Oncogene (2014) 33, 5546–5558 & 2014 Macmillan Publishers Limited All rights reserved 0950-9232/14 www.nature.com/onc ORIGINAL ARTICLE Nuclear loss of protein arginine N-methyltransferase 2 in breast carcinoma is associated with tumor grade and overexpression of cyclin D1 protein J Zhong1,3, R-X Cao1,2,3, J-H Liu1,2, Y-B Liu1, J Wang1, L-P Liu1, Y-J Chen1, J Yang1,2, Q-H Zhang1,YWu1, W-J Ding1, T Hong1,2, X-H Xiao1,2, X-Y Zu1 and G-B Wen1 Human protein arginine N-methyltransferase 2 (PRMT2, HRMT1L1) is a protein that belongs to the arginine methyltransferase family, and it has diverse roles in transcriptional regulation through different mechanisms depending on its binding partners. In this study, we provide evidences for the negative effect of PRMT2 on breast cancer cell proliferation in vitro and in vivo. Morever, cyclin D1, one of the key modulators of cell cycle, was found to be downregulated by PRMT2, and PRMT2 was further shown to suppress the estrogen receptor a-binding affinity to the activator protein-1 (AP-1) site in cyclin D1 promoter through indirect binding with AP-1 site, resulting in the inhibition of cyclin D1 promoter activity in MCF-7 cells. Furthermore, a positive correlation between the expression of PRMT2 and cyclin D1 was confirmed in the breast cancer tissues by using tissue microarray assay. In addition, PRMT2 was found to show a high absent percentage in breast caner cell nuclei and the nuclear loss ratio of PRMT2 was demonstrated to positively correlate with cyclin D1 expression and the increasing tumor grade of invasive ductal carcinoma. Those results offer an essential insight into the effect of PRMT2 on breast carcinogenesis, and PRMT2 nuclear loss might be an important biological marker for the diagnosis of breast cancer. Oncogene (2014) 33, 5546–5558; doi:10.1038/onc.2013.500; published online 2 December 2013 Keywords: nuclear loss; PRMT2; cyclin D1; breast cancer INTRODUCTION fetal brain, and to enhance androgen receptor-mediated Estrogen receptor a (ERa) is a transcription factor and engaged in a transactivation dependent on the cellular background.16 Recently, broad range of biological processes, including cell proliferation, PRMT2 has been demonstrated to have weak methyltransferase differentiation, morphogenesis and apoptosis,1–3 as well as the activity on a histone H4 substrate, but its optimal substrates have not development and progression of breast cancer.4 ERa-mediated yet been identified.17,18 A series of reports show that PRMT2 is clearly transcription is through binding directly to specific estrogen involved in a variety of cellular processes, including lung function, response elements (EREs) in the promoters of responsive genes5 or the inflammatory response, apoptosis promotion, Wnt signaling and via protein–protein interaction with other promoter-bound tran- leptin signaling regulation,19–23 suggesting that PRMT2 has diverse 6 7 scription factors, such as specificity protein 1 (Sp1), AP-1 or roles in transcriptional regulation through different mechanisms 8 nuclear factor-kB. In either case, coactivators or corepressors are depending on its binding partners. further recruited to form a functional receptor complex that In previous study, we identified that PRMT2 is capable of 9 specifies transcriptional activities of downstream targets. Cyclin binding to ERa both in vitro and in vivo, and we showed that D1 (CCND1) is a D-type cyclin that regulates G1-S cell cycle PRMT2 expression was higher in human breast tumors when progression during cell proliferation. CCND1 is also E2/ERa compared with adjacent normal tissue, suggesting a role for responsive and is thought to have major roles in breast PRMT2 in breast tumorigenesis.24 To further understand the 10,11 cancer. However, there is no classical ERE in the CCND1 physiological function of PRMT2, as well as its potential role in the promoter, and the contribution of E2/ERa to CCND1 action in development and progression of breast cancer, MCF7 breast 12 breast cells remains unclear. The roles of CCND1 transcription cancer cells with high level of PRMT2 expression was used for a regulation in breast tumorigenesis need to be further defined. loss-of-function cell model by artificial microRNA (miRNA) based Human protein arginine N-methyltransferase 2 (PRMT2, HRMT1L1) on the murine miR-155 sequence.25 This study provides evidences is a protein that belongs to the arginine methyltransferase family and for the negative effect of PRMT2 on breast cancer cell contains a highly conserved catalytic Ado-Met-binding domain and proliferation, uncovers the molecular mechanism of PRMT2 unique Src homology 3 domain that binds proteins with proline-rich regulating the expression of CCND1, which accounts for PRMT2- motifs.13,14 Initially, PRMT2 enhances ERa-mediated transactivation in induced proliferation suppression in breast cancer cells, and CV-1 cells,15 and subsequent research showed that PRMT2 was found demonstrates the correlation between PRMT2 nuclear loss and to be aberrantly expressed in skeletal muscle, ovary, prostate and grade of invasive ductal breast carcinoma. 1Institute of Clinical Medicine, First Affiliated Hospital of University of South China, Hengyang, PR China and 2Department of Metabolism and Endocrinology, First Affiliated Hospital of University of South China, Hengyang, PR China. Correspondence: Dr X-Y Zu or G-B Wen, Institute of Clinical Medicine, First Affiliated Hospital of University of South China, 69 chuanshan Road, Hengyang 421001, China. E-mail: [email protected] or [email protected] 3The first two authors contributed equally to this work. Received 30 April 2013; revised 17 September 2013; accepted 18 October 2013; published online 2 December 2013 PRMT2 nuclear loss correlates with cyclin D1 overexpression J Zhong et al 5547 RESULTS to evaluate knockdown of PRMT2 mRNA, real-time PCR was miRNA induced downregulation of PRMT2 expression in breast performed, and as shown in Figure 1d, PRMT2 mRNA levels in cancer cells MCF7 cells with PRMT2-miRNAs were reduced by almost 80% and Initially, experiments were performed to select the best miRNA to 70% respectively, as compared with those in control cells. knockdown PRMT2 expression. A pcDNA6.2-GW/EmGFP-miR- based miRNA expression plasmid with a pre-miRNA sequence was constructed and transfected to MCF7 cells. Two kinds of Suppression of PRMT2 expression promotes the cell proliferation miRNA were designed to test their inhibitory effect on PRMT2 and colony formation of MCF7 cells expression in MCF7 cells. PRMT2-miRNA1 was targeted to exon 4 We next examined the effect of miRNA-induced PRMT2 down- of PRMT2, and PRMT2-miRNA2 was targeted to exon 9 of PRMT2 regulation on the proliferation ability of MCF7 cells. Without (Figure 1a). Stable cell lines with the PRMT2-miRNAs were treatment of 17b-Estradiol (E2), MCF7 cells carrying PRMT2- obtained after the transfected MCF7 cells were selected by miRNA1, PRMT2-miRNA2 or LacZ-miRNA showed no significant blasticidin for 2 weeks (Supplementary Figure S1). Immuno- difference in their growth rates at the indicated time points fluorescence staining and western blotting were performed to (Figure 2a). Whereas, MCF7 cells with either PRMT2-miRNA1 or verify the expression of PRMT2 in the transfected MCF7 cells. The PRMT2-miRNA2 showed markedly increased proliferate ability cells with the pre-miRNA sequence against PRMT2 showed compared with that of cells with LacZ-miRNA, when treated with significantly decreased expression of PRMT2 compared with 10 nM E2 for 5 days (Figure 2b). We speculated that suppression of control cells with LacZ-miRNA (Figures 1b and c). Furthermore, endogenous PRMT2 expression could increase responsiveness of Antisense target sequence miRNA loop Sense target sequence Overhang (Mature miRNA Sequence) derived from miR-155 (nucleotides 1-8 and 11-21 PRMT2-miR1 5’-TGCTGTGGAAGTGGACGCTAAACCAGGTTTTGGCCACTGACTGACCTGGTTTAGTCCACTTCCA-3’ 3’- CACCTTCACCTGCGATTTGGTCCAAAACCGGTGACTGACTGGACCAAATCAGGTGAAGGTGTCC-5’ PRMT2-miR2 5’-TGCTGTCTTCATCCTGCCACGTGTCCGTTTTGGCCACTGACTGACGGACACGTCAGGATGAAGA-3’ 3’-CAGAAGTAGGACGGTGCACAGGCAAAACCGGTGACTGACTGCCTGTGCAGTCCTACTTCTGTCC-5’ GFP PRMT2 DAPI Merge LacZ-miRNA PRMT2-miR1 PRMT2-miR2 1000 800 600 LacZ-miRNAPRMT2-miR1PRMT2-miR2 400 PRMT2 200 0 -actin to PRMT2-miRNA cells PRMT2 expressive folds of LacZ-miRNA cells compared LacZ-miRNAPRMT2-miR1PRMT2-miR2 Figure 1. Downregulation of PRMT2 in MCF7 cells with PRMT2-miRNA. (a) Pre-miRNA double-strand oligo inserted into miRNA expression vector-pcDNA 6.2-GW/EmGFP-miR. (b) MCF7 cells with either LacZ-miRNA or PRMT2-miRNA were fixed in paraformaldehyde, permeabilized with triton X-100, and were incubated with cy3-conjugated PRMT2 antibody. The cells were then stained with 4,6-diamidino-2-phenylindole (DAPI) and viewed under a Zeiss LSM 510 confocal microscope. (c) Western blot analysis of MCF7 cells transfected with PRMT2-miRNA compared with MCF7 cells with LacZ-miRNA. (d) Summary of real-time reverse transcription–PCR results of MCF7 cells transfected with PRMT2-miRNA compared with LacZ-miRNA cells. GFP, green fluorescent protein. & 2014 Macmillan Publishers Limited Oncogene (2014) 5546 – 5558 PRMT2 nuclear loss correlates with cyclin D1 overexpression J Zhong et al 5548 ) 3.0 ) LacZ-miRNA 4 LacZ-miRNA 4 8 * * PRMT2-miR1 PRMT2-miR1 PRMT2-miR2 7 PRMT2-miR2 * 2.5 6 5 4 2.0 3 2 Cell numbers (x 10 Cell numbers 1.5 (x 10 Cell numbers 1 1234567 1 234567 (days) (days) 0.85 LacZ-miRNA 1.0 LacZ-miRNA PRMT2-miR1 PRMT2-miR1 0.80 PRMT2-miR2 PRMT2-miR2 * * 0.8 * 0.75 0.6 OD/well OD/well 0.70 0.4 0.65 -11 -10 -9 -8 -7 -6 1234567 E2 (M/L) 010 10 10 10 10 10 (days) LacZ-miRNA PRMT2-miR1 PRMT2-miR2 - E2 + E 160 * 2 140 * 120 -E2 100 80 60 40 Colony numbers Colony 20 +E2 0 LacZ-miRNA PRMT2-miR1PRMT2-miR2 Figure 2. Suppression of PRMT2 expression promotes the cell proliferation and colony formation of MCF7 cells. (a and b) Logarithmic population of the MCF7 cells expressing LacZ-miRNA, PRMT2-miR1 or PRMT2-miR2 without (a) or with 10 nM E2 (b).