DOCSLIB.ORG

Malignant Pleural Mesothelioma–Targeted CREBBP/EP300 Inhibitory Protein 1 Promoter System for Gene Therapy and Virotherapy

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Malignant Pleural Mesothelioma–Targeted CREBBP/EP300 Inhibitory Protein 1 Promoter System for Gene Therapy and Virotherapy Research Article Malignant Pleural Mesothelioma–Targeted CREBBP/EP300 Inhibitory Protein 1 Promoter System for Gene Therapy and Virotherapy Takuya Fukazawa,1 Junji Matsuoka,1 Yoshio Naomoto,1 Yutaka Maeda,2 Mary L. Durbin,3 and Noriaki Tanaka1 1Department of Gastroenterological Surgery, Okayama University Graduate School of Medicine, Dentistry and Pharmaceutical Sciences, Okayama, Japan; 2Division of Pulmonary Biology, Cincinnati Children’s Hospital Medical Center, Cincinnati, Ohio; and 3Department of Ecology and Evolutionary Biology, University of California, Irvine, California Abstract lioma has proven curative (6, 7). Moreover, the diffuse nature of Gene therapy and virotherapy are one of the approaches used pleural mesothelioma, which often covers most of the lung and the to treat malignant pleural mesothelioma. To improve the interlobular fissures, is the principal limitation to radiotherapy (8). efficiency of targeting malignant mesothelioma cells, we Long-term survival (>5 years) with any treatment modality is designed a novel system using the promoter of the CREBBP/ exceedingly rare in malignant pleural mesothelioma. Thus, there is EP300 inhibitory protein 1 (CRI1), a gene specifically expressed an urgent need for new therapeutic options for mesothelioma. in malignant pleural mesothelioma. Four tandem repeats of The first human gene therapy trial approved in the United States À the CRI1promoter (CRI1 138 4x) caused significantly high as a primary cancer treatment was aimed at mesothelioma. At least promoter activity in malignant pleural mesothelioma cells but four gene therapy trials have been carried out in mesothelioma patients using different vector systems (adenovirus and vaccinia little promoter activity in normal mesothelial cells and virus) and transgenes [herpes simplex virus thymidine kinase (HSV- normal fibroblasts. The recombinant adenoviral vector h expressing proapoptotic BH3-interacting death agonist or tk) combined with ganciclovir, interleukin-2, and IFN- ;ref.9]. À early region 1A driven by the CRI1 138 4x promoter induced However, no significant clinical responses were observed, indicat- cell death in malignant mesothelioma cells but not in normal ing that improvements are critically needed in gene therapy cells. Moreover, these viruses showed antitumor effects in a approaches for the treatment of mesothelioma (10). mesothelioma xenograft mouse model. Here, we describe a Another attractive method to treat malignant pleural mesothe- novel strategy to target malignant mesothelioma using the lioma is to induce apoptosis by the introduction of proapoptotic À138 4x genes (11, 12) or cell lysis by the replicative oncolytic adenovirus CRI1 promoter system. [Cancer Res 2008;68(17):7120–9] (13). To use these approaches, the development of a specific promoter system targeting mesothelioma but not normal cells is Introduction essential considering the side effects of proapoptotic genes and the Malignant pleural mesothelioma is an aggressive tumor of replicating adenovirus. To design a system for specific gene therapy mesenchymal origin and is increasing worldwide as a result of and virotherapy to treat malignant mesothelioma, we evaluated the widespread exposure to asbestos that was widely used in specificity of the promoters of four different mesothelioma-specific industrialized countries until approximately 1970. There is genes: calretinin (14), Wilms’ tumor suppressor gene (WT1; ref. 15), substantial interest in this disease because millions of people have mesothelin (16), and CREBBP/EP300 inhibitory protein 1 (CRI1; been exposed to asbestos fibers, and there are more than 3,000 ref. 17). Transient transfection assay showed that the CRI1 cases of mesothelioma seen annually in the United States (1). The promoter is highly active in malignant pleural mesothelioma cells median survival of patients with mesothelioma from time of (H2452, MSTO-211H, H2052, and H28) but much less active in diagnosis ranges between 1 and 2years (2,3). The mortality is normal mesothelial cells and pleural cells. However, the other three expected to increase, at least until 2020, which is mainly due to the promoters of mesothelioma-specific genes (calretinin, WT1, and long latency (30–50 years) of the disease (4). mesothelin) showed high promoter activity not only in the Despite considerable advances in the understanding of its mesothelioma cells but also in normal cells. pathogenesis and etiology, malignant mesothelioma remains In the present study, we have assessed the capability of largely unresponsive to standard modalities of cancer therapy (5). adenovirus-mediated transgene expression induced by the CRI1 In some cases, extrapleural pneumonectomy can prolong the promoter specifically in mesothelioma cells in vitro and the median survival time of more than 2years; however, this approach feasibility of targeting malignant mesothelioma in both in vitro cell is suitable for only a few patients. Most surgical intervention is culture and in vivo in a mesothelioma xenograft mouse model. often impossible because of intrapleural spread. Although chemo- therapy can ameliorate the symptoms of the disease, including pain and breathlessness with pleural effusion, no regimen for mesothe- Materials and Methods Tissues and cell lines. The human malignant mesothelioma cells H2452, MSTO-211H, H2052, and H28, the human lung adenocarcinoma cells H322 and A549, and the human breast cancer cells MCF7 were obtained from the Note: Supplementary data for this article are available at Cancer Research Online (http://cancerres.aacrjournals.org/). American Type Culture Collection (ATCC) and grown in Ham’s F12(A549 Requests for reprints: Takuya Fukazawa, Department of Gastroenterological cells), RPMI 1640 (H2452, MSTO-211H, H2052, H28, and H322 cells), or Surgery, Okayama University Graduate School of Medicine, Dentistry and DMEM high glucose (MCF7) supplemented with 10% heat-inactivated fetal Pharmaceutical Sciences, 2-5-1 Shikata-cho, Okayama 700-8558, Japan. Phone: 81-86- bovine serum (FBS). Normal pleural rat cells 4/4 R.M.-4 obtained from 235-7257; Fax: 81-86-221-8775; E-mail: [email protected]. I2008 American Association for Cancer Research. ATCC were grown in Ham’s F12K supplemented with 15% heat-inactivated doi:10.1158/0008-5472.CAN-08-0047 FBS. The human hepatoblastoma cells Hep3B obtained from ATCC were Cancer Res 2008; 68: (17). September 1, 2008 7120 www.aacrjournals.org Downloaded from cancerres.aacrjournals.org on September 24, 2021. © 2008 American Association for Cancer Research. CRI1 for Gene Therapy and Virotherapy À À À grown in Eagle’ MEM supplemented with 1 mmol/L sodium pyruvate, 0.1% Ad-CRI1 2586/GFP, Ad-CRI1 138 4x/GFP, Ad-CRI1 138 4x/HA-BID, and Ad- À nonessential amino acids, and 10% heat-inactivated FBS. The normal CRI1 138 4x/E1A were generated by homologous recombination (18, 19). human lung fibroblasts (NHLF) obtained from Clonetics and the normal The viral titer for each vector was determined by plaque assay and the human mesothelial cells obtained from Dominion Pharmakine were grown optimal multiplicity of infection (MOI) was determined by infecting each in culture medium supplied by the manufacturer. All cell lines were cultured cell line with Ad-CMV/GFP and assessing the expression of GFP by flow j in 10% CO2 at 37 C. Additionally, normal human pleura specimens were cytometric analysis. H2452 cells were infected with the recombinant obtained from a consenting patient undergoing treatment for diseases other adenoviral vectors at a MOI of 50 plaque-forming units (pfu)/cell, and all than mesothelioma (84-y-old male). The lysates of normal human lung other human cells were infected at a MOI of 20 pfu/cell. For infection of the protein were obtained from Chemicon International. conditionally replicating adenovirus (CRAd), H2452 cells were infected with À Plasmids. The human CRI1, calretinin, WT1, and mesothelin promoters Ad-CRI1 138 4x/E1A at a MOI of 10 pfu/cell, and all other human cells were À were obtained from purified human genomic DNA (Clontech) by PCR. The infected at a MOI of 4 pfu/cell. Ad-CRI1 138 4x/GFP was used as control. The position of the transcription initiation site (+1) was determined by the human CRI1 short hairpin RNA (shRNA) lentiviral transfer vector for human Ensembl Human Genome browser.4 The luciferase reporter construct CRI1 gene was obtained from Sigma (MISSION shRNA Bacterial Glycerol À pGL.Calretinin 2179 was generated by subcloning the promoter region of Stock). The transformed human embryonic kidney 293T cells (1 Â 106) were calretinin À2179/+70 from the genomic DNA using PCR primers (5¶- plated in a 10-cm dish and cotransfected the following day with 26 AL of the tttggtaccKpnIaatacttttacacaaagcgtggcctg and 5¶-aaaHindIIIaagcttgagctggtgc- Lentivirus Packaging Mix (Sigma) and the shRNA transfer vector (2.6 Ag) by cgaccaccacacccgggagccggcgg). The PCR-generated fragment was digested lipofection. Twenty-four and 48 h later, viral supernatants were collected in with KpnI and HindIII and subcloned directly into the pGL3-Basic luciferase serum-free medium and filtered through 0.45-Am pore size filters. The À À reporter construct (Promega). pGL.WT1 1887, pGL.Mesothelin 2310, and nontarget shRNA lentiviral (Sigma) vector was used as a control. The viral À pGL.CRI1 2586 were constructed in the same manner using the following titer was measured by HIV p24 Antigen ELISA kit (ZeptMetrix; refs. 20–22). primers: mesothelin, 5¶-tttctcgagggggtcaggcttgtgctcccgggagtcctg and 5¶- Cells were infected with the recombinant
Load more

Recommended publications
  • Mixed Hepatoblastoma in the Adult: Case Report and Review of the Literature
    J Clin Pathol: first published as 10.1136/jcp.33.11.1058 on 1 November 1980. Downloaded from J Clin Pathol 1980;33:1058-1063 Mixed hepatoblastoma in the adult: case report and review of the literature RP HONAN AND MT HAQQANI From the Department of Pathology, Walton Hospital, Rice Lane, Liverpool L9 JAE, UK SUMMARY A case of mixed hepatoblastoma in a woman is described. A survey of the English literature reveals 13 cases acceptable as mixed hepatoblastoma; these have been described and published under a variety of names. Difficulties in nomenclature and the histology of these cases are discussed. Diagnosis depends on the identification of both malignant mesenchymal and malignant epithelial elements. The former include myxoid connective tissue resembling primitive mesenchyme and areas resembling adult fibrosarcoma. Mature fibrous tissue with calcification and bone for- mation may be seen. Epithelial areas show tissue resembling fetal liver, poorly differentiated epithelial cells, and/or areas of adenocarcinoma. The current view on histogenesis is also given. Most hepatoblastomas occur in children under the mixedtumour,6carcino-osteochondromyxosarcoma,5 copyright. age of 2 years.' Hepatoblastoma in adults is ex- and rhabdomyosarcohepatoma.7 tremely rare, and the prognosis is much worse than in the mixed hepatoblastoma of childhood. Case report The literature of mixed hepatoblastoma in adults has until recently been confused, and the true inci- CLINICAL PRESENTATION dence of the tumour obscured, owing to the various A Chinese woman aged 27 had been resident in names used by different authors to describe their England for eight years. She gave a history of cases. The commonest pseudonym is 'mixed malig- 18 months' intermittent right-sided chest pain http://jcp.bmj.com/ nant tumour',2-4 an ambivalent term which merely and upper abdominal discomfort.
    [Show full text]
  • PROPOSED REGULATION of the STATE BOARD of HEALTH LCB File No. R057-16
    PROPOSED REGULATION OF THE STATE BOARD OF HEALTH LCB File No. R057-16 Section 1. Chapter 457 of NAC is hereby amended by adding thereto the following provision: 1. The Division may impose an administrative penalty of $5,000 against any person or organization who is responsible for reporting information on cancer who violates the provisions of NRS 457. 230 and 457.250. 2. The Division shall give notice in the manner set forth in NAC 439.345 before imposing any administrative penalty 3. Any person or organization upon whom the Division imposes an administrative penalty pursuant to this section may appeal the action pursuant to the procedures set forth in NAC 439.300 to 439. 395, inclusive. Section 2. NAC 457.010 is here by amended to read as follows: As used in NAC 457.010 to 457.150, inclusive, unless the context otherwise requires: 1. “Cancer” has the meaning ascribed to it in NRS 457.020. 2. “Division” means the Division of Public and Behavioral Health of the Department of Health and Human Services. 3. “Health care facility” has the meaning ascribed to it in NRS 457.020. 4. “[Malignant neoplasm” means a virulent or potentially virulent tumor, regardless of the tissue of origin. [4] “Medical laboratory” has the meaning ascribed to it in NRS 652.060. 5. “Neoplasm” means a virulent or potentially virulent tumor, regardless of the tissue of origin. 6. “[Physician] Provider of health care” means a [physician] provider of health care licensed pursuant to chapter [630 or 633] 629.031 of NRS. 7. “Registry” means the office in which the Chief Medical Officer conducts the program for reporting information on cancer and maintains records containing that information.
    [Show full text]
  • Pediatric Abdominal Masses
    Pediatric Abdominal Masses Andrew Phelps MD Assistant Professor of Pediatric Radiology UCSF Benioff Children's Hospital No Disclosures Take Home Message All you need to remember are the 5 common masses that shouldn’t go to pathology: 1. Infection 2. Adrenal hemorrhage 3. Renal angiomyolipoma 4. Ovarian torsion 5. Liver hemangioma Keys to (Differential) Diagnosis 1. Location? 2. Age? 3. Cystic? OUTLINE 1. Kidney 2. Adrenal 3. Pelvis 4. Liver OUTLINE 1. Kidney 2. Adrenal 3. Pelvis 4. Liver Renal Tumor Mimic – Any Age Infection (Pyelonephritis) Don’t send to pathology! Renal Tumor Mimic – Any Age Abscess Don’t send to pathology! Peds Renal Tumors Infant: 1) mesoblastic nephroma 2) nephroblastomatosis 3) rhabdoid tumor Child: 1) Wilm's tumor 2) lymphoma 3) angiomyolipoma 4) clear cell sarcoma 5) multilocular cystic nephroma Teen: 1) renal cell carcinoma 2) renal medullary carcinoma Peds Renal Tumors Infant: 1) mesoblastic nephroma 2) nephroblastomatosis 3) rhabdoid tumor Child: 1) Wilm's tumor 2) lymphoma 3) angiomyolipoma 4) clear cell sarcoma 5) multilocular cystic nephroma Teen: 1) renal cell carcinoma 2) renal medullary carcinoma Renal Tumors - Infant 1) mesoblastic nephroma 2) nephroblastomatosis 3) rhabdoid tumor Renal Tumors - Infant 1) mesoblastic nephroma 2) nephroblastomatosis 3) rhabdoid tumor - Most common - Can’t distinguish from congenital Wilms. Renal Tumors - Infant 1) mesoblastic nephroma 2) nephroblastomatosis 3) rhabdoid tumor Look for Multiple biggest or diffuse and masses. ugliest. Renal Tumors - Infant 1) mesoblastic
    [Show full text]
  • NY-ESO-1 (CTAG1B) Expression in Mesenchymal Tumors
    Modern Pathology (2015) 28, 587–595 & 2015 USCAP, Inc. All rights reserved 0893-3952/15 $32.00 587 NY-ESO-1 (CTAG1B) expression in mesenchymal tumors Makoto Endo1,2,7, Marieke A de Graaff3,7, Davis R Ingram4, Simin Lim1, Dina C Lev4, Inge H Briaire-de Bruijn3, Neeta Somaiah5, Judith VMG Bove´e3, Alexander J Lazar6 and Torsten O Nielsen1 1Department of Pathology and Laboratory Medicine, University of British Columbia, Vancouver, British Columbia, Canada; 2Department of Orthopaedic Surgery, Kyushu University, Fukuoka, Japan; 3Department of Pathology, Leiden University Medical Center, Leiden, The Netherlands; 4Department of Surgical Oncology, The University of Texas MD Anderson Cancer Center, Houston, TX, USA; 5Department of Sarcoma Medical Oncology, The University of Texas MD Anderson Cancer Center, Houston, TX, USA and 6Department of Pathology, The University of Texas MD Anderson Cancer Center, Houston, TX, USA New York esophageal squamous cell carcinoma 1 (NY-ESO-1, CTAG1B) is a cancer-testis antigen and currently a focus of several targeted immunotherapeutic strategies. We performed a large-scale immunohistochemical expression study of NY-ESO-1 using tissue microarrays of mesenchymal tumors from three institutions in an international collaboration. A total of 1132 intermediate and malignant and 175 benign mesenchymal lesions were enrolled in this study. Immunohistochemical staining was performed on tissue microarrays using a monoclonal antibody for NY-ESO-1. Among mesenchymal tumors, myxoid liposarcomas showed the highest positivity for NY-ESO-1 (88%), followed by synovial sarcomas (49%), myxofibrosarcomas (35%), and conventional chondrosarcomas (28%). Positivity of NY-ESO-1 in the remaining mesenchymal tumors was consistently low, and no immunoreactivity was observed in benign mesenchymal lesions.
    [Show full text]
  • A Case of Adult Hepatoblastoma
    DOI: https://doi.org/10.22516/25007440.339 Case report A case of adult hepatoblastoma Rafael Pila-Pérez, MD,1 Jaider Luis Saurith-Monterrosa, MD,1* Pedro Rosales-Torres, MD,1 Rafael Pila-Peláez, MD,1 Javier Alberto Artola-González, MD.1 1. Manuel Ascunce Domenech Hospital in Abstract Camaguey, Cuba Background: In contrast to childhood hepatoblastoma, adult hepatoblastoma (HBA) is a rare and not-fully- understood liver tumor with a poor prognosis. To date, about 50 cases have been adequately reported in the *Correspondence: Jaider Luis Saurith-Monterrosa, MD, medical literature. Objective: We present the case of a patient who was discharged from our hospital with a [email protected] diagnosis of hepatocellular carcinoma approximately 3 months before returning. Clinical case: A 60-year-old male patient with a history of alcoholism and heavy smoking was admitted to our hospital for abdominal pain. ......................................... Received: 13/01/19 Physical examination revealed a palpable tumor in the right hypochondrium region. This patient had been Accepted: 18/02/19 discharged approximately 3 months previously with a diagnosis of hepatocellular carcinoma in the course of liver cirrhosis. The patient died, and the autopsy revealed an HBA. Conclusions: Adult hepatoblastoma is an infrequent tumor with a severe prognosis. Many cases are asymptomatic until the time of diagnosis, and the tumor is usually very large. Liver enzymes, alpha-fetus protein, and imaging studies lead to a diagnosis of hepatocellular carcinoma which is a common tumor in adults. Histological study confirms the diagnosis. Due to the poor prognosis for HBA in contrast to better prospects for treatment of hepatoblastoma in children, it is logical to use pediatric treatment in adults.
    [Show full text]
  • The a Subunit of GTP-Binding Protein G0 in Neuroblastoma: Correlation with Advanced Disease Stage
    [CANCER RESEARCH 54, 2334-2336, May 1, 19941 The a Subunit of GTP-binding Protein G0 in Neuroblastoma: Correlation with Advanced Disease Stage Yukio Ishiguro,' Kanefusa Kato, Tomiko Asano, Hiroshi Akatsuka, Hiroyuki Iwata, Fujio Ito, and Takahiro Ito Department ofSurgery, Branch Hospital ofNagoya University School ofMedicine, Daiko-minam4 Higashi-ku, Nagoya 461 [V. L, H. A., H. L, F. I., T. I.J, and Department of Biochemistry, Institute for Developmental Research, Aichi Prefectural Colony, Kamiya-cyo, Kasugai [K K, T. A.J, Japan ABSTRACT chemotherapy with cyclophosphamide and vincristine for 3 to 12 months. Stage III patients without recurrences (n = 5) had postoperative chemotherapy Tissue levels of the a subunit of G protein G0 (G0 a) were measured in for 2 years. Nine of 24 patients with distant metastases or recurrences had bone solid tumors from pediatric patients by immunoassay.G0 a concentra marrow transplants after complete clinical remissions. Survival time was tions were determined in the supernatant obtained by centrifugatlon of measured from the start of treatment. Diagnoses were confirmed histologically. tissue homogenates prepared in the presence (total G0 a) or absence of 2% Preparation of Tissue Extracts. Tissues were homogenized at 0°Cin 10 sodium cholate (soluble G0 a). Mean G0 a concentrations (total G0 a and volumes of 10 mM Tris-HCI (pH 7.5) containing 1 mM EDTA, using a soluble G0 a) in neuroblastomas (7 ganglioneuromas,13 ganglioneuro Polytron-type homogenizer. One-half of each homogenate was centrifuged at blastomas, and 50 neuroblastomas) were over 50-fold higher than those in 4°Cat 125,000 X g for 40 mm, and the supernatant was saved for G0 a other solidtumors from pediatric patients (n 13).Mean total G0a and analysis of the soluble fraction (soluble G0 a).
    [Show full text]
  • A Brighter Future Pediatric Malignancies and IHC Mike Lacey, M.D
    A Brighter Future Pediatric Malignancies and IHC Mike Lacey, M.D. Pediatric Pathology The life science business of Merck KGaA, Darmstadt, Germany operates as MilliporeSigma in the U.S. and Canada. Pediatric Malignancies and IHC Mike Lacey, M.D. Pediatric tumors are heterogenous and can be quite varied in appearance. However, those in the infamous “small round blue- cell tumor” group, with their hyperchromatic nuclei and small amount of cytoplasm can be challenging, and their detection require cost-efficient and focused immunohistochemistry and ancillary testing. Ideally, ample material should be obtained for routine histology and ancillary testing, including immunohistochemistry, fluorescentin situ hybridization, fresh tissue for cytogenetic studies, and snap-frozen tumor for DNA/ RNA extraction both for routine molecular testing (i.e., reverse- transcription PCR studies), as well as future research study protocols (genome wide studies, targeted gene sequencing). The term “blastoma” refers to a tumor that recapitulates its embryological origin. Although the cellular origin of many pediatric tumors is presumed and even accepted in many cases, it is important to emphasize that they are labeled according to their morphologic differentiation patterns. 2 Pediatric Malignancies and IHC Neuroblastoma markers including neuron-specific enolase (NSE), protein gene product 9.5 (PGP 9.5), synaptophysin, Neuroblastic tumors (NT) represent a spectrum NB84 (antibody to NB cell lines), CD56, CD57, and with variable degrees of cell maturation along the tyrosine hydroxylase. embryological development of the sympathetic nervous system and include 3 main categories: Similar to CD99, PGP 9.5 may show cytoplasmic neuroblastoma (NB), ganglioneuroblastoma (GNB), and staining within a number of other tumors with ganglioneuroma (GN), based on the amount of S-100 neuroectodermal lineage, including Ewing sarcoma positive schwannian stroma (SCHNS) and ganglion family of tumors (EWSFT), synovial sarcoma cell differentiation.
    [Show full text]
  • Second Revised Proposed Regulation of the State
    SECOND REVISED PROPOSED REGULATION OF THE STATE BOARD OF HEALTH LCB File No. R057-16 February 5, 2018 EXPLANATION – Matter in italics is new; matter in brackets [omitted material] is material to be omitted. AUTHORITY: §§1, 2, 4-9 and 11-15, NRS 457.065 and 457.240; §3, NRS 457.065 and 457.250; §10, NRS 457.065; §16, NRS 439.150, 457.065, 457.250 and 457.260. A REGULATION relating to cancer; revising provisions relating to certain publications adopted by reference by the State Board of Health; revising provisions governing the system for reporting information on cancer and other neoplasms established and maintained by the Chief Medical Officer; establishing the amount and the procedure for the imposition of certain administrative penalties by the Division of Public and Behavioral Health of the Department of Health and Human Services; and providing other matters properly relating thereto. Legislative Counsel’s Digest: Existing law defines the term “cancer” to mean “all malignant neoplasms, regardless of the tissue of origin, including malignant lymphoma and leukemia” and, before the 78th Legislative Session, required the reporting of incidences of cancer. (NRS 457.020, 457.230) Pursuant to Assembly Bill No. 42 of the 78th Legislative Session, the State Board of Health is: (1) authorized to require the reporting of incidences of neoplasms other than cancer, in addition to incidences of cancer, to the system for reporting such information established and maintained by the Chief Medical Officer; and (2) required to establish an administrative penalty to impose against any person who violates certain provisions which govern the abstracting of records of a health care facility relating to the neoplasms the Board requires to be reported.
    [Show full text]
  • Adult Hepatoblastoma: a Case Report and Literature Review
    CASE REPORT – OPEN ACCESS International Journal of Surgery Case Reports 4 (2013) 204–207 Contents lists available at SciVerse ScienceDirect International Journal of Surgery Case Reports j ournal homepage: www.elsevier.com/locate/ijscr Adult hepatoblastoma: A case report and literature review a,b,∗ B.O. Al-Jiffry a Department of Surgery, College of Medicine and Medical Sciences, Taif University, PO Box 888, Taif 21947, Kingdom of Saudi Arabia b Department of Surgery, Al-Hada Military Hospital, PO Box 1347, Taif, Kingdom of Saudi Arabia a r t i c l e i n f o a b s t r a c t Article history: INTRODUCTION: Adult hepatoblastoma is a rare malignant liver neoplasm. Surgery is the only cure, but Received 17 August 2012 recurrence is common even after complete resection. No therapeutic strategy has been established. Received in revised form 5 October 2012 PRESENTATION OF CASE: A 22-year-old man presented with a rapidly expanding right hypochondrial mass. Accepted 27 October 2012 Pain preceded the appearance of the mass. No definitive diagnosis was established in the referring hospi- Available online 24 November 2012 tal. In addition, two attempts of embolization failed to reach the tumor due to its large size and vascular × displacement. Clinical examination revealed a 26 cm 23 cm mass occupying the right hypochondrium Keywords: and epigastrium as far as the right iliac fossa, compressing the stomach, spleen, kidneys and liver. The Hepatoblastoma preoperative diagnosis was gastrointestinal stromal tumor because it appeared to originate from the Liver malignancies stomach. During surgery, we found a mass arising from the liver, adhering to the omentum, stomach, and Primary liver tumors Adult left hemidiaphragm, and infiltrating the pericardium.
    [Show full text]
  • Congenital Mesoblastic Nephroma - a Case Report
    :U$ 1ilt射훌훌뿔슐誌 第 25 卷 第 2 號 pp. 326 - 329, 1989 Journal of Korean Radiol앵 ical Soc iety, 25(2) 326 - 329, 1989 Congenital Mesoblastic Nephroma - A Case Report- Dong Ho Lee, M.D., Jae Hooo Lim, M.D., Young Tae Ko, M.D. Department of Radiology, Kyung Hee University Hospital 〈 國文沙錄 〉 先天性 中 R조좋性 賢睡 慶熙大學校 醫科大學 放射線科學敎室 李東鎬·林在勳·高永泰 先天性 中)ff葉性 賢睡은 新生兒 複部睡塊로 냐타냐는 賢藏의 良↑生睡場이 다 . 著者들은 先天性 中 R조葉↑生 賢睡 1 例를 經驗하였기에 報告하고자 한마. 超音波檢훌 및 電算化斷層握影上 境界가 分 明 한 固形睡場으로 內部에 마수의 짧性 壞死을 보였다. - Abstract- Congenital mesoblastic nephroma is a benign renal tumor that appears as a neonatal abdominal mass We have experienced a case of congenital mesoblastic nephroma. The ultrasonographic and CT findings are well-demarcated solid mass containing large portion of cystic necrosis and congenital fibrosarcomaJ). The behavior of this tumor is benign, so complete removal is Introduction cura tIveL2.5\，~) Authors report one patient of congenital meso­ Congenital mesoblastic nephroma is the com­ blastic nephroma with presentation of IVP, ult­ monest neonatal renal neoplasml- 6), and it is alm­ rasonographic, CT and pathologic findings. ost always discovered in the first few months of 4 life2- ). Synonyms for this tumor include fetal re­ Case Report nal hamartoma, leiomyomatous hamartoma, mesenchymal hamartoma of infancy, congenital A 2-month-old boy was referred to our hospital Wilms’ tumor, fibroma, fibromyoma, fibrosarcoma due to abdominal mass . He was born at local clinic with NFSD (normal fullterm spontaneous 이 논문은 1989 년 l 월 1 6 일 접 수하여 19 89 년 2 월 10 일에 채택되었음 delivery)and 3.3 Kg.
    [Show full text]
  • Breast Lesions in Children and Adolescents
    Pictorial Essay | Pediatric Imaging https://doi.org/10.3348/kjr.2018.19.5.978 pISSN 1229-6929 · eISSN 2005-8330 Korean J Radiol 2018;19(5):978-991 Breast Lesions in Children and Adolescents: Diagnosis and Management Eun Ji Lee, MD, Yun-Woo Chang, MD, PhD, Jung Hee Oh, MD, Jiyoung Hwang, MD, Seong Sook Hong, MD, PhD, Hyun-joo Kim, MD, PhD All authors: Department of Radiology, Soonchunhyang University Seoul Hospital, Seoul 04401, Korea Pediatric breast disease is uncommon, and primary breast carcinoma in children is extremely rare. Therefore, the approach used to address breast lesions in pediatric patients differs from that in adults in many ways. Knowledge of the normal imaging features at various stages of development and the characteristics of breast disease in the pediatric population can help the radiologist to make confident diagnoses and manage patients appropriately. Most breast diseases in children are benign or associated with breast development, suggesting a need for conservative treatment. Interventional procedures might affect the developing breast and are only indicated in a limited number of cases. Histologic examination should be performed in pediatric patients, taking into account the size of the lesion and clinical history together with the imaging findings. A core needle biopsy is useful for accurate diagnosis and avoidance of irreparable damage in pediatric patients. Biopsy should be considered in the event of abnormal imaging findings, such as non-circumscribed margins, complex solid and cystic components, posterior acoustic shadowing, size above 3 cm, or an increase in mass size. A clinical history that includes a risk factor for malignancy, such as prior chest irradiation, known concurrent cancer not involving the breast, or family history of breast cancer, should prompt consideration of biopsy even if the lesion has a probably benign appearance on ultrasonography.
    [Show full text]
  • MRI Vs CT Vs Func7onal Imaging
    Staging and Following Common Pediatric Malignancies: MRI vs CT vs Func;onal Imaging Stephan D. Voss, MD, PhD Department of Radiology Boston Children’s Hospital Harvard Medical School Disclosure Statement No Disclosure Intro NeuroblastomaCancer Hepatoblastoma Wilms Tumor Surveillance Survivorship Imaging Imaging in Childhood Cancer • Detec;ng, Characterizing and Staging Disease - Generang Differen;al Diagnosis • Guiding Surgical Planning - Biopsy, resecon • Evaluang Treatment Response - Anatomic and Func;onal Imaging - Acute and Late • Predic;ng Outcome • Diagnosing & Managing Complicaons • Monitoring for Recurrence - Early and Late Intro NeuroblastomaCancer Hepatoblastoma Wilms Tumor Surveillance Survivorship Imaging The “Big Three” • Neuroblastoma • Hepatoblastoma • Wilm’s Tumor • Others: - Rhabdomyosarcoma - Germ Cell Tumors - Neurofibromatosis - Other liver, renal tumors Cases Intro NeuroblastomaNeuroblastomaCancer Hepatoblastoma WilmsImaging & Tumor Surveillance Imaging Survivorship Radiaon Risk Surveillance Imaging NBL: Previous Staging & Risk Classificaon • Major prognos;c factors • Poor prognos;c features • INSS stage of the disease include • Age, Histology and • Age >18 months molecular pathology • N-MYC gene amplificaon • 3 different risk categories • Diploid DNA content • Low, Intermediate, High • Poorly differen;ated/ undifferen;ated histology Cases Intro NeuroblastomaNeuroblastomaCancer Hepatoblastoma WilmsImaging & Tumor Surveillance Imaging Survivorship Radiaon Risk Surveillance Imaging Image Defined Risk Factors – IDRF’s • Surgical
    [Show full text]