice, F. Inoue and M. (a CRAd) has great clinical potential for the treatment of Takahashi for kindly providing normal human pleura, and Dr. Ira Pastan for providing mesothelioma. antibody against mesothelin.

References suppressors in malignant pleural mesothelioma using monoclonal antibody K1 present on ovarian cancers and large-scale transcriptional profiling. Am J Pathol 2007; normal mesothelium. Cancer Res 1992;52:181–6. 1. Enterline PE, Henderson VL. Geographic patterns for 166:1827–40. 32. Gulyas M, Hjerpe A. Proteoglycans and WT1 as pleural mesothelioma deaths in the United States, 1968- 18. He TC, Zhou S, da Costa LT, Yu J, Kinzler KW, markers for distinguishing adenocarcinoma, epithelioid 81. J Natl Cancer Inst 1987;79:31–7. Vogelstein B. A simplified system for generating mesothelioma, and benign mesothelium. J Pathol 2003; 2. Antman KH. Natural history and epidemiology of recombinant adenoviruses. Proc Natl Acad Sci U S A 199:479–87. malignant mesothelioma. Chest 1993;103:373–6. 1998;95:2509–14. 33. Gulyas M, Dobra K, Hjerpe A. Expression of genes 3. Aisner J. Current approach to malignant mesothelio- 19. Fukazawa T, Walter B, Owen-Schaub LB. Adenoviral coding for proteoglycans and Wilms’ tumor susceptibil- ma of the pleura. Chest 1997;107:332–4. Bid overexpression induces caspase-dependent cleavage ity gene 1 (WT1) by variously differentiated benign 4. Robinson BW, Lake RA. Advances in malignant of truncated Bid and p53-independent apoptosis in human mesothelial cells. Differentiation 1999;165:89–96. mesothelioma. N Engl J Med 2005;353:1591–603. human non-small cell lung cancers. J Biol Chem 2003; 34. Inase N, Miyake S, Yoshizawa Y. Calretinin promoter 5. Nowak AK, Lake RA, Kindler HL, Robinson BW. New 278:25428–34. for suicide gene expression in malignant mesothelioma. approaches for mesothelioma: biologics, vaccines, gene 20. Ahn KS, Ou W, Silver J. Inhibition of certain strains of Anti Cancer Res 2001;21:1111–4. therapy, and other novel agents. Semin Oncol 2002;29: HIV-1 by cell surface polyanions in the form of 35. Narasimhan SR, Yang L, Gerwi BI, Broaddus VC. 82–96. cholesterol-labeled oligonucleotides. Virology 2004;330: Resistance of pleural mesothelioma cell lines to 6. Nowak AK, Byrne MJ, Williamson R, et al. A 50–61. apoptosis: relation to expression of Bcl-2and Bax. Am multicentre phase II study of cisplatin and gemcita- 21. Layne SP, Merges MJ, Dembo M, et al. Factors J Physiol 1998;275:165–71. bine for malignant mesothelioma. Br J Cancer 2002;87: underlying spontaneous inactivation and susceptibility 36. Cao XX, Mohuiddin I, Ece F, McConkey DJ, Smythe 491–6. to neutralization of human immunodeficiency virus. WR. Histone deacetylase inhibitor downregulation of 7. Vogelzang NJ, Rusthoven JJ, Symanowski J, et al. Phase Virology 1992;189:695–714. bcl-xl gene expression leads to apoptotic cell death in III study of pemetrexed in combination with cisplatin 22. Bess JW, Jr., Powell PJ, Issaq HJ, et al. Tightly bound mesothelioma. Am J Respir Cell Mol Biol 2001;25:562–8. versus cisplatin alone in patients with malignant pleural zinc in human immunodeficiency virus type 1, human 37. Robinson BW, Musk AW, Lake RA. Malignant mesothelioma. J Clin Oncol 2003;21:2636–44. T-cell leukemia virus type I, and other retroviruses. mesothelioma. Lancet 2005;5:397–408. 8. Baldini EH. External beam radiation therapy for the J Virol 1992;66:840–7. 38. Heise C, Kirn DH. Replication-selective adenoviruses treatment of pleural mesothelioma. Thoracic Surg Clin 23. Onda M, Willingham M, Nagata S, et al. New as oncolytic agents. J Clin Invest 2000;105:847–51. 2004;14:543–8. monoclonal antibodies to mesothelin useful for immu- 39. Ito H, Aoki H, Kuhnel F, et al. Autophagic cell 9. van der Most RG, Robinson BW, Nelson DJ. Gene nohistochemistry, fluorescence-activated cell sorting, death of malignant glioma cells induced by a con- therapy for malignant mesothelioma: beyond the infant Western blotting, and ELISA. Clin Cancer Res 2005;11: ditionally replicating adenovirus. J Natl Cancer Inst years. Cancer Gene Ther 2006;13:897–904. 5840–6. 2006;98:625–36. 10. Albelda SM, Wiewrodt R, Sterman DH. Gene therapy 24. Young N, Hahn CN, Poh A, et al. Effect of disrupted 40. Leja J, Dzojic H, Gustafson E, Oberg K, Giandomenico for lung neoplasms. Clin Chest 2002;23:265–77. SOX18 transcription factor function on tumor growth, V, Essand M. A novel chromogranin-A promoter-driven 11. Mohiuddin I, Cao X, Fang B, Nishizaki M, Smythe vascularization, and endothelial development. J Natl oncolytic adenovirus for midgut carcinoid therapy. Clin WR. Significant augmentation of pro-apoptotic gene Cancer Inst 2006;98:1060–67. Cancer Res 2007;13:2455–62. therapy by pharmacologic bcl-xl down-regulation in 25. Walensky LD, Pitter K, Morash J, et al. A stapled BID 41. Kishimoto H, Kojima T, Watanabe Y, et al. In vivo mesothelioma. Cancer Gene Ther 2001;8:547–54. BH3 helix directly binds and activates BAX. Mol Cell imaging of lymph node metastasis with telomerase- 12. Pataer A, Smythe WR, Yu R, et al. Adenovirus- 2006;24:199–210. specific replication-selective adenovirus. Nat Med 2006; mediated Bak gene transfer induces apoptosis in 26. Alemany R, Lai S, Lou YC, Jan HY, Fang X, Zhang 10:1213–9. mesothelioma cell lines. J Thorac Cardiovasc Surg 2001; WW. Complementary adenoviral vectors for oncolysis. 42. Adusumilli PS, Stiles BM, Chan MK, et al. Imaging 121:61–7. Cancer Gene Ther 1999;6:21–5. and therapy of malignant pleural mesothelioma using 13. Bischoff JR, Kirn DH, Williams A, et al. An adenovirus 27. Ordonez NG. Immunohistochemical diagnosis of replication-competent herpes simplex viruses. J Gene mutant that replicates selectively in p53-deficient epithelioid mesothelioma: an update. Arch Pathol Lab Med 2006;8:603–15. human tumor cells. Science 1996;274:373–6. Med 2005;129:1407–14. 43. Roberts DM, Nanda A, Havenga MJ, et al. Hexon- 14. Gotzos V, Vogt P, Celio MR. The calcium binding 28. Lugli A, Forster Y, Haas P, et al. Calretinin expression chimaeric adenovirus serotype 5 vectors circumvent protein calretinin is a selective marker for malignant in human normal and neoplastic tissues: a tissue pre-existing anti-vector immunity. Nature 2006;441: pleural mesotheliomas of the epithelial type. Pathol Res microarray analysis on 5233 tissue samples. Hum Pathol 239–43. Pract 1996;192:137–47. 2003;34:994–1000. 44. Kulklitis RJ, Singhal S, Delong P, et al. Immuno-gene 15. Amin KM, Litzky LA, Smythe WR, et al. Wilms’ tumor 29. Hassan R, Remaley AT, Sampson ML, et al. Detection therapy with interferon-h before surgical debulking 1 susceptibility (WT1) gene products are selectively and quantitation of serum mesothelin, a tumor marker delays recurrence and improves survival in a murine expressed in malignant mesothelioma. Am J Pathol for patients with mesothelioma and ovarian cancer. Clin model of malignant mesothelioma. J Thorac Cardiovasc 1995;146:344–56. Cancer Res 2006;12:447–53. Surg 2003;127:123–30. 16. Ordonez NG. Value of mesothelin immunostaining 30. Breidenbach M, Rein DT, Everts M, et al. Mesothelin- 45. Hakkarainen T, Hemminki A, Curiel DT, Wahlfors J. A in the diagnosis of mesothelioma. Mod Pathol 2003;16: mediated targeting of adenoviral vectors for ovarian conditionally replicative adenovirus that codes for a TK- 192–7. cancer gene therapy. Gene Ther 2005;12:187–93. GFP fusion protein (Ad5D24TK-GFP) for evaluation of 17. Gordon GJ, Rockwell GN, Jensen RV, et al. Identifi- 31. Chang K, Pai LH, Batra JK, Pastan I, Willingham MC. the potency of oncolytic virotherapy combined with cation of novel candidate oncogenes and tumor Characterization of the antigen (CAK1) recognized by molecular chemotherapy. Int J Mol Med 2006;4:751–9.

www.aacrjournals.org 7129 Cancer Res 2008; 68: (17). September 1, 2008

Downloaded from cancerres.aacrjournals.org on September 24, 2021. © 2008 American Association for Cancer Research. Malignant Pleural Mesothelioma−Targeted CREBBP/EP300 Inhibitory Protein 1 Promoter System for Gene Therapy and Virotherapy

Takuya Fukazawa, Junji Matsuoka, Yoshio Naomoto, et al.

Cancer Res 2008;68:7120-7129.

Updated version Access the most recent version of this article at: http://cancerres.aacrjournals.org/content/68/17/7120

Supplementary Access the most recent supplemental material at: Material http://cancerres.aacrjournals.org/content/suppl/2008/08/19/68.17.7120.DC1

Cited articles This article cites 45 articles, 9 of which you can access for free at: http://cancerres.aacrjournals.org/content/68/17/7120.full#ref-list-1

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/68/17/7120. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.