The Role of Arginine Methylation of Hnrnpul1 in the DNA Damage Response Pathway Gayathri Gurunathan

The role of arginine methylation of hnRNPUL1 in the DNA damage response pathway

Gayathri Gurunathan

Faculty of Medicine

Division of Experimental Medicine

McGill University, Montreal, Quebec, Canada

August 2014

A Thesis Submitted to McGill University in Partial Fulfillment of the Requirements for the Degree of Master of Science

Post-translational modifications play a key role in mediating the DNA damage response

(DDR). It is well-known that serine/threonine phosphorylation is a major post-translational modification required for the amplification of the DDR; however, less is known about the role of other modifications, such as arginine methylation. It is known that arginine methylation of the

DDR protein, MRE11, by protein arginine methyltransferase 1 (PRMT1) is essential for the response, as the absence of methylation of MRE11 in mice leads to hypersensitivity to DNA damage agents. Herein, we identify hnRNPUL1 as a substrate of PRMT1 and the methylation of hnRNPUL1 is required for DNA damage signalling. I show that several RGG/RG sequences of hnRNPUL1 are methylated in vitro by PRMT1. Recombinant glutathione S-transferase (GST) proteins harboring hnRNPUL1 RGRGRG, RGGRGG and a single RGG were efficient in vitro substrates of PRMT1. Moreover, I performed mass spectrometry analysis of Flag-hnRNPUL1 and identified the same sites methylated in vivo. PRMT1-depletion using RNA interference led to the hypomethylation of hnRNPUL1, consistent with PRMT1 being the only enzyme in vivo to methylate these sequences. We replaced the arginines with lysine in hnRNPUL1 (Flag- hnRNPUL1RK) such that this mutant protein cannot be methylated by PRMT1. Indeed Flag- hnRNPUL1RK was undetected using specific dimethylarginine antibodies. Flag-hnRNPUL1RK did not co-immunoprecipitate with PRMT1, as expected, since PRMT1 is known to associate with its substrates. Flag-hnRNPUL1RK had reduced affinity to NBS1, a subunit of the MRE11-

RAD50-NBS1, a DDR complex. Finally, Flag-hnRNPUL1RK had an aberrant localization at

DNA damage breaks using laser microirradiation. Collectively, my findings provide insight into how the arginine methylation of hnRNPUL1 plays a significant role in the DNA damage response. 2

Sommaire

Les modifications post-traductionnelles jouent un rôle fondamental, notamment dans la régulation des mécanismes de réponse aux dommages causés à l’ADN. Il a été démontré que la méthylation des arginines de la protéine MRE11 par l’enzyme protéine-arginine méthyltransférase 1 (PRMT1) est essentiel dans la voie de signalisation des dommages causés à l’ADN. Dans cette étude, nous décrivons l’identification d’un nouveau substrat de l’enzyme

PRMT1 : la protéine hnRNPUL1.

Dans un premier temps, nous avons identifié que la déplétion de l’enzyme PRMT1 induit une hypométhylation de la protéine hnRNPUL1. De plus la protéine hnRNPUL1 contient plusieurs motifs RGG/RG, une séquence consensus méthylée par les PRMTs. Un essai de méthylation in vitro a montré que plusieurs de ces séquences consensus sont méthylées par l’enzyme PRMT1. Une analyse in vivo de la protéine Flag-hnRNPUL1 par spectrométrie de masse a confirmée les sites de méthylation des motif RGG/RG identifiés précédemment in vitro.

Ces résultats furent supportés par la génération d’un mutant Flag-hnRNPUL1RK dépourvue d’arginine dans les séquences RGG/RG méthylées identifiées. En utilisant un anticorps spécifique reconnaissant les arginines diméthylées, nous avons découvert que le mutant Flag- hnRNPUL1RK était hypométhylé. Nous avons également observé que le mutant ne pouvait plus interagir avec PRMT1 par co-immunoprécipitation, contrairement à la protéine non-muté Flag- hnRNPUL1. Ensemble ces résultats démontrent une association physique de la protéine hnRNPUL1 avec PRMT1 requise pour sa méthylation directe par PRMT1 sur les résidus arginines de ces motifs RGG/RG.

Nous avons ensuite découvert que le mutant hypométhylé Flag-hnRNPUL1RK présente une affinité de liaison réduite avec la sous-unité NBS1 du complexe de recrutement MRE11-

RAD50-NBS1(MRN), impliqué dans la réponse aux dommages à l’ADN. En effet, nous avons

été capable de co-immunoprécipiter la sous-unité NBS1 avec la protéine Flag-hnRNPUL1, mais pas avec son mutant Flag-hnRNPUL1RK. Finalement, la localisation de Flag-hnRNPUL1RK est aberrante en présence aux coupures des brins d’ADN. Nous pensons que ce mécanisme est régulé par la méthylation des motifs RGG/RG de hnRNPUL1 par PRMT1.

De façon globale, ces résultats illustrent la façon dont la méthylation des arginines de la protéine hnRNPUL1 par l’enzyme PRMT1 joue un rôle de premier plan au niveau de la réponse aux dommages de l’ADN produite par les coupures doubles brins.

Preface

This Master of Science thesis was written in accordance with the Guidelines for Thesis

Preparation from the Faculty of Graduate Studies and Research of McGill University.

The experiments and studies were conducted under the supervision of Dr.Stéphane

Richard. As well, each contributor who has collaborated in this research is acknowledged in the following section and throughout the remainder of the text.

The mass spectrometry analysis discussed in this thesis was performed by Dr. Éric

Bonneil (Figure 6B). The laser scissor damage experiment discussed in this thesis was performed by Yan Coulombe in Dr. Jean-Yves Masson laboratory (Université de Laval) (Figure

9A).

Acknowledgements

I would first like to extend my sincere gratitude and appreciation to my supervisor, Dr.

Stéphane Richard, for giving me the remarkable opportunity to work on such an interesting project and guiding me every step of the way. His continuous support and encouragement has truly been the propelling force that has motivated and inspired me to learn various technical skills and explore the field without limiting myself, thereby allowing me to grow as a young scientist and pursue my studies at McGill University in an active and dynamic environment.

I would also like to thank the members of my thesis advisory committee, who have provided me with valuable guidance and support while monitoring my progress throughout my studies. Their input and feedback throughout my annual committee meetings have been truly noteworthy and have enabled me to push myself a step higher in pursuing my scientific goals while constantly driving myself forward.

My fellow colleagues (both past and present) in the Richard lab have provided me with immense support, guidance and care, which I am truly grateful for. Whether it is moral support during times of need, experimental expertise when troubleshooting experiments, or simply providing a friendly and exciting atmosphere to work in on a daily basis, I truly appreciate their support. I would like to extend my special thanks and sincere gratitude to Dr. Zhenbao Yu, who has provided me with continuous support in helping me develop the necessary skills required to perform various experiments and for his valuable input in the troubleshooting aspect of my experimental techniques. His guidance and experimental expertise has made a significant contribution to my project and allowed for the completion of my thesis. As well, my utmost gratitude goes out to Palaniraja Thandapani who has been extremely supportive in the 6

stimulation of scientific discussions and in providing moral support. All of my dear lab members have been the constant driving force in improving my research strategies in all aspects and their immense care, generosity and unconditional support has truly allowed me to acquire various skills and values both inside and outside the professional environment which are tools that shall be useful throughout my life. I also like to extend my thanks to the all the students, technicians and post-doctoral fellows who I have met at the Lady Davis Institute throughout my studies, for their insight into my project, moral support and encouragement.

I would like to extend my gratitude to Dr. Éric Bonneil for performing the mass spectrometry analysis which has significantly contributed to my project. As well, the laser scissor damage research provided by Yan Coulombe under the guidance of Dr. Jean-Yves

Masson has been crucial for the completion of my thesis and I would like to sincerely thank them for their valuable contribution to my project.

I would like to acknowledge the Canadian Institutes of Health Canada (CIHR) for providing financial support for the research presented in this thesis.

Last but not least, I would like to thank my parents and brother for being there for me and supporting me throughout my graduate studies and schooling. I am forever grateful for the love and care that they have provided me with. Their continuous support and motivation have always encouraged me to chase my dreams in life.

Table of Contents

ABSTRACT ...... 2

SOMMAIRE ...... 3

PREFACE ...... 5

ACKNOWLEDGEMENTS ...... 6

TABLE OF CONTENTS ...... 8

LIST OF FIGURES AND TABLES ...... 10

LIST OF ABBREVIATIONS ...... 11

INTRODUCTION...... 15

Part I: Arginine Methylation ...... 15

PRMT1 ...... 19

PRMT2 ...... 20

PRMT3 ...... 20

PRMT4 ...... 21

PRMT5 ...... 21

PRMT6 ...... 22

PRMT7 ...... 22

PRMT8 ...... 22

PRMT9 ...... 23

Part II: RNA binding proteins ...... 24

Part III: hnRNPs ...... 26

hnRNP purification ...... 26

Structural architecture of hnRNP family members ...... 27 8

Involvement of hnRNPs in a multitude of pathways ...... 30

Part IV: hnRNP U and hnRNPUL1 ...... 33

Part V: The DNA damage response ...... 37

Genotoxic stress and DNA damage ...... 38

Types of damage and cellular response ...... 39

Signal transduction in the DNA damage response ...... 43

ATM pathway specifics ...... 45

ATR pathway specifics ...... 45

Apoptosis ...... 46

Human disorders and cancer ...... 47

Therapeutic applications and personalized clinical intervention ...... 49

EXPERIMENTAL PROCEDURES ...... 52

RESULTS ...... 58

RGG/RG motifs of hnRNPUL1 are methylated by PRMT1 ...... 58

PRMT1 methylates and associates with hnRNPUL1 in vivo ...... 60

Arginine methylation regulates the hnRNPUL1/NBS1 interaction...... 61

The methylation of the hnRNPUL1 RGG/RG motifs regulates its

recruitment at sites of DNA damage ...... …………………62

DISCUSSION ...... 70

REFERENCES ...... 77

List of Figures and Tables

Figure 1: The three flavours of protein arginine methyltransferases...... 16

Figure 2: The nine members of the protein arginine methyltransferase family ...... 18

Figure 3: Conserved structural domains in the hnRNP family...... 29

Figure 4: Types of damage and repair mechanisms...... 41

Figure 5: The RGG/RG motif of hnRNPUL1 is methylated by PRMT1 in vitro...... 65

Figure 6: hnRNPUL1 harbors methylated arginine residues identified in vivo via mass spectrometry analysis ...... 66

Figure 7: The RGG/RG motif of hnRNPUL1 is methylated by PRMT1 in vivo via a physical association ...... 67

Figure 8: Methylation of hnRNPUL1 is required for its interaction with NBS1 ...... 68

Figure 9: The methylation of the hnRNPUL1 RGG/RG motifs regulates its recruitment at sites of DNA damage ...... 69

Table 1: Methylated arginine residues of hnRNPUL1 identifiedin vivo via mass spectrometry ...... 64

List of Abbreviations

53BP1: p53 binding protein 1 AA: amino acid AdoMet: S-Adenosyl methionine aDMA: asymmetric dimethyl-arginine ATCC: american type culture collection ATM: ataxia telangiectasia mutated ATP: adenosine-5'-triphosphate ATR: ataxia telangiectasia and Rad3 related BBS: BRD-7 binding site BER: Base excision repair BLAST: basic local alignment search tool BLM: Bloom’s syndrome helicase BRCA1: breast cancer 1 BRCT: BRCA1 C-terminus BRD7: bromodomain-Containing Protein 7

CARM1: coactivator-associated arginine methyltransferase 1 CBP: nuclear cap-binding protein CDC25A: cell division cycle 25 homolog A CDK: cyclin-dependent kinases cDNA: complementary DNA CHK1: checkpoint kinase 1 CHK2: checkpoint kinase 2 Co-IP: co-immunoprecipitation CRB2: crumbs homolog 2 CSK: cytoskeleton striping buffer

CtIP: CtBP-interacting protein DAPI: 4',6-diamidino-2-phenylindole DMEM: Dulbecco's Modified Eagle's Medium DNA: deoxyribonucleic acid DNA-PK: DNA-dependent protein kinase DSB: double-strand break E1B-AP5: adenoviral early region 1B-associated protein 5

G0 phase: quiescent state, in cell cycle context

G1 phase: cell cycle state between mitosis and DNA replication

G1/S: cell cycle state boundary between G1 phase and S phase

G2 phase: cell cycle state between DNA replication and mitosis

G2/M: cell cycle state boundary between G2 phase and M phase GAR: glycine and arginine rich region GFP: green fluorescent protein GST: glutathione-S-transferase H2A: histone H2A H2AX: H2A histone family, member X H2B: histone H2B H3: histone H3 H3K4: H3 lysine 4 H4: histone H4 hnRNP: heterogeneous nuclear ribonucleoproteins hnRNPUL1: heterogeneous nuclear ribonucleoprotein U-like 1 HR: homologous recombination IgG: immunoglobulin G IFN: interferon receptor IP: immunoprecipitation 12

IPTG: isopropyl β-D-1-thiogalactopyranoside IR: ionizing radiation IRES: internal ribosomal entry site IRIF: ionizing radiation induced foci KO: knockout LncRNA: long non coding RNA M phase: mitosis state in cell cycle MEF: mouse embryonic fibroblasts MMA: monomethyl arginine MMR: mismatch repair MDC1: mediator of DNA damage checkpoint 1 MRE11: meiotic recombination 11 MRN: Mre11-Rad50-Nbs1 NBS1: nibrin NCBI: national center for biotechnology information NER: nucleotide excision repair NHEJ: non-homologous end joining p53: tumor protein 53 PBS: phosphate buffered saline PCR: polymerase chain reaction PCNA: proliferating cell nuclear antigen PDB: protein data bank PML: promyelocytic leukemia PP: proline rich region PRMT: protein arginine methyltransferase PST: proline-serine-threonine rich PTM: post-translational modification 13

RAD50:DNA repair protein RAD50 RAD51: DNA repair protein RAD51 homolog 1 RAD54:DNA repair and recombination protein RAD54-like RBP: RNA binding protein RCSB: research collaboratory for structural bioinformatics RGG/RG: arginine glycine rich region RNA: ribonucleic acid ROS: reactive oxygen species S phase: DNA synthesis state in cell cycle SAF-A: scaffold attachment factor A S/TQ: serine or threonine followed by glutamine site SAM: S-adenosyl methionine SAM68: Src-associated in mitosis 68 kDa protein SAP: SAF-A/B Acinus and PIAS motif sDMA: symmetric dimethyl-arginine SDS: sodium dodecyl sulfate SDS-PAGE: SDS- polyacrylamide gel electrophoresis SH3: SRC homology 3 siRNA: short interfering RNA

SPRY: SPIa/Ryanodine receptor domain ssDNA: single-stranded DNA ORF: open reading frame UTR: untranslated region XRCC4: X-ray repair complementing defective repair in chinese hamster cells 4 γH2AX: phosphorylated H2AX

Introduction

Part I: Arginine Methylation The first evidence of arginine methylation dates back to 1964 when the Allfrey et al., group demonstrated the structural modifications of histones via the addition of either acetyl or methyl groups (Allfrey, Faulkner et al. 1964). Moreover, these two modifications (i.e. acetylation and methylation) have been shown to take place post-translationally upon completion of the polypeptide chain of proteins (Allfrey, Faulkner et al. 1964). Arginine is a positively charged amino acid that is unique in its nature as it has hydrogen bonding potential: its guanidino group has five potential hydrogen bond donors that are favorably positioned to mediate interactions with biological hydrogen bond acceptors (Bedford and Clarke 2009). It has also been demonstrated to engage in amino aromatic interactions with nucleic acids and proteins. Arginine methylation is a common post-translational modification (PTM) that takes place in eukaryotic cells, such that the arginine residues may be modified to contain methyl groups (Gary and Clarke

1998). This variation may occur in three flavours, specifically ω-NG-monomethylarginine

(MMA), ω-NG, NG-asymmetric dimethylarginine (ADMA) andω-NG’, NG-symmetric dimethylarginine (SDMA) where S-adenosylmethionine (SAM) is used as the methyl group donor (Bedford and Clarke 2009) (Atkinson and Murray 1967) (Figure 1). Furthermore, due to the addition of the methyl groups onto the arginine residues, there are numerous implications with respect to protein-protein interactions, both in a positive and negative manner, among others. The bulkiness of the arginine residue increases causing greater steric hindrance leading to decreased hydrogen bonding potential which places an increasing hydrophobic property to a protein. Nevertheless, the positive charge of the arginine residue does not change.

Figure 1.The three flavours of protein arginine methyltransferases -Adapted from (Yang and Bedford 2013)

This covalent post-translational modification is catalyzed by a family of intracellular enzymes known as the protein arginine methyltransferases (PRMTs). The PRMTs are a family consisting of nine members which have a highly conserved methyltransferase catalytic domain which is known to oligomerize into a ring-like structure (Weiss, McBride et al. 2000) (Zhang and Cheng

2003) (Figure 2). Furthermore, the PRMTs may be classified into three categories; namely, type

I, type II or type III. Type I enzymes are known to catalyze the addition of two methyl groups to the same terminal nitrogen of the arginine residue in order to generate ADMA and MMA

(Bedford 2007). PRMT1, PRMT3, PRMT4 (also known as CARM1), PRMT6 and PRMT8 fall into this category. PRMT2 has been recently shown to have Type I arginine methyltransferase activity, however, little is known about its respective substrate repertoire (Lakowski and Frankel

2009). Meanwhile, type II enzymes catalyze the formation of SDMA and MMA via the addition of the second methyl group to the other terminal nitrogen of the arginine residue. PRMT5 and

PRMT9 classify in this listing (Bedford 2007). Finally, type III PRMTs generate exclusively

MMAs and to date only PRMT7 has been established as a member of this category (Zurita-

Lopez, Sandberg et al. 2012).

Figure 2. The nine members of the protein arginine methyltransferases family -Adapted from (Nicholson, Chen et al. 2009, Yang and Bedford 2013)

PRMT1

Protein arginine methyltransferase 1 is the major arginine methyltransferase that is responsible for catalyzing the formation of 85% of total arginine residues methylated in the mammalian cell

(Tang, Kao et al. 2000). Moreover, it is principally a nuclear protein that exhibits a preference for the methylation of RGG/RG motifs of RNA binding proteins in addition to other proteins

(Tang, Kao et al. 2000) (Boisvert, Dery et al. 2005). It falls under the type I category of arginine methylation flavours such that it catalyzes the formation of ω-monomethylarginine as an intermediate and asymmetric ω-NG, NG-dimethylarginine as the product. In various tissues,

PRMT1 has been shown to have varying catalytic activities as well as distinct substrate specificity since the PRMT1 gene has 12 coding exons which allows for the generation of 7 different isoforms via splicing (Goulet, Gauvin et al. 2007).

It has been demonstrated that PRMT1 is essential for early development via a conditional null allele of PRMT1 in mouse models; a PRMT1 null embryo has been shown to be lethal and die at embryonic day 6.5 (Yu, Chen et al. 2009) (Pawlak, Scherer et al. 2000). In addition, it was observed that a conditional knockout of PRMT1 in mouse embryonic fibroblasts (MEFs) causes spontaneous DNA damage, checkpoint activation defects, cell cycle progression defects, among others. This further suggests a significant role for PRMT1 in the DNA damage response pathway

(Yu, Chen et al. 2009). Cell cycle defects include a reduced intra- S phase, numerous chromosomal translocations, and an elevated hypersensitivity to chemically induced DNA damage (Yu, Chen et al. 2009). The deregulation of PRMT1, whether it be overexpressed or aberrantly spliced, leads to numerous types of pathologies of several diseases, mainly cancers including breast, prostate, lung, colon, bladder cancer as well as leukemia (Goulet, Gauvin et al.

2007) (Seligson, Horvath et al. 2005, Le Romancer, Treilleux et al. 2008) (Cheung, Wan et al.

2007, Shia, Okumura et al. 2012) (Yoshimatsu, Toyokawa et al. 2011) (Guendel, Carpio et al.

2010, Butler, Gore et al. 2011) (Mathioudaki, Scorilas et al. 2011, Tzifi, Economopoulou et al.

2012) (Zou and Elledge 2003).

PRMT2

PRMT2 was initially identified via sequence homology to the rat protein arginine methyltransferase PRMT1 gene (Katsanis, Yaspo et al. 1997). It has a Src homology 3 (SH3) binding domain, which is associated with many processes (Baldwin, Morettin et al. 2014). In particular, it has been shown to interact with hnRNPUL1, also known as the adenovirus early protein E1B-55 kDa (Kzhyshkowska, Schutt et al. 2001). The substrate repertoire of PRMT2 has not been fully elucidated as any methyltransferase activity has yet to be detected (Baldwin,

Morettin et al. 2014). Numerous alternatively spliced isoforms of PRMT2 have been identified

(Baldwin, Morettin et al. 2014). Also, PRMT2 has been shown to interact with a variety of proteins including RARα, PPAR-γ, estrogen receptor α, among others (Qi, Chang et al. 2002).

PRMT3

Yeast two hybrid analysis was performed to identify PRMT3 as a rat PRMT1 interacting protein.

Although they vary in their subcellular localizations, PRMT3 shares sequence similarity with

PRMT1 and is predominantly cytoplasmic. It is known to have type I arginine methyltransferase activity (Tang, Gary et al. 1998). The crystal structure of PRMT3 has been reported and is established as having an Ado-Met domain as well as a barrel-like domain (Zhang, Zhou et al.

2000). The cone-shaped active site is localized between the two domains (Zhang, Zhou et al.

2000).

PRMT4/CARM1

PRMT4 is also known as a Co-activator-associated arginine methyltransferase 1 (CARM1) and it was first identified as an interacting protein to GRIP1, which is the p160 steroid receptor coactivator (Chen, Huang et al. 2000). It has type I arginine methyltransferase activity and is involved in a multitude of cellular processes including RNA metabolism such as transcription and pre-mRNA processing, as well as a role in the DNA damage response pathway (Baldwin,

Morettin et al. 2014). Unlike other methyltransferases in the type I category, PRMT4 has a preference for PGM methylation motifs in substrates (Baldwin, Morettin et al. 2014). PRMT4 functions as a transcriptional coactivator by binding to p160 including estrogen responsive genes

(Chen, Huang et al. 2000) (Teyssier, Chen et al. 2002).

PRMT5

PRMT5 has type II arginine methyltransferase activity and is the predominant type II methyltransferase in mammals (Pawlak, Scherer et al. 2000). PRMT5 is mainly compartmentalized in the cytoplasm and is in a complex with MEP50 and pICln involved in snRNP biogenesis (Friesen, Massenet et al. 2001) (Krapivinsky, Pu et al. 1998). PRMT5 has been shown to interact with a wide repertoire of proteins and complexes including Rad9a, FEN1, and p53 (Jansson, Durant et al. 2008) (Guo, Zheng et al. 2010) (He, Shi et al. 2011). Moreover,

PRMT5 KO mice demonstrate lethality between 3.5 and 6.5 embryonic days (Tee, Pardo et al.

2010).

PRMT6

PRMT6 was identified on chromosome 1 of the human genome as a novel methyltransferase displaying unique functionality compared to its other type I enzyme family members, in that it exhibited automethylation activity (Frankel, Yadav et al. 2002). It was the first PRMT to demonstrate such activity and it was shown to be uniquely compartmentalized in the cell nucleus as identified during its association with the green fluorescent protein (GFP) marker (Frankel,

Yadav et al. 2002).

PRMT7

PRMT7 was initially identified from a genetic suppressor elements screen in Chinese hamster cells, where PRMT7 was presented as a gene encoding two proteins, namely, p77 and p82, which was later renamed PRMT7α and β due to significant sequence homology with the PRMT enzymes family (Gros, Delaporte et al. 2003). A role for PRMT7 in drug resistance has been reported(Zheng, Schmidt-Ott et al. 2005). Although PRMT7 was initially classified as a type II protein arginine methyltransferase, recent findings show PRMT7 is a type III enzyme due to the generation of a monomethyl arginine, which is deemed to be an intermediate during the methylation reactions (Zurita-Lopez, Sandberg et al. 2012).

PRMT8

PRMT8 has a particular tissue specificity in that it is anchored to the plasma membrane in the brain and has two automethylation sites as well as a myristoylation site that are localized in the

N-terminus (Lee, Sayegh et al. 2005) (Dillon, Rust et al. 2013). Although the complete mechanism of PRMT8, as well as its substrate repertoire are not fully established, a role for the

N-terminus of PRMT8 in its automethylation activity by reducing its binding affinity for

AdoMet has been reported (Dillon, Rust et al. 2013).

PRMT9

This protein arginine methyltransferase has not fully been characterized as of yet (Yang and

Bedford 2013). Nevertheless, being identified at the same time as PRMT8, its structural architecture is similar to that of PRMT7, since it has Ado-Met binding motifs. In addition, it contains two tetratricopeptide repeats (Lee, Sayegh et al. 2005) (Yang and Bedford 2013).

PRMTs are known to have a preference for methylation of proteins that harbor a glycine arginine rich (RGG/RG) motif (Najbauer, Johnson et al. 1993). Nevertheless, certain protein arginine methyltransferases such as PRMT4 (CARM1) have substrate specificity in that they do not methylate at glycine-arginine rich regions (Lee and Bedford 2002) Instead, PRMT4 prefers methylation at proline-glycine and methionine rich sites (Chen, Huang et al. 2000).

There are numerous substrates of PRMT1 in the cell, of which, histones consist of a major portion. Histone 4 at arginine 3 has been shown to be dimethylated by PRMT1 and this has numerous implications in chromatin structure and function (Strahl, Briggs et al. 2001) (Wang,

Huang et al. 2001). Moreover, other substrates of PRMT1 include RNA binding proteins, transcription factors, and DNA damage proteins (Boisvert, Dery et al. 2005).

Many players that are involved in the DNA damage response pathway have been shown to be methylated by PRMT1 which include the following: 53BP1, MRE11 and BRCA1 (Boisvert,

Hendzel et al. 2005, Boisvert, Rhie et al. 2005) (Guendel, Carpio et al. 2010). Furthermore, one such example of the importance of arginine methylation is regulation of MRE11 in the DNA

damage response pathway. The RGG/RG motif of MRE11 is methylated by PRMT1 both in vitro as well as in vivo (Boisvert, Hendzel et al. 2005). Arginine methylation of MRE11 is essential for both its location to DNA damage foci as well as its exonuclease activity (Boisvert,

Dery et al. 2005).

Part II: RNA binding proteins

RNA binding proteins (RBPs) are involved in numerous aspects of RNA metabolism whether it be to ensure the proper and effective processing, folding, stabilization and localization of RNA, as well as correct mRNA translation (Lukong, Chang et al. 2008). Numerous RBPs contain RGG/RG motifs making them good candidate substrates for arginine methylation.

More recently, a prominent role for RBPs in the DNA damage response in both RNA and DNA metabolism has been reported (Dutertre, Lambert et al. 2014). RBPs regulate post-transcriptional gene expression in a variety of ways such as binding to RNA sequences, regulatory long noncoding RNAs (ncRNAs), and secondary structures in pre-mRNAs (Glisovic, Bachorik et al.

2008) (Lunde, Moore et al. 2007). Furthermore, upon DNA damage, there is a global decrease in gene expression due to transcriptional inhibition via introduction of premature stop codons resulting in nonsense mediated mRNA decay (Dutertre, Lambert et al. 2014).

RBPs have been shown to be vital mediators in the prevention of genomic instability by inhibiting the formation of RNA and DNA hybrids, also known as R-loops. These loops, which are prompted by G-rich DNA repeats, are a threat to genomic stability when in contact with replication forks (Aguilera and Garcia-Muse 2012). Moreover, the mechanism by which the R- loop formation is bypassed involves packaging of pre-mRNA in the earlier stages in order to

prevent unprocessed transcripts from binding to the DNA template (Dutertre, Lambert et al.

2014).

In addition, a role for RBPs in localizing to the sites of DNA damage, as well as associating with other DNA repair factors and proteins has been observed (Dutertre, Lambert et al. 2014). One such RBP which binds to mismatched DNA and engages in the DNA mismatch repair machinery is YB-1. (Kim, Paek et al. 2003, Gaudreault, Guay et al. 2004, Bergmann, Royer-Pokora et al.

2005). YB-1 has been reported to participate in endonuclease activity and strand separation in vitro (Gaudreault, Guay et al. 2004) (Kim, Paek et al. 2003, Bergmann, Royer-Pokora et al.

2005).

A variety of enzymatic activities have been attributed to RBPs involved in the DNA damage response pathway. Many of the RBPs undergo extensive post-translational modifications including phosphorylation, ADP-ribosylation, acetylation, ubiquitination, and sumoylation

(Dutertre, Lambert et al. 2014). Such modifications are vital for effective signalling and cascade action to take place, such that the appropriate DNA damage repair response is propagated. Major

DNA damage molecular sensors such as ATR kinase and ATM kinase are examples of complexes which post-translationally modify the RBPs in order to elicit a choreographed DNA repair response.

Stress responses often trigger the relocalization of numerous RBPs which also includes the process of nuclear-cytoplasmic shuttling (Cammas, Lewis et al. 2008). This subnuclear localization enables RBPs to take part in numerous aspects of cellular processes, thereby, increasing efficiency and likelihood of proper cell functioning. An example of such a scenario is the relocalization of the splicing factor Sam68 (Src-associated in mitosis) to nuclear stress 25

granules upon DNA damage (Busa, Geremia et al. 2010). In addition, a highly coordinated and intricate network is enabled upon effective RBPs redistribution in the cell post DNA damage; thereby, facilitating mRNA stability. Numerous changes in alternative splicing patterns take place upon RBP relocalization and redistribution in the cell (Cammas, Lewis et al. 2008).

Part III: hnRNPs

A growing importance for hnRNPs in numerous biological events has emerged such that gene regulation is a key and prominent cellular event among them (Piccolo, Corona et al. 2014). hnRNP proteins are a group of multifunctional nuclear-cytoplasmic shuttling and highly conserved family of RBPs. They play a variety of roles in a multitude of regulatory pathways including transcription and translation regulation, telomere elongation, chromatin remodeling, and DNA repair, among others (Carpenter, MacKay et al. 2006). hnRNP proteins have conserved structural domains and the individual members of this family have the potential to elicit tumor progression through their involvement in mechanisms that cause cell attack and apoptosis prevention (Carpenter, MacKay et al. 2006).

Furthermore, hnRNPs and their respective cellular activities take place both in the nuclear and cytoplasmic compartments; that is, processes such as pre-mRNA processing and transcription which are initiated in the cell nucleus and shift location upon completion to the cytoplasm, in order to take part in mRNA translation and turnover (Krecic and Swanson 1999). hnRNP purification

Some of the earliest studies had established an effective purification method for the hnRNPs

(Pinol-Roma, Choi et al. 1988). These hnRNP complexes/particles are a combination of

heterogeneous nuclear RNAs (hnRNAs) which are associated with other proteins in the cell in order to form hnRNP complexes (Dreyfuss 1986). An efficient immunoprecipitation method allowed for the purification of hnRNP particles using monoclonal antibodies to hnRNPs (Pinol-

Roma, Choi et al. 1988). In order to categorize and name the various components of the hnRNP, affinity chromatography and two dimensional gel electrophoresis permitted for the effective visualization of the various polypeptides and their corresponding molecular weights i.e. 34,000 to 120,000 daltons (Pinol-Roma, Choi et al. 1988). The approximate 30 spots identified on the two dimensional gel allowed for the naming of the many members of the hnRNP family from hnRNP A1 to U. Finally, the interaction between proteins and the associated RNA was visualized using a covalent cross-linking method in the presence of UV light (Dreyfuss 1986).

Structural architecture of hnRNP family members

Extensive studies have established a significant role for hnRNPs in a multitude of regulatory pathways in the cell, whether it be DNA regulation, RNA regulation, or many others (Carpenter,

MacKay et al. 2006). Alternative splicing patterns enable the generation of numerous isoforms of hnRNPs. There is a conservation of numerous structural domains amongst all the members of the hnRNP family as depicted below (Carpenter, MacKay et al. 2006) (Figure 3). Namely, the RNA binding domain (also coined the RNA recognition motif), which is located at the N-terminus, allows for the recognition and binding of DNA or RNA (Dreyfuss 1986). Other common structural elements that are found in many hnRNP family members include the RGG/RG motif as well as KH domains. Furthermore, the RGG/RG motifs span 25 amino acid sequences at a time, with conserved Arg-Gly-Gly tripeptide repeats and play a role in protein-protein interactions, RNA binding, and transcriptional regulation (Dreyfuss 1986). In terms of the KH

domain, it is ~50 amino acids in length with stretches of octapeptide repeats of Ile-Gly-X2-Gly-

X2-Ile where X can be any amino acid (Iwanaga, Sueoka et al. 2005). Moreover, this KH domain was first reported in hnRNP K, where it was shown to play a role in RNA binding.

Figure 3- Conserved structural domains in the hnRNP family -Adapted from (Carpenter et al., 2005)

Involvement of hnRNPs in a multitude of pathways

As mentioned previously, many roles for hnRNPs in numerous pathways have been reported. For example, hnRNPs have been shown to play a role in DNA regulation such that many hnRNPs participate in the DNA repair pathways in response to cellular damage and stress. Certain co- localization experiments demonstrated the interaction between hnRNPs and DNA repair factors; one such example being hnRNP B1 and DNA-PK (Iwanaga, Sueoka et al. 2005). As well, a role for hnRNPs in telomere regulation and biogenesis has been reported. The mechanism involves hnRNPs in the recruitment of telomerases to telomeric ends of chromosomes (Ford, Wright et al.

2002)

Gene regulation needs to be tightly monitored and catered to appropriate cellular conditions in order to propagate the most efficient signalling cascade whether it is during normal cellular conditions or during stressful periods such as oncogenesis. Thus, there is a need for chromatin remodeling and transcription. This being said, a role for hnRNPs during this process has been reported. In this context, hnRNP U was reported to be involved in a direct binding interaction with chromosomal DNA in vivo (Goehring and Morabia 1997). hnRNPs are involved in numerous aspects of RNA metabolism as well. Firstly, in mRNA turnover, nascent pre-mRNA requires 3`end processing and polyadenylation (Proudfoot and

O'Sullivan 2002). Effective cleavage of pre-mRNA is enhanced via hnRNPs, namely hnRNP H`, such that cleavage stimulation factors (CstF) are recruited to the sites on the pre-mRNA in order to mediate this process efficiently and ensure generation of mature mRNA (Bagga, Arhin et al.

1998). In such a way, many other members of the hnRNP family contribute to mRNA biogenesis, whether it is positive or negative regulation. 30

Numerous hnRNPs have been reported to bind the internal ribosomal entry site (IRES) which allows for the effective recruitment of the ribosome to the mRNAs; thereby, regulating the translation of the mRNA into proteins (Kim, Paek et al. 2003). An example of this includes the binding of hnRNP C to the IRES of the c-myc mRNA, such that the translation of the c-myc mRNA is upregulated (Kim, Paek et al. 2003). The importance of this binding interaction between hnRNP C within the IRES may be highlighted as a c-myc mutant mRNA which did not contain the hnRNP C binding site demonstrated a decrease in the translation of the c-myc mRNA to protein compared to the wildtype mRNA (Kim, Paek et al. 2003). hnRNPs can regulate apoptosis either positively or negatively depending on their interaction partners. Bcl-x is a protein that belongs to the apoptotic pathway and two isoforms may be obtained via pre-mRNA alternative splicing. The two forms, Bcl-xS and Bcl-xL are a promoter and inhibitor of apoptosis, respectively. This being said, hnRNP F and hnRNP H mediate the selection of the isoforms via binding to the exonic regions (Garneau, Revil et al. 2005).

Furthermore, one feature of cancer cells is metastasis which requires the regulation of the spreading initiation centre (de Hoog, Foster et al. 2004). The destruction of focal adhesion complexes enables the cancer cells to detach from the basal membrane and relocalize itself to other parts of the body. It has been reported that hnRNPs play a role in this process in that certain hnRNPs, (hnRNP P2, hnRNP K, and hnRNP E1) were found in the spreading initiation centres

(de Hoog, Foster et al. 2004). Interestingly, the alteration with any of these hnRNPs triggered an increase in metastasis. Another aspect of cancer progression includes the process of angiogenesis whereby tumor growth is dependent on their own blood source. Factors involved in this process include fibroblast growth factor (FGF), vascular endothelial growth factor (VEGF), among

others and these have been shown to be regulated by members of the hnRNP family; primarily hnRNP L (Nyberg, Xie et al. 2005) (Shih and Claffey 1999).

Various types of cancers express different members of the hnRNP family. The expression of hnRNP I and hnRNP C1/C2 is increased in brain and lung cancers, respectively (Carpenter,

MacKay et al. 2006). A role for hnRNPs in tumor development and progression has also been reported. Upon literature analysis via databases, it was found that the hnRNP promoter regions; namely, those of hnRNP A1, A2, D, F, H, H’ and K, all contained an upstream binding element for oncogenes (Carpenter, MacKay et al. 2006). Such binding elements included E2F AP1, c- myc, and acute myeloid leukemia (AML). Thus, this phenomenon further suggests that hnRNPs are regulated by oncogenes (Carpenter, MacKay et al. 2006). In the instance of cellular proliferation which is a prominent feature in cancer cells, members of the hnRNP family including hnRNP A1 and hnRNP A2/B1 have their expression regulated throughout the various stages during cell-cycle transitioning in Colo 16 squamous carcinoma cells and HaCaT immortalized keratinocytes (He, Brown et al. 2005). The proliferation rate in these cells was drastically diminished upon hnRNP A1 and A2 reduction via siRNA targeting, suggesting these genes have oncogenic potential (He, Brown et al. 2005). Another member of the hnRNP family has been classified as a tumor suppressor, namely, hnRNP E4. Studies have demonstrated that expression levels of hnRNP E4 are upregulated upon DNA damage in a p53-dependent manner

(Zhu, Zhang et al. 2000).

Previous studies have demonstrated that the majority of NG,NG-dimethylarginine found in mammalian cells, approximately 65%, is enclosed by hnRNPs (Kzhyshkowska, Schutt et al.

2001).

Part IV: hnRNP U and hnRNPUL1

hnRNPUL1 is known as heterogeneous nuclear ribonucleoprotein U-like protein and belongs to the hnRNP family. It contains significant sequence homology with hnRNP U, which is also identified as scaffold attachment factor A (SAF-A) (Bode, Goetze et al. 2003). hnRNP U has also been previously demonstrated to be an inhibitor of RNA polymerase II elongation (Kim,

Paek et al. 2003). hnRNPUL1 was first identified as adenoviral early region 1B-associated protein 5 (E1B-AP5) since it was known to associate with the adenovirus early protein E1B-55kDa (Ad5EE1B55K) during lytic infection (Gabler, Schutt et al. 1998). Viral growth and propagation depends on the accumulation of viral mRNA in the cytoplasm. This recruitment of mRNA relies on the binding interaction between E1B-55 kDa protein and hnRNPUL1 (Gabler, Schutt et al.

1998).hnRNPUL1 has been reported to act on both viral and cellular promoters, with overexpression causing adenoviral mRNA export while host cell mRNA shuffling is shut down in lytically infected cells (Gabler, Schutt et al. 1998). Alongside this previously mentioned role, hnRNPUL1 has been suggested to act as a cofactor when it functions as a regulator of gene expression. hnRNP U (SAF-A) is known to be multi-functionally involved in both DNA and RNA binding with a specific affinity for scaffold associated DNA regions which are known to be sequestered with A-T amino acids (Xiao, Tang et al. 2012) (Ahn and Whitby 2003). In addition, hnRNP U is a key structural component involved in chromatin modeling and organization and has been shown to be methylated by PRMT1 in its RGG/RG motif; a particular site of interest spanning amino acids 778 to 793, where there are four RG rich sites (Herrmann, Bossert et al. 2004). 33

Moreover, hnRNP U is ubiquitously methylated and this may be seen as constitutive because the unmethylated form of hnRNP U is rapidly degraded post translation. Methylated proteins in cells may be recycled and reused in order to maintain a constant pool of resources for the newly synthesized gene products during various developmental and cellular processes (Herrmann,

Bossert et al. 2004). hnRNP U has been shown to be a basic transcriptional inhibitor (Kzhyshkowska, Rusch et al.

2003). Studies demonstrated roles in regulating transcription of hormone receptors such as the glucocorticoid receptor (GR), which is stimulated via ligand binding (Eggert, Michel et al.

1997). The inhibition of transcriptional activation may be seen when hnRNP U physically interacts with the glucocorticoid receptor. Overexpression experiments of hnRNP U hinders the transcription and may function to sequester and store intranuclear glucocorticoid receptors

(Eggert, Michel et al. 1997).

As well, another protein that was shown to co-localize with hnRNPUL1 and physically associate is the bromodomain (BD)-containing protein, BRD7 (Kzhyshkowska, Rusch et al. 2003). It has been demonstrated that the interaction between BRD7 and hnRNPUL1 is essential in order for hnRNPUL1 to maintain its characteristic as a transcriptional activator. Deletion of the region where BRD7 binds to hnRNPUL1 changes hnRNPUL1 from an activator to a strong transcriptional repressor of GR-responsive promoters. Removing the RGG region of hnRNPUL1 results in modification of its repression activity, but it was shown that the N-terminal of hnRNPUL1 was responsible for this repression. In addition, hnRNPUL1 has been shown to interact with the TAP protein on its N-terminus, which allows for the regulation of RNA nuclear export substrates and its nuclear pore complexes (Kzhyshkowska, Rusch et al. 2003).

An adenovirus’ replication cycle may be divided into two stages based on viral DNA replication; namely, early and late phase. During the early stage of adenovirus replication, viral DNA replication takes place while, the late stage of replication is marked by cellular protein synthesis shutdown since the host cell mRNAs have been inhibited (Schenk, Lieberburg et al. 1996). The late phase of the adenovirus infection may be characterized by the favored production of viral proteins resulting in changes to gene expression profiles in terms of mRNA transport as well as protein biogenesis (Dobner and Kzhyshkowska 2001).

Previous studies demonstrated that the methylation of hnRNPUL1 changes during the later phase of the adenovirus lytic infection. In particular, a late adenoviral product, L4-100 kDa gets methylated by PRMT1 (Kzhyshkowska, Kremmer et al. 2004). An in vitro methylation assay confirmed the methylation of this late viral product, which is 100 kDa in molecular weight.

Many functions have been attributed to this product such as RNA binding as well as assistance in increasing the translation efficiency of the late viral transcripts (Hayes, Telling et al. 1990,

Andrade, Bull et al. 2001). Various kinds of cells generate unique methylation profiles for L4-

100 kDa during lytic infection. Nevertheless, the enzymatic activity of numerous enzymes of the protein arginine methyltransferase family play a role as all methylation profiles generated throughout adenoviral lytic infections are not generated by just a singular enzyme

(Kzhyshkowska, Kremmer et al. 2004).

PARP1 is a protein that has a key role in the maintenance of genomic stability (Hong, Jiang et al.

2013). Once DSBs arise, PARP1 in addition many protein kinases such as ATM and ATR, bind to the double stranded breaks and mediate the signal cascade to effectively repair the damaged

DNA. PARP1 has also been shown to associate with the MRE11 subunit of the MRN molecular

sensor complex in order to get recruited to the DNA damage sites (Haince, McDonald et al.

2008). PARP1 poly(ADP-ribosyl)ates itself and other proteins to contribute to the DNA damage response (Schreiber, Dantzer et al. 2006) (Jagtap and Szabo 2005). hnRNPUL1 is one among the many proteins to which PARP1 binds and recruits to the DNA damage sites via poly(ADP- ribosyl)ation. It was shown that upon hnRNPUL1 depletion, PARP1 expression levels were lessened suggesting a role for hnRNPUL1 in PARP1 expression (Hong, Jiang et al. 2013). A newer role for hnRNPUL1 was identified as a regulator of the ATR pathways during lytic adenoviral infection, in that, hnRNPUL1 plays a role at the viral replication centres (Blackford,

Bruton et al. 2008). hnRNPUL1 has also shown to co-localize with ATRIP, which is an ATR- interacting protein as well as RPA 32, which is an ATR substrate replication protein A 32. hnRNPUL1 has been shown to play a role in cancer progression such that it was reported to interact with the tumor suppressor p53 and have an inhibitory effect on its transcription (Barral,

Rusch et al. 2005). hnRNPUL1 contains a SAP domain which is known as the DNA/RNA binding domain and is involved in higher order chromosomal organization. It also has a SPRY domain which is implicated in various protein-protein interactions. Its other domains include BBS, which are the

BRD7 binding site, RGG/RG domain as well as some lower complexity regions.

Initial findings have shown that hnRNPUL1 is methylated in its RGG rich box, located in the C- terminal part of the protein, via PRMT1 in vitro, which is responsible for regulating protein-

RNA interactions (Kzhyshkowska, Schutt et al. 2001). These methylation sites have yet to be mapped, however, PRMT1 was not responsible for the methylation of hnRNPUL1 in vivo.

Further experiments demonstrated that hnRNPUL1 and PRMT2 occurs interacted in vivo in 36

order to methylate hnRNPUL1 in its RGG box domain (Kzhyshkowska, Schutt et al. 2001). This was seen via a yeast-two hybrid system where the interaction between hnRNPUL1 and PRMT2 was occurring through hnRNPUL1’s SH3 domain. The SH3 domain has been shown to be a significant player in modulating the stability of PRMT2. hnRNPUL1 also contains a proline-rich sequence right after the RGG motif. This stretch of proline amino acids have been known to be involved in protein-protein interactions (Kzhyshkowska, Schutt et al. 2001).

A role for hnRNPUL1 in the DNA damage pathway has been identified (Polo, Blackford et al.

2012). It was shown to be required for double strand break resection and ATR signalling. It was proposed that there are two pools of hnRNPUL1 in the cell, such that one pool is involved in

RNA metabolism while the other participates in DSB pair (Polo, Blackford et al. 2012). The

MRN complex was seen as a key player in this process as the localization of hnRNPUL1 to sites of DSBs required the presence of MRN complex. Furthermore, depletion of hnRNPUL1 displayed defective ATR signalling and recruitment of ATRIP to the damage sites, while ATM signalling remained unchanged. There was a deficiency in RPA accumulation as well as ssDNA formation in the hnRNPUL1-depleted cells. Further experiments demonstrated that hnRNPUL1 proteins function in a pathway that is downstream of MRN and CtIP, however, upstream of BLM such that hnRNPUL1 proteins promote the DSB resection by regulating BLM recruitment. The

RGG motif of hnRNPUL1 is essential for its mobilization to and from the sites of DNA damage, in a MRN dependent and RNA independent manner (Polo, Blackford et al. 2012).

Part V: The DNA damage response

The ultimate objective of propelling life forward relies on the successful transmission of accurate and intact genetic material to progeny cells from one generation to the next 37

(Kerzendorfer and O’Driscoll 2009). Thus, in order to ensure organisms’ survival and fitness in the next generation, a faithful surveillance of the genetic information must be maintained. Many endogenous and exogenous agents place genotoxic stress on DNA such that genomic integrity is constantly challenged (Jackson and Bartek 2009). Therefore, precision and accuracy in DNA duplication, chromosome distribution as well as responding to DNA damage issues are of main concern. Genetic control of cell-cycle transitions along with the evolution of cellular systems that monitor DNA damage have allowed for normal human development in hope of maximizing genomic fidelity while minimizing the propagation of heritable mutations to daughter cells

(Jackson and Bartek 2009). Pioneering work has established that the DNA damage response

(DDR) pathway is a multifaceted and intermeshed network which consists of DNA damage detection, signal initiation and activation of DNA repair mechanisms (Harper and Elledge 2007).

Failure to repair defective DNA and bypass of cellular senescence may result in a transmission of damaged DNA and lethal mutations to progeny. Genomic instability increases the likelihood for the development of numerous human illnesses (Huen and Chen 2010).

Genotoxic stress and DNA damage

The highly reactive nature of DNA exposes itself as a prime target for a plethora of genotoxic agents. The number of modifications that occur to human genomic DNA in a single day from genotoxic stress surpasses 100,000 (Rich, Allen et al. 2000). A persistent source of exogenous

DNA damage is ultraviolet light (UV). UV-A and UV-B are parts of the solar UV spectrum that are present in sunlight and they have a harming potential of approximately 100,000 lesions per exposed cell per hour (Jackson and Bartek 2009). Apart from ultraviolet radiation, other environmental agents that cause DNA damage include tobacco products, industrial substances,

warfare chemicals (ex: mustard gas) among other drugs that are used in cancer treatment and chemotherapy. The latter play a large role in causing DNA-damage as the ailments used in cancer therapies initiate covalent crosslinks among DNA bases (ex: carboplatin and cisplatin), drugs that add alkyl groups to DNA bases (ex: temozolomide), and those that sequester topoisomerase I or II enzymes onto the DNA to create single (SSB) or double strand breaks

(DSB) (Lord and Ashworth 2012). In addition, endogenous sources of DNA damage include cellular metabolic processes that produce reactive oxygen species (ROS) that oxidize DNA bases and generate SSBs. To avoid such damage, DNA is embedded in chromatin proteins which provide some DNA damage protection. However, during essential cellular processes such as

DNA replication and transcription, chromatin rearrangement occurs in such a way that DNA becomes exposed to damaging agents; hence, becoming more vulnerable (Rich, Allen et al.

2000). During replication, DSBs may be generated due to stalled replication forks and collisions further increasing DNA’s proneness to damage. This being said, ionization radiation (IR) is also another means of DSBs, which is the most toxic and lethal form of DNA damage seeking attention from the DDR pathway (Finn, Lowndes et al. 2012).

Types of damage and cellular response

Firstly, the DNA damage response pathway is a complex network of signal transduction that allows for interaction among the various pathway molecules which include sensors, transducers and effectors in order to maximize cell survival. Once the damage is recognized, it is assessed via checkpoints and either repair and/or apoptosis take place accordingly. The cell-cycle checkpoint arrest provides the cell with some time to repair the DNA damage, however, if the appropriate response is implemented yet the repair is unsuccessful, then either cellular

senescence or apoptosis takes place to prevent the transmission of damaged genetic information to daughter cells during cell division (Huen and Chen 2010). Checkpoints are vital players in the

DDR as they work to preserve genomic integrity by serving as barriers that halt the dissemination of defective genomes. This process is essential as a lack of quality control may result in embryonic lethality (due to heightened sensitivity to DNA-damaging mediators) and genomic instability which are hallmark features of cancer (Rich, Allen et al. 2000).

Figure 4: Types of damage and repair mechanisms - Adapted from (Zhou and Elledge

2000)

The presence of multiple DNA- repair mechanisms may be attributed to the fact that DNA repair is tailored to the type of DNA lesion that has occurred (Hakem 2008). Figure 4 depicts an overview of the various repair mechanisms based on the type of lesion, the corresponding stage in the cell cycle, and their mode of action. The different types of damage include SSBs, DSBs, bulky adducts, base mismatches and base alkylation. As well, the various repair mechanisms include base excision repair, homologous recombination and non-homologous end joining (both for DSBs), nucleotide excision repair, mismatch repair and direct reversal. The major proteins that play a role in the DDR pathway associated with each kind of break is shown, resulting in particular tumors if these respective DDR proteins are defective. Thus, drugs listed below have been developed to resolve these clinical conditions (Lord and Ashworth 2012).

Double Stranded Breaks

DSBs are the most toxic and lethal form of DNA damage seeking attention from the DDR pathway (Finn, Lowndes et al. 2012). Two main mechanisms which regulate the repair of DSBs include non-homologous end joining (NHEJ) and homologous recombination (HR) (Ferguson and Alt 2001). NHEJ’s distinct feature is that it ligates DNA ends together with minimal processing. This mechanism occurs throughout the cell cycle, since it does not require template

DNA for the repair process (Caldecott 2008). Thus, it remains a preferred method of repair in mammalian cells, particularly quiescent cells. However, despite its simplicity, the likelihood of mutagenesis is higher compared to HR: if ligation does not occur properly, then chromosomal translocations or fusions may be the outcome (Huen and Chen 2010). Ku protein heterodimers bind to the DSBs to stabilize the lesions. Then, it recruits the protein kinase DNA-PKcs allowing for activation and recruitment of the end-processing enzymes (DNA-PK holoenzyme). This nucleoprotein complex triggers the alignment and rejoining of DNA via DNA ligase IV-XRCC4

(Rich, Allen et al. 2000). There is also a Ku-independent NHEJ pathway known as microhomology-mediated end-joining (MMEJ), which generates deletions in sequences, however, this pathway remains a subject of study (Ciccia and Elledge 2010).

HR is favored mainly at the S and G2 phases of the cell cycle (Liu and Huang 2014). The DNA surrounding the DSB is resected to expose the ssDNA. This is promoted by the MRE11-RAD50-

NBS1 (MRN) complex performing nucleolytic processing. The ssDNA binding protein,

Replication Protein A (RPA) quickly sequesters onto the ssDNA which then dislodge and form a

RAD51-nucleoprotein filament (Liu and Huang 2014). With the combined effort of some other proteins such as breast-cancer susceptibility proteins (BRCA1 and BRCA2), strand invasion occurs and a homologous sister chromatid serves as the template for DNA synthesis to ensure effective repair with the help of polymerases, nucleases and helicases (Daley, Kwon et al. 2013).

Overall, the coordinated assembly of repair factors leads to the tight orchestration of events to maximize repair efficiency and ensure genomic integrity.

Signal transduction in the DNA damage response

Key components of the signal transduction pathway are phosphoinositol-3-kinase-like protein kinases ATM (Ataxia telangiectasia) and ATR (Ataxia telangiectasia and Rad3- related)

(Kerzendorfer and O’Driscoll 2009). They are the major regulators in the DNA damage response network and orchestrate a plethora of phosphorylation events of over 700 proteins. These protein kinases are activated upon DNA lesion detection caused by genotoxic stress (Huen and Chen

2010). As seen earlier, ionizing radiation generates the most harmful type of DNA damage which is DSBs. Many of the proteins that take part in the signal cascade and repair mechanisms form foci structures when triggered by ionizing radiation. RAD51 forms foci structures upon DNA

damage, allowing phosphorylation of the histone variant H2AX and recruitment along with an assembly of other DNA repair proteins at the sites of DNA lesions where the ionizing radiation induced foci (IRIF) are present (Tarsounas, Davies et al. 2003). Thus, this phosphorylation event of H2AX (a sensitive marker used to detect DNA damage) is an essential trigger required for the enhancement of DNA repair (Sharma, Singh et al. 2012). Studies have shown that H2AX deficient embryos are immunologically compromised and have delays in development, leading to tumor susceptibility (Huen and Chen 2010).

In mammalian cells, the BRCT domain-containing protein mediator of DNA damage checkpoint

1 (MDC1) established its importance as a key checkpoint regulator and ‘molecular adaptor’ since it is one of the primary proteins that makes its way to the DNA lesion sites in the γH2AX – dependent pathway (Stucki, Clapperton et al. 2005). It is a key protein that aids in the recruitment of other repair proteins such as BRCA1 and 53BP1 to lesion sites where foci have formed.

The ATM and ATR pathway work in parallel to one another (Marechal and Zou 2013). Their phosphorylation substrates often overlap (ex: p53, BRCA1, FANC-D2). ATM is primarily responsible dealing with DNA damage caused by IR, whereas the ATR mediated pathway is activated with other kinds of stress. ATR knockout mice die early during embryogenesis which establishes ATR as a vital protein kinase involved in development (Zhou and Elledge 2000).

ATR is known to take on the role of a haploinsufficient tumor suppressor, such that genomic integrity is maintained and tumor incidence is lessened. Furthermore, loss of ATR generates genomic instability called DNA fragile Site expression, which are regions in the genome which usually span over 100 kb in size and demonstrate instability and high chances of breakage during

replicative stress (Kerzendorfer and O’Driscoll 2009). Meanwhile, ATM null mice demonstrate viability despite some growth defects such as infertility (Zhou and Elledge 2000).

ATM pathway specifics

At DSB sites, the Mre11-Rad50-Nbs1 (MRN) complex is used to recruit ATM, alongside other signal mediators such as MDC1 and 53BP1. Chk2 is an effector kinase protein that is phosphorylated downstream of ATM, where Chk2 then phosphorylates Cdc25 which triggers it for ubiquitin-mediated degradation (Falck, Mailand et al. 2001). Due to the fact that Cdc25 is a key regulator in the activation of Cdk-cyclins, the degradation of Cdc25 does not allow for the removal of inhibitory phosphates on Cdk1-Cyclin B and Cdk-cyclin E present on Cdk-cyclin complexes (Falck, Mailand et al. 2001). Hence, the checkpoint arrest occurs at the G2/M and

G1/S phases. Moreover, the p53 tumor suppressor gene is phosphorylated by ATM, which greatly enhances its stability. This induces its target p21, a Cdk-inhibitor, such that DNA replication is prohibited (Kerzendorfer and O’Driscoll 2009).

ATR pathway specifics

ATR interacts with ATRIP and is a heterodimer that gets recruited by the Replication Protein A heterotrimer (RPA1-3) to the SSBs (Zou, Liu et al. 2006). ATR phosphorylates the MRN complex alongside the Rad17/Rfc2-5 and Rad9/Rad1/Hus1 complexes and all are recruited to

DNA damage sites (Zou and Elledge 2003). ATR kinase activity is increased by TopBP1, since the complexes mentioned earlier are recruited to the damage sites independent of ATR/ATRIP complex.

ATR is able to phosphorylate other molecules such as p53 and BRCA1. Chk1 is an effector kinase that works in a similar manner as Chk2. This overlap in pathways highlights the fact that defects in both Chk1 and Chk2 are required for the cell-cycle checkpoint failure as each on its own is insufficient to initiate (Kerzendorfer and O’Driscoll 2009). Overall, the forced arrest of the cell cycle enables DNA repair of damaged cells to take place before moving forward.

Apoptosis

The major cause of programmed cell death is DNA damage (Rich, Allen et al. 2000). Studies have shown that DNA damage may elicit apoptosis in order to deal with tissue organization issues. That is, cell-cell communication is vital, especially when cellular processes such as DNA replication and transcription take place, and thus, complications with these processes has detrimental effects on the cell. Changes in cellular polarity and sensing are the basis of tumors such as adenomas (Royer and Lu 2011). Instances like this require apoptosis to take place compared to other modes of death.

The quality of the genome that is passed down from one generation to the next is closely monitored via checkpoints and repair mechanisms. In the case that genome integrity is challenged and successful repair has not taken place, then apoptosis takes place to ensure transmission of damaged genetic material does not occur. Sometimes, it also happens that mixed signals are carried through such that even cells where damage has been rectified face the death signalling pathway.

Apoptosis allows for the quick deletion of cells from tissues while targeting them for phagocytosis. Parts of cells may be recycled for regeneration via low energy usage (uncoupling of catalytic and DNA-binding domains of PARP) (Elmore 2007).

Telomeres are guanine-rich repetitive DNA sequences that are present at the ends of chromosomes. DNA repair proteins tend to cluster at telomeric ends perhaps because the cells consider them as DSBs. The telomeres interact with other proteins to form a loop-like structure called the shelterin complex (process known as ‘capping’) (Donate and Blasco 2011).With age, telomere lengths shorten (telomere attrition) and this causes chromosome ends to become exposed which may result in ligation, however, the shelterin complex prevents this from happening. After a certain point, the telomere ends surpass minimal length and thus, the shelterin complex is not able to protect the chromosome anymore. This is lethal for the cell and thus triggers checkpoints to begin apoptosis to prevent unwanted cell proliferation. Nevertheless, there are instances when the p53 apoptosis pathway is bypassed, resulting in end-end ligations.

This chromosome fusion and translocation events are harmful for the cell as they promote tumorigenesis (Donate and Blasco 2011). Such altered chromosomes and shortened telomeres are key characteristics of persistent cancers. Thus, the integrity of the telomeric DNA challenges genomic instability (Lord and Ashworth 2012).

Human disorders and cancer

Unfaithful repair of DNA damage and transmission of flawed genomic DNA to progenitor cells enhance rates of tumor development. A key feature of a tumor cell is its genomic instability

(Zhou and Elledge 2000). Previous studies have demonstrated that alongside genomic instability in most cancers, there is chromosome instability as well, which refers to any alterations in chromosome number and structure. When such chromosomal changes occur, it may result in

‘driver’ genes present in the tumor, which leads to overall alterations in cell behaviour increasing

the likelihood of disease. Cancer hallmarks include various other types of genomic changes that occur as well (Zhou and Elledge 2000).

The following diseases may be grouped under the classification of defective DNA signalling response mechanism:

Ataxia Telangiectasia (A-T)

A-T is a progressive neurological disorder which has a clinical phenotype that consists of the following: progressive loss of muscle coordination (ataxia), dysfunctional eye coordination

(oculomotor apraxia), impairment of speech and articulation, different kinds of specific immunoglobulin deficiencies, as well as an increased susceptibility to developing lymphomas

(Kerzendorfer and O’Driscoll 2009). Patients with this condition show a typical defect in the cell cycle checkpoint G1/S, intra-S and G2/M phases when the DDR pathway is triggered by DSBs.

As well, one of the other hallmark characteristics of this human disorder is that p53 and Chk2 are unsuccessful in being phosphorylated. Despite the fact that ATM is a vital player in the DDR of

‘heterochromatin associated double stranded breaks’, many components of the DDR are dysfunctional in this disorder (Kerzendorfer and O’Driscoll 2009). This highlights the importance of genomic integrity and stability. Functional chromatin is required in order to prevent atypical ATM signalling. Cell-cycle arrest is vital to allow the cell to repair any DNA lesions and breaks present. However, this A-T disorder has combined dysfunctional DNA repair and defective cell-cycle checkpoints, which together create the onset of chromosomal damage which greatly promotes tumor formation. Thus, the intricate network of DDR, required checkpoint activation and effective repair are all vital for faithful genome maintenance in order to prevent such human disorders and promote normal human development (Kerzendorfer and

O’Driscoll 2009).

Nijmegen breakage syndrome (NBS)

The MRN (Mre11-Nbs1-Rad50) complex and its substrates are vital players in the signalling pathway of ATM. Patients with this syndrome exhibit microcephaly, growth impedance, multiple infections, amenorrhea, ovarian dysgenesis along with a predisposition for lymphoma

(Chrzanowska, Gregorek et al. 2012). Those with NBS syndrome demonstrate extreme sensitivity to DNA damaging agents along with defects in the following cell-cycle checkpoints:

G1/S, intra-S and G2/M. The characteristics of this disorder are mostly similar to those patients with A-T syndrome as ATM is a vital player in the DDR pathway to DSBs (Chrzanowska,

Gregorek et al. 2012).

Therapeutic applications and personalized clinical intervention

Thus far, the sites of cancer and its particular clinical features have been used to classify cancer and analyze patient’s cases (Lord and Ashworth 2012). However, the more effective approach would be to use techniques such as whole-genome sequencing in order to assess the ‘pathogenic mutation’ patterns for every cancer. As well, further elucidating the intricate DDR network will allow for the discovery of novel biomarkers for the early detection of cancer and may provide personalized treatment options for each patient, on a case-by-case basis. Detection of ‘driver’ genes affected by DNA damage will allow for the effective classification of cancer. Furthermore, by obtaining the DNA sequence for the cancer (which is often referred to as a ‘sequence scar’), it is possible to identify which mutagens have driven mutagenesis in the tumor and, which repair mechanisms have been triggered in response to this damage (Lord and Ashworth 2012). By following such an approach, patients will be treated based on the assessment of their specific

DNA repair mechanism defect and biomarkers will be used to recognize such defects allowing target based therapy to be used.

Hallmark features of cancer include changes in cell and tissue architecture, and genomic instability. The nucleus of the cell is where numerous supercomplexes are present which engage in various aspects of the DNA repair mechanisms as well as apoptotic pathways (Rich, Allen et al. 2000). The onset of cancer brings about many changes with DNA metabolism as well as organisation of the nucleus. With such rapid mutations, with numbers ranging from 103 to 105 mutations per tumor, it may be difficult to fully characterize the source of lesions (Rich, Allen et al. 2000). Nevertheless, certain techniques and advances in cancer research have led to the emergence of techniques such as karyotyping to visualize and perform chromosomal analysis.

Other immunoprecipitation techniques as well as RNAi screening coupled to functional readouts may help explore novel components in the DDR pathway (Huen and Chen 2010).

Despite the fact that many components of the DDR pathway have already been analyzed, there is still need for identifying and characterizing components and interactions taking part in this intricate and complex network comprising of signalling, repair, checkpoints, and response. A closer look at novel interactions and DNA damage in vivo studies may help discern between different medical conditions. This will allow for a more effective and personalized therapeutic approach in order to maximize the chances of a successful clinical intervention. In order to optimize the DNA damage response and cater the repair to the type of damage, a network of sensors is required. Moreover, it is vital to ensure that once repair is initiated, the sensory component is able to determine when the repair process is complete. The latter is also an important aspect to consider as the repair mechanism eventually needs to be stopped once the

DNA damage has been rectified (Zhou and Elledge 2000). Constitutive repair is not beneficial

for the cell: cells may falsely classify certain components of DNA replication as damage and as a result, disruptions in DNA synthesis and other deleterious effects are plausible (Zhou and

Elledge 2000). Although unraveling new substrates and their interactions in the DDR pathway remain enigmatic, it is a key step forward in this field of study, creating scope for advances in medical research.

Experimental Procedures

Antibodies, immunoprecipitations and immunoblotting

Rabbit anti-hnRNPUL1 was purchased from Proteintech (Chicago, IL). Mouse anti-Flag (M2) antibody, anti--tubulin antibody, and protein-A-Sepharose beads were purchased from Sigma

(St. Louis, MO). Anti-GFP antibody was purchased from Novus Biologicals (Littleton, CO).

Rabbit anti-PRMT1 antibody and ASYM25b were described previously (Cote, Boisvert et al.

2003, Yu, Chen et al. 2009). Species-specific immunoglobulin G (IgG) control antibodies were from Invitrogen (Carlsbad, CA). Protease and phosphatase inhibitor cocktails were obtained from Roche (Mississauga, ON). Streptavidin agarose beads were purchased from Life

Technologies (Burlington, ON). Immunoprecipitations and immunoblotting were performed as previously described (Boisvert, Cote et al. 2002). Briefly, cells were lysed in 50 mM HEPES pH

7.4, 150 mM NaCl, and 1% Triton X-100 on ice for 15 min. After removal of the Triton insoluble matter by centrifugation, the supernatant was incubated with the indicated antibodies on ice for 2 h. The bound proteins were immunopurified using protein A Sepharose beads tumbled at 4˚C for 1 h and separated by SDS-PAGE, transferred to nitrocellulose membranes and immunoblotted with the indicated antibodies as previously described (Boisvert, Cote et al.

2002).

Plasmids, siRNAs and transfection

Flag-hnRNPUL1 was subcloned into the pcDNA 3.1 vector. The hnRNPUL1 human cDNA clone was purchased from ORIGENE (Rockville, MD). The primers (Sigma Aldrich) used for the subcloning were 5'- GGG GGA TCC GAT GTG CGC CGT CTG AAG GTG- 3' and 5'-

GGG GTC GAC CTA CTG TGT ACT TGT GCC ACC- 3'. Flag-hnRNPUL1RK (R612K, 52

R618K, R620K, R639K, R645K, R656K and R661K in pcDNA 3.1 was generated from Flag- hnRNPUL1 by Mutagenex Inc. (Hillsborough, NJ). GFP-hnRNPUL1 and GFP-hnRNPUL1RK were also generated by Mutagenex Inc. (Hillsborough, NJ). All DNA constructs were entirely sequenced.

GST-fusion proteins of hnRNPUL1 peptides were constructed by inserting synthesized oligonucleotide duplexes into the PGEX-3X vector at the Bam HI and Eco RI cut sites.

Oligonucleotide sequences (Sigma Aldrich) of GST fusion proteins of hnRNPUL1 are as follows:

Di-RG:

5'- GATCTATGAAGAAAACCGGGGACGGGGGTACTTTGAGCACTGA-3' and

5'-TCG ATCAGTGCTCAAAGTACCCCCGTCCCCGGTTTTCTTCATA-3'

RRGR:

5'-GATCCACCGAGAGGATAGGAGGGGCCGCTCTCCTCAGCCTTGA-3' and

5'-TCGATCAAGGCTGAGGAGAGCGGCCCCTCCTATCCTCTCGGTG-3'

RIRG:

5'-GATCCCCCTTAGTGAGCGTATCCGGGGCACCGTTGGACCATGA-3' and

5'-TCGATCATGGTCCAACGGTGCCCCGGATACGCTCACTAAGGGG-3'

Tri-RG:

5'-

GATCTTTGACAACCGAGGTGGTGGTGGCTTCCGGGGCCGCGGGGGTGGTGGTGGCTT

CCAGTGA-3' and

5'- TCGATCACTGGAAGCCACCACCACCCCCGCGGCCCCGGAAGCCACCACCACCTC

GGTTGTCAAA-3' 53

Di-RGG:

5'-GATCCCTGGAGGCAACCGTGGCGGCTTCCAGAACCGAGGGGGAGGCAGCGGTG

GAGGATGA-3' and

5'-TCGATCATCCTCCACCGCTGCCTCCCCCTCGGTTCTGGAAGCCGCCACGGTTGCC

TCCAGG-3'

Mono-RGG:

5'-GATCGGAGGAGGCAACTACCGAGGAGGTTTCAACCGCAGCGGAGGTGGTGGCT

GA-3' and

5'-TCGATCAGCCACCACCTCCGCTGCGGTTGAAACCTCCTCGGTAGTTGCCTCC

TCC-3'

siRNAs purchased from Dharmacon Inc. (Lafayette, CO) along with their respective target sequences were as follows: siLuciferase (siCTL, 5'-CGU ACG CGG AAU ACU UCG A dTdT-

3'), siGFP (siCTL, 5'-AAC ACU UGU CAC UAC UUU CUC UU dTdT -3') sihnRNPUL1 (5'-

GCA GUG GAA CCA GUA CUA U dTdT -3'), and siPRMT1 (5'-CGT CAA AGC CAA CAA

GTT A dTdT - 3').

Cell culture, transfection and drug treatments

HEK293T and U2OS were purchased from the American Type Culture Collection (Manassas,

VA). Cells were cultured in Dulbecco’s modified Eagle medium (DMEM; Invitrogen) supplemented with 10% fetal bovine serum (FBS; BioSera), 1 mM sodium pyruvate and antibiotics under typical culture conditions. Plasmids were transfected with Lipofectamine 2000

(Invitrogen), and siRNAs were transfected with Lipofectamine RNAiMAX (Invitrogen) as per

the manufacturer’s instructions. Cells were analyzed 48 h or 72 h after transfection depending on the experiment to be performed. Stable cell lines were selected with 200 g/ml of Geneticin

(G418; Invitrogen) and a few single clones were selected via western blotting analysis and immunofluorescence confirmation of stably transfected cells. Campthothecin drug treatments, using 1 μM as the final concentration in media were performed as described previously (Polo,

Blackford et al. 2012). One hour post drug treatment, cells were washed with PBS and supplemented with new DMEM media; cells were harvested at the various time points post drug treatment accordingly.

Expression and purification of GST fusion proteins

GST fusion proteins were purified from 500 ml of E.coli DH5α cells grown in a rich 2XYT medium with the appropriate antibiotic. Subsequently, following five hours of vigorous shaking post induction via IPTG (Invitrogen), bacteria were centrifuged at 5000 rpm 7 min at 4˚C. Cells were lysed with lysis buffer (50 mM Tris pH 7.5, 150 mM NaCl, 1mM PMSF, 5mM EDTA,

0.1% Triton X-100) and samples were sonicated 3 times for 30 sec each, followed by a centrifugation at 12000 rpm for 15 min. The lysates were incubated with gluthathione-Sepharose beads on a tumbler at 4˚C overnight. The following day, beads were washed with 20 mM Tris pH 7.5, 0.1 % Triton X-100, with a final wash with just PBS. GST-fusion proteins were eluted with elution buffer (10 mM reduced gluthathione in 50 mM Tris pH 8.0). The eluted proteins were dialysed overnight in PBS.

In vitro methylation assays

The methylation of the hnRNPUL1 RGG/RG motifs by PRMT1 was performed using recombinant proteins. GST-RGG/RG proteins were incubated with GST-PRMT1 and 0.55 µCi of [methyl-3H] S-adenosyl-L-methionine in the presence of 25 mM Tris- HCl at pH 7.4 for 1 h in a final total volume of 30 μl (Cote, Boisvert et al. 2003). The reactions were stopped by adding

30 μl of 2X Laemmli buffer, followed by boiling the samples at 100˚C for 10 min. The methylation of the GST-RGG/RG motifs was assessed by polyacrylamide gel electrophoresis and stained with Coomassie Blue. The destained gel was soaked in EN3HANCE for 1 h, followed by a gentle agitation in cold water 30 min. The washed gel was dried at 60˚C for 1.5 h and visualized by fluorography, as described (Cote, Boisvert et al. 2003).

Affinity pull-down assays

For the affinity pull down assay, 300 μl of cellular lysates were incubated with 2 μl of 1 mM unmethylated and methylated forms of a biotinylated DiRGG and DiRGGme2a peptides, respectively, on ice for 1 h. Then, 40 µl of 50% Streptavidin Agarose slurry was added and incubated at 4 ºC for 1 h with constant end-over-end mixing. Beads were washed with lysis buffer containing increasing salt concentrations. The samples were then boiled with 40 µl of 2X

SDS PAGE sample buffer, resolved in SDS polyacrylamide gels, transferred to nitrocellulose membranes and subjected to immunoblotting with the indicated antibodies. As previously mentioned, peptides used were as follows:

DiRGG Biotin-RRGRGRGRGFRGARGGRGGGGAPRG-NH2

DiRGGme2a Biotin-RRGRGRGRGFRGAR(Me2a)GGR(Me2a)GGGGAPRG-NH2 where R (Me2a) signifies a methylation arginine residue.

Laser Scissor

HeLa cells were transfected with 400 ng of GFP-hnRNPUL1 and GFP-hnRNPUL1RK plasmids with Effectene transfection reagent from Qiagen (Toronto, ON). 16 hours post transfection,

FRAP analysis was performed. Fluorescence was observed on a Leica TCS SP5 II confocal microscope. A 405-nm ultraviolet laser was used to create laser-induced DNA damage. GFP fluorescence was visualized and observed within the micro-irradiated nuclear region using a 488 nm excitation filter with a 63X objective. Volocity software was used in order to monitor background and perform photo-bleaching corrections to every dataset, respectively.

Results:

RGG/RG motifs of hnRNPUL1 are methylated by PRMT1

Arginine glycine repeat sequences have been found in more than 1400 human proteins

(Thandapani, O'Connor et al. 2013). They can be classified into 4 types of RGG/RG motifs namely, Di-RG, Di-RGG, Tri-RG and Tri-RGG (Thandapani, O'Connor et al. 2013). RGG/RG motifs regulate protein/protein, protein/RNA and protein/DNA interactions and are preferred sites of methylation by protein arginine methyltransferases (PRMTs) (Thandapani, O'Connor et al. 2013). The arginine methylation of the MRE11 RGG/RG motif is physiologically required for optimal MRE11 nuclease activity to activate the ATR signalling cascade (Yu, Vogel et al. 2012).

To further define the role of RGG/RG motif and its methylation in DNA damage signalling, we chose to study heteronuclear ribonucleoprotein (hnRNP) U like protein 1. hnRNPUL1 was recently shown to participate in ATR activation following DNA damage signalling (Polo,

Blackford et al. 2012). hnRNPUL1 harbors a DiRGG and a TriRG motif as well as single RG sequences (Fig. 5A). We examined whether these sequences were methylated by PRMT1. In vitro methylation assays were performed where each of the RGG/RG motifs of hnRNPUL1 was fused to GST. These GST-RGG/RG fusion proteins were incubated with GST-PRMT1 and

[methyl-3H]-S-adenosyl-L-methionine, as the methyl donor. The methylated proteins were visualized by fluorography after separation by SDS-PAGE and equal loading was observed by

Coomassie Blue staining (Fig. 5B, left panel). The TriRG, DiRGG as well as monoRGG of hnRNPUL1 were methylated by PRMT1. GST-GAR of MRE11 was used as a positive control and GST alone as a negative control (Fig. 5B, right panel). All of the three methylated RGG/RG motifs are located nearby to each other from amino acid 612 to 666.

To investigate whether hnRNPUL1 harbors any methylarginines in vivo, we performed mass spectrometry analysis. U2OS cells transfected with an expression vector encoding Flag-epitope tagged hnRNPUL1 were lysed under denaturing conditions with a lysis buffer containing 1%

SDS in order to disrupt protein-protein interactions and thus limit proteins that co- immunoprecipitate with hnRNPUL1. Such denaturing conditions allow for a reduction in background, since we were interested uniquely in studying the post-translational modifications of hnRNPUL1 and not in identifying other unspecific protein-protein interactions. The SDS was diluted to 0.1% with lysis buffer devoid of SDS, such that Flag-hnRNPUL1 could be immunoprecipitated with anti-Flag antibodies coupled to agarose beads. The immunopurified hnRNPUL1 was subjected to mass spectrometry with focus on modified hnRNPUL1 peptides

(Fig. 6B). Mass spectrometry analysis detected 49 peptides with 62% coverage of hnRNPUL1 and 42 of the total 66 arginines in the protein were detected (Fig. 6A). Amongst the 42 arginines detected, 5 were dimethylated (R584, R618, R620, R645, R656), while some were monomethylated (R661, R685, R690) (Table 1). Importantly, R645 resides in a Di-RGG motif and R618 and R620 reside within the Tri-RG motif of hnRNPUL1. The presence of monomethylated R661, R685 and R690, suggests that monomethylarginines may represent intermediates for the final asymmetrical dimethylation step by PRMT1.

Moreover, the methylation sites observed in vitro correlate and are included in the list of arginine residues that were shown to be methylated in vivo via mass spectrometry analysis i.e. R584, 618,

620, 645, 656, 661, 685 and 690, which further reinforces our findings.

PRMT1 methylates and associates with hnRNPUL1 in vivo.

We next examined whether PRMT1 was the enzyme responsible for the methylation of endogenous hnRNPUL1 in vivo. HEK293 cells were transfected with control (siLuciferase) or

PRMT1 siRNAs and cellular extracts were prepared for immunoprecipitation with control (IgG) or anti-hnRNPUL1 antibodies. The bound proteins were separated by SDS-PAGE and immunoblotted with ASYM25b, a specific asymmetric dimethylarginine antibody. Equivalent hnRNPUL1 was immunoprecipitated from siLuc and siPRMT1 cells (Fig. 7A). ASYM25b only recognized hnRNPUL1 in siLuc, but not siPRMT1 transfected cells, demonstrating that hnRNPUL1 was hypomethylated in PRMT1-depleted cells. These findings suggest that PRMT1 is the physiological enzyme responsible for the arginine methylation of hnRNPUL1 in vivo.

We identified hnRNPUL1 arginines 612, 618, 620, 639, 645, 656, and 661 to be arginine methylated and we next proceeded to substitute all these 7 arginines with lysines to generate a mutant hnRNPUL1 (RK) that is devoid of any methylarginines (Fig. 6 and Table 1). We chose lysine to maintain the charge and lysine is not a substrate of PRMTs. We initially examined whether Flag-hnRNPUL1RK is indeed hypomethylated in vivo. HEK293 cells transfected with

Flag-hnRNPUL1 or Flag-hnRNPUL1RK were lysed and anti-Flag immunoprecipitations were performed. Immunoblotting of the Flag immunoprecipitations with ASYM25b revealed that hnRNPUL1 was abundantly arginine methylated, but not Flag-hnRNPUL1RK (Fig. 7B).

Immunoblotting lysates with anti-tubulin antibodies confirmed equivalent loading and expression of the Flag epitope tagged proteins. These findings show that the arginines that reside within RGG/RG motifs are the only sequences that contain methylarginines in hnRNPUL1.

We tested whether endogenous PRMT1 associated with Flag-hnRNPUL1 and Flag- hnRNPUL1RK. HEK293 transfected with Flag-hnRNPUL1 or Flag-hnRNPUL1RK were lysed and

co-immunoprecipitation analyses were performed. Untransfected cells were used as the negative control. We observed that PRMT1 co-immunoprecipitated with Flag-hnRNPUL1, but not Flag- hnRNPUL1RK (Fig. 7B). Immunoblotting lysates with anti-tubulin and anti-Flag antibodies confirmed equivalent loading and expression of the Flag epitope tagged proteins (Fig. 7B). The fact that PRMT1 did not associate with Flag-hnRNPUL1RK may explain why the protein is indeed hypomethylated. These findings suggest that the 7 arginines located within the RGG/RG motifs of hnRNPUL1 are the sites of methylation by PRMT1.

Arginine methylation regulates the hnRNPUL1/NBS1 interaction

Previous studies identified an interaction between the RGG/RG region of hnRNPUL1 and NBS1, but it was not known that hnRNPUL1 was arginine methylated or was required for this interaction (Polo, Blackford et al. 2012). To determine whether arginine methylation of hnRNPUL1 affects the NBS1 interaction, methylated and unmethylated DiRGG biotinylated peptides were used in affinity pull-down assays (Fig. 8A). Cellular lysates were prepared from

HEK293 cells transfected with YFP-NBS1 and incubated with DiRGG and DiRGGme2a biotinylated peptides bound to Streptavidin beads. The bound proteins were separated by SDS-

PAGE and immunoblotted with anti-GFP antibodies to detect YFP-NBS1. We observed that the methylated DiRGG peptide had a higher relative affinity towards NBS1 in comparison to the unmethylated peptide and this was confirmed by washing with increasing concentrations of NaCl

(Fig. 8A and 8B).

We tested whether hypomethylated hnRNPUL1 interacted with NBS1. U2OS cells were co- transfected with control pcDNA3.1, Flag-hnRNPUL1 or Flag-hnRNPUL1RK and YFP-NBS1 expression vectors. Once the cells were lysed, co-immunoprecipitation experiments were

performed. NBS1 associated with the Flag-hnRNPUL1, as expected, however, NBS1 had a reduced affinity for Flag-hnRNPUL1RK (Fig. 8C).

To further determine whether arginine methylation of hnRNPUL1 regulates its interaction with

NBS1, we examined the interaction in PRMT1-deficient cells. HEK293 cells were transfected with control or PRMT1 siRNAs along with YFP-NBS1 and Flag-hnRNPUL1. The lysed cells were immunoprecipitated with anti-Flag antibodies and the bound proteins were separated by

SDS-PAGE and immunoblotted with anti-GFP antibodies. We observed a reduced

NBS1/hnRNPUL1 interaction in PRMT1 siRNA treated cells (Fig. 8D). Immunoblots of whole cell lysates (WCL) from control and PRMT1 knockdown cells with anti-GFP, anti-FLAG and anti-PRMT1 antibodies confirmed equal expression, as well as the PRMT1 knockdown. These findings suggest a role for arginine methylation in the interaction between NBS1 and hnRNPUL1.

The methylation of the hnRNPUL1 RGG/RG motifs regulates its recruitment at sites of

DNA damage

hnRNPUL1 exhibits two types of dynamics at DNA damage sites depending on the presence or absence of RNA (Polo, Blackford et al., 2012). hnRNPUL1 is rapidly excluded from laser microirradiation sites, but in the presence of transcription inhibitors, it is effectively recruited at DNA damage tracks. An RGG deletion mutant of hnRNPUL1 was shown to be defective in these dynamic properties (Polo, Blackford et al., 2012). To assess the role of the arginine and their methylation within the RGG motifs in the exclusion and recruitment at sites of

DNA damage, we transfected U2OS cells with GFP-hnRNPUL1 or GFP- hnRNPUL1RK. The cells were examined for the recruitment to laser microirradiated nuclear regions in the absence

and presence of the transcriptional inhibitor, 5,6 dichloro--D-ribofuranosylbenzimidazole

(DRB). Interestingly, both GFP-hnRNPUL1 and hnRNPUL1RK were excluded from laser microirradiated nuclear regions in U2OS cells (Figure 9A). However, GFP-hnRNPUL1 was effectively recruited at sites of DNA damage, while GFP-hnRNPUL1RK was not recruited at these DNA damage sites (Figure 9A, 9B). Furthermore, these observations demonstrate a role for the arginine methylation of RGG/RG motif of hnRNPUL1 in the recruitment of hnRNPUL1 at

DNA damage sites.

Table 1. Methylated arginine residues of hnRNPUL1 identified in vivo via mass spectrometry

Figure 5. The RGG/RG motif of hnRNPUL1 is methylated by PRMT1 in vitro

A) SAP designates the SAF- A/B, Acinus and PIAS motif, while BBS denotes BRD7-binding site. The sequence of 549-696 is shown: underlined and bold arginines were identified to be methylated. B) GST with the indicated peptide sequences were methylated by recombinant

3 PRMT1 in vitro using H –SAM. Proteins were resolved by SDS-PAGE, stained with Coomassie blue (left panel), dried and analyzed by fluorography (right panel). GST-GAR (glycine arginine rich) and GST were used as the positive and negative control, respectively. The indicated sequences (RGG or RG) were fused to GST and thus migrate at a similar molecular mass as

GST. GST-GAR harbors extra ~60aa and migrates close to 33kDa.

Figure 6. hnRNPUL1 harbors methylated arginine residues identified in vivo via mass spectrometry analysis A) Protein sequence of hnRNPUL1 with the arginine residues that were detected via mass

spectrometry highlighted in purple. B) Schematic of a peptide analyzed by mass spectrometry is

depicted. Flag-hnRNPUL1 in U2OS cells was immunoprecipitated and subjected to mass

spectrometry analysis. The corresponding mass spectrum demonstrates the addition of the methyl

groups to the respective arginine residues. The addition of 28 atomic mass units denotes the

addition of a methyl group to the arginine residue as indicated by the x-axis mass over charge

ratio. Moreover, the peak size as indicated on the y-axis of the spectrum correlates with intensity

and abundance of the peptide.

Figure 7: The RGG/RG motif of hnRNPUL1 is methylated by PRMT1 in vivo via a physical association

A) Whole cell lysates from HEK293 cells transfected with siPRMT1 and siControl were subjected to immunoprecipitation 48 h post transfection with the anti-hnRNPUL1 antibody.

Whole cell lysates (WCL) and immunoprecipitants were immunoblotted with the indicated antibodies. B) HEK293 cells were transfected with Flag-hnRNPUL1 wildtype and Flag- hnRNPUL1RK in which the arginine residues R612, R618, R620, R639, R645, R656, and R661 located in the RGG/RG motif and identified to be methylated were mutated to lysines. Whole cell lysates (WCL) and Flag immunoprecipitants were subjected to western blot analysis using the antibodies indicated. Tubulin was used as loading control.

Figure 8. Methylation of hnRNPUL1 is required for its interaction with NBS1 A) HEK293 cells were transfected with YFP-NBS1. Cellular lysates were incubated with 2 μl of

1 mM DiRGG and DiRGGme2a peptides and subjected to streptavidin pull-down. Whole cell lysates (WCL) and Streptavidin-immunoprecipitants were immunoblotted with the anti-GFP antibody. B) HEK293 cells were transfected with YFP-NBS1. Cellular lysates were incubated with 2 μl of 1 mM DiRGG and DiRGGme2a peptides and subjected to streptavidin pull-down.

Beads were washed with lysis buffer containing increasing concentrations of NaCl. Whole cell lysates (WCL) and Streptavidin-immunoprecipitates were immunoblotted with the anti-GFP antibody. C) U2OS cells were transfected with empty vector (pcDNA 3.1), Flag-hnRNPUL1 wildtype, Flag-hnRNPUL1 R-K mutant and YFP-NBS1. Whole cell lysates (WCL) and Flag- immunoprecipitants were immunoblotted with the indicated antibodies. D) HEK293 cells were transfected with siControl and siPRMT1 along with YFP-NBS1 and Flag-hnRNPUL1. The whole cell lysates (WCL) and Flag immunoprecipitates were subjected to western blot analysis using the antibodies indicated.

Figure 9. The methylation of the hnRNPUL1 RGG/RG motifs regulates its recruitment at sites of DNA damage

A) U2OS cells were transfected with GFP-hnRNPUL1 wildtype and GFP-hnRNPUL1RK and subjected to laser micro irradiation treatment. The cells were examined for the recruitment to laser microirradiated nuclear regions in the absence and presence of the transcriptional inhibitor,

5,6 dichloro--D-ribofuranosylbenzimidazole (DRB). Live imaging was used to observe the exclusion and recruitment patterns post laser scissor damage. B) Quantification of percentage of cells with hnRNPUL1 recruitment. Quantification of recruitment patterns of GFP-hnRNPUL1

(WT) and GFP-hnRNPUL1RK (R/K mutant) respectively.

Discussion:

RNA binding proteins (RBPs) have been increasingly associated with a multitude of pathways, including, but not limited to RNA metabolism, DNA metabolism, signal transduction and more recently DNA repair (Dutertre, Lambert et al. 2014). Their roles in such pathways include the regulation and controlled monitoring of post-transcriptional gene regulation through binding to RNA sequences and secondary structures in untranslated and coding regions of mRNAs and association with non-coding RNAs (Lunde, Moore et al. 2007, Glisovic, Bachorik et al. 2008). Post-translational modifications of proteins play an integral part of the DNA damage response pathway. RBPs are sensitive to post-translational modifications by regulating their cellular localization, stability and recruitment at sites of DNA damage. Moreover, these modifications can elicit tight control (both spatial and temporal) of the key players involved in the DNA damage response such that protein-protein interactions may be facilitated allowing effective signal amplification and a final cellular response which include DNA repair, cell cycle arrest, and apoptosis.

My findings have elucidated a role for arginine methylation of hnRNPUL1, a member of the hnRNP family, in the DNA damage response pathway. The family of hnRNPs have been implicated in numerous cellular processes including RNA metabolism, telomere elongation,

DNA repair, and chromatin reorganization, in addition to among many other regulatory pathways

(Carpenter, MacKay et al. 2006). hnRNPUL1 has sequence homology to hnRNP U, a protein which has been shown to be a participant in the DNA damage response pathway (Polo,

Blackford et al. 2012).

hnRNP U, also known as scaffold attachment factor A (SAF-A), is a nucleic acid binding ribonucleoprotein which has a characteristic binding preference for scaffold associated DNA regions including areas rich in A-T amino acids (Fackelmayer, Dahm et al. 1994). hnRNP U contains a unique site from 778 to 793 amino acids bearing four RG rich regions which are preferred sites for arginine methylation (Herrmann, Bossert et al. 2004). PRMT1 has been reported to be the enzyme responsible for the methylation of hnRNP U in its RGG/RG rich motif (Herrmann, Bossert et al. 2004). In addition, the unmethylated form of hnRNP U is unstable, further suggesting the methylation of this protein is constitutive. As methylated proteins may be recycled and reused, this process allows for the constant replenishment of the resource pool, making it available for the newly synthesized gene products throughout a multitude of cellular processes that occur in the cell (Herrmann, Bossert et al. 2004). In the present study, we have defined a role for the methylation of the RGG/RG motif of hnRNPUL1 in

DNA damage signalling. We show that the TriRG, DiRGG and monoRGG of hnRNPUL1 are methylated by PRMT1 in vitro using [methyl-3H] S-adenosyl-L-methionine as the methyl donor.

Defects in PRMT1-deficient cells have been previously characterized (Yu, Chen et al. 2009). It has been shown that PRMT1 is essential for early development using a conditional null allele of

PRMT1 in mice. PRMT1 null embryos die at embryonic day 6.5 (Yu, Chen et al. 2009). PRMT1- deficient MEFs display genomic instability and exhibit spontaneous DNA damage, checkpoint defects, and delays in cell cycle progression. This further supports a crucial role for PRMT1 in the DNA damage response pathway (Yu, Chen et al. 2009).

We further showed via mass spectrometry analysis of Flag-tagged hnRNPUL1 in U2OS cells the presence of methylarginines in vivo. The identification of mono-methylarginine suggests these marks serve as potential priming sites for the subsequent dimethylation by PRMT1. These

findings further reinforced our previously obtained analysis in vitro, where we observed that

PRMT1 was responsible for the in vitro methylation of the RGG/RG rich sequences of hnRNPUL1 (Fig. 5B).

The role of arginine methylation and PRMTs in the DDR pathway has not fully been characterized. Nevertheless, we observed the methylation status of hnRNPUL1 in PRMT1 knockdown HEK293 cells using siRNA. hnRNPUL1 was shown to be hypomethylated in the

PRMT1-deficient cells, demonstrating that PRMT1 is the physiological enzyme responsible for the methylation of hnRNPUL1 in its RGG/RG motif. Previous studies have implicated hnRNPUL1 to be required for resection at double strand breaks and to be required for optimal activation of ATR. It was proposed that there are two pools of hnRNPUL1 in the cell, such that one pool is involved in RNA metabolism, while the other participates in DSB repair (Polo,

Blackford et al. 2012). Perhaps arginine methylation divides these two pools.

Earlier studies have demonstrated a role for arginine methylation of the MRE11 subunit of the

MRN molecular sensor complex, an important complex in the DDR, to be methylated in its

RGG/RG motif by PRMT1 both in vitro as well as in vivo (Boisvert, Dery et al. 2005). The exonuclease activity of MRE11 is regulated via its methylation by PRMT1 (Boisvert, Dery et al.

2005). A previously generated mouse knock-in allele of Mre11, where the methylated arginines within its RGG/RG motif are substituted to lysines, displayed hypersensitivity to γ-irradiation

(IR) (Yu, Vogel et al. 2012). In addition, genomic instability and cell cycle checkpoint defects were also observed. An analogous experimental design, using charge conservation, an hnRNPUL1 (RK) mutant protein was generated such that it was devoid of methylated arginines at the previously identified sites. We were able to show that the Flag-hnRNPUL1RK was

hypomethylated in vivo, whereas the Flag-hnRNPUL1 was copiously methylated, which further signifies the presence of methylarginines within the context of the RGG/RG motif.

PRMT1 is known to associate with its substrates (Zhang and Cheng 2003). Moreover, it preferentially methylates RGG/RG motifs of RBPs in addition to other proteins (Tang, Kao et al.

2000). Our findings demonstrate, using endogenous PRMT1 in co-immunoprecipitation studies that PRMT1 physically interacts with Flag-hnRNPUL1, but not with Flag-hnRNPUL1RK.

It has been shown that the localization and recruitment of hnRNPUL1 to DSB damage sites is dependent on the presence of the MRN complex (Polo, Blackford et al. 2012). It has also been reported that hnRNPUL1 functions in a pathway that is downstream of MRN and CtIP, however, upstream of BLM such that hnRNPUL1 promotes DSB resection by regulating BLM recruitment

(Polo, Blackford et al. 2012). Previous findings have also demonstrated an interaction between the C-terminal of NBS1 and the RGG/RG motif of hnRNPUL1. Nonetheless, the role that methylation plays in this interaction was now known. We used methylated and unmethylated forms of DiRGG biotinylated peptides in affinity pull-down assays. We observed an increase binding between the methylated peptide and NBS1, as opposed to the unmethylated form of the peptide. These findings suggest the methylation of hnRNPUL1 increases the interaction with

NBS1. To explore this further in vivo, we used Flag-hnRNPUL1 and evaluated its association with endogenous NBS1. Interestingly, the affinity for this interaction was significantly lessened for Flag-hnRNPUL1RK (Fig. 8C). In addition, using siRNA PRMT1-depleted cells in which both

YFP-NBS1 and Flag-hnRNPUL1 were overexpressed, we observed a reduced binding interaction between NBS1 and hnRNPUL1.

Previous studies have shown that the RGG/RG motif of hnRNPUL1 is essential for its mobilization to and from sites of DNA damage, in an MRN-dependent and RNA-independent

manner (Polo, Blackford et al. 2012). Moreover, it has been observed that upon laser scissor damage, hnRNPUL1 forms unique exclusion and recruitment patterns, such that they either become excluded from the breakage sites or are recruited to them (Polo, Blackford et al. 2012).

Nevertheless, as numerous post-translational modifications have been shown to play a role in the

DDR pathway, this collectively indicates the relevance of further exploring the roles of arginine methylation in the context of DNA repair pathways. Using post-laser scissor damage, we observed a prominent role for the arginine methylation of hnRNPUL1, by observing U2OS cells transfected with GFP-hnRNPUL1 or GFP-hnRNPUL1RK and their distribution patterns accordingly, whether it is exclusion or recruitment. The cells were examined for the recruitment to laser microirradiated nuclear regions in the absence and presence of the transcriptional inhibitor, 5,6 dichloro--D-ribofuranosylbenzimidazole (DRB). An interesting pattern that was observed was the following: both GFP-hnRNPUL1 and hnRNPUL1RK were excluded from laser microirradiated nuclear regions in U2OS cells (Figure 9A). Nevertheless, GFP-hnRNPUL1 was effectively recruited at sites of DNA damage, while GFP-hnRNPUL1RK was not recruited at these DNA damage sites (Figure 9A, 9B). These observations had confirmed that initial thought that perhaps the methylation of the arginine residues located in the RGG/RG motif of hnRNPUL1 could be required for the recruitment of hnRNPUL1 to the sites of DNA damage.

Therefore, these findings suggest that the arginines within the RGG/RG motifs are required for the recruitment at sites of DNA damage in the presence of transcription inhibitors, but are not required for exclusion of hnRNPUL1 from sites of DNA damage. Further studies in this matter should be performed to further explore whether arginine methylation and PRMT1 is required for the localization of hnRNPUL1 to DNA damage sites. This may be done by using U2OS cells

transfected with PRMT1 siRNA and the recruitment of GFP-hnRNPUL1 at laser microirradiated nuclear regions may be assessed accordingly.

Collectively, our findings demonstrate a role for arginine methylation of hnRNPUL1 in the DNA damage response pathway. Nevertheless, there still remains much more to be determined to fully delineate the role that arginine methylation plays in the DDR. For example, it would be important to perform functional studies comparing Flag-hnRNPUL1 and Flag-hnRNPUL1RK while removing the endogenous hnRNPUL1 via siRNA or using CRISPR/Cas9 technology. This will enable us to further monitor and assess the defects that hypomethylation of hnRNPUL1 may cause to the DDR. In particular, in order to understand the role of arginine methylation in the regulation of hnRNPUL1 functions, mutants harboring R-K mutations of the identified methyl arginine sites may be used to study defects in checkpoint activation, genomic instability and

DNA damage response. For example, in the case of checkpoint activation studies, a role for the

RGG/RG motif of hnRNPUL1 may be elucidated, if we are to predict that the hnRNPUL1RK will have defects in carrying out proper cell-cycle transitioning. Survival assays such as colony formation assays post campthothecin drug treatment (causing DNA damage) may be used in order to assess any differences between the wild type and mutants forms of hnRNPUL1. In perspective, measuring the half-life of hnRNPUL1 wild type and mutants will enable us to comment on how the methylation of hnRNPUL1 will affect overall protein stability.

Another interesting question that we may expand on is whether the methylation of hnRNPUL1 is modulated upon DNA damage. Further experiments need to be performed in order to determine if the arginine methylation of hnRNPUL1 is regulated upon DNA damage. SILAC experiments allow for the effective comparison between the relative levels of arginine methylation between

DNA-damage treated and non-treated samples. Thus, large quantities of protein are required for

the accurate detection of peptides covering the region of the methylated residues. Our SILAC experiment was not sensitive enough to compare the arginine methylation between the IR-treated cells and control cells. Thus, further experimentation will allow us to shed some light in this area of study.

Although many components of the hnRNPUL1 mechanism are being gradually uncovered, the overall contribution of this post-translational modification necessitates further studies to gain perspective on the significance of hnRNPUL1.

References Aguilera, A. and T. Garcia-Muse (2012). "R loops: from transcription byproducts to threats to genome stability." Mol Cell 46(2): 115-124. Ahn, J. S. and M. C. Whitby (2003). "The Role of the SAP Motif in Promoting Holliday Junction Binding and Resolution by SpCCE1." Journal of Biological Chemistry 278(31): 29121-29129. Allfrey, V. G., R. Faulkner and A. E. Mirsky (1964). "Acetylation and Methylation of Histones and Their Possible Role in the Regulation of Rna Synthesis." Proc Natl Acad Sci U S A 51: 786-794. Andrade, F., H. G. Bull, N. A. Thornberry, G. W. Ketner, L. A. Casciola-Rosen and A. Rosen (2001). "Adenovirus L4-100K Assembly Protein Is a Granzyme B Substrate that Potently Inhibits Granzyme B-Mediated Cell Death." Immunity 14(6): 751-761. Atkinson, M. R. and A. W. Murray (1967). "Regulation of adenylate deaminase from Ehrlich ascites- tumour cells by a phosphonate analogue of adenosine triphosphate." Biochem J 104(1): 10C- 12C. Bagga, P. S., G. K. Arhin and J. Wilusz (1998). "DSEF-1 is a member of the hnRNP H family of RNA-binding proteins and stimulates pre-mRNA cleavage and polyadenylation in vitro." Nucleic Acids Res 26(23): 5343-5350. Baldwin, R. M., A. Morettin and J. Cote (2014). "Role of PRMTs in cancer: Could minor isoforms be leaving a mark?" World J Biol Chem 5(2): 115-129. Barral, P. M., A. Rusch, A. S. Turnell, P. H. Gallimore, P. J. Byrd, T. Dobner and R. J. Grand (2005). "The interaction of the hnRNP family member E1B-AP5 with p53." FEBS Lett 579(13): 2752-2758. Bedford, M. T. (2007). "Arginine methylation at a glance." J Cell Sci 120(Pt 24): 4243-4246. Bedford, M. T. and S. G. Clarke (2009). "Protein arginine methylation in mammals: who, what, and why." Mol Cell 33(1): 1-13. Bergmann, S., B. Royer-Pokora, E. Fietze, K. Jürchott, B. Hildebrandt, D. Trost, F. Leenders, J.-C. Claude, F. Theuring, R. Bargou, M. Dietel and H.-D. Royer (2005). "YB-1 Provokes Breast Cancer through the Induction of Chromosomal Instability That Emerges from Mitotic Failure and Centrosome Amplification." Cancer Research 65(10): 4078-4087. Blackford, A. N., R. K. Bruton, O. Dirlik, G. S. Stewart, A. M. Taylor, T. Dobner, R. J. Grand and A. S. Turnell (2008). "A role for E1B-AP5 in ATR signalling pathways during adenovirus infection." J Virol 82(15): 7640-7652. Bode, J., S. Goetze, H. Heng, S. A. Krawetz and C. Benham (2003). "From DNA structure to gene expression: mediators of nuclear compartmentalization and dynamics." Chromosome Research 11(5): 435-445. Boisvert, F. M., J. Cote, M. C. Boulanger, P. Cleroux, F. Bachand, C. Autexier and S. Richard (2002). "Symmetrical dimethylarginine methylation is required for the localization of SMN in Cajal bodies and pre-mRNA splicing." J Cell Biol 159(6): 957-969. Boisvert, F. M., U. Dery, J. Y. Masson and S. Richard (2005). "Arginine methylation of MRE11 by PRMT1 is required for DNA damage checkpoint control." Genes Dev 19(6): 671-676. Boisvert, F. M., U. Dery, J. Y. Masson and S. Richard (2005). "[A new role for arginine methylation in DNA repair]." Med Sci (Paris) 21(6-7): 579-581. Boisvert, F. M., M. J. Hendzel, J. Y. Masson and S. Richard (2005). "Methylation of MRE11 regulates its nuclear compartmentalization." Cell Cycle 4(7): 981-989.

Boisvert, F. M., A. Rhie, S. Richard and A. J. Doherty (2005). "The GAR motif of 53BP1 is arginine methylated by PRMT1 and is necessary for 53BP1 DNA binding activity." Cell Cycle 4(12): 1834-1841. Busa, R., R. Geremia and C. Sette (2010). "Genotoxic stress causes the accumulation of the splicing regulator Sam68 in nuclear foci of transcriptionally active chromatin." Nucleic Acids Res 38(9): 3005-3018. Butler, M. G., A. V. Gore and B. M. Weinstein (2011). "Zebrafish as a model for hemorrhagic stroke." Methods Cell Biol 105: 137-161. Caldecott, K. W. (2008). "Single-strand break repair and genetic disease." Nat Rev Genet 9(8): 619- 631. Cammas, A., S. M. Lewis, S. Vagner and M. Holcik (2008). "Post-transcriptional control of gene expression through subcellular relocalization of mRNA binding proteins." Biochem Pharmacol 76(11): 1395-1403. Carpenter, B., C. MacKay, A. Alnabulsi, M. MacKay, C. Telfer, W. T. Melvin and G. I. Murray (2006). "The roles of heterogeneous nuclear ribonucleoproteins in tumour development and progression." Biochim Biophys Acta 1765(2): 85-100. Chen, D., S. M. Huang and M. R. Stallcup (2000). "Synergistic, p160 coactivator-dependent enhancement of estrogen receptor function by CARM1 and p300." J Biol Chem 275(52): 40810- 40816. Cheung, A. M., T. S. Wan, J. C. Leung, L. Y. Chan, H. Huang, Y. L. Kwong, R. Liang and A. Y. Leung (2007). "Aldehyde dehydrogenase activity in leukemic blasts defines a subgroup of acute myeloid leukemia with adverse prognosis and superior NOD/SCID engrafting potential." Leukemia 21(7): 1423-1430. Chrzanowska, K., H. Gregorek, B. Dembowska-Baginska, M. Kalina and M. Digweed (2012). "Nijmegen breakage syndrome (NBS)." Orphanet Journal of Rare Diseases 7(1): 13. Ciccia, A. and S. J. Elledge (2010). "The DNA damage response: making it safe to play with knives." Mol Cell 40(2): 179-204. Cote, J., F. M. Boisvert, M. C. Boulanger, M. T. Bedford and S. Richard (2003). "Sam68 RNA binding protein is an in vivo substrate for protein arginine N-methyltransferase 1." Mol Biol Cell 14(1): 274-287. Daley, J. M., Y. Kwon, H. Niu and P. Sung (2013). "Investigations of homologous recombination pathways and their regulation." Yale J Biol Med 86(4): 453-461. de Hoog, C. L., L. J. Foster and M. Mann (2004). "RNA and RNA binding proteins participate in early stages of cell spreading through spreading initiation centers." Cell 117(5): 649-662. Dillon, M. B., H. L. Rust, P. R. Thompson and K. A. Mowen (2013). "Automethylation of protein arginine methyltransferase 8 (PRMT8) regulates activity by impeding S-adenosylmethionine sensitivity." J Biol Chem 288(39): 27872-27880. Dobner, T. and J. Kzhyshkowska (2001). "Nuclear export of adenovirus RNA." Curr Top Microbiol Immunol 259: 25-54. Donate, L. E. and M. A. Blasco (2011). "Telomeres in cancer and ageing." Philosophical Transactions of the Royal Society B: Biological Sciences 366(1561): 76-84. Dreyfuss, G. (1986). "Structure and function of nuclear and cytoplasmic ribonucleoprotein particles." Annu Rev Cell Biol 2: 459-498. Dutertre, M., S. Lambert, A. Carreira, M. Amor-Gueret and S. Vagner (2014). "DNA damage: RNA- binding proteins protect from near and far." Trends Biochem Sci 39(3): 141-149.

Eggert, M., J. Michel, S. Schneider, H. Bornfleth, A. Baniahmad, F. O. Fackelmayer, S. Schmidt and R. Renkawitz (1997). "The glucocorticoid receptor is associated with the RNA-binding nuclear matrix protein hnRNP U." J Biol Chem 272(45): 28471-28478. Elmore, S. (2007). "Apoptosis: a review of programmed cell death." Toxicol Pathol 35(4): 495-516. Fackelmayer, F. O., K. Dahm, A. Renz, U. Ramsperger and A. Richter (1994). "Nucleic-acid-binding properties of hnRNP-U/SAF-A, a nuclear-matrix protein which binds DNA and RNA in vivo and in vitro." Eur J Biochem 221(2): 749-757. Falck, J., N. Mailand, R. G. Syljuasen, J. Bartek and J. Lukas (2001). "The ATM-Chk2-Cdc25A checkpoint pathway guards against radioresistant DNA synthesis." Nature 410(6830): 842-847. Ferguson, D. O. and F. W. Alt (2001). "DNA double strand break repair and chromosomal translocation: lessons from animal models." Oncogene 20(40): 5572-5579. Finn, K., N. F. Lowndes and M. Grenon (2012). "Eukaryotic DNA damage checkpoint activation in response to double-strand breaks." Cell Mol Life Sci 69(9): 1447-1473. Ford, L. P., W. E. Wright and J. W. Shay (2002). "A model for heterogeneous nuclear ribonucleoproteins in telomere and telomerase regulation." Oncogene 21(4): 580-583. Frankel, A., N. Yadav, J. Lee, T. L. Branscombe, S. Clarke and M. T. Bedford (2002). "The novel human protein arginine N-methyltransferase PRMT6 is a nuclear enzyme displaying unique substrate specificity." J Biol Chem 277(5): 3537-3543. Friesen, W. J., S. Massenet, S. Paushkin, A. Wyce and G. Dreyfuss (2001). "SMN, the product of the spinal muscular atrophy gene, binds preferentially to dimethylarginine-containing protein targets." Mol Cell 7(5): 1111-1117. Gabler, S., H. Schutt, P. Groitl, H. Wolf, T. Shenk and T. Dobner (1998). "E1B 55-kilodalton- associated protein: a cellular protein with RNA-binding activity implicated in nucleocytoplasmic transport of adenovirus and cellular mRNAs." J Virol 72(10): 7960-7971. Garneau, D., T. Revil, J. F. Fisette and B. Chabot (2005). "Heterogeneous nuclear ribonucleoprotein F/H proteins modulate the alternative splicing of the apoptotic mediator Bcl-x." J Biol Chem 280(24): 22641-22650. Gary, J. D. and S. Clarke (1998). "RNA and protein interactions modulated by protein arginine methylation." Prog Nucleic Acid Res Mol Biol 61: 65-131. Gaudreault, I., D. Guay and M. Lebel (2004). "YB-1 promotes strand separation in vitro of duplex DNA containing either mispaired bases or cisplatin modifications, exhibits endonucleolytic activities and binds several DNA repair proteins." Nucleic Acids Res 32(1): 316-327. Glisovic, T., J. L. Bachorik, J. Yong and G. Dreyfuss (2008). "RNA-binding proteins and post- transcriptional gene regulation." FEBS Lett 582(14): 1977-1986. Goehring, C. and A. Morabia (1997). "Epidemiology of benign breast disease, with special attention to histologic types." Epidemiol Rev 19(2): 310-327. Goulet, I., G. Gauvin, S. Boisvenue and J. Cote (2007). "Alternative splicing yields protein arginine methyltransferase 1 isoforms with distinct activity, substrate specificity, and subcellular localization." J Biol Chem 282(45): 33009-33021. Gros, L., C. Delaporte, S. Frey, J. Decesse, B. R. de Saint-Vincent, L. Cavarec, A. Dubart, A. V. Gudkov and A. Jacquemin-Sablon (2003). "Identification of new drug sensitivity genes using genetic suppressor elements: protein arginine N-methyltransferase mediates cell sensitivity to DNA-damaging agents." Cancer Res 63(1): 164-171.

Guendel, I., L. Carpio, C. Pedati, A. Schwartz, C. Teal, F. Kashanchi and K. Kehn-Hall (2010). "Methylation of the tumor suppressor protein, BRCA1, influences its transcriptional cofactor function." PLoS One 5(6): e11379. Guo, Z., L. Zheng, H. Xu, H. Dai, M. Zhou, M. R. Pascua, Q. M. Chen and B. Shen (2010). "Methylation of FEN1 suppresses nearby phosphorylation and facilitates PCNA binding." Nat Chem Biol 6(10): 766-773. Haince, J. F., D. McDonald, A. Rodrigue, U. Dery, J. Y. Masson, M. J. Hendzel and G. G. Poirier (2008). "PARP1-dependent kinetics of recruitment of MRE11 and NBS1 proteins to multiple DNA damage sites." J Biol Chem 283(2): 1197-1208. Hakem, R. (2008). "DNA-damage repair; the good, the bad, and the ugly." Embo j 27(4): 589-605. Harper, J. W. and S. J. Elledge (2007). "The DNA damage response: ten years after." Mol Cell 28(5): 739-745. Hayes, B. W., G. C. Telling, M. M. Myat, J. F. Williams and S. J. Flint (1990). "The adenovirus L4 100-kilodalton protein is necessary for efficient translation of viral late mRNA species." J Virol 64(6): 2732-2742. He, Y., M. A. Brown, J. A. Rothnagel, N. A. Saunders and R. Smith (2005). "Roles of heterogeneous nuclear ribonucleoproteins A and B in cell proliferation." J Cell Sci 118(Pt 14): 3173-3183. He, Z. Y., C. B. Shi, H. Wen, F. L. Li, B. L. Wang and J. Wang (2011). "Upregulation of p53 expression in patients with colorectal cancer by administration of curcumin." Cancer Invest 29(3): 208-213. Herrmann, F., M. Bossert, A. Schwander, E. Akgun and F. O. Fackelmayer (2004). "Arginine methylation of scaffold attachment factor A by heterogeneous nuclear ribonucleoprotein particle- associated PRMT1." J Biol Chem 279(47): 48774-48779. Hong, Z., J. Jiang, J. Ma, S. Dai, T. Xu, H. Li and A. Yasui (2013). "The role of hnRPUL1 involved in DNA damage response is related to PARP1." PLoS One 8(4): e60208. Huen, M. S. and J. Chen (2010). "Assembly of checkpoint and repair machineries at DNA damage sites." Trends Biochem Sci 35(2): 101-108. Iwanaga, K., N. Sueoka, A. Sato, S. Hayashi and E. Sueoka (2005). "Heterogeneous nuclear ribonucleoprotein B1 protein impairs DNA repair mediated through the inhibition of DNA- dependent protein kinase activity." Biochem Biophys Res Commun 333(3): 888-895. Jackson, S. P. and J. Bartek (2009). "The DNA-damage response in human biology and disease." Nature 461(7267): 1071-1078. Jagtap, P. and C. Szabo (2005). "Poly(ADP-ribose) polymerase and the therapeutic effects of its inhibitors." Nat Rev Drug Discov 4(5): 421-440. Jansson, M., S. T. Durant, E. C. Cho, S. Sheahan, M. Edelmann, B. Kessler and N. B. La Thangue (2008). "Arginine methylation regulates the p53 response." Nat Cell Biol 10(12): 1431-1439. Katsanis, N., M.-L. Yaspo and E. C. Fisher (1997). "Identification and mapping of a novel human gene, HRMT1L1, homologous to the rat protein arginine N-methyltransferase 1 (PRMT1) gene." Mammalian Genome 8(7): 526-529. Kerzendorfer, C. and M. O’Driscoll (2009). "Human DNA damage response and repair deficiency syndromes: Linking genomic instability and cell cycle checkpoint proficiency." DNA Repair 8(9): 1139-1152. Kim, J. H., K. Y. Paek, K. Choi, T. D. Kim, B. Hahm, K. T. Kim and S. K. Jang (2003). "Heterogeneous nuclear ribonucleoprotein C modulates translation of c-myc mRNA in a cell cycle phase-dependent manner." Mol Cell Biol 23(2): 708-720.

Krapivinsky, G., W. Pu, K. Wickman, L. Krapivinsky and D. E. Clapham (1998). "pICln binds to a mammalian homolog of a yeast protein involved in regulation of cell morphology." J Biol Chem 273(18): 10811-10814. Krecic, A. M. and M. S. Swanson (1999). "hnRNP complexes: composition, structure, and function." Curr Opin Cell Biol 11(3): 363-371. Kzhyshkowska, J., E. Kremmer, M. Hofmann, H. Wolf and T. Dobner (2004). "Protein arginine methylation during lytic adenovirus infection." Biochem J 383(Pt 2): 259-265. Kzhyshkowska, J., A. Rusch, H. Wolf and T. Dobner (2003). "Regulation of transcription by the heterogeneous nuclear ribonucleoprotein E1B-AP5 is mediated by complex formation with the novel bromodomain-containing protein BRD7." Biochem J 371(Pt 2): 385-393. Kzhyshkowska, J., H. Schutt, M. Liss, E. Kremmer, R. Stauber, H. Wolf and T. Dobner (2001). "Heterogeneous nuclear ribonucleoprotein E1B-AP5 is methylated in its Arg-Gly-Gly (RGG) box and interacts with human arginine methyltransferase HRMT1L1." Biochem J 358(Pt 2): 305- 314. Lakowski, T. M. and A. Frankel (2009). "A kinetic study of human protein arginine N- methyltransferase 6 reveals a distributive mechanism." J Biol Chem 283(15): 10015-10025. Le Romancer, M., I. Treilleux, N. Leconte, Y. Robin-Lespinasse, S. Sentis, K. Bouchekioua- Bouzaghou, S. Goddard, S. Gobert-Gosse and L. Corbo (2008). "Regulation of estrogen rapid signalling through arginine methylation by PRMT1." Mol Cell 31(2): 212-221. Lee, J. and M. T. Bedford (2002). "PABP1 identified as an arginine methyltransferase substrate using high-density protein arrays." EMBO Rep 3(3): 268-273. Lee, J., J. Sayegh, J. Daniel, S. Clarke and M. T. Bedford (2005). "PRMT8, a new membrane-bound tissue-specific member of the protein arginine methyltransferase family." J Biol Chem 280(38): 32890-32896. Liu, T. and J. Huang (2014). "Quality control of homologous recombination." Cell Mol Life Sci. Lord, C. J. and A. Ashworth (2012). "The DNA damage response and cancer therapy." Nature 481(7381): 287-294. Lukong, K. E., K.-w. Chang, E. W. Khandjian and S. Richard (2008). "RNA-binding proteins in human genetic disease." Trends in Genetics 24(8): 416-425. Lunde, B. M., C. Moore and G. Varani (2007). "RNA-binding proteins: modular design for efficient function." Nat Rev Mol Cell Biol 8(6): 479-490. Marechal, A. and L. Zou (2013). "DNA damage sensing by the ATM and ATR kinases." Cold Spring Harb Perspect Biol 5(9). Mathioudaki, K., A. Scorilas, A. Ardavanis, P. Lymberi, E. Tsiambas, M. Devetzi, A. Apostolaki and M. Talieri (2011). "Clinical evaluation of PRMT1 gene expression in breast cancer." Tumour Biol 32(3): 575-582. Najbauer, J., B. A. Johnson, A. L. Young and D. W. Aswad (1993). "Peptides with sequences similar to glycine, arginine-rich motifs in proteins interacting with RNA are efficiently recognized by methyltransferase(s) modifying arginine in numerous proteins." J Biol Chem 268(14): 10501- 10509. Nicholson, T. B., T. Chen and S. Richard (2009). "The physiological and pathophysiological role of PRMT1-mediated protein arginine methylation." Pharmacol Res 60(6): 466-474. Nyberg, P., L. Xie and R. Kalluri (2005). "Endogenous inhibitors of angiogenesis." Cancer Res 65(10): 3967-3979.

Pawlak, M. R., C. A. Scherer, J. Chen, M. J. Roshon and H. E. Ruley (2000). "Arginine N- methyltransferase 1 is required for early postimplantation mouse development, but cells deficient in the enzyme are viable." Mol Cell Biol 20(13): 4859-4869. Piccolo, L. L., D. Corona and M. C. Onorati (2014). "Emerging Roles for hnRNPs in post- transcriptional regulation: what can we learn from flies?" Chromosoma. Pinol-Roma, S., Y. D. Choi, M. J. Matunis and G. Dreyfuss (1988). "Immunopurification of heterogeneous nuclear ribonucleoprotein particles reveals an assortment of RNA-binding proteins." Genes Dev 2(2): 215-227. Polo, S. E., A. N. Blackford, J. R. Chapman, L. Baskcomb, S. Gravel, A. Rusch, A. Thomas, R. Blundred, P. Smith, J. Kzhyshkowska, T. Dobner, A. M. Taylor, A. S. Turnell, G. S. Stewart, R. J. Grand and S. P. Jackson (2012). "Regulation of DNA-end resection by hnRNPU-like proteins promotes DNA double-strand break signalling and repair." Mol Cell 45(4): 505-516. Proudfoot, N. and J. O'Sullivan (2002). "Polyadenylation: a tail of two complexes." Curr Biol 12(24): R855-857. Qi, C., J. Chang, Y. Zhu, A. V. Yeldandi, S. M. Rao and Y. J. Zhu (2002). "Identification of protein arginine methyltransferase 2 as a coactivator for estrogen receptor alpha." J Biol Chem 277(32): 28624-28630. Rich, T., R. L. Allen and A. H. Wyllie (2000). "Defying death after DNA damage." Nature 407(6805): 777-783. Royer, C. and X. Lu (2011). "Epithelial cell polarity: a major gatekeeper against cancer[quest]." Cell Death Differ 18(9): 1470-1477. Schenk, D., I. Lieberburg, R. Motter and P. Seubert (1996). "The effect of apolipoprotein E genotype on biochemical markers of Alzheimer's disease." Ann N Y Acad Sci 802: 92-100. Schreiber, V., F. Dantzer, J. C. Ame and G. de Murcia (2006). "Poly(ADP-ribose): novel functions for an old molecule." Nat Rev Mol Cell Biol 7(7): 517-528. Seligson, D. B., S. Horvath, T. Shi, H. Yu, S. Tze, M. Grunstein and S. K. Kurdistani (2005). "Global histone modification patterns predict risk of prostate cancer recurrence." Nature 435(7046): 1262-1266. Sharma, A., K. Singh and A. Almasan (2012). "Histone H2AX phosphorylation: a marker for DNA damage." Methods Mol Biol 920: 613-626. Shia, W. J., A. J. Okumura, M. Yan, A. Sarkeshik, M. C. Lo, S. Matsuura, Y. Komeno, X. Zhao, S. D. Nimer, J. R. Yates, 3rd and D. E. Zhang (2012). "PRMT1 interacts with AML1-ETO to promote its transcriptional activation and progenitor cell proliferative potential." Blood 119(21): 4953-4962. Shih, S. C. and K. P. Claffey (1999). "Regulation of human vascular endothelial growth factor mRNA stability in hypoxia by heterogeneous nuclear ribonucleoprotein L." J Biol Chem 274(3): 1359-1365. Strahl, B. D., S. D. Briggs, C. J. Brame, J. A. Caldwell, S. S. Koh, H. Ma, R. G. Cook, J. Shabanowitz, D. F. Hunt, M. R. Stallcup and C. D. Allis (2001). "Methylation of histone H4 at arginine 3 occurs in vivo and is mediated by the nuclear receptor coactivator PRMT1." Curr Biol 11(12): 996-1000. Stucki, M., J. A. Clapperton, D. Mohammad, M. B. Yaffe, S. J. Smerdon and S. P. Jackson (2005). "MDC1 directly binds phosphorylated histone H2AX to regulate cellular responses to DNA double-strand breaks." Cell 123(7): 1213-1226.

Tang, J., J. D. Gary, S. Clarke and H. R. Herschman (1998). "PRMT 3, a type I protein arginine N- methyltransferase that differs from PRMT1 in its oligomerization, subcellular localization, substrate specificity, and regulation." J Biol Chem 273(27): 16935-16945. Tang, J., P. N. Kao and H. R. Herschman (2000). "Protein-arginine methyltransferase I, the predominant protein-arginine methyltransferase in cells, interacts with and is regulated by interleukin enhancer-binding factor 3." J Biol Chem 275(26): 19866-19876. Tarsounas, M., D. Davies and S. C. West (2003). "BRCA2-dependent and independent formation of RAD51 nuclear foci." Oncogene 22(8): 1115-1123. Tee, W. W., M. Pardo, T. W. Theunissen, L. Yu, J. S. Choudhary, P. Hajkova and M. A. Surani (2010). "Prmt5 is essential for early mouse development and acts in the cytoplasm to maintain ES cell pluripotency." Genes Dev 24(24): 2772-2777. Teyssier, C., D. Chen and M. R. Stallcup (2002). "Requirement for multiple domains of the protein arginine methyltransferase CARM1 in its transcriptional coactivator function." J Biol Chem 277(48): 46066-46072. Thandapani, P., T. R. O'Connor, T. L. Bailey and S. Richard (2013). "Defining the RGG/RG motif." Mol Cell 50(5): 613-623. Tzifi, F., C. Economopoulou, D. Gourgiotis, A. Ardavanis, S. Papageorgiou and A. Scorilas (2012). "The Role of BCL2 Family of Apoptosis Regulator Proteins in Acute and Chronic Leukemias." Adv Hematol 2012: 524308. Wang, H., Z. Q. Huang, L. Xia, Q. Feng, H. Erdjument-Bromage, B. D. Strahl, S. D. Briggs, C. D. Allis, J. Wong, P. Tempst and Y. Zhang (2001). "Methylation of histone H4 at arginine 3 facilitating transcriptional activation by nuclear hormone receptor." Science 293(5531): 853-857. Weiss, V. H., A. E. McBride, M. A. Soriano, D. J. Filman, P. A. Silver and J. M. Hogle (2000). "The structure and oligomerization of the yeast arginine methyltransferase, Hmt1." Nat Struct Biol 7(12): 1165-1171. Xiao, R., P. Tang, B. Yang, J. Huang, Y. Zhou, C. Shao, H. Li, H. Sun, Y. Zhang and X. Fu (2012). "Nuclear Matrix Factor hnRNP U/SAF-A Exerts a Global Control of Alternative Splicing by Regulating U2 snRNP Maturation." Molecular Cell 45(5): 656-668. Yang, Y. and M. T. Bedford (2013). "Protein arginine methyltransferases and cancer." Nat Rev Cancer 13(1): 37-50. Yoshimatsu, M., G. Toyokawa, S. Hayami, M. Unoki, T. Tsunoda, H. I. Field, J. D. Kelly, D. E. Neal, Y. Maehara, B. A. Ponder, Y. Nakamura and R. Hamamoto (2011). "Dysregulation of PRMT1 and PRMT6, Type I arginine methyltransferases, is involved in various types of human cancers." Int J Cancer 128(3): 562-573. Yu, Z., T. Chen, J. Hebert, E. Li and S. Richard (2009). "A mouse PRMT1 null allele defines an essential role for arginine methylation in genome maintenance and cell proliferation." Mol Cell Biol 29(11): 2982-2996. Yu, Z., G. Vogel, Y. Coulombe, D. Dubeau, E. Spehalski, J. Hebert, D. O. Ferguson, J. Y. Masson and S. Richard (2012). "The MRE11 GAR motif regulates DNA double-strand break processing and ATR activation." Cell Res 22(2): 305-320. Zhang, X. and X. Cheng (2003). "Structure of the predominant protein arginine methyltransferase PRMT1 and analysis of its binding to substrate peptides." Structure 11(5): 509-520. Zhang, X., L. Zhou and X. Cheng (2000). "Crystal structure of the conserved core of protein arginine methyltransferase PRMT3." EMBO J 19(14): 3509-3519.

Zheng, Z., K. M. Schmidt-Ott, S. Chua, K. A. Foster, R. Z. Frankel, P. Pavlidis, J. Barasch, V. D. D'Agati and A. G. Gharavi (2005). "A Mendelian locus on chromosome 16 determines susceptibility to doxorubicin nephropathy in the mouse." Proc Natl Acad Sci U S A 102(7): 2502-2507. Zhou, B. B. and S. J. Elledge (2000). "The DNA damage response: putting checkpoints in perspective." Nature 408(6811): 433-439. Zhu, J., S. Zhang, J. Jiang and X. Chen (2000). "Definition of the p53 functional domains necessary for inducing apoptosis." J Biol Chem 275(51): 39927-39934. Zou, L. and S. J. Elledge (2003). "Sensing DNA damage through ATRIP recognition of RPA-ssDNA complexes." Science 300(5625): 1542-1548. Zou, Y., Y. Liu, X. Wu and S. M. Shell (2006). "Functions of human replication protein A (RPA): from DNA replication to DNA damage and stress responses." J Cell Physiol 208(2): 267-273. Zurita-Lopez, C. I., T. Sandberg, R. Kelly and S. G. Clarke (2012). "Human protein arginine methyltransferase 7 (PRMT7) is a type III enzyme forming omega-NG-monomethylated arginine residues." J Biol Chem 287(11): 7859-7870.