DOCSLIB.ORG

Nuclear Loss of Protein Arginine N-Methyltransferase 2 in Breast Carcinoma Is Associated with Tumor Grade and Overexpression of Cyclin D1 Protein

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Nuclear Loss of Protein Arginine N-Methyltransferase 2 in Breast Carcinoma Is Associated with Tumor Grade and Overexpression of Cyclin D1 Protein Oncogene (2014) 33, 5546–5558 & 2014 Macmillan Publishers Limited All rights reserved 0950-9232/14 www.nature.com/onc ORIGINAL ARTICLE Nuclear loss of protein arginine N-methyltransferase 2 in breast carcinoma is associated with tumor grade and overexpression of cyclin D1 protein J Zhong1,3, R-X Cao1,2,3, J-H Liu1,2, Y-B Liu1, J Wang1, L-P Liu1, Y-J Chen1, J Yang1,2, Q-H Zhang1,YWu1, W-J Ding1, T Hong1,2, X-H Xiao1,2, X-Y Zu1 and G-B Wen1 Human protein arginine N-methyltransferase 2 (PRMT2, HRMT1L1) is a protein that belongs to the arginine methyltransferase family, and it has diverse roles in transcriptional regulation through different mechanisms depending on its binding partners. In this study, we provide evidences for the negative effect of PRMT2 on breast cancer cell proliferation in vitro and in vivo. Morever, cyclin D1, one of the key modulators of cell cycle, was found to be downregulated by PRMT2, and PRMT2 was further shown to suppress the estrogen receptor a-binding affinity to the activator protein-1 (AP-1) site in cyclin D1 promoter through indirect binding with AP-1 site, resulting in the inhibition of cyclin D1 promoter activity in MCF-7 cells. Furthermore, a positive correlation between the expression of PRMT2 and cyclin D1 was confirmed in the breast cancer tissues by using tissue microarray assay. In addition, PRMT2 was found to show a high absent percentage in breast caner cell nuclei and the nuclear loss ratio of PRMT2 was demonstrated to positively correlate with cyclin D1 expression and the increasing tumor grade of invasive ductal carcinoma. Those results offer an essential insight into the effect of PRMT2 on breast carcinogenesis, and PRMT2 nuclear loss might be an important biological marker for the diagnosis of breast cancer. Oncogene (2014) 33, 5546–5558; doi:10.1038/onc.2013.500; published online 2 December 2013 Keywords: nuclear loss; PRMT2; cyclin D1; breast cancer INTRODUCTION fetal brain, and to enhance androgen receptor-mediated Estrogen receptor a (ERa) is a transcription factor and engaged in a transactivation dependent on the cellular background.16 Recently, broad range of biological processes, including cell proliferation, PRMT2 has been demonstrated to have weak methyltransferase differentiation, morphogenesis and apoptosis,1–3 as well as the activity on a histone H4 substrate, but its optimal substrates have not development and progression of breast cancer.4 ERa-mediated yet been identified.17,18 A series of reports show that PRMT2 is clearly transcription is through binding directly to specific estrogen involved in a variety of cellular processes, including lung function, response elements (EREs) in the promoters of responsive genes5 or the inflammatory response, apoptosis promotion, Wnt signaling and via protein–protein interaction with other promoter-bound tran- leptin signaling regulation,19–23 suggesting that PRMT2 has diverse 6 7 scription factors, such as specificity protein 1 (Sp1), AP-1 or roles in transcriptional regulation through different mechanisms 8 nuclear factor-kB. In either case, coactivators or corepressors are depending on its binding partners. further recruited to form a functional receptor complex that In previous study, we identified that PRMT2 is capable of 9 specifies transcriptional activities of downstream targets. Cyclin binding to ERa both in vitro and in vivo, and we showed that D1 (CCND1) is a D-type cyclin that regulates G1-S cell cycle PRMT2 expression was higher in human breast tumors when progression during cell proliferation. CCND1 is also E2/ERa compared with adjacent normal tissue, suggesting a role for responsive and is thought to have major roles in breast PRMT2 in breast tumorigenesis.24 To further understand the 10,11 cancer. However, there is no classical ERE in the CCND1 physiological function of PRMT2, as well as its potential role in the promoter, and the contribution of E2/ERa to CCND1 action in development and progression of breast cancer, MCF7 breast 12 breast cells remains unclear. The roles of CCND1 transcription cancer cells with high level of PRMT2 expression was used for a regulation in breast tumorigenesis need to be further defined. loss-of-function cell model by artificial microRNA (miRNA) based Human protein arginine N-methyltransferase 2 (PRMT2, HRMT1L1) on the murine miR-155 sequence.25 This study provides evidences is a protein that belongs to the arginine methyltransferase family and for the negative effect of PRMT2 on breast cancer cell contains a highly conserved catalytic Ado-Met-binding domain and proliferation, uncovers the molecular mechanism of PRMT2 unique Src homology 3 domain that binds proteins with proline-rich regulating the expression of CCND1, which accounts for PRMT2- motifs.13,14 Initially, PRMT2 enhances ERa-mediated transactivation in induced proliferation suppression in breast cancer cells, and CV-1 cells,15 and subsequent research showed that PRMT2 was found demonstrates the correlation between PRMT2 nuclear loss and to be aberrantly expressed in skeletal muscle, ovary, prostate and grade of invasive ductal breast carcinoma. 1Institute of Clinical Medicine, First Affiliated Hospital of University of South China, Hengyang, PR China and 2Department of Metabolism and Endocrinology, First Affiliated Hospital of University of South China, Hengyang, PR China. Correspondence: Dr X-Y Zu or G-B Wen, Institute of Clinical Medicine, First Affiliated Hospital of University of South China, 69 chuanshan Road, Hengyang 421001, China. E-mail: [email protected] or [email protected] 3The first two authors contributed equally to this work. Received 30 April 2013; revised 17 September 2013; accepted 18 October 2013; published online 2 December 2013 PRMT2 nuclear loss correlates with cyclin D1 overexpression J Zhong et al 5547 RESULTS to evaluate knockdown of PRMT2 mRNA, real-time PCR was miRNA induced downregulation of PRMT2 expression in breast performed, and as shown in Figure 1d, PRMT2 mRNA levels in cancer cells MCF7 cells with PRMT2-miRNAs were reduced by almost 80% and Initially, experiments were performed to select the best miRNA to 70% respectively, as compared with those in control cells. knockdown PRMT2 expression. A pcDNA6.2-GW/EmGFP-miR- based miRNA expression plasmid with a pre-miRNA sequence was constructed and transfected to MCF7 cells. Two kinds of Suppression of PRMT2 expression promotes the cell proliferation miRNA were designed to test their inhibitory effect on PRMT2 and colony formation of MCF7 cells expression in MCF7 cells. PRMT2-miRNA1 was targeted to exon 4 We next examined the effect of miRNA-induced PRMT2 down- of PRMT2, and PRMT2-miRNA2 was targeted to exon 9 of PRMT2 regulation on the proliferation ability of MCF7 cells. Without (Figure 1a). Stable cell lines with the PRMT2-miRNAs were treatment of 17b-Estradiol (E2), MCF7 cells carrying PRMT2- obtained after the transfected MCF7 cells were selected by miRNA1, PRMT2-miRNA2 or LacZ-miRNA showed no significant blasticidin for 2 weeks (Supplementary Figure S1). Immuno- difference in their growth rates at the indicated time points fluorescence staining and western blotting were performed to (Figure 2a). Whereas, MCF7 cells with either PRMT2-miRNA1 or verify the expression of PRMT2 in the transfected MCF7 cells. The PRMT2-miRNA2 showed markedly increased proliferate ability cells with the pre-miRNA sequence against PRMT2 showed compared with that of cells with LacZ-miRNA, when treated with significantly decreased expression of PRMT2 compared with 10 nM E2 for 5 days (Figure 2b). We speculated that suppression of control cells with LacZ-miRNA (Figures 1b and c). Furthermore, endogenous PRMT2 expression could increase responsiveness of Antisense target sequence miRNA loop Sense target sequence Overhang (Mature miRNA Sequence) derived from miR-155 (nucleotides 1-8 and 11-21 PRMT2-miR1 5’-TGCTGTGGAAGTGGACGCTAAACCAGGTTTTGGCCACTGACTGACCTGGTTTAGTCCACTTCCA-3’ 3’- CACCTTCACCTGCGATTTGGTCCAAAACCGGTGACTGACTGGACCAAATCAGGTGAAGGTGTCC-5’ PRMT2-miR2 5’-TGCTGTCTTCATCCTGCCACGTGTCCGTTTTGGCCACTGACTGACGGACACGTCAGGATGAAGA-3’ 3’-CAGAAGTAGGACGGTGCACAGGCAAAACCGGTGACTGACTGCCTGTGCAGTCCTACTTCTGTCC-5’ GFP PRMT2 DAPI Merge LacZ-miRNA PRMT2-miR1 PRMT2-miR2 1000 800 600 LacZ-miRNAPRMT2-miR1PRMT2-miR2 400 PRMT2 200 0 -actin to PRMT2-miRNA cells PRMT2 expressive folds of LacZ-miRNA cells compared LacZ-miRNAPRMT2-miR1PRMT2-miR2 Figure 1. Downregulation of PRMT2 in MCF7 cells with PRMT2-miRNA. (a) Pre-miRNA double-strand oligo inserted into miRNA expression vector-pcDNA 6.2-GW/EmGFP-miR. (b) MCF7 cells with either LacZ-miRNA or PRMT2-miRNA were fixed in paraformaldehyde, permeabilized with triton X-100, and were incubated with cy3-conjugated PRMT2 antibody. The cells were then stained with 4,6-diamidino-2-phenylindole (DAPI) and viewed under a Zeiss LSM 510 confocal microscope. (c) Western blot analysis of MCF7 cells transfected with PRMT2-miRNA compared with MCF7 cells with LacZ-miRNA. (d) Summary of real-time reverse transcription–PCR results of MCF7 cells transfected with PRMT2-miRNA compared with LacZ-miRNA cells. GFP, green fluorescent protein. & 2014 Macmillan Publishers Limited Oncogene (2014) 5546 – 5558 PRMT2 nuclear loss correlates with cyclin D1 overexpression J Zhong et al 5548 ) 3.0 ) LacZ-miRNA 4 LacZ-miRNA 4 8 * * PRMT2-miR1 PRMT2-miR1 PRMT2-miR2 7 PRMT2-miR2 * 2.5 6 5 4 2.0 3 2 Cell numbers (x 10 Cell numbers 1.5 (x 10 Cell numbers 1 1234567 1 234567 (days) (days) 0.85 LacZ-miRNA 1.0 LacZ-miRNA PRMT2-miR1 PRMT2-miR1 0.80 PRMT2-miR2 PRMT2-miR2 * * 0.8 * 0.75 0.6 OD/well OD/well 0.70 0.4 0.65 -11 -10 -9 -8 -7 -6 1234567 E2 (M/L) 010 10 10 10 10 10 (days) LacZ-miRNA PRMT2-miR1 PRMT2-miR2 - E2 + E 160 * 2 140 * 120 -E2 100 80 60 40 Colony numbers Colony 20 +E2 0 LacZ-miRNA PRMT2-miR1PRMT2-miR2 Figure 2. Suppression of PRMT2 expression promotes the cell proliferation and colony formation of MCF7 cells. (a and b) Logarithmic population of the MCF7 cells expressing LacZ-miRNA, PRMT2-miR1 or PRMT2-miR2 without (a) or with 10 nM E2 (b).
Load more

Recommended publications
  • Behavioural Brain Research 217 (2011) 271–281
    Behavioural Brain Research 217 (2011) 271–281 Contents lists available at ScienceDirect Behavioural Brain Research journal homepage: www.elsevier.com/locate/bbr Research report The telomeric part of the human chromosome 21 from Cstb to Prmt2 is not necessary for the locomotor and short-term memory deficits observed in the Tc1 mouse model of Down syndrome Arnaud Duchon a, Stéphanie Pothion b, Véronique Brault a, Andrew J. Sharp c, Victor L.J. Tybulewicz d, Elizabeth M.C. Fisher e, Yann Herault a,b,f,∗ a Institut de Génétique Biologie Moléculaire et Cellulaire, Translational Medicine and Neuroscience Program, IGBMC, CNRS, INSERM, Université de Strasbourg, UMR7104, UMR964, 1 rue Laurent Fries, 67404 Illkirch, France b Transgenese et Archivage Animaux Modèles, TAAM, CNRS, UPS44, 3B rue de la Férollerie 45071 Orléans, France c Department of Genetics and Genomic Sciences, Mount Sinai School of Medicine, 1425 Madison Avenue, Room 14-75B, Box 1498, New York, NY 10029, USA d MRC National Institute for Medical Research, Mill Hill, London NW7 1AA, UK e UCL Institute of Neurology, Queen Square, London WC1N 3BG, UK f Institut Clinique de la Souris, ICS, 1 rue Laurent Fries, 67404 Illkirch, France article info abstract Article history: Trisomy 21 or Down syndrome (DS) is the most common form of human aneuploid disorder. Increase Received 5 September 2010 in the copy number of human chromosome 21 genes leads to several alterations including mental retar- Received in revised form 6 October 2010 dation, heart and skeletal dysmorphologies with additional physiological defects. To better understand Accepted 17 October 2010 the genotype and phenotype relationships, several mouse models have been developed, including the Available online 31 October 2010 transchromosomic Tc1 mouse, which carries an almost complete human chromosome 21, that displays several locomotor and cognitive alterations related to DS.
    [Show full text]
  • An Animal Model with a Cardiomyocyte-Specific Deletion of Estrogen Receptor Alpha: Functional, Metabolic, and Differential Netwo
    Washington University School of Medicine Digital Commons@Becker Open Access Publications 2014 An animal model with a cardiomyocyte-specific deletion of estrogen receptor alpha: Functional, metabolic, and differential network analysis Sriram Devanathan Washington University School of Medicine in St. Louis Timothy Whitehead Washington University School of Medicine in St. Louis George G. Schweitzer Washington University School of Medicine in St. Louis Nicole Fettig Washington University School of Medicine in St. Louis Attila Kovacs Washington University School of Medicine in St. Louis See next page for additional authors Follow this and additional works at: https://digitalcommons.wustl.edu/open_access_pubs Recommended Citation Devanathan, Sriram; Whitehead, Timothy; Schweitzer, George G.; Fettig, Nicole; Kovacs, Attila; Korach, Kenneth S.; Finck, Brian N.; and Shoghi, Kooresh I., ,"An animal model with a cardiomyocyte-specific deletion of estrogen receptor alpha: Functional, metabolic, and differential network analysis." PLoS One.9,7. e101900. (2014). https://digitalcommons.wustl.edu/open_access_pubs/3326 This Open Access Publication is brought to you for free and open access by Digital Commons@Becker. It has been accepted for inclusion in Open Access Publications by an authorized administrator of Digital Commons@Becker. For more information, please contact [email protected]. Authors Sriram Devanathan, Timothy Whitehead, George G. Schweitzer, Nicole Fettig, Attila Kovacs, Kenneth S. Korach, Brian N. Finck, and Kooresh I. Shoghi This open access publication is available at Digital Commons@Becker: https://digitalcommons.wustl.edu/open_access_pubs/3326 An Animal Model with a Cardiomyocyte-Specific Deletion of Estrogen Receptor Alpha: Functional, Metabolic, and Differential Network Analysis Sriram Devanathan1, Timothy Whitehead1, George G. Schweitzer2, Nicole Fettig1, Attila Kovacs3, Kenneth S.
    [Show full text]
  • DIRAS3 Antibody Catalog # ASC11908
    10320 Camino Santa Fe, Suite G San Diego, CA 92121 Tel: 858.875.1900 Fax: 858.622.0609 DIRAS3 Antibody Catalog # ASC11908 Specification DIRAS3 Antibody - Product Information Application WB Primary Accession O95661 Other Accession NP_004666, 4757772 Reactivity Human Host Rabbit Clonality Polyclonal Isotype IgG Calculated MW Predicted: 25 kDa Observed: 24 kDa KDa Application Notes DIRAS3 antibody can be used for detection of DIRAS3 by Western blot at 1 Western blot analysis of DIRAS3 in human - 2 µg/ml. testis tissue lysate with DIRAS3 antibody at 1 µg/ml. DIRAS3 Antibody - Additional Information DIRAS3 Antibody - Background Gene ID 9077 Target/Specificity DIRAS3 is a member of the ras superfamily, DIRAS3; DIRAS3 antibody is human specific. and is expressed in normal ovarian and breast epithelial cells, but not in ovarian and breast Reconstitution & Storage cancers. It is an imprinted gene, with DIRAS3 antibody can be stored at 4℃ for mono-allelic expression of the paternal allele, three months and -20℃, stable for up to which is associated with growth suppression one year. and down-regulation of cyclin D1 promoter Precautions activity and induction of p21 (WAF/CIP1). Thus, DIRAS3 Antibody is for research use only this gene appears to be a putative tumor and not for use in diagnostic or therapeutic suppressor gene whose function is abrogated procedures. in ovarian and breast cancers (1). DIRAS3 has been shown to induce autophagy in human ovarian cancer cells by blocking PI3K signaling, inhibiting the mammalian target of rapamycin DIRAS3 Antibody - Protein Information (TOR), upregulating ATG4, and colocalizing with LC3 in autophagosomes (2). DIRAS also Name DIRAS3 interacts with C-RAF and downregulates mitogen-activated protein kinase kinases Synonyms ARHI, NOEY2, RHOI (MEK) to restrict cell migration (3).
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Protein Identities in Evs Isolated from U87-MG GBM Cells As Determined by NG LC-MS/MS
    Protein identities in EVs isolated from U87-MG GBM cells as determined by NG LC-MS/MS. No. Accession Description Σ Coverage Σ# Proteins Σ# Unique Peptides Σ# Peptides Σ# PSMs # AAs MW [kDa] calc. pI 1 A8MS94 Putative golgin subfamily A member 2-like protein 5 OS=Homo sapiens PE=5 SV=2 - [GG2L5_HUMAN] 100 1 1 7 88 110 12,03704523 5,681152344 2 P60660 Myosin light polypeptide 6 OS=Homo sapiens GN=MYL6 PE=1 SV=2 - [MYL6_HUMAN] 100 3 5 17 173 151 16,91913397 4,652832031 3 Q6ZYL4 General transcription factor IIH subunit 5 OS=Homo sapiens GN=GTF2H5 PE=1 SV=1 - [TF2H5_HUMAN] 98,59 1 1 4 13 71 8,048185945 4,652832031 4 P60709 Actin, cytoplasmic 1 OS=Homo sapiens GN=ACTB PE=1 SV=1 - [ACTB_HUMAN] 97,6 5 5 35 917 375 41,70973209 5,478027344 5 P13489 Ribonuclease inhibitor OS=Homo sapiens GN=RNH1 PE=1 SV=2 - [RINI_HUMAN] 96,75 1 12 37 173 461 49,94108966 4,817871094 6 P09382 Galectin-1 OS=Homo sapiens GN=LGALS1 PE=1 SV=2 - [LEG1_HUMAN] 96,3 1 7 14 283 135 14,70620005 5,503417969 7 P60174 Triosephosphate isomerase OS=Homo sapiens GN=TPI1 PE=1 SV=3 - [TPIS_HUMAN] 95,1 3 16 25 375 286 30,77169764 5,922363281 8 P04406 Glyceraldehyde-3-phosphate dehydrogenase OS=Homo sapiens GN=GAPDH PE=1 SV=3 - [G3P_HUMAN] 94,63 2 13 31 509 335 36,03039959 8,455566406 9 Q15185 Prostaglandin E synthase 3 OS=Homo sapiens GN=PTGES3 PE=1 SV=1 - [TEBP_HUMAN] 93,13 1 5 12 74 160 18,68541938 4,538574219 10 P09417 Dihydropteridine reductase OS=Homo sapiens GN=QDPR PE=1 SV=2 - [DHPR_HUMAN] 93,03 1 1 17 69 244 25,77302971 7,371582031 11 P01911 HLA class II histocompatibility antigen,
    [Show full text]
  • The Role of Arginine Methylation of Hnrnpul1 in the DNA Damage Response Pathway Gayathri Gurunathan
    The role of arginine methylation of hnRNPUL1 in the DNA damage response pathway Gayathri Gurunathan Faculty of Medicine Division of Experimental Medicine McGill University, Montreal, Quebec, Canada August 2014 A Thesis Submitted to McGill University in Partial Fulfillment of the Requirements for the Degree of Master of Science © Gayathri Gurunathan 2014 Abstract Post-translational modifications play a key role in mediating the DNA damage response (DDR). It is well-known that serine/threonine phosphorylation is a major post-translational modification required for the amplification of the DDR; however, less is known about the role of other modifications, such as arginine methylation. It is known that arginine methylation of the DDR protein, MRE11, by protein arginine methyltransferase 1 (PRMT1) is essential for the response, as the absence of methylation of MRE11 in mice leads to hypersensitivity to DNA damage agents. Herein, we identify hnRNPUL1 as a substrate of PRMT1 and the methylation of hnRNPUL1 is required for DNA damage signalling. I show that several RGG/RG sequences of hnRNPUL1 are methylated in vitro by PRMT1. Recombinant glutathione S-transferase (GST) proteins harboring hnRNPUL1 RGRGRG, RGGRGG and a single RGG were efficient in vitro substrates of PRMT1. Moreover, I performed mass spectrometry analysis of Flag-hnRNPUL1 and identified the same sites methylated in vivo. PRMT1-depletion using RNA interference led to the hypomethylation of hnRNPUL1, consistent with PRMT1 being the only enzyme in vivo to methylate these sequences. We replaced the arginines with lysine in hnRNPUL1 (Flag- hnRNPUL1RK) such that this mutant protein cannot be methylated by PRMT1. Indeed Flag- hnRNPUL1RK was undetected using specific dimethylarginine antibodies.
    [Show full text]
  • Supplementary Table 1: Adhesion Genes Data Set
    Supplementary Table 1: Adhesion genes data set PROBE Entrez Gene ID Celera Gene ID Gene_Symbol Gene_Name 160832 1 hCG201364.3 A1BG alpha-1-B glycoprotein 223658 1 hCG201364.3 A1BG alpha-1-B glycoprotein 212988 102 hCG40040.3 ADAM10 ADAM metallopeptidase domain 10 133411 4185 hCG28232.2 ADAM11 ADAM metallopeptidase domain 11 110695 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 195222 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 165344 8751 hCG20021.3 ADAM15 ADAM metallopeptidase domain 15 (metargidin) 189065 6868 null ADAM17 ADAM metallopeptidase domain 17 (tumor necrosis factor, alpha, converting enzyme) 108119 8728 hCG15398.4 ADAM19 ADAM metallopeptidase domain 19 (meltrin beta) 117763 8748 hCG20675.3 ADAM20 ADAM metallopeptidase domain 20 126448 8747 hCG1785634.2 ADAM21 ADAM metallopeptidase domain 21 208981 8747 hCG1785634.2|hCG2042897 ADAM21 ADAM metallopeptidase domain 21 180903 53616 hCG17212.4 ADAM22 ADAM metallopeptidase domain 22 177272 8745 hCG1811623.1 ADAM23 ADAM metallopeptidase domain 23 102384 10863 hCG1818505.1 ADAM28 ADAM metallopeptidase domain 28 119968 11086 hCG1786734.2 ADAM29 ADAM metallopeptidase domain 29 205542 11085 hCG1997196.1 ADAM30 ADAM metallopeptidase domain 30 148417 80332 hCG39255.4 ADAM33 ADAM metallopeptidase domain 33 140492 8756 hCG1789002.2 ADAM7 ADAM metallopeptidase domain 7 122603 101 hCG1816947.1 ADAM8 ADAM metallopeptidase domain 8 183965 8754 hCG1996391 ADAM9 ADAM metallopeptidase domain 9 (meltrin gamma) 129974 27299 hCG15447.3 ADAMDEC1 ADAM-like,
    [Show full text]
  • UNIVERSITY of CALIFORNIA RIVERSIDE Investigations Into The
    UNIVERSITY OF CALIFORNIA RIVERSIDE Investigations into the Role of TAF1-mediated Phosphorylation in Gene Regulation A Dissertation submitted in partial satisfaction of the requirements for the degree of Doctor of Philosophy in Cell, Molecular and Developmental Biology by Brian James Gadd December 2012 Dissertation Committee: Dr. Xuan Liu, Chairperson Dr. Frank Sauer Dr. Frances M. Sladek Copyright by Brian James Gadd 2012 The Dissertation of Brian James Gadd is approved Committee Chairperson University of California, Riverside Acknowledgments I am thankful to Dr. Liu for her patience and support over the last eight years. I am deeply indebted to my committee members, Dr. Frank Sauer and Dr. Frances Sladek for the insightful comments on my research and this dissertation. Thanks goes out to CMDB, especially Dr. Bachant, Dr. Springer and Kathy Redd for their support. Thanks to all the members of the Liu lab both past and present. A very special thanks to the members of the Sauer lab, including Silvia, Stephane, David, Matt, Stephen, Ninuo, Toby, Josh, Alice, Alex and Flora. You have made all the years here fly by and made them so enjoyable. From the Sladek lab I want to thank Eugene, John, Linh and Karthi. Special thanks go out to all the friends I’ve made over the years here. Chris, Amber, Stephane and David, thank you so much for feeding me, encouraging me and keeping me sane. Thanks to the brothers for all your encouragement and prayers. To any I haven’t mentioned by name, I promise I haven’t forgotten all you’ve done for me during my graduate years.
    [Show full text]
  • DIRAS3 Antibody Cat
    DIRAS3 Antibody Cat. No.: 8139 DIRAS3 Antibody Specifications HOST SPECIES: Rabbit SPECIES REACTIVITY: Human DIRAS3 antibody was raised against an 18 amino acid peptide near the carboxy terminus of human DIRAS3. IMMUNOGEN: The immunogen is located within the last 50 amino acids of DIRAS3. TESTED APPLICATIONS: ELISA, WB DIRAS3 antibody can be used for detection of DIRAS3 by Western blot at 1 - 2 μg/ml. APPLICATIONS: Antibody validated: Western Blot in human samples. All other applications and species not yet tested. SPECIFICITY: DIRAS3 antibody is human specific. POSITIVE CONTROL: 1) Cat. No. 1313 - Human Testis Tissue Lysate Predicted: 25 kDa PREDICTED MOLECULAR WEIGHT: Observed: 24 kDa Properties September 26, 2021 1 https://www.prosci-inc.com/diras3-antibody-8139.html PURIFICATION: DIRAS3 antibody is affinity chromatography purified via peptide column. CLONALITY: Polyclonal ISOTYPE: IgG CONJUGATE: Unconjugated PHYSICAL STATE: Liquid BUFFER: DIRAS3 antibody is supplied in PBS containing 0.02% sodium azide. CONCENTRATION: 1 mg/mL DIRAS3 antibody can be stored at 4˚C for three months and -20˚C, stable for up to one STORAGE CONDITIONS: year. Additional Info OFFICIAL SYMBOL: DIRAS3 ALTERNATE NAMES: DIRAS family GTP-binding RAS-like 3, ARHI, NOEY2 ACCESSION NO.: NP_004666 PROTEIN GI NO.: 4757772 GENE ID: 9077 USER NOTE: Optimal dilutions for each application to be determined by the researcher. Background and References DIRAS3 is a member of the ras superfamily, and is expressed in normal ovarian and breast epithelial cells, but not in ovarian and breast cancers. It is an imprinted gene, with mono-allelic expression of the paternal allele, which is associated with growth suppression and down-regulation of cyclin D1 promoter activity and induction of p21 (WAF/CIP1).
    [Show full text]
  • Differential Regulation of Estrogen Receptor Α Expression in Breast
    Author Manuscript Published OnlineFirst on January 10, 2014; DOI: 10.1158/0008-5472.CAN-13-2020 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. CAN-13-2020R Differential Regulation of Estrogen Receptor α Expression in Breast Cancer Cells by Metastasis-Associated Protein 1 Hyun-Jin Kang1, Min-Ho Lee1, Hae-Lim Kang1, Sung-Hae Kim1, Jung-Ranh Ahn1, Hyelin Na1, Tae-Young Na1, Yona Kim2, Je Kyung Seong2, and Mi-Ock Lee1 1College of Pharmacy and Bio-MAX institute, Research Institute of Pharmaceutical Sciences; and 2College of Veterinary Medicine, BK21 Plus Program for Veterinary Science, Seoul National University, Seoul, Korea; Keywords: Estrogen receptor α; MTA1; IFI16; epigenetics, hormone sensitivity Hyun-Jin Kang, Min-Ho Lee, and Hae-Lim Kang contributed equally to this work. Corresponding Authors: Mi-Ock Lee Ph. D., College of Pharmacy, Seoul National University, 1 Gwanak-ro, Gwanak-gu, Seoul 151-742, Korea. Phone: 82-2-880-9331; Fax: 82-2-887-2692; E-mail: [email protected] Downloaded from cancerres.aacrjournals.org on September 29, 2021. © 2014 American Association for Cancer Research. Author Manuscript Published OnlineFirst on January 10, 2014; DOI: 10.1158/0008-5472.CAN-13-2020 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. ABSTRACT Metastasis-associated protein 1 (MTA1) is a component of the nucleosome remodeling and histone deacetylase (HDAC) complex, which plays an important role in progression of breast cancer. Although MTA1 is known as a repressor of the transactivation function of estrogen receptor (ER)α, its involvement in the epigenetic control of transcription of the ERα gene ESR1 has not been studied.
    [Show full text]
  • High-Throughput Bioinformatics Approaches to Understand Gene Expression Regulation in Head and Neck Tumors
    High-throughput bioinformatics approaches to understand gene expression regulation in head and neck tumors by Yanxiao Zhang A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy (Bioinformatics) in The University of Michigan 2016 Doctoral Committee: Associate Professor Maureen A. Sartor, Chair Professor Thomas E. Carey Assistant Professor Hui Jiang Professor Ronald J. Koenig Associate Professor Laura M. Rozek Professor Kerby A. Shedden c Yanxiao Zhang 2016 All Rights Reserved I dedicate this thesis to my family. For their unfailing love, understanding and support. ii ACKNOWLEDGEMENTS I would like to express my gratitude to Dr. Maureen Sartor for her guidance in my research and career development. She is a great mentor. She patiently taught me when I started new in this field, granted me freedom to explore and helped me out when I got lost. Her dedication to work, enthusiasm in teaching, mentoring and communicating science have inspired me to feel the excite- ment of research beyond novel scientific discoveries. I’m also grateful to have an interdisciplinary committee. Their feedback on my research progress and presentation skills is very valuable. In particular, I would like to thank Dr. Thomas Carey and Dr. Laura Rozek for insightful discussions on the biology of head and neck cancers and human papillomavirus, Dr. Ronald Koenig for expert knowledge on thyroid cancers, Dr. Hui Jiang and Dr. Kerby Shedden for feedback on the statistics part of my thesis. I would like to thank all the past and current members of Sartor lab for making the lab such a lovely place to stay and work in.
    [Show full text]
  • Expression Analysis of Genes Located Within the Common Deleted Region
    Leukemia Research 84 (2019) 106175 Contents lists available at ScienceDirect Leukemia Research journal homepage: www.elsevier.com/locate/leukres Research paper Expression analysis of genes located within the common deleted region of del(20q) in patients with myelodysplastic syndromes T ⁎ Masayuki Shiseki , Mayuko Ishii, Michiko Okada, Mari Ohwashi, Yan-Hua Wang, Satoko Osanai, Kentaro Yoshinaga, Naoki Mori, Toshiko Motoji, Junji Tanaka Department of Hematology, Tokyo Women’s Medical University, 8-1 Kawada-cho, Shinjuku-ku, Tokyo, 162-8666, Japan ARTICLE INFO ABSTRACT Keywords: Deletion of the long arm of chromosome 20 (del(20q)) is observed in 5–10% of patients with myelodysplastic Deletion 20q syndromes (MDS). We examined the expression of 28 genes within the common deleted region (CDR) of del Common deleted region (20q), which we previously determined by a CGH array using clinical samples, in 48 MDS patients with (n = 28) Myelodysplastic syndromes or without (n = 20) chromosome 20 abnormalities and control subjects (n = 10). The expression level of 8 of 28 genes was significantly reduced in MDS patients with chromosome 20 abnormalities compared to that of control subjects. In addition, the expression of BCAS4, ADA, and YWHAB genes was significantly reduced in MDS pa- tients without chromosome 20 abnormalities, which suggests that these three genes were commonly involved in the molecular pathogenesis of MDS. To evaluate the clinical significance, we analyzed the impact of the ex- pression level of each gene on overall survival (OS). According to the Cox proportional hazard model, multi- variate analysis indicated that reduced BCAS4 expression was associated with inferior OS, but the difference was not significant (HR, 3.77; 95% CI, 0.995-17.17; P = 0.0509).
    [Show full text]