Emily F. McDonald: GABA Receptors in Human Sclera

Expression of GABA Receptors in Human Sclera

Emily McDonald (nee Shanahan) BSc (BmedSc), Hons (Microbiol)

The School of Optometry and Vision Science, Faculty of Health, Vision Improvement Domain, Institute of Health and Biomedical Innovation, Queensland University of Technology

A thesis submitted in fulfilment of the requirements for the Degree of Master of Applied Science (Research)

2014 Emily F. McDonald: GABA Receptors in Human Sclera

Keywords

Choroid Cultured Human Scleral Cells Eye Flow Cytometry Gamma‐Aminobutyric Acid (GABA) GABA Receptors Immunohistochemistry mRNA Reverse‐Transcriptase Polymerase Chain Reaction Retina Retinal Pigment Epithelium Sclera

ii

Emily F. McDonald: GABA Receptors in Human Sclera

Abstract

Background: Myopia, colloquially known as short‐sightedness, is a common refractive error and is caused by elongation of the globe, i.e. axial elongation. Myopia, although predominantly caused by excessive elongation, can be associated with optical alterations. The sclera must expand to allow for this increase in size and, ultimately, must grow, or remodel, for myopia to develop. It has been found that ‐aminobutyric acid (GABA), a retinal neurotransmitter, influences eye growth and, accordingly, refractive development. In the chick model of myopia, GABA antagonists have been shown to inhibit experimental myopia and have been proposed as having a promising clinical role in the myopia treatment. Although the mechanism for this effect is unknown, it has been recently shown that GABA receptors are located in chick sclera, cornea and retinal pigment epithelium (RPE). It is well known that there are GABA receptors present in the retina, including that of humans, and that GABA is used as a retinal transmitter; however, not much is known about GABA in other ocular tissues. The aim of this study was to determine the presence or absence of GABA receptors in human scleral tissue and cultured human scleral cells, as well as choroidal/RPE and retinal tissue. Methods: Human ocular tissues were obtained from six donor eyes from the Queensland Eye Bank. Three linked experiments were undertaken (i) immunohistochemistry (IHC) on human scleral sections, (ii) reverse‐transcriptase polymerase chain reaction (RT‐PCR) of ocular tissues, and (iii) RT‐PCR and flow cytometry (Dominici et al.) of cultured scleral cells. (i) IHC was undertaken on human scleral tissue from one donor using antibodies raised against three different GABA receptor subunits previously shown to be expressed in human retinal tissue – GABAA Alpha 1, GABAC Rho 1, and GABAC Rho 2. As representative of the GABAB receptor, the following antibody was also included: GABAB R2. The antibodies were applied to the scleral sections taken from the four quadrants of the eye – superior, inferior, medial, and lateral. The tissue required bleaching due to the presence of melanocytes. (ii) Following isolation of total ribonucleic acid (RNA), RT‐PCR was undertaken to determine gene expression of all known GABA receptor subunits on human scleral tissue (n=3 eyes), choroid/RPE tissue (n=2 eyes), and retinal tissue (n=2 eyes). (iii) Scleral cells were cultured using standard techniques utilising DMEM and FBS and passaged three times. RT‐PCR was performed (n=2 eyes) and scleral cells were subsequently characterised using FC; the cells were labelled with cell surface markers CD31, CD34, CD44, CD45, CD73, CD90, CD105, GABAA‐α1, GABAB‐2, GABR‐R1, and GABR‐R2. Results: Findings from the IHC of the scleral sections (i) were inconclusive due to background staining. This may be due, at least in part, to the bleaching step (necessary due to the presence of melanocytes) which increased the basophilia of the tissue. An alternative strategy was to look at which GABA receptor genes were expressed. The gene expression component of the project (ii) revealed the presence of several GABA receptor subunits in all of the ocular tissues tested, including the cultured scleral cells (iii). The three scleral donors yielded positive RNA results for GABA subunits representing GABAA and GABAC receptors using RT‐PCR. The cultured scleral cells similarly revealed the presence of GABAA and GABAC receptor subunits and were additionally positive for GABAB. The choroid/RPE and retinal samples were also positive for GABAA and GABAC receptor subunits; one of the retinal donors also yielded a positive result for GABAB. FC showed that the scleral‐derived cells grown as fibroblasts were mesenchymal stromal cells.

iii

Emily F. McDonald: GABA Receptors in Human Sclera

Significance: This study is the first to show that GABA receptor gene expression was observed in human sclera, human cultured mesenchymal stromal cells, and the combined choroid/RPE. This finding has important implications for future research, including the role of GABA in refractive development and myopia. Knowledge of the complete profile of GABA receptor expression would identify which might be more specific targets for treatment of myopia. Furthermore, other ocular functions mediated by these receptors are yet to be determined.

iv

Emily F. McDonald: GABA Receptors in Human Sclera

TABLE OF CONTENTS

KEYWORDS ...... II ABSTRACT...... III LIST OF TABLES ...... VIII LIST OF FIGURES ...... X ABBREVIATIONS, ACRONYMS, & SYMBOLS ...... XII STATEMENT OF ORIGINAL AUTHORSHIP ...... XIV STRUCTURE OF THESIS ...... XIV ACKNOWLEDGEMENTS ...... XV 1 LITERATURE REVIEW ...... 1

1.1 INTRODUCTION ...... 1

1.2 BRIEF OVERVIEW OF THE EYE ...... 3

1.3 MYOPIA: DEFINITION, EPIDEMIOLOGY, & POSSIBLE CAUSES ...... 4

1.4 THE PROPOSED MYOPIA SIGNALLING CASCADE: WHERE THE SCLERA IS THOUGHT TO FIT IN ...... 5 1.4.1 Neural Retina: Generates Primary Signal for Myopia Development? ...... 6 1.4.2 Retinal Pigment Epithelium: Signal Relay in the Control of Eye Growth? ...... 8 1.4.3 Choroid: Responsible for Fluid Regulation ...... 10 1.4.4 Sclera: Responsible for Controlling Eye Dimensions ...... 11

1.5 ‐AMINOBUTYRIC ACID ...... 11

1.5.1 ‐Aminobutyric Acid Receptors – GABAA, GABAB, and GABAC ...... 12 1.5.2 ‐Aminobutyric Acid as a Piece in the Myopia Puzzle: GABA in Eye Growth ...... 17 1.5.3 ‐Aminobutyric Acid within the Human Eye ...... 17 1.5.4 ‐Aminobutyric Acid in Animal Models ...... 18 1.5.5 ‐Aminobutyric Acid in Fibroblasts of other Tissues ...... 21 1.5.6 Pharmacological Factors Affecting Eye Growth in Animal Models ...... 22

1.6 HUMAN SCLERA ...... 22 1.6.1 Gross Structure & Function of Sclera ...... 23 1.6.2 Composition of the Sclera ...... 24 1.6.3 Collagen ...... 26 1.6.4 Elastin ...... 26 1.6.5 Enzymes ...... 26 1.6.6 Scleral Fibroblasts ...... 29 1.6.7 Glycoproteins ...... 30 1.6.8 Growth Factors ...... 30

v

Emily F. McDonald: GABA Receptors in Human Sclera

1.6.9 Proteoglycans ...... 30 1.6.10 Other Receptor Types known to be Present in Human Sclera ...... 32 1.6.11 Factors Affecting Human Scleral Structure & Function ...... 34

1.7 SUMMARY ...... 35

1.8 RESEARCH AIMS ...... 37

2 MATERIALS AND METHODOLOGY ...... 38

2.1 HUMAN RESEARCH ETHICS ISSUES ...... 38

2.2 EYE COLLECTION ...... 38

2.3 PREPARATION FOR MICROTOMY ...... 39

2.4 MICROTOMY ...... 40

2.5 PRELIMINARY WORK: H&E AND BLEACHING OPTIMISATION ...... 40

2.6 IMMUNOHISTOCHEMISTRY: EXPERIMENT #1 ...... 43

2.7 CELL CULTURING & FLOW CYTOMETRY: EXPERIMENT #2 ...... 43

2.8 ANALYSIS OF GABA RECEPTOR GENE EXPRESSION IN OCULAR TISSUES AND CELLS: EXPERIMENT #3. 44 2.8.1 Primer Design ...... 44 2.8.2 RNA Isolation and Reverse‐Transcription ...... 47 2.8.3 RT‐PCR Amplification of GABA Receptors ...... 49

3 RESULTS ...... 51

3.1 IMMUNOHISTOCHEMISTRY: EXPERIMENT #1 ...... 51

3.2 FLOW CYTOMETRY: EXPERIMENT #2 ...... 53

3.3 ANALYSIS OF GABA RECEPTOR GENE EXPRESSION IN OCULAR TISSUES AND CELLS: EXPERIMENT #3. 56 3.3.1 RT‐PCR Amplification of GABA Receptors ...... 56

4 DISCUSSION ...... 60

4.1 SUMMARY OF FINDINGS ...... 60

4.2 LIMITATIONS OF IMMUNOHISTOCHEMISTRY ...... 60

4.3 POLYMERASE CHAIN REACTION METHODOLOGICAL ISSUES ...... 61

4.4 GABA RECEPTORS IN SCLERA ...... 61

4.5 GABA RECEPTORS IN RETINAL PIGMENT EPITHELIUM & CHOROID ...... 62

4.6 GABA RECEPTORS IN RETINA ...... 62

4.7 LIMITATIONS OF FLOW CYTOMETRY...... 63

4.8 RELEVANCE TO MYOPIA ...... 63

4.9 LIMITATIONS ...... 64

4.10 REAL WORLD IMPLICATIONS ...... 65

4.11 FUTURE DIRECTIONS ...... 65

4.12 CONCLUSION ...... 67

vi

Emily F. McDonald: GABA Receptors in Human Sclera

REFERENCES/BIBLIOGRAPHY ...... 68 APPENDIX ONE: ANIMAL STUDIES – BACKGROUND ...... 90 APPENDIX TWO: GROSS ANATOMY OF HUMAN SCLERA ...... 92 APPENDIX THREE: GEL RESULTS...... 95 APPENDIX FOUR: GABA RECEPTOR GENE SEQUENCING ...... 129 APPENDIX FIVE: GENOME MAPS ...... 136

vii

Emily F. McDonald: GABA Receptors in Human Sclera

LIST OF TABLES

Table 1.1: Known functions of the RPE as compiled by Strauss in 2005 (Strauss, 2005)...... 9

Table 1.2: Characteristics of the three GABA receptor types: GABAA, GABAB, and GABAC.. 16

Table 1.3: Summaries of notable papers utilising GABA in animal studies...... 17

Table 1.4: Ocular tissues – human and animal – found to have GABA receptors present...... 20

Table 1.5: Main biochemical constituents present in human sclera...... 25

Table 1.6: Known functions of MMPs...... 27

Table 1.7: Known MMPs and their associated substrate specificity...... 28

Table 1.8: Receptor types observed in human sclera...... 33

Table 1.9: Location of muscarinic receptors in ocular and non‐ocular tissues...... 33

Table 1.10: Key functions of receptors present in human sclera...... 34

Table 2.1: Donor characteristics; information supplied from the QEB...... 38

Table 2.2: Individual primers (and expected product size) for each gene, including all known

transcript variants where applicable and represented by a ʹVʹ in the gene name,

representing a GABA receptor subunit...... 46

Table 2.3: Annealing temperatures for primers following exposure of all cells and tissues to

three different annealing ranges...... 47

Table 2.4: Results from NanoDrop...... 49

Table 3.1: Raw data analysis obtained from FC for human scleral stromal cells...... 55

Table 3.2: The results for each of the GABA receptor subunit genes as demonstrated by PCR.

...... 58

Table A1: Recent examples of animal models used for myopia research...... 91

Table A2: RT‐PCR results for mesenchymal stromal cells obtained from donor 6952...... 95

Table A3: RT‐PCR results for mesenchymal stromal cells obtained from donor 6953...... 97

Table A4: RT‐PCR results for mesenchymal stromal cells obtained from donor 6952...... 99

Table A5: RT‐PCR results for mesenchymal stromal cells obtained from donors 6952 & 6953.

...... 101

Table A6: RT‐PCR results for mesenchymal stromal cells obtained from donor 6953...... 103

Table A7: RT‐PCR results for choroid/RPE, retina, and mesenchymal stromal cells obtained

from donors 6952 & 6953...... 104

viii

Emily F. McDonald: GABA Receptors in Human Sclera

Table A8: RT‐PCR results for choroid/RPE, retina, sclera, and mesenchymal stromal cells

obtained from donors 6952 & 6953...... 106

Table A9: RT‐PCR results for sclera obtained from donor 6952...... 108

Table A10: RT‐PCR results for sclera obtained from donor 6953...... 109

Table A11: RT‐PCR results for sclera obtained from donor 6954...... 110

Table A12: RT‐PCR results for sclera obtained from donors 6952, 6953, & 6954...... 111

Table A13: RT‐PCR results for sclera obtained from donors 6952, 6953, & 6954...... 113

Table A14: RT‐PCR results for choroid/RPE obtained from donor 6952...... 115

Table A15: RT‐PCR results for choroid/RPE & retina obtained from donors 6952 & 6953. .. 116

Table A16: RT‐PCR results for retina obtained from donor 6953...... 118

Table A17: RT‐PCR results for retina, choroid/RPE, sclera, and mesenchymal stromal cells

obtained from donor 6952...... 119

Table A18: RT‐PCR results for choroid/RPE ‐ donor 6953 ‐ & retina ‐ donor 6952...... 121

Table A19: RT‐PCR results for choroid/RPE & retina obtained from donors 6952 & 6953. .. 123

Table A20: RT‐PCR results for retina, choroid/RPE, sclera, mesenchymal stromal cells

obtained from donor 6952...... 125

Table A21: RT‐PCR results for mesenchymal stromal cells obtained from donor 6953...... 127

Table A22: RT‐PCR results for mesenchymal stromal cells obtained from donor 6952...... 128

Table A23: Relevant Blast results obtained from the AGRF for each product representative of

potential positive results for GABA receptor genes...... 130

ix

Emily F. McDonald: GABA Receptors in Human Sclera

LIST OF FIGUREs

Figure 1.1: Leading causes of visual loss in Australia (Baird et al., 2010)...... 1

Figure 1.2: A pictorial representation of the human eye (Atchison and Smith, 2000) ...... 4

Figure 1.3: An emmetropisation model depicting the visual signalling cascade (Young, 2010)

...... 6

Figure 1.4: The different layers of the retina and the cells associated with each of these layers

(Yang, 2004) ...... 7

Figure 1.5: Chemical structure of ‐aminobutyric acid (Ng et al., 2011) ...... 11

Figure 1.6: Structure of the GABAA receptor...... 13

Figure 1.7: Structure of the GABAB receptor (Enna, 2007) ...... 14

Figure 1.8: Pharmacological differences between GABAA and GABAC receptors (Gottesmann,

2002, Bormann, 2000) ...... 15

Figure 1.9: Model illustrating the likely molecular structure – based on current knowledge –

of the ECM of the mammalian sclera (McBrien and Gentle, 2003) ...... 24

Figure 1.10: Proposed model of the role of scleral myofibroblast cells in the biochemical and

biomechanical remodelling that facilitates myopia development (McBrien et al., 2009). 29

Figure 1.11: Diagrammatic representation of the scleral remodelling that underpins myopia

development (McBrien et al., 2009)...... 35

Figure 2.1: Photograph (taken by EFM) of a typical eye specimen showing length of the optic

nerve and visible veins ...... 39

Figure 2.2: Scleral map highlighting superior, inferior, nasal, and temporal regions in

relation to the optic nerve (Elsheikh et al., 2010)...... 40

Figure 2.3: Illustration demonstrating how the eye cups were dissected ...... 40

Figure 2.4: Overview of scleral tissue structure, including demonstration of melanocytes in

deeper sclera, from donor 6397L to determine integrity of tissue and basic structures

using H&E...... 41

Figure 2.5: Bleaching optimisation results observed for donor 6397L (tissue taken from

lateral region)...... 42

Figure 3.1: IHC – SMA – performed on donor 6397L (sections taken from inferior region)....52

Figure 3.2: IHC – GABAA Alpha 1 – performed on donor 6397L (sections taken from inferior

region)...... 53

x

Emily F. McDonald: GABA Receptors in Human Sclera

Figure 3.3: Shown above is the percentage of live scleral‐derived stromal cells (passage 3)...55

Figure A1: Animal models depicting the processes involved during induced‐hyperopia

myopic defocus (portrayed on the left) and induced‐myopia hyperopic defocus

(portrayed on the right) (Rymer and Wildsoet, 2005) ...... 90

Figure A2: Some of the major muscles surrounding the eyeball; shown are the relative

positions of the insertions of the horizontal and vertical rectus muscles (Maza et al.,

2012)...... 92

Figure A3: The insertions of the superior oblique and inferior oblique muscles (Maza et al.,

2012)...... 92

Figure A4: Vascular supply to the globe, highlighting the relationships between the internal

carotid, ophthalmic, central retina, long posterior ciliary, short posterior ciliary, anterior

ciliary, and lacrimal arteries (Maza et al., 2012) ...... 93

Figure A5: Sites of perforation of the sclera by the long and short posterior ciliary arteries,

the short posterior ciliary veins, and the inferior and superior vortex veins (Maza et al.,

2012)...... 93

Figure A6: The relationships between the lacrimal, vortex, short posterior ciliary, inferior

ophthalmic, retinal, supraorbital, and superior ophthalmic veins (Maza et al., 2012) ..... 94

Figure A7: The relationships, shown as a transverse section of the globe, between the short

posterior ciliary, long posterior ciliary, and anterior ciliary arteries and short posterior

ciliary, anterior ciliary, and vortex veins (Maza et al., 2012) ...... 94

xi

Emily F. McDonald: GABA Receptors in Human Sclera

ABBREVIATIONS, ACRONYMS, & SYMBOLS

α Alpha  Delta  Epsilon  Gamma  Pi  Theta AGRF Australian Genome Research Facility AL Axial Length APC Allophycocyanin BMC [3H]Bicuculline Methochloride BP Base Pair BSA Bovine Serum Albumin CACA cis‐4‐Aminocrotonic Acid CAMP cis‐2‐(aminomethyl)Cyclopropane‐1‐carboxylic Acid cAMP Cyclic Adenosine Monophosphate cDNA Complementary Deoxyribonucleic Acid CNS Central Nervous System DAB 3,3‐Diaminobenzidine dNTP Deoxyribonucleotide Triphosphate ECM Extracellular Matrix EST Expressed Sequence Tag FBS Fetal Bovine Serum FC Flow Cytometry FITC Fluorescein Isothiocyanate GABA ‐Aminobutyric Acid GABARAP GABAA Receptor‐Associated Protein GABA‐T GABA Transaminase GABAA GABAA Receptor α Subunit GABRB GABAA Receptor β Subunit GABRB3 GABAA Receptor β3 Subunit GABRG GABAA Receptor  Subunit GABRE GABAA Receptor  Subunit GABRD GABAA Receptor  Subunit GABRQ GABAA Receptor  Subunit GABRP GABAA Receptor  Subunit GABBR GABAB Receptor GABRR GABAC Receptor  Subunit GAD Glutamic Acid Decarboxylase GAG Glycosaminoglycan GAPDH Glyceraldehyde‐3‐Phosphate Dehydrogenase I4AA Imidazole‐4‐Acetic Acid IGF Insulin‐like Growth Factor IHBI Institute of Health and Biomedical Innovation IHC Immunohistochemistry IL‐1β Interleukin‐1β

xii

Emily F. McDonald: GABA Receptors in Human Sclera

IOP Intraocular Pressure M1 – M5 Muscarinic Receptor Subtypes 1‐5 MMP Matrix Metalloproteinase mRNA Messenger Ribonucleic Acid NE Norepinephrine NGF Nerve Growth Factor PBS Phosphate Buffered Saline PCR Polymerase Chain Reaction PDGF Platelet‐Derived Growth Factor PE Phycoerythrin PG Proteoglycan QEB Queensland Eye Bank QEI Queensland Eye Institute QUT Queensland University of Technology RNA Ribonucleic Acid RPE Retinal Pigment Epithelium RT‐PCR Reverse‐Transcriptase PCR SLRP Small Leucine‐Rich Proteoglycans SMA Smooth Muscle Actin TACA trans‐4‐Aminobut‐2‐enoic acid TAMP trans‐2‐Aminomethylcyclopropanecarboxylic Acid TGF Transforming Growth Factor THIP 4,5,6,7,‐Tetrahydroisoxazolo[5,4‐c]pyridine‐3‐ol TNF‐α Tumour Necrosis Factor‐α TPMPA 1,2,5,6‐Tetrahydropyridine‐4‐yl)methylphosphinic Acid VIP Vasoactive Intestinal Peptide

xiii

Emily F. McDonald: GABA Receptors in Human Sclera

Statement of original authorship

The work contained in this thesis has not been previously submitted for a degree or diploma in any other higher education institution. To the best of my knowledge and belief, the thesis contains no material previously published or written by another person except where due reference is made.

QUT Verified Signature

......

Emily F. McDonald

February 28th 2014

‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐‐

Structure of thesis

This Thesis has the following structure:

Chapter 1 – Literature Review

Chapter 2 – Materials and Methodology

Chapter 3 – Results

Chapter 4 – Discussion

xiv

Emily F. McDonald: GABA Receptors in Human Sclera

Acknowledgements

Katrina Schmid, thank you for teaching me how to be an independent researcher. I appreciate your constructive and expert feedback on the drafts of this thesis.

Damien Harkin, I would like to thank you for your guidance throughout the histological components of this project. Your passion for histology is inspiring. I agree – SMA is a rather photogenic antibody.

Sally‐Anne Stephenson, I really appreciate your time, availability, and guidance throughout the gene expression component of this project. Of course, I must mention my gratitude for your muscles; without them, I would not have been able to extract RNA from the fibrous scleral tissue. That was one of the best days in the lab for sure.

Neil Richardson, thank you for all the constructive discussions and the hours you have spent in the lab guiding me through immunohistochemistry. Your easy‐going, encouraging approach made the transition back into the world of science that much easier.

Laura Bray, I want to thank you for always being available – including at the lab bench.

Most notably, thank you for the hours spent on flow cytometry. On a personal note, your friendship is truly invaluable and I would not be where I am without your support along the way.

Tom Hogerheyde, thank you for teaching me the gene expression techniques. The painstaking hours you put in were greatly appreciated.

Mark Woolf, without you pushing me I would not have taken on the project in the first place and I am grateful. Thank you for your support.

To all my IHBI friends – you know who you are. My Masters experience would not have been the same without each and every one of you. Thank you for your individual contributions and I am looking forward to seeing you all enjoy success in your own fields.

xv

Emily F. McDonald: GABA Receptors in Human Sclera

Neil Tindale and Anne Roiko, I am forever indebted to both of you for the scientific foundation and mentorship you provided me with during my years at USC.

On a personal note, I would like to thank my husband, Pete. You are my rock and none of this would have been possible without you. I dedicate my thesis to you.

Emily F. McDonald

xvi

Emily F. McDonald: GABA Receptors in Human Sclera

1 literature review

1.1 Introduction

Myopia, or short‐sightedness, is the most common refractive disorder (Young et al., 2007,

Tan et al., 2010, Young et al., 2003, Fredrick, 2002, Leo and Young, 2011) affecting approximately 25% of the world population (Pan et al., 2012). The reasons behind the high prevalence of myopia are currently obscure (Nickla and Wallman, 2010, Bloom et al., 2010,

Hammond et al., 2004, Brand et al., 2007) but its public health and economic impact is considerable (Young et al., 2007, Baltussen et al., 2009, Kleinstein et al., 2003, Jones et al.,

2007, Rose et al., 2008b, Yang et al., 2009, Paluru et al., 2004). The impact of refractive errors in Australia is significant (refer to Figure 1.1).

Figure 1.1: Leading causes of visual loss in Australia (Baird et al., 2010). Refractive error correctable with spectacles is a significant contributing factor.

Myopia is predominantly caused by an elongated axial length (AL) of the globe (McBrien and Gentle, 2003, Summers Rada et al., 2006). Less commonly, myopia is caused by the eyeʹs optics; for example, a too powerful cornea or crystalline lens (Flitcroft, 2012). The sclera must expand to allow for this increase in size and, ultimately, must grow, or remodel, for myopia to develop (Young et al., 2004, Summers Rada and Hollaway, 2011, Barathi and

Beuerman, 2011, McBrien et al., 2006, Moring et al., 2007, Choo, 2003). Due to the location of the retina and the sclera, the retinal signal must be transmitted to the sclera via the retinal pigment epithelium (RPE) and choroid (Rymer and Wildsoet, 2005, Crewther, 2000). It is generally considered that the retina is the primary controller of eye growth (Wallman and

1

Emily F. McDonald: GABA Receptors in Human Sclera

Winawer, 2004). Evidence for this is the fact that when hemifield diffusers are used to form‐ deprive only half of the eye, only the half of the eye that was deprived elongates (Wallman et al., 1987). Regional modifications to eye shape could not be produced via a signal sent from the brain to the eyes.

The choroid and RPE have thus been implicated in eye growth control processes. It is thought that the choroid might participate in refractive adjustment as a slow accommodative mechanism: animal studies have demonstrated that the choroid is capable of increasing its thickness in response to myopic defocus (Wallman et al., 1995) and thinning in response to hyperopic defocus (Wildsoet and Wallman, 1995) The RPE is believed to play a critical role in ocular growth regulation and the basis for this understanding is due to the fact that the

RPE separates the retina (the source of growth‐regulating signals) from the choroid and retina and, accordingly, is involved in their growth regulation (Rymer and Wildsoet, 2005,

Crewther, 2000). Evidence suggests that RPE cells both synthesise and secrete many kinds of cytokines (Tanihara et al., 1997). During negative lens treatment in chicks, insulin‐like growth factor‐1 (IGF‐1) was observed to increase and IGF‐1 receptors were up‐regulated in

RPE, as well as in choroid and fibrous sclera (Penha et al., 2011). Chick RPE has been shown to have β‐adrenoceptors, vasoactive intestinal peptide (VIP) receptors, α1‐adrenoceptors, dopamine receptors, and muscarinic acetylcholine receptors (Rymer and Wildsoet, 2005).

It has been found that ‐aminobutyric acid (GABA), a retinal neurotransmitter, influences eye growth and, accordingly, refractive development (Stone et al., 2003, Leung et al., 2005).

In the chick animal model of myopia, GABA antagonists have been shown to inhibit experimental myopia (Chebib et al., 2009b) and have been proposed as having a ʺpromising clinical role in the regulation of ocular growth including the treatment of myopia” (Leung et al., 2005). Although the mechanism for this effect is unknown, it has been recently shown that, in addition to the retina [human: (Davanger et al., 1991, Crooks and Kolb, 1992, Vardi and Sterling, 1994, Gussin et al., 2011); chick: (Hering and Kröger, 1996, Albrecht and

Darlison, 1995)], GABA receptors are located in chick sclera (Cheng et al., 2011), chick cornea

(Cheng et al., 2012), and chick RPE (Cheng et al., In Press).

This project will determine if the three main GABA receptor sub‐types – GABAA, GABAB, and GABAC [GABAC is actually a subset of GABAA (Bormann, 2000)] – are present or absent

2

Emily F. McDonald: GABA Receptors in Human Sclera

in the human sclera. These receptor sub‐types were chosen as they constitute all known

GABA subtypes. Although previous studies have highlighted the influence of GABA on eye growth and localisation of GABA receptors in chick sclera (Cheng et al., 2011, Leung et al.,

2005), no study has been undertaken involving human scleral tissue. A relatively recent paper (Watson and Young, 2004) commented that it is surprising that the human sclera remains such an under‐researched structure. The sclera had previously been thought to be essentially inert (McBrien and Gentle, 2003) but it is now recognised that the sclera is a dynamic tissue, capable of altering its composition and properties ‐ its rigidity and thickness

‐ in response to its visual environment (Summers Rada, 2006) and thus potentially playing a role(s) in the onset and development of myopia (Watson and Young, 2004, Wang et al., 2011).

1.2 Brief Overview of the Eye

The eye (shown in Figure 1.2) is a nearly spherical organ consisting broadly of three layers:

1) the external layer formed by the cornea and sclera; 2) the intermediate layer divided into two parts: the iris‐ciliary body anteriorly and the choroid posteriorly; 3) and the internal layer consisting of the retina (Mitra et al., 2005). The eye is structurally limited by the cornea and sclera (Ayoub, 2008). The iris controls, through automatic adjustment, the amount of light entering the eye (Bogdanov, 2000). The ciliary body functions to produce components of the aqueous humour (Fischer and Reh, 2003). The choroid is a thin, vascularised sheath located between the sclera and the retina (Kiilgaard and Jensen, 2005). The retina, a membrane containing an array of photoreceptor cells called rods and cones, converts light energy into electrical signals (Bogdanov, 2000). The photoreceptors convert light energy to electrical activity and transmit nerve impulses to the brain via the optic nerve (Bogdanov,

2000).

3

Emily F. McDonald: GABA Receptors in Human Sclera

Figure 1.2: A pictorial representation of the human eye (Atchison and Smith, 2000).

1.3 Myopia: Definition, Epidemiology, & Possible Causes

Myopia (derived from the Greek words myein, meaning ‘to shut’ and ōps, meaning ‘eye’; i.e., to squint) is typically due to axial elongation of the vitreous chamber – ‘axial myopia’

(McBrien and Gentle, 2003, Summers Rada et al., 2006). ‘Axial elongation’ refers to elongation of the eye in the axial direction; in myopia, the eye expands more axially than it does equatorially (Atchison et al., 2004). The elongation process creates a mismatch between the refractive power and length of the eye, the visual image of distant objects is formed in front of the photoreceptor plane, and negative spectacle lenses are required to optically correct the resultant image blur (Lundström et al., 2009, McBrien and Gentle, 2003,

Benavente‐Perez, 2006, Leo and Young, 2011, Metlapally and McBrien, 2008, Chen et al.,

2011). The refractive distribution of neonatal eyes is normal; over a period of approximately six months, eyes emmetropise and, during this time, visual feedback is used to adjust refraction to eliminate neonatal errors (Candy et al., 2009).

Myopia is considered to be a leading cause of visual impairment (Gilmartin, 2004, Fredrick,

2002, Majava et al., 2007). Severe cases of myopia, or high myopia, can lead to premature cataracts, glaucoma, retinal detachment, and macular degeneration (Young, 2004, Saw et al.,

2005). Low myopia is observed around an AL of 24 mm, or 0 ‐ ‐6 dioptres, and high myopia is observed around an AL of 30 mm, or greater than ‐6 dioptres (Meng et al., 2011). The precise cause(s) or mechanism(s) triggering the axial elongation observed in myopia are still unknown (Atchison et al., 2004, Shelton and Summers Rada, 2009, Tan et al., 2010, Wang et

4

Emily F. McDonald: GABA Receptors in Human Sclera

al., 2011); myopia is regarded as a multifactorial, complex disorder (Chen et al., 2011). The main conundrum concerns the fact that not all eyes develop myopia although being exposed to comparable visual environments (Lundström et al., 2009).

Suggested causes and/or contributing factors include both genetic (refer to Baird et al., 2010 for a summary of myopia candidate genes) and environmental, such as education, metabolism, and physical and outdoor activity (Chen et al., 2003, Yang et al., 2009, Fredrick,

2002, Paget et al., 2008, Hornbeak and Young, 2009, Jacobi and Pusch, 2010). For example, myopia is more common in children who have myopic parents (Jones et al., 2007, Jones‐

Jordan et al., 2010, Liang et al., 2004) and the refractive errors of identical twins are similar

(Lyhne et al., 2001, Dirani et al., 2008). It is suggested that myopic children spend more time indoors doing nearwork and less time outdoors than non‐myopic children (Khader et al.,

2006, Rose et al., 2008b, Rose et al., 2008a).

A recent genome‐wide association study (Kiefer et al., 2013) featuring 45,771 participants identified 22 significant associations (20 of which were novel). The candidate genes were identified as follows: DLX1, PABPCP2, PDE11A, PRSS56, ZBTB38, BMP3, KCNQ5, LAMA2,

SFRP1, TOX, TJP2, KCNMA1, RGR, LRRC4C, DLG2, RDH5, ZIC2, BMP4, GJD2, RASGRF1,

RBFOX1, and SHISA6. The most recent evidence is stronger for environmental causes and/or contributing factors than for genetic (Lougheed, 2014, Goldschmidt and Jacobsen,

2014). It has also been suggested that myopia might develop either as a result of form‐ deprivation (Mathur et al., 2009), altered release of certain neurotransmitters and growth factors (Yang et al., 2009, Raviola and Wiesel, 2007), diet (Charman, 2011, Mutti and Marks,

2011, Cordain et al., 2002), or relative peripheral hyperopia, where the abnormal axial growth of the eye is caused by the peripheral image lying behind the retina (Mathur et al.,

2009, Mutti et al., 2007).

1.4 The Proposed Myopia Signalling Cascade: Where the Sclera is thought to fit in

Due to the fact that the retina directly processes visual information, it has also been suggested that it is the most likely candidate to generate the primary signal for myopia development (Wallman, 1993). This potential process, initiated by a visual stimulus and resulting in a cascade of events through the different layers of the eye, is depicted in Figure

1.3 shown below (Young, 2010). As shown in Figure 1.3, when the AL of the eye is shorter

5

Emily F. McDonald: GABA Receptors in Human Sclera

than the focal plane, hyperopic defocus (1) occurs on the retina unless fully cleared by accommodation (9). Hyperopic defocus reduces the amplitude of responses of retinal neurons (2); in turn, the communication of signals (3) through the RPE and (4) choroid is altered. The resulting communication to the sclera produces (5) altered gene expression in fibroblasts. Eventually, remodelling of the scleral extracellular matrix (ECM) occurs (6), increasing the creep rate of the sclera (7), which increases the axial elongation rate of the eye

(8). The amount of defocus is reduced as the axial elongation moves the retina closer to the focal plane. Responses increase with reduced retinal defocus and, in turn, alter communication to the sclera. Finally, scleral remodelling is altered such that both the creep rate is decreased and axial elongation is slowed. The following section addresses the functional anatomy and potential roles of the retina, RPE, choroid, and sclera in the proposed visually‐driven signalling pathway. As the focus of this project is on the sclera, it is particularly important to briefly highlight that, as the sclera forms the structural outer coat of the eye, in conjunction with the choroid, it controls the location of the retina (Young,

2010).

Figure 1.3: An emmetropisation model depicting the visual signalling cascade (Young, 2010). The cascade of events involves the retina, RPE, choroid, and sclera.

1.4.1 Neural Retina: Generates Primary Signal for Myopia Development?

The neural retina (refer to Figure 1.4 for a pictorial representation of the retinal layers), approximately 100‐200 μm thick, is responsible for processing all incoming visual signals

(Massey, 2005). The retinal layer, a thin sheet at the back of the eye responsible for converting light associated with visual image into action potentials that are sent to the brain, contains six discrete populations of cells: photoreceptors (rod and cones), horizontal cells

(lateral interneurons), bipolar cells (vertical connections), amacrine cells (lateral interneurons), ganglion cells (output neurons), and interplexiform cells (Massey, 2005).

The human retina contains a number of neurotransmitters and neuropeptides, such as dopamine, glycine, substance P, and somatostatin (Tornqvist and Ehinger, 1988); the

6

Emily F. McDonald: GABA Receptors in Human Sclera

prevailing retinal neurotransmitter molecules implicated in influencing eye growth regulation are dopamine (Schaeffel et al., 1995, Wallman, 1993), muscarinic acetylcholine (Lin et al., 2009, McBrien et al., 2001b), glucagon (Fischer et al., 1999), and VIP (Tornqvist and

Ehinger, 1988, Rymer and Wildsoet, 2005). Refer to Flitcroft (2012) for a recent review summarising current knowledge on the role of the retina in the control of eye growth. The next innermost layer of the eye is the RPE. The following section outlines the functional anatomy of the RPE and its potential role in the local signalling cascade mediating myopia.

Figure 1.4: The different layers of the retina and the cells associated with each of these layers (Yang, 2004). GABAergic neurons are shown in blue. GABA is typically involved in the lateral pathways involving horizontal and amacrine cells.

There is substantial evidence from animal studies to support the role of the retina in the regulation of ocular growth. For example, if the optic nerve is severed or the action potentials in it blocked, form‐deprivation myopia is unaffected (Norton et al., 1994, Troilo et al., 1987, Wildsoet and Pettigrew, 1988). In addition, lens compensation occurs, although with some differences (Wildsoet, 2003, Wildsoet and Wallman, 1995). It has been observed in studies that use diffusers or negative lenses that cover only half of the retina, only the covered half of the eye exhibits myopia; in contrast, if positive lenses are used to cover half

7

Emily F. McDonald: GABA Receptors in Human Sclera

of the retina, only the covered half exhibits inhibited eye growth (Diether and Schaeffel,

1997, Hodos and Kuenzel, 1984, Wallman et al., 1987).

1.4.2 Retinal Pigment Epithelium: Signal Relay in the Control of Eye Growth?

The RPE, classically described as a polarised epithelial monolayer of cells, is sandwiched between the retina and the choroid; due to its location, the RPE is thought to play a crucial role in relaying signals between the retina and choroid (Rymer and Wildsoet, 2005,

Crewther, 2000). Refer to Table 1.1 for a list of functions of the RPE.

8

Emily F. McDonald: GABA Receptors in Human Sclera

Table 1.1: Known functions of the RPE as compiled by Strauss in 2005 (Strauss, 2005). The RPE is responsible for a diverse array of functions, including light absorption, transportation, nutrient absorption, phagocytosis, and secretion. Functions of RPE Reference(s) Absorbs the light energy focused by the lens on the retina (Bok, 1993, Boulton and Dayhaw‐Barker, 2001) Transports ions, water, and metabolic end products from the (Dornonville de la Cour, subretinal space to the blood 1993, Hamann, 2002, Marmor, 1999, Miller and Edelman, 1990, Steinberg, 1985, Crewther, 2000) Absorbs nutrients such as glucose, retinol, and fatty acids from the (Strauss, 2005) blood and delivers these nutrients to photoreceptors Enables exchange of retinal between the photoreceptors and the RPE; (Strauss, 2005, Baehr et al., this is important as photoreceptors are unable to reisomerise all‐ 2003, Besch et al., 2003, trans‐retinal, formed after photon absorption, back into 11‐cis‐ Thompson and Gal, 2003, retinal. Therefore, retinal is transported to the RPE, reisomerised to Booij et al., 2010) 11‐cis‐retinal and transported back to the photoreceptors: this process is known as the ‘visual cycle of retinal’. Stabilises ion composition in the subretinal space, which is essential (Dornonville de la Cour, for the maintenance of photoreceptor excitability 1993, Steinberg, 1985, Steinberg et al., 1983, Booij et al., 2010) Phagocytosis of shed photoreceptor outer segments; the outer (Bok, 1993, Finnemann, segments of the photoreceptors are digested, and essential 2003, Gal et al., 2000, substances, such as retinal, are recycled and returned to the Strauss, 2005, Strauss et al., photoreceptors to rebuild light‐sensitive outer segments from the 1998, Wistow et al., 2002, base of the photoreceptors. Booij et al., 2010) Secretes a variety of growth factors helping to maintain the structural (Strauss, 2005) integrity of choriocapillaris endothelium and photoreceptors Plays an important role in the establishing the immune privilege of the (Ishida et al., 2003, Streilein eye by secreting immunosuppressive factors et al., 2002)

The RPE is critical to communication occurring between the retina and the rest of the eye.

Due to its central location within the outer layers of the eye, it is thought that the RPE may act as a signal relay in the control of eye growth (Crewther, 2000). In their review paper,

Rymer & Wildsoet (2005) suggested that, aside from the presence of ion transporters and signal receptors, the RPE, lying between the signal source (retina) and its target (the sclera and choroid) may play a critical role based on location alone. In addition, Rymer & Wildsoet

(2005) highlighted three retinal neurotransmitters, dopamine, VIP, and glucagon, that have been linked to eye growth regulation. As the RPE secretes growth factors into the choroid targeting both the choroid and sclera, it is thought that the concentration and activity of these growth factors might be modulated by fluid transport across the RPE (Crewther, 2000,

Rymer and Wildsoet, 2005). The next section addresses the functional anatomy and potential role of the choroid in the myopia signalling cascade.

9

Emily F. McDonald: GABA Receptors in Human Sclera

1.4.3 Choroid: Responsible for Fluid Regulation

The term choroid is derived from the Greek words for “membrane” and “form”; the choroid

(the middle tunic of the eye) is a vascularised and pigmented tissue attached to the sclera by strands of connective tissue (Guyer et al., 2005). The choroidal circulation demonstrates one of the highest rates of blood flow – millilitres/minute/gram – in the human body (Alm and

Bill, 1973, Alm and Bill, 1987, Torczynski, 1987); more than 70% of all the blood in the globe at any one time can be found in the choriocapillaris (Parver et al., 1980, Rohen, 1964), one of the layers of the choroid. From the most superficial to the deepest, the four layers of the choroid are termed the suprachoroid or suprachoroidea: a transitional zone between the choroid and sclera containing elements of both, stroma: extravascular tissue, choriocapillaris: a highly anastomosed network of capillaries, and Bruch’s membrane: a complex 5‐laminar structure (Guyer et al., 2005, Nickla and Wallman, 2010). In terms of composition, the choroid is comprised of blood vessels, melanocytes, fibroblasts, resident immunocompetent cells and supporting collagenous and elastic connective tissue (Nickla and Wallman, 2010).

In humans, the choroid is approximately 200 μm in width at birth and decreases to approximately 80 μm by the age of 90 (Ramrattan et al., 1994). Choroidal thickness is diurnally modulated: the choroid is thickest at about midnight and thinnest at noon

(Papastergiou et al., 1998, Nickla et al., 1998). It is believed that this process is driven by a circadian oscillator as the rhythm free‐runs in constant darkness (Nickla, 2006).

The main functions of the choroid are three‐fold: 1) thermoregulation via heat dissipation, 2) nourishment of the RPE and retina up to the outer aspect of the inner nuclear layer, and 3) producing the visible pigmentation of the fundus (Guyer et al., 2005). In addition, the choroid secretes growth factors, adjusts the position of the retina by changes in choroidal thickness, and plays an important role in the drainage of the aqueous humour from the anterior chamber, via the uveoscleral pathway (Nickla and Wallman, 2010) [approximately

35% of the drainage in humans (Alm and Nilsson, 2009)]. A recent paper (Summers, 2013) outlined the role of the choroid in ocular growth and the development of refractive errors as follows: 1) the choroid can act on neighbouring tissues through growth factors, 2) choroidal gene expression and thickness can be influenced by visual stimuli, 3) the choroid, in response to visual stimuli, secretes scleral growth factors, and 4) choroidal RALDH2 activity and retinoic acid synthesis have been linked to modulation of scleral remodelling.

10

Emily F. McDonald: GABA Receptors in Human Sclera

1.4.4 Sclera: Responsible for Controlling Eye Dimensions

Finally, the outermost layer is the sclera. As the sclera is thought to control the dimensions of the eye, it is important to assess the potential role of the sclera in the visually‐driven signalling pathway. Essentially, the sclera controls the location of the retina as it forms the structural outer layer of the eye (Young, 2010). In the context of the myopic eye, the resultant thinning of the sclera during elongation is attributed to tissue remodelling and not simply passive stretching (Choo, 2003). The sclera will be covered in greater detail – including gross structure, function and biochemistry – in Section 1.6.

1.5 ‐Aminobutyric Acid

Neurotransmitters can be divided into two sub‐groups: inhibitory and excitatory (Wilson and Cowan, 1972). GABA (the chemical structure shown in Figure 1.5) is an important inhibitory neurotransmitter present in the central nervous system (CNS), which includes the retina (Krogsgaard‐Larsen et al., 1997, Chebib et al., 2009b, Enz and Cutting, 1999, Barnard et al., 1998). GABA was first discovered over 60 years ago in the mammalian CNS (Roberts and

Frankel, 1950). The neurotransmitter is most highly concentrated in the substantia nigra, basal ganglia, hypothalamus, the periaqueductal grey matter, and the hippocampus (van der

Zeyden et al., 2008). In the mammalian brain, GABA‐releasing synapses are the principle source of inhibition and glutamate‐releasing synapses are the principle excitatory transmitters (Ben‐Ari, 2002); GABA and glutamate only differ by a single carboxyl group

(Waagepetersen et al., 2007). Approximately 90% of all synaptic neurotransmission in the

CNS is mediated by GABA and glutamate (Schousboe and Waagepetersen, 2003,

Waagepetersen and Schousboe, 2009) and at least one‐third of all CNS neurons utilise GABA as their primary neurotransmitter (Vithlani et al., 2011). GABAergic transmission requires both a synthesising enzyme – glutamic acid decarboxylase, or GAD – and a degradative enzyme – GABA transaminase, otherwise known as GABA‐T (Waagepetersen et al., 2007,

Yazulla, 2010).

Figure 1.5: Chemical structure of ‐aminobutyric acid (Ng et al., 2011).

11

Emily F. McDonald: GABA Receptors in Human Sclera

The role and significance of GABA receptors in non‐neuronal human tissue is obscure.

Recent research using tissue obtained from mice found GABAA receptor protein in the following non‐neuronal sites: renal medulla, cortex, heart, left ventricle, aorta, and pancreas

(Tyagi et al., 2007). GABAA receptor protein has also been found to be present in human, rabbit, and rat kidney tissue (Sarang et al., 2001). Future studies determining the role and significance of GABA receptors in non‐neuronal tissues, including sclera, would help in piecing together the big picture of myopia and would shed some light on potential pharmaceutical intervention.

1.5.1 ‐Aminobutyric Acid Receptors – GABAA, GABAB, and GABAC

GABA is a highly flexible molecule; it can attain many low‐energy conformations that bind to three pharmacologically and physiologically distinct GABA receptors: GABAA, GABAB, and GABAC (Figure 1.6, Figure 1.7, & Table 1.2). GABAC is, more recently, known as

GABAA0r (Barnard et al., 1998, Leung et al., 2005, Bormann, 2000); the change in nomenclature classifies the ‐containing GABA receptors as a specialised set of GABAA receptors that are insensitive to both bicuculline and benzodiazepines (Bormann, 2000).

Generally, GABAA and GABAB receptors are defined by their respective sensitivities to bicuculline and baclofen; GABAC receptors are a pharmacologically distinct group – they do not respond to either drug (Bowery, 1989, Johnston, 1996, Bormann and Feigenspan, 1995,

Cherubini and Strata, 1997, Bormann, 2000); see Figure 1.8.

12

Emily F. McDonald: GABA Receptors in Human Sclera

A)

B)

C)

Figure 1.6: Structure of the GABAA receptor. [Figure (A) taken from (Enna, 2007); Figures (B) and (C) taken from (Akk et al., 2007).] (A) Pentameric structure of GABAA receptor showing five representative subunits – in this case, 2x α subunits, 2x β subunits, and 1x 2 subunit (Enna, 2007). Also shown are unique binding sites for each subunit. The binding sites for GABA are sandwiched between the α and β subunits. Ionotropic GABAA receptors are fast‐acting, ligand‐gated chloride channels

13

Emily F. McDonald: GABA Receptors in Human Sclera

(Sieghart, 2006); GABA receptor activation causes an influx of chloride ions (Waagepetersen et al., 2007). The membrane topography of GABAC receptors is assumed to be very similar to that of GABAA (Bormann, 2000). However, GABAC receptors are composed exclusively of  (1‐3) subunits (Bormann, 2000). (The two P symbols at the bottom of the diagram represent protein kinase.) (B) A single subunit of the GABAA receptor (Akk et al., 2007). This image is focusing on the topography of the subunits; M1‐M4 represents individual transmembrane domains. The transmembrane domain coloured grey – M2 – forms an important part of the chloride channel (Akk et al., 2007). (C) Top‐down view of the pentameric structure of the GABAA receptor (Akk et al., 2007).

Figure 1.7: Structure of the GABAB receptor (Enna, 2007). Metabotropic GABAB receptors produce slow and prolonged inhibitory responses; GABAB receptors are coupled indirectly via proteins to either calcium or potassium channels (Bettler and Tiao, 2006). Postsynaptically, stimulation of GABAB receptors causes an efflux of potassium ions (Waagepetersen et al., 2007); presynaptically, GABAB receptors regulate calcium channels and thereby cause inhibition of transmitter release (Olsen and Betz, 2006). It is important to note that the GABAB receptor is an obligate heterodimer: the receptor is only functional when both the GABAB R1 isoform and the GABAB R2 isoform are co‐ expressed in the same cell (Pierce et al., 2002).

14

Emily F. McDonald: GABA Receptors in Human Sclera

a)

b)

Figure 1.8: Pharmacological differences between GABAA and GABAC receptors (Gottesmann, 2002, Bormann, 2000). (A) The GABAA receptor has binding sites for barbiturates, benzodiazepines, and neurosteroids and GABA responses are blocked by bicuculline (competitively) and by picrotoxin (non‐competitively) (Gottesmann, 2002, Bormann, 2000). (B) The GABAC receptor is activated by CACA, antagonised by TPMPA, and blocked by picrotoxinin (Gottesmann, 2002, Bormann, 2000).

15

Emily F. McDonald: GABA Receptors in Human Sclera

Table 1.2: Characteristics of the three GABA receptor types: GABAA, GABAB, and GABAC.

GABAA Receptor GABAB Receptor GABAC (or GABAA0R) Reference(s) Receptor Category Ligand‐gated ion channel G‐protein coupled Ligand‐gated ion channel (Emberger et al., 2000, Enz and Cutting, 1999, receptor (to either calcium Johnston, 1996, Ben‐Ari et al., 2007, Kumar et or potassium channels) al., 2008, Vithlani et al., 2011) Subunits α1‐6, β1‐3, 1‐3, , , , &  GBR1 & GBR2 1‐3 (Bormann, 2000, Krogsgaard‐Larsen et al., 1997, Fritschy et al., 2004, Emberger et al., 2000, Enz and Cutting, 1999, Schousboe and Waagepetersen, 2008, Stone et al., 2003, Ben‐ Ari et al., 2007, MacDonald et al., 2007, Vithlani et al., 2011) Agonists I4AA Baclofen CACA (Bormann, 2000, Krogsgaard‐Larsen et al., Isoguvacine CAMP 1997, Schousboe and Waagepetersen, 2008) Isonipecotic acid Muscimol (partial) Muscimol TACA TACA TAMP TAMP (weak) THIP Antagonists BMC Phaclofen I4AA (Bormann, 2000, Krogsgaard‐Larsen et al., Gabazine Saclofen Isoguvacine (weak) 1997, Enz and Cutting, 1999) Picrotoxin Picrotoxin THIP (weak) TPMPA Desensitisation Strong Variable Weak (Bormann, 2000, Mutneja et al., 2005) Modulator(s) Barbiturates ‐‐‐ Zinc? (Bormann, 2000, Emberger et al., 2000, Benzodiazepines Kaneda et al., 2000) Ethanol Neurosteroids Triazolopyridazines BMC – [3H]bicuculline methochloride; CACA – cis‐4‐aminocrotonic acid; CAMP – cis‐2‐(aminomethyl)cyclopropane‐1‐carboxylic acid; I4AA – imidazole‐4‐acetic acid; TACA – trans‐4‐aminobut‐2‐enoic acid; TAMP – trans‐2‐aminomethylcyclopropanecarboxylic acid; THIP – 4,5,6,7,‐tetrahydroisoxazolo[5,4‐c]pyridine‐3‐ol; TPMPA – and (1,2,5,6‐ tetrahydropyridine‐4‐yl)methylphosphinic acid.

16

Emily F. McDonald: GABA Receptors in Human Sclera

1.5.2 ‐Aminobutyric Acid as a Piece in the Myopia Puzzle: GABA in Eye Growth

GABA antagonists have been found to influence ocular growth in chick models of myopia

(Stone et al., 2003, Leung et al., 2005) and, in association with inhibition of myopia

development in chicks, facilitate learning and memory in mice (Chebib et al., 2009b). One

key study (Stone et al., 2003) demonstrated that GABA plays a modulatory role during eye

growth and refractive development. Refer to Table 1.3 for a summary of papers addressing

the use of GABA in animal models.

Table 1.3: Summaries of notable papers utilising GABA in animal studies. GABA antagonists were found to inhibit both form‐deprivation myopia and normal eye development. Reference(s) Background Finding Antagonists to GABAA and White leghorn chicks received daily intravitreal GABAC Rho receptor injections of agonists or antagonists to GABAA (Stone et al., subtypes inhibited both and GABAC Rho receptor subtypes. Results 2003) form‐deprivation myopia following the injection period were determined and the development of eyes using refractometry, ultrasound, and callipers. with normal visual input. Gallus domesticus chicks received regular (days 4, 7 Two antagonists – bicuculline & 10) intravitreal injections of two antagonists – and TPMPA – to GABAA bicuculline and TPMPA – to GABAA and and GABAC Rho receptor (Leung et al., GABAC Rho receptor subtypes. Measurements subtypes inhibited both 2005) following the trial period were taken using form‐deprivation myopia ultrasound, streak retinoscopy, and micrometer and normal eye screw gauges. development. Red‐Rhode Island White cross cockerels were fitted monocularly with a ‐15D spectacle lens and received daily intravitreal injections of cis‐3‐ Antagonists to GABAC – cis‐3‐ ACPBPA or trans‐3‐ACPBPA, GABAC ACPBPA and trans‐3‐ antagonists. Measurements were taken using ACPBPA – were found to (Chebib et al., streak retinoscopy and A‐scan ultrasonography. both inhibit myopia 2009b) Mice received intra‐peritoneal injections of cis‐3‐ development in chicks and ACPBPA or trans‐3‐ACPBPA and, following the facilitate learning and injection period, were subjected to the Morris memory in mice. Water Maze to determine potential effects of the above‐mentioned drugs on learning and memory capability.

1.5.3 ‐Aminobutyric Acid within the Human Eye

The human retina contains all three GABA receptor subtypes (Qian and Ripps, 2009). The

majority of the mammalian retinal cells found to express GABA are the amacrine cells

(Nguyen‐Legros et al., 1997, Davanger et al., 1991, Crooks and Kolb, 1992). GABAC is

expressed predominantly in the retina on bipolar cells of every subtype (Qian and Ripps,

2009). In the retina, GABA shares functional pathways with dopamine and acetylcholine,

17

Emily F. McDonald: GABA Receptors in Human Sclera

neurotransmitters also implicated in refractive development (Stone et al., 2003). Refer to

Table 1.4 for general and specific locations of GABA receptors in the eye (both human and animal due to somewhat limited human data).

A study was undertaken by Young in 2003 using human scleral tissue from nine donors with non‐myopic refractive history (Young et al., 2003). A cDNA (complementary deoxyribonucleic acid) library was constructed from the scleral ribonucleic acid (RNA) and a total of 640 expressed sequence tags (ESTs) were produced. The only neuronal‐specific EST yielded was for GABAA receptor‐associated protein (gene name: GABARAP). [It must be noted that this study was by no means comprehensive. The authors acknowledged this point based on the fact that genes such as collagen type 1 and elastin, known constituents of the sclera, were not identified in their library screening procedure. The authors estimated that the genes that were identified in the study represented only 1‐2% of the total number of mRNA (messenger ribonucleic acid) species potentially expressed by scleral fibroblasts

(Young et al., 2003).]

It has been postulated that, in the normal eye, GABA may be involved in determining the shape of the normal developing eye (Leung et al., 2005). One paper (Leung et al., 2005) has suggested, based on animal studies undertaken in chicks, that GABA antagonists may have a direct effect on ocular growth; accordingly, GABA antagonists have been recommended as having “a promising clinical role in the regulation of ocular growth including the treatment of myopia” (Leung et al., 2005). Leung et al. (2005) found that the GABA antagonists, bicuculline and TPMPA, reduced form‐deprived ocular growth, as well as normal growth.

However, it must be noted that bicuculline alone, at a concentration of 10 mg / mL, caused hypermetropia of the control eyes.

1.5.4 ‐Aminobutyric Acid in Animal Models

A recent study (Cheng et al., 2011) found the GABAC receptor subtype, rho1, present in chick sclera (the presence or absence of the other two main receptor subtypes was not investigated). Another recent study (Cheng et al., 2012) found the GABAA Alpha 1 and

GABAC Rho 1 receptor subtypes present in chick cornea; GABAB was not found to be present. A study currently in press (Cheng et al., In Press) reported expression of GABAA

Alpha 1, GABAB R2, and GABAC Rho 1 receptor subtypes in chick RPE. Although GABA

18

Emily F. McDonald: GABA Receptors in Human Sclera

receptors have been found in chick sclera (and cornea and RPE), it is unknown whether

GABA receptors are present or absent in human sclera. For background information into animal studies – species employed, techniques used, and rationale for different approaches, refer to Appendix 1.

19

Emily F. McDonald: GABA Receptors in Human Sclera

Table 1.4: Ocular tissues – human and animal – found to have GABA receptors present. GABA‐stained retinal cells include amacrine and ganglion cells. Ocular Tissue GABA Present in: Finding Reference(s) Human Retina The total number of GABA‐stained cells (strongly or moderately stained) was estimated to be between 26 and 40%. The majority of cells that demonstrated GABA immunoreactivity were interpreted as amacrine cells, terminating in the inner plexiform layer (as none of the stained cells displayed extensions in an outward direction). Furthermore, a subpopulation was observed to be immunoreactive in the (Davanger et ganglion cell layer (these cells were al., 1991) assumed to be displaced amacrine cells). Cells thought to represent sectioned interplexiform cell fibres and terminals present in the inner nuclear and outer plexiform layers appeared to demonstrate GABA immunoreactivity. There appeared to be some GABA‐stained ganglion cells but no horizontal, bipolar, or Müller cells stained for GABA. Human Retina The study focused on the central retina. Approximately 40% of the amacrine cells present in the inner nuclear layer were found to be GABA immunoreactive. Furthermore, a few amacrine cells in the inner plexiform layer and ganglion cell (Crooks and layer also demonstrated GABA Kolb, 1992) immunoreactivity. There appeared to be faint staining of photoreceptors and cone pedicles in the outer plexiform layer. (Bipolar, horizontal, and most ganglion cells did not demonstrate immunoreactivity.) Human Retina Staining for GABAA Alpha 1 subunit was found to be intense in both the inner and outer plexiform layers. Immunoreactivity for the above antibody was also present in many amacrine and ganglion cell somas in the inner nuclear layer and ganglion cell layer. The same cells also stained for GABAA Beta 2 & 3 but less intensely. The (Vardi and presence of the GABAA receptors on the Sterling, 1994) bipolar dendritic tips may mean that the role of the GABA receptors are to mediate the receptive field surrounding both off and on bipolar cells. The presence of the GABAA receptors on the bipolar axon terminals suggest that much of the inhibition feeding back from GABAergic amacrine to bipolar cells is GABAA‐

20

Emily F. McDonald: GABA Receptors in Human Sclera

mediated. Although all three GABA receptor subtypes were found to be present in the vertebrate retina, the retina was found to be (Lukasiewicz particularly enriched with GABAC. Of Vertebrate Retina and Shields, note, it was mentioned that “GABA‐ 1998) mediated inhibition may play important roles in modulating visual information as it flows from photoreceptors to the brain”. GABAC Rho 1 immunoreactivity was primarily (Gussin et al., Human Retina observed in the inner plexiform layer. 2011) The GABAC Rho 1 receptor subunit was found to be present in fibroblasts and (Cheng et al., Chick Sclera chondrocytes of both the fibrous and 2011) cartilaginous layers of chick sclera. Chick corneal tissue was found to be positive for both GABAA Alpha 1 and GABAC Rho 1 receptor subunits and was negative for GABAB. GABA may play a role in corneal (Cheng et al., Chick Cornea transparency by way of fluid transportation 2012) in the corneal epithelium. The GABA receptors may be involved in regulating corneal sensitivity or other neural functions in the corneal epithelium.

1.5.5 ‐Aminobutyric Acid in Fibroblasts of other Tissues

The functional impact of GABA on fibroblast activity, in particular, has been documented in a few relatively recent studies. For example, GABA stimulates the synthesis of hyaluronic acid and enhances the survival rate of the dermal fibroblasts obtained from skin samples (Ito et al., 2007). Less recently (Göhlich et al., 1984), it was demonstrated that the rate of GABA synthesis in skin fibroblasts from Huntington’s disease patients can be around 3 times higher than in healthy controls. A study on fibroblasts obtained from human buccal mucosa found that GABA stimulated collagen synthesis and proliferation (Scutt et al., 1987). From a gene expression perspective, several genes encoding cellular receptors, including GABAA, have been noted in genes induced in skin and lung fibroblasts (Gu and Iyer, 2006). mRNA expression for the GABAA receptor β3 subunit, GABRB3, has been found to be up‐regulated in human cleft lip and/or palate fibroblasts (Baroni et al., 2006). The cell proliferation activity of GABA was studied using the mouse fibroblast cell line, NIH3T3 (Han et al., 2007). It was found that GABA treatment significantly promoted cell proliferation and significantly suppressed the mRNA expression of inflammatory mediators, such as IL‐1β (interleukin‐1β) and TNF‐α(tumour necrosis factor‐α) (Han et al., 2007). From the above studies, it is clear that GABA can potentially play a functional role in fibroblast activity.

21

Emily F. McDonald: GABA Receptors in Human Sclera

1.5.6 Pharmacological Factors Affecting Eye Growth in Animal Models

A recent review into pharmaceutical interventions for myopia control (Ganesan and

Wildsoet, 2010) addressed the use of GABA and cited three studies; two studies involved chicks and one involved monkeys. The chick studies – one utilising form‐deprivation myopia and the original study of its kind (Stone et al., 2003) and the other one lens‐induced myopia (Chebib et al., 2009a) – both reported the same outcome: anti‐myopia effects for a range of GABA antagonists. More specifically, GABAC‐selective antagonists proved to be more potent than either GABAA‐ or GABAB‐selective antagonists. Both of these studies are in agreement with another recent study (Chebib et al., 2009b), which also found GABA antagonists – cis‐ and trans‐3‐ACPBPA – had weak effects (presence of the antagonists resulted in a reduced cellular GABA response) at GABAA and GABAB receptors but potent antagonist effects at GABAC receptors. The study involving monkeys found retinal GABAC receptors appeared to be involved in modulation by GABA of a retinoic acid pathway (Song et al., 2005). The review concludes the section on GABA with this: “However, there has been no follow‐up to this study [referring to: (Song et al., 2005)] and no relevant studies of other mammalian models” (Ganesan and Wildsoet, 2010).

1.6 Human Sclera

The sclera, or ‘skeleton’ of the eye (Trier, 2005), is a dynamic tissue; it is capable of responding to changes, modulated by visually guided signals originating from the retina, in the visual environment by altering ocular size and refraction (Summers Rada et al., 2006).

The biochemical and biomechanical properties of the sclera determine, to a large degree, the shape and size of the globe and thus the refractive state; scleral physiology must alter to allow the eye to expand during refractive development (Summers Rada et al., 2006,

Benavente‐Perez, 2006, Jobling et al., 2009, Young et al., 2003, Yang et al., 2009). Accordingly, myopia development presents, not only as a rapid increase in eye size, but is also associated with a loss of scleral tissue weight (Yang et al., 2009) and scleral thinning (Morgan, 2003).

However, it has not been fully elucidated what initiates and regulates the scleral remodelling that occurs during myopia onset and development (McBrien et al., 2006). For relevant background information, the following sections outline the different constituents and biochemical properties of the sclera.

22

Emily F. McDonald: GABA Receptors in Human Sclera

1.6.1 Gross Structure & Function of Sclera

The sclera (derived from the Greek word skleros, meaning ‘hard’), together with the cornea, is derived from both the neural crest and mesoderm and forms the outermost covering of the eye (Summers Rada et al., 2006, Kashiwagi et al., 2010, Young et al., 2003, Seko et al., 2008,

Fullwood et al., 2011). It is commonly known as the white of the eye and forms an almost complete sphere between 22 mm (Tsai et al., 2010) and 24 mm diameter (Watson and Young,

2004). The sclera is a dense, fibrous, viscoelastic connective tissue (Summers Rada et al.,

2006, Rada et al., 1997, Yang et al., 2009), accounts for approximately 85% of the total ocular surface (McBrien and Gentle, 2003, Watson and Young, 2004), and extends from the cornea to the optic nerve (Elsheikh et al., 2010). The sclera is composed of three layers: (external layer to inner aspect) the episclera, scleral stroma proper, and the lamina fusca (McCluskey,

2001, Watson and Young, 2004).

Scleral connective tissue contains matrix‐secreting fibroblasts embedded in a matrix of irregular and interwoven collagen fibres in close association with various proteoglycans, or

PGs, and glycoproteins (Rada et al., 1997, Summers Rada et al., 2006, Young et al., 2003,

McCluskey, 2001, McBrien et al., 2006). The underlying structure, composition, and arrangement of collagen fibres in the sclera presents very differently to collagen found in the cornea; its presentation is more comparable to collagen found in the skin (Yang et al., 2009,

Summers Rada et al., 2006). Due to the irregularity of its collagen fibres and its relative hydration, the sclera is characteristically opaque and yet brilliantly white (McBrien and

Gentle, 2003, Elsheikh et al., 2010, Meek and Fullwood, 2001, Kashiwagi et al., 2010, Tsai et al., 2010, Fullwood et al., 2011). The opacity of the sclera ensures that internal light scattering does not affect the retinal image (Watson and Young, 2004, Seko et al., 2008). The sclera is avascular; it obtains its nutrients via the choroid and vascular plexi in Tenon’s capsule – a hypocellular layer of radially‐arranged, compact collagen bundles running parallel to the scleral surface – and episclera (Watson and Young, 2004).

The main functions of the sclera are essentially three‐fold: 1) the sclera is rigid, but not inflexible, in order to offer resistance to the effects of intraocular pressure, or IOP, and external trauma (Summers Rada et al., 2006, McBrien and Gentle, 2003, Elsheikh et al., 2010,

Rada et al., 1997, McCluskey, 2001, Tsai et al., 2010, Watson and Young, 2004); 2) the sclera is tough and impenetrable – yet allowing vascular and neural access – in order to provide

23

Emily F. McDonald: GABA Receptors in Human Sclera

protection to ocular components (McBrien and Gentle, 2003, Summers Rada et al., 2006,

Elsheikh et al., 2010, McCluskey, 2001, Tsai et al., 2010, Trier, 2005, Watson and Young, 2004); and 3) the sclera is capable of rapid remodelling whilst maintaining shape and dimensional parameters by providing a stable base for contractions of the ciliary muscle (McBrien and

Gentle, 2003) and enabling attachment for other extraocular muscle insertions (Elsheikh et al., 2010, McCluskey, 2001).

1.6.2 Composition of the Sclera

The major biochemical components of the sclera include collagen, elastin, glycoproteins, and proteoglycans (refer to Table 1.5). This structure is responsible for maintaining the rigidity, strength, and elasticity that is characteristic of the sclera (Summers Rada et al., 2006). The sclera essentially consists of connective tissue comprised of the ECM and ECM‐secreting fibroblasts (Summers Rada et al., 2006) in close association with PGs and glycoproteins

(Young et al., 2004); refer to Figure 1.9. Biochemical changes in the scleral framework and in the molecules required for synthesis and degradation processes can lead to significant changes in scleral biomechanical properties; accordingly, associated biochemical and biomechanical changes have been observed in scleral shape, ocular size, and, eventually, the refractive state of the eye (Young et al., 2004, McBrien et al., 2009). Current knowledge addressing specific biochemical and biomechanical changes during myopia onset and development are described at the end of each section below, if applicable.

Figure 1.9: Model illustrating the likely molecular structure – based on current knowledge – of the ECM of the mammalian sclera (McBrien and Gentle, 2003). Major biochemical components include collagen, elastin, glyproteins, and proteoglycans.

24

Emily F. McDonald: GABA Receptors in Human Sclera

Table 1.5: Main biochemical constituents present in human sclera. Constituent Reference(s) Fibrous Connective Tissue (Summers Rada et al., 2006, McBrien and Gentle, 2003, Elsheikh et al., 2010, Jobling et al., 2009, Kusakari et al., 1997, Young et al., 2003, Yang et al., 2009) Collagen Types I, III, IV, V, VI, VIII, XII, & XIII (Jobling et al., 2009, Summers Rada et al., 2006, McBrien and Gentle, 2003, Kashiwagi et al., 2010, Wessel et al., 1997, Yang et al., 2009, Kusakari et al., 1997, Trier, 2005) Elastin (Moses et al., 1978, Maza et al., 2012) Enzymes (McCluskey, 2001, McBrien and Gentle, 2003) Fibroblasts & Myofibroblasts (Cui et al., 2008, McCluskey, 2001, Summers Rada et al., 2006, Young et al., 2003, McBrien and Gentle, 2003, Cui et al., 2004) Glycoproteins (McCluskey, 2001, Young et al., 2003, Tsai et al., 2010) Growth Factors (Moring et al., 2007) Proteoglycans (McCluskey, 2001, Tsai et al., 2010) Aggrecan (McBrien and Gentle, 2003, Summers Rada et al., 2006, Rada et al., 1997) Biglycan (McBrien and Gentle, 2003, Summers Rada et al., 2006, Rada et al., 1997) Decorin (McBrien and Gentle, 2003, Summers Rada et al., 2006, Rada et al., 1997) Glycosaminoglycans (Summers Rada et al., 2006) Chondroitin sulfate (Summers Rada et al., 2006) Dermatan sulfate (Summers Rada et al., 2006) Heparan sulfate (Summers Rada et al., 2006) Heparan (Summers Rada et al., 2006) Hyaluronan (Kashiwagi et al., 2010, Summers Rada et al., 2006) Keratan sulfate (Summers Rada et al., 2006)

25

Emily F. McDonald: GABA Receptors in Human Sclera

1.6.3 Collagen

Mammalian scleral tissue is composed of approximately 90% collagen by weight (Summers

Rada et al., 2006, McBrien and Gentle, 2003, Yang et al., 2009). There are 8 collagen subtypes present in human sclera: Type I, III, IV, V, VI, VIII, XII and XIII (McBrien and Gentle, 2003,

Summers Rada et al., 2006, Yang et al., 2009, McCluskey, 2001, Kashiwagi et al., 2010, Trier,

2005, Jobling et al., 2009, Kusakari et al., 1997). The structure and function of each collagen subtype varies considerably (Summers Rada et al., 2006). Type I collagen fibres are the most abundant type and can be present in up to 50‐70% of the human sclera (Yang et al., 2009).

With respect to diameters, adult human scleral collagen fibres are highly variable: fibrils have an average range of 94‐102 nm and an overall range between 25‐250 nm (Summers

Rada et al., 2006). More specifically, the outer scleral layer – the episclera – has been reported to have an average of 100 nm (Yang et al., 2009). In terms of thickness, the average fibre ranges between 10‐25 μm (Tsai et al., 2010). During myopia development, the diameter of the scleral collagen fibrils is reduced, weakening the sclera (Choo, 2003, Gentle et al.,

2003).

1.6.4 Elastin

As is characteristic of tissues that are subjected to multidirectional stretching, the human sclera is partly composed of elastic fibres (McCluskey, 2001, Moses et al., 1978). Elastic fibres are partly abundant in the lamina fusca and trabecular meshwork (Watson and Young,

2004); however, overall, elastic tissue forms less than 2% of the sclera per se (Moses et al.,

1978). The elastin is composed of non‐polar hydrophobic amino acids, such as alanine, valine, isoleucine, and leucine, and contains little hydroxyproline and no hydroxylysine

(Watson and Young, 2004).

1.6.5 Enzymes

Notable enzymes present in the sclera are matrix metalloproteinases (MMPs), elastases, collagenases, and proteoglycanases (Maza et al., 2012). MMPs, matrix‐degrading, zinc‐ dependent endopeptidases (Benoit de Coignac et al., 2000), are produced by scleral fibroblasts (McCluskey, 2001) as either secreted or membrane‐bound pro‐enzymes or zymogens (Cauwe et al., 2007). Remodelling and breakdown of the ECM occurs, at least in part, by MMPs (McBrien and Gentle, 2003, Kashiwagi et al., 2010) since they are responsible for degrading collagens, PGs, and other matrix macromolecules (Tomita et al., 2002): MMPs

26

Emily F. McDonald: GABA Receptors in Human Sclera

cleave almost all ECM components (Pirilä et al., 2007). Other functions of MMPs are listed in

Table 1.6. The MMPs, of which there are 23 in humans (listed in Table 1.7), share a common domain structure with a signal peptide for secretion, a propeptide, a catalytic domain, a hinge region, and, in the majority of cases, a C‐terminal domain (Clark et al., 2008, Cauwe et al., 2007). MMPs are activated by removal of the NH2‐terminal propeptide (Cauwe et al.,

2007). Altering the visual environment leads to changes in the concentration of MMPs

(Fredrick, 2002) and, accordingly, alterations have been observed in MMPs during myopia development (McBrien et al., 2006). Specifically, levels of MMPs, and their tissue inhibitors, increase during myopia development (Wride et al., 2006, Choo, 2003). MMP‐2 has been most strongly implicated in the process of scleral remodelling (Jones et al., 1996).

Table 1.6: Known functions of MMPs. Some functions include regulation of cell growth, regulation of apoptosis, and alteration of cell motility. Functions of MMPs References Opposing effects on angiogenesis via matrix degradation but also release of angiogenesis inhibitors Regulation of cell growth via cleavage of cell surface‐bound growth factors and receptors, release of growth factors sequestered in the ECM or integrin signalling (Clark et al., 2008, Cauwe et al., Regulation of apoptosis via release of death or survival factors 2007) Alteration of cell motility by revealing cryptic matrix signals, or cleavage of adhesion molecules Effects on the immune system and host defence Modulation of the bioactivity of cytokines

Other proteases include elastases, collagenases, and proteoglycanases (McCluskey, 2001,

Maza et al., 2012). Elastase is regarded as a powerful proteinase that lacks specificity, unlike some of the other proteinases, such as collagenase (Maza et al., 2012). Elastase, as its name suggests, degrades elastin but, due to its lack of specificity, it is capable of degrading other components of the ECM, such as collagen and PGs (Maza et al., 2012). Collagenase degrades collagen fibrils; collagen degradation as a function in both normal and inflamed tissues depends on the balance between collagenase and its inhibitors (Wooley, 1984).

Proteoglycanases degrade the core protein and link proteins of PGs (Maza et al., 2012).

27

Emily F. McDonald: GABA Receptors in Human Sclera

Table 1.7: Known MMPs and their associated substrate specificity. In the context of myopia, MMP‐2, or gelatinase‐A, has been most strongly implicated in the process of scleral remodelling. Gene Name(s) Reference(s) MMP‐1 Interstitial collagenase or fibroblast collagenase or collagenase‐1 (Tomita et al., 2002) MMP‐2 Gelatinase‐A or 72kDa type IV collagenase (Benoit de Coignac et al., 2000, Clark et al., 2008) MMP‐3 Stromelysin‐1 (Cauwe et al., 2007) MMP‐7 Matrilysin‐1 (Benoit de Coignac et al., 2000, Clark et al., 2008) MMP‐8 Neutrophil collagenase or collagenase‐2 (Pirilä et al., 2007, Giambernardi et al., 2001) MMP‐9 Gelatinase‐B (Benoit de Coignac et al., 2000, Clark et al., 2008) MMP‐10 Stromelysin‐2 (Cauwe et al., 2007) MMP‐11 Stromelysin‐3 (Cauwe et al., 2007) MMP‐12 Macrophage metalloelastase (Benoit de Coignac et al., 2000, Clark et al., 2008) MMP‐13 Collagenase‐3 (Cauwe et al., 2007) MMP‐14 Membrane‐type 1‐MMP (Clark et al., 2008) MMP‐15 Membrane‐type 2‐MMP (Clark et al., 2008) MMP‐16 Membrane‐type 3‐MMP (Clark et al., 2008) MMP‐17 Membrane‐type 4‐MMP (Clark et al., 2008) MMP‐19 RASI‐1 (Cauwe et al., 2007) MMP‐20 Enamalysin (Benoit de Coignac et al., 2000, Clark et al., 2008) MMP‐21 Not classified (Cauwe et al., 2007) MMP‐23 CA‐MMP (Cauwe et al., 2007) MMP‐24 Membrane‐type 5‐MMP (Cauwe et al., 2007) MMP‐25 Membrane‐type 6‐MMP (Cauwe et al., 2007) MMP‐26 Matrilysin‐2 or endometase (Pirilä et al., 2007) MMP‐27 ‐‐‐ (Clark et al., 2008) MMP‐28 Epilysin (Cauwe et al., 2007)

28

Emily F. McDonald: GABA Receptors in Human Sclera

1.6.6 Scleral Fibroblasts

Scleral fibroblasts – or sclerocytes – are present in the ECM, although not in abundance

(McCluskey, 2001), and are arranged in lamellae, or layers (Summers Rada et al., 2006,

Young et al., 2003). It is thought the lamella arrangement of the fibroblasts may play an important role in controlling the size of the eye (Summers Rada et al., 2006). Activated fibroblasts have a spindle‐shaped morphology with stress fibre formation, fibronectin fibrils and focal adhesion complexes (Tomasek et al., 2002, Jester and Ho‐Chang, 2003, Jester et al.,

2002). Fibroblasts, along with the corneal stroma, are responsible for the production of proteins found in the ECM, such as collagen, PGs, and hyaluronan (Kashiwagi et al., 2010,

McCluskey, 2001). Accordingly, the structural organisation and integrity of the sclera is largely dependent on the activity of the scleral fibroblasts (McBrien and Gentle, 2003, Baglole et al., 2006); fibroblasts both synthesise and remodel the ECM (Young et al., 2003). Scleral fibroblasts are involved in scleral remodelling during axial elongation in myopia (Cui et al.,

2004, Cui et al., 2008) and it has been recently suggested that cellular signals acting on the scleral fibroblast may direct the growth process resulting in myopia (Barathi et al., 2009).

Interestingly, the proliferation of fibroblasts in the sclera decrease during myopia development but, during recovery, increase (Choo, 2003). Fibroblasts are thought to play a role(s) during myopic development (refer to Figure 1.10).

Figure 1.10: Proposed model of the role of scleral myofibroblast cells in the biochemical and

29

Emily F. McDonald: GABA Receptors in Human Sclera

biomechanical remodelling that facilitates myopia development (McBrien et al., 2009).

1.6.7 Glycoproteins

For the purposes of this document, the term ‘glycoprotein’ will be primarily used to describe molecules consisting of an oligosaccharide with a mannose core N‐glycosidically linked to asparagine; in the absence of the above clause, it could be argued that collagen, elastin, and

PGs are glycosylated proteins (Maza et al., 2012). Several non‐collagenous glycoproteins have been characterised in the ground substance of the sclera during various embryological developmental stages; they include fibronectin, vitronectin, and laminin (Summers Rada et al., 2006). Fibronectin and laminin are also present in adult sclera (Chapman et al., 1998,

Fukuchi et al., 2001, Maza et al., 2012). It appears that fibronectin plays an important role in the organisation of the pericellular and intercellular matrix due to its ability to bind to collagen, fibroblasts, and glycosaminoglycans (GAGs) (Kleinman et al., 1981, Yamada et al.,

1980). Laminin, found in the basement membranes, participates in assembly of basement membranes and promotion of cell adhesion, growth, migration, and differentiation

(Kleinman et al., 1985).

1.6.8 Growth Factors

It has been reported that many characteristics of scleral ECM remodelling are thought to be under the control of specific growth factors (Summers Rada et al., 2006). During embryological development, there are six known growth factors associated with scleral growth: IGF‐I, IGF‐II, PDGF (platelet‐derived growth factor), TGF‐β (transforming growth factor), NGF (nerve growth factor), and NE (norepinephrine) (Tripathi et al., 1991). It has been observed in animal studies that, during myopia development, there is a decrease in the levels of TGF‐β (Jobling et al., 2004). The levels of the growth factor, thrombospondin‐1

(Frost and Norton, 2007), have also been shown to reduce.

1.6.9 Proteoglycans

PGs comprise approximately 0.7‐0.9% of the total dry weight of the sclera (Summers Rada et al., 2006). PGs, abundant ECM molecules, consist of a core protein with at least one attached

GAG side‐chain made up of repeating disaccharide units (Summers Rada et al., 2006,

McCluskey, 2001, Moreno et al., 2005, Ihanamäki et al., 2004). The GAG side‐chain attached to the PG often carries a negative charge due to their high degree of sulfation (Summers

30

Emily F. McDonald: GABA Receptors in Human Sclera

Rada et al., 2006, McCluskey, 2001). Scleral PGs serve several biologic functions: regulation of hydration in vivo, maintenance of structural integrity, growth regulation, matrix organisation, collagen fibril assembly and arrangement, and cell adhesion (Rada et al., 1997,

Summers Rada et al., 2006, McCluskey, 2001, Majava et al., 2007, Watson and Young, 2004).

PGs are synthesised from proteins produced and secreted by fibroblasts, as mentioned previously (McCluskey, 2001, Johnson et al., 2006).

Glycosaminoglycans

As mentioned above, PGs consist of a core protein with at least one attached GAG side‐chain made up of repeating disaccharide units. GAGs are constructed from several types of sugar residues, which include N‐acetylglucosamine, N‐acetylgalactosamine, glucuronic acid, and iduronic acid (Summers Rada et al., 2006). GAGs are categorised into four main groups based upon their disaccharide composition, the type of linkage between disaccharides, and the number and location of sulfate residues: 1) hyaluronan, 2) chondroitin sulfate and dermatan sulfate, 3) heparan sulfate and heparan, and 4) keratan sulfate (Summers Rada et al., 2006, Ihanamäki et al., 2004). The most abundant GAGs appear to be dermatan sulphate and chondroitin sulphate; hyaluronic acid and heparan are only present in small amounts

(Maza et al., 2012).

Hyaluronan, a unique, non‐sulphated GAG, is an important constituent of the ECM: it plays a role in regulating cell migration, proliferation, adhesion, development, and differentiation

(Kashiwagi et al., 2010, Laurent and Fraser, 1992, Knudson and Knudson, 1993). Hyaluronan occupies the limited space between the collagen fibrils (Trier, 2005). Chondroitin sulphate

(consisting of sulphated N‐acetylgalactosamine and glucuronic acid), dermatan sulphate

(consisting of sulphated N‐acetylgalactosamine and two different types of uronic acid, glucuronic acid and iduronic acid), heparan sulphate (sulphated N‐acetylglucosamine and two different types of uronic acid, glucuronic acid and iduronic acid), and hyaluronic acid

(N‐acetylglucosamine and glucuronic acid) form the greater composition of the amorphous ground substance present in the intercellular and interfibrillar spaces of the sclera (Maza et al., 2012). Among the biochemical changes observed in myopic patients, decreased production of GAGs has also been reported (McBrien et al., 2000, Rada et al., 2000). It must also be noted that, as part of the aging process, there is a significant loss of GAG composition

(particularly dermatan sulphate); as GAGs are highly hydrated, the decrease in age‐related

31

Emily F. McDonald: GABA Receptors in Human Sclera

tissue hydration can be attributed, at least in part, to this loss of GAG composition (Brown et al., 1994).

Aggrecan, Biglycan, and Decorin

Three PG types have been identified in human sclera: aggrecan, biglycan, and decorin (Rada et al., 1997, Johnson et al., 2006, Watson and Young, 2004, Boubriak et al., 2003). Of the PGs synthesised from sclera organ culture, aggrecan, biglycan, and decorin represent 6%, 20%, and 74% respectively (Trier, 2005, Rada et al., 1997). Compared to biglycan and decorin, aggrecan is a comparatively large PG: it contains over 100 chondroitin sulfate chains, over 30 keratan sulfate chains (Rada et al., 1997), and more than 50 oligosaccharide chains (Vynios et al., 2001). Aggrecan has a space filling role in both cartilage and the sclera (Fullwood et al.,

2011). Biglycan – also referred to as PG I – is a small PG (McBrien and Gentle, 2003); it has a molecular mass of 200 kDa (Rada et al., 1997). Biglycan contains two chondroitin‐dermatan sulfate chains (Rada et al., 1997, Vynios et al., 2001) and belongs to the Small Leucine‐Rich

Proteoglycans (SLRPs) family (Summers Rada et al., 2006, Zhang et al., 2009). SLRPs are characterised by a central domain containing leucine‐rich repeats flanked on both N‐ and C‐ terminal sides by small cysteine clusters (Moreno et al., 2005, McEwan et al., 2006). Biglycan plays an important role in regulating collagen fibril assembly and interaction (McBrien and

Gentle, 2003, Zhang et al., 2009). Decorin, the most abundant PG (Trier, 2005), is reasonably small: it consists of a molecular mass of 120 kDa (Rada et al., 1997). Decorin contains one chondroitin‐dermatan sulfate chain (Rada et al., 1997, Vynios et al., 2001). Biglycan and decorin are closely related (Rada et al., 1997, McCluskey, 2001); decorin also belongs to the

SLRP family (Summers Rada et al., 2006, Zhang et al., 2009). [Both biglycan and decorin are known as Class I SLRPs (Schaefer and Iozzo, 2008).] Decorin exhibits a unique organisation of 10 tandem leucine‐rich repeats enabling the molecule to fold into an arch‐shape structure suited to bind both globular and non‐globular proteins (Santra et al., 2002). Decorin – also referred to as PG II – binds, in vitro, to collagens type I and II (Rada et al., 1997) and, along with biglycan, plays an important role in collagen fibril assembly and interaction (McBrien and Gentle, 2003, Zhang et al., 2009).

1.6.10 Other Receptor Types known to be Present in Human Sclera

Several receptor types have been found in human sclera; refer to Table 1.8. There has been interest in muscarinic receptors as a potential target for pharmaceutical agents, in the context

32

Emily F. McDonald: GABA Receptors in Human Sclera

of myopia, but the studies have found variable effects (Luft et al., 2003, Diether et al., 2007).

Table 1.9 lists known locations of muscarinic receptors in both ocular and non‐ocular tissues and Table 1.10 outlines key functions of receptors shown in Table 1.8.

Table 1.8: Receptor types observed in human sclera. Types include collagen, prostanoid, and muscarinic receptors. Receptor Type Present in Human Sclera References α1(XIII) Collagen mRNA (Sandberg‐Lall et al., 2000) ADORA1 (Cui et al., 2008) ADORA2B (Cui et al., 2008) CD14 (Chang et al., 2004) E‐Prostanoid Receptors (Subtypes 1‐4) (Schlötzer‐Schrehardt et al., 2002) FP (PGF2α Receptor) (Schlötzer‐Schrehardt et al., 2002) MD‐2 (Chang et al., 2004) Muscarinic Receptor Subtype 1 (M1) (Collison et al., 2000, Qu et al., 2006) Muscarinic Receptor Subtype 2 (M2) (Qu et al., 2006) Muscarinic Receptor Subtype 3 (M3) (Collison et al., 2000, Qu et al., 2006) Muscarinic Receptor Subtype 4 (M4) (Qu et al., 2006) Muscarinic Receptor Subtype 5 (M5) (Qu et al., 2006) TLR4 (Chang et al., 2004)

Table 1.9: Location of muscarinic receptors in ocular and non‐ocular tissues. Location Muscarinic Receptor/s Reference Cornea and epithelium of M3 (Collison et al., 2000) the crystalline lens Iris sphincter and ciliary M1‐M5 (Gil et al., 1997, Gupta et al., body 1994, Zhang et al., 1995) Retina M3 and M4 (Fischer et al., 1998) Lung Fibroblasts M1‐M4 (Matthiesen et al., 2006) Labial Salivary Glands M1, M3, M5 (Ryberg et al., 2008) Sclera M1‐M5 (Qu et al., 2006)

33

Emily F. McDonald: GABA Receptors in Human Sclera

Table 1.10: Key functions of receptors present in human sclera. Role or Possible Involvement Reference ADORA1 and ADORA2B Receptors Associated with the regulation of IOP in rabbits and monkeys (Crosson et al., 1994, Tian et al., 1997) ADORA1 inhibits adenylcyclase (Gi/o‐coupled) and therefore (Burnstock, 2007) decreases levels of cAMP (cyclic adenosine monophosphate) ADORA2B activates adenylcyclase (Gs‐coupled) and increases (Burnstock, 2007) levels of cAMP CD14 Receptors Enhances activation of cells by lipopolysaccharide (Viriyakosol et al., 2000) E‐Prostanoid Receptors Exert a variety of actions in various tissues and cells; some of these (Narumiya et al., 1999) actions are described below:  relaxation and contraction of various types of smooth muscles  modulate neuronal activity by either inhibiting or stimulating neurotransmitter release, sensitizing sensory fibers to noxious stimuli, or inducing central actions such as fever generation and sleep induction  involved in apoptosis, cell differentiation, and oncogenesis  regulate the activity of blood platelets both positively and negatively and are involved in vascular homeostasis and haemostasis FP (PGF2) Receptors May play a role in regulating IOP (Schlötzer‐Schrehardt et al., 2002) MD‐2 Receptors Accessory molecule that associates with the extracellular domain of (Nagai et al., 2002, Shimazu et TLR4 (see below for more on TLR4) conferring on it al., 1999) lipopolysaccharide responsiveness Muscarinic Receptors Transactivate growth factor receptors (Kanno et al., 2003) Accommodation, altered aqueous outflow, and contraction of the (Gabelt and Kaufman, 1992, iris sphincter muscle Kaufman, 1984) Regulating growth of the corneal epithelium and control corneal (Lind and Cavanagh, 1995) wound healing TLR4 Receptors Recognition of the highly conserved pathogen‐associated (Chang et al., 2004) molecular patterns unique to microbes Stimulation results in the activation of an immunostimulatory and (Medzhitov et al., 1997, Schnare immunomodulatory cell‐signalling pathways essential for innate et al., 2001) immunity and activation of the adaptive arm of the immune response

1.6.11 Factors Affecting Human Scleral Structure & Function

During myopia development, fibril diameter and the processes involved in collagen synthesis and degradation change (McBrien et al., 2006). In a human myopic eye, the sclera thins and the diameter of collagen fibrils found in the posterior sclera becomes progressively,

34

Emily F. McDonald: GABA Receptors in Human Sclera

as compared to non‐myopic eyes, smaller (Jobling et al., 2009, Kusakari et al., 1997, Cui et al.,

2008, McBrien et al., 2001a, McBrien et al., 2000, Tseng et al., 2004, Yang et al., 2009, Gottlieb et al., 1990). The thinning of the sclera and the narrowing of the fibrils is usually associated with a disconnection of the collagen fibre bundles (Yang et al., 2009) and an abnormal pattern of interlacing (Gottlieb et al., 1990). It has been hypothesised that the above‐ mentioned pathological features of the fibrils – narrowing and disconnection – results from reduced collagen synthesis and/or increased collagen degradation (Yang et al., 2009).

Accordingly, elevated activity of collagen‐degrading enzymes has been implicated in early stages of myopia onset (McBrien et al., 2001a). The process of scleral remodelling is depicted in Figure 1.11.

Figure 1.11: Diagrammatic representation of the scleral remodelling that underpins myopia development (McBrien et al., 2009). It is believed that the visually‐generated signal is communicated from the retina and through the choroid to the sclera.

1.7 Summary

Based on the literature described here, it is clear that distribution and function of GABA in scleral tissue is a relatively unexplored area. Previously, the human sclera has been thought to be essentially inert (McBrien and Gentle, 2003) and, accordingly, there is a significant gap in the literature addressing and exploring the potentially dynamic role(s) of the sclera – including in the context of communication with neurotransmitters, such as GABA – in refractive conditions (Watson and Young, 2004). GABA is an important inhibitory

35

Emily F. McDonald: GABA Receptors in Human Sclera

neurotransmitter present in the CNS and retina (Krogsgaard‐Larsen et al., 1997, Chebib et al.,

2009b, Enz and Cutting, 1999, Barnard et al., 1998). Specifically, GABA antagonists have been found to influence ocular growth in chick models of myopia (Stone et al., 2003, Leung et al., 2005) and, in association with inhibition of myopia development in chicks, facilitate learning and memory in mice (Chebib et al., 2009b). One key animal study (Stone et al.,

2003) demonstrated that GABA plays a modulation role during eye growth and refractive development. As stated in a recent paper (Cheng et al., 2011), due to the fact that there are many examples of GABA receptors located in multiple ocular sites, the discovery of rho 1

GABAC receptors in non‐neuronal ocular tissues is not as unusual as it may first appear.

This study will provide important new information on GABA receptor localisation in human scleral tissue at both a whole of tissue and cellular level.

We hypothesise, based on the limited chick data available, that GABA receptors will be present in human non‐retinal tissues, including RPE and sclera.

36

Emily F. McDonald: GABA Receptors in Human Sclera

1.8 Research Aims

The aims of this research project were:

1) Investigate the expression of GABA receptors in human scleral tissue using both

immunohistochemistry (IHC) and gene expression studies

2) Investigate the expression of GABA receptors in cultured human scleral cells by

culturing scleral cells ex vivo and examining these for GABA receptor gene expression

3) Investigate the expression of GABA receptors in choroidal, RPE, and retinal tissue

using both IHC and gene expression studies

The overarching theme of this thesis was to investigate human sclera – cells and tissue – and factors that may impact scleral cell growth with relevance to myopia. The first study to be completed was to determine if GABA receptors are present in human scleral tissue. Based on the fact that these receptors have been localised to the scleral tissue of other species

(Cheng et al., 2011), it was predicted that GABA receptors would also be present in human scleral tissue. The second study sought to target mesenchymal stromal cell populations obtained from human scleral cell cultures. Thirdly, we investigated the potential presence of

GABA receptors in choroidal, RPE, and retinal tissues obtained from the same donors as the scleral tissue and stromal cells were sourced.

37

Emily F. McDonald: GABA Receptors in Human Sclera

2 Materials and methodology

This project utilised IHC – antibodies raised against four different GABA receptor subunits previously found in human retina – and reverse‐transcriptase polymerase chain reaction

(RT‐PCR) – 21 different primers designed to amplify all known GABA receptor subunits.

IHC was only undertaken using human scleral tissue; RT‐PCR was undertaken using human sclera, choroid/RPE, retina, and cultured human scleral cells. The following sections outline all materials used and methodology implemented during this project and experiments are listed in the following order: Experiment (i) – IHC; Experiment (ii) – Cell culturing and flow cytometry (Dominici et al.) ; & Experiment (iii) – Analysis of GABA receptor gene expression in ocular tissues and cells.

2.1 Human Research Ethics Issues

This project involves the use of human cadaveric tissue and, therefore, ethics approval was required. For this project, the Queensland University of Technology (QUT) ethics committee granted ethics approval for all experimental work. The QUT ethics approval number for this project is 0800000807.

2.2 Eye Collection

Eye cups were collected from the Queensland Eye Bank (QEB), Princess Alexandra Hospital,

Brisbane, Queensland within 4‐5 days of death. Until collection, the tissue was stored at 4C in tissue storage medium. Since eye cups were obtained in pairs, the right eye was fixed in formalin for 2 days and then stored in 70% ethanol at 4°C; the right eye was used for IHC.

The left eye was stored at ‐80°C for subsequent gene expression studies. The age of the donors varied from 61 to 86 years. The refractive history and ethnicity of the donors was not known. However, the age and cause of death of all donors was known (Table 2.1).

Table 2.1: Donor characteristics; information supplied from the QEB. Age Cause of Death IHC or RT‐PCR 71 Unknown IHC 86 Non‐Small Cell Lung Cancer IHC 79 Intracranial Haemorrhage IHC 65 Metastatic Lung Cancer RT‐PCR 61 Metastatic Pancreatic Cancer RT‐PCR 75 Lung Adenocarcinoma, COPD, Hypertension RT‐PCR

38

Emily F. McDonald: GABA Receptors in Human Sclera

2.3 Preparation for Microtomy

Whole eyes were sectioned into strips from the inferior, superior, medial, and lateral quadrants ~15 mm x 5 mm from the anterior section to approximately 3 mm from the start of the optic nerve (Figure 2.1 shows a photograph of a typical eye specimen). The rationale for obtaining the four different regions was to allow for potential variability (at a cellular level) from one region to another. Orientation (Figure 2.2 maps out directional orientation and

Figure 3 provides an illustration depicting how the eyes were dissected) was determined using several parameters: as it was already known whether the eye was left or right

(supplied information from QEB) and the eyes each presented with a reasonable length of optic nerve, it was relatively straightforward to determine the general orientation of the eye based on the direction of the optic nerve. More specifically, the vortex veins were visible and served as landmarks for determining the orientation. In some cases, the rectus and oblique muscles were attached as well. For more information on the gross anatomy of human sclera and associated landmarks, refer to Appendix 2.

Figure 2.1: Photograph (taken by EFM) of a typical eye specimen showing length of the optic nerve and visible veins. In the top left region of the eye (as shown in the picture), some remnants of muscle are evident.

39

Emily F. McDonald: GABA Receptors in Human Sclera

Figure 2.2: Scleral map highlighting superior, inferior, nasal, and temporal regions in relation to the optic nerve (Elsheikh et al., 2010).

Figure 2.3: Illustration demonstrating how the eye cups were dissected. Each eye was cut into four strips – superior, inferior, medial and lateral. Each strip was approximately 5 mm wide and 15 mm in length.

2.4 Microtomy

The formalin‐fixed tissue sections mentioned above were processed by routine paraffin embedding technique. The processing (dehydration with alcohols, clearing with xylene, and infiltration with molten wax) was performed using a Tissue‐Tek VIP 1000 by Helen

OʹConnor at QUT, Gardens Point. Embedding was undertaken using a Tissue‐Tek Tissue

Embedding Console System 4593. Microtomy was performed using either a Reichert‐Jung

2030 (Queensland Eye Institute, or QEI) or a Microm HM 325 (QUT, Gardens Point) – both are rotary microtomes with disposable blades. Serial sections were cut to 3 microns in width and mounted on glass slides (Menzel HD Microscope Slides, Superfrost Plus Ground).

Tissue sections were dried at 60°C for several hours.

2.5 Preliminary Work: H&E and Bleaching Optimisation

The paraffin tissue sections were deparaffinised using xylene and rehydrated using ascending grades of ethanol (70, 90, and 100%). Haematoxylin & eosin staining was undertaken to examine the general morphology of the tissue (refer to Figure 2.4 for H&E

40

Emily F. McDonald: GABA Receptors in Human Sclera

images – donor 6397L – showing the landscape of the sclera). The tissue was stained with

Mayerʹs haematoxylin for 3 minutes, differentiated with two dips in acid alcohol, and treated with Scottʹs reagent for 30 seconds. The images were taken using an Olympus BX41 microscope and a Nikon DXM 1200 camera.

Figure 2.4: Overview of scleral tissue structure, including demonstration of melanocytes in

41

Emily F. McDonald: GABA Receptors in Human Sclera

deeper sclera, from donor 6397L to determine integrity of tissue and basic structures using H&E. (A) A montage of three photographs (20x oil immersion lens) demonstrating nearly the full thickness of the sclera and adjacent retinal tissue in a lateral section. Note the higher density of stromal cell nuclei within the outer third of the sclera along with the presence of blood vessels. (B) A corresponding image of the outer sclera within a section taken from the medial aspect of the sclera. Note the thicker muscular wall of the arteriole surrounded by unexpected melanocytes. (C) A higher power image (100x oil immersion lens) showing the detailed morphology of the vessel wall (the arrow is highlighting the endothelium) and adjacent melanocytes, which appear brown (medial section).

As can be seen in Figure 2.4 above, there are melanocytes present in the sclera. Due to the possibility of melanocytes being mistaken for false‐positive antibody results (Orchard and

Calonje, 1998), bleaching – exposure to oxalic acid for one minute and to potassium permanganate for 3‐5 minutes – was attempted prior to undertaking IHC. It was found that

3‐5 minutes of bleaching was an optimal timeframe to ensure the melanocytes appeared pale instead of brown (refer to Figure 2.5). However, bleaching the tissue also increased the basophilia of the tissue and resulted in a bluish appearance.

Figure 2.5: Bleaching optimisation results observed for donor 6397L (tissue taken from lateral region). (A) Mayer’s haematoxylin only as a control; the arrow is highlighting a melanocyte (B) Appearance of tissue following one minute of oxalic acid and 30 seconds of potassium permanganate. As shown, bleaching increased the basophilia of the tissue and resulted in the tissue becoming negatively charged. The pigmentation has started to disappear but not entirely; the arrow is highlighting the outer layer of sclera; (C) Appearance of tissue following one minute of oxalic acid and 1 minute of potassium permanganate. Bruch’s membrane has started to become visible and there is still pigmentation present; (D) Appearance of tissue following one minute of oxalic acid and 2 minutes of potassium permanganate. Still a small amount of pigmentation visible; (E) Appearance of tissue following one minute of oxalic acid and 5 minutes of potassium permanganate. Bruch’s membrane is now well‐defined as a thin blue line beneath the RPE.

42

Emily F. McDonald: GABA Receptors in Human Sclera

2.6 Immunohistochemistry: Experiment #1

IHC was performed using the Dako EnVision+ HRP (DAB) kit (DakoCytomation, Botany,

New South Wales, Australia). The following antibodies were used:

1) QED Biosciences Inc. Anti‐Alpha 1 GABA‐A Receptor Monoclonal (Lot # 032510)

2) Sigma Aldrich Prestige Antibodies Anti‐GABRR2 Rabbit (Lot # R06608)

3) Sapphire Biosciences Rb pAb to GABRR1 (Lot # GR25385‐2)

4) Epitomics GABA (B) R2 Rabbit mAb (Lot #YE102203)

The antibodies listed above – excluding the one for GABA B R2 – were selected based on previous studies demonstrating presence in human retinal tissue: GABA A α‐1 (Vardi and

Sterling, 1994), GABA 1 (Gussin et al., 2011, Hackam et al., 1997), and GABA 2 (Wang et al., 1994, Hackam et al., 1997). GABA B R2 was selected as representative for the GABA B receptor type. Deparaffinised slides were blocked in 2% bovine serum albumin (BSA) in phosphate buffered saline (PBS) for 30 minutes. The primary antibodies were diluted in 2%

BSA (1:100 and 1:200) and applied at room temperature for one hour. The peroxidise‐ labelled polymer was added for 20 minutes at room temperature after the slides were washed three times in PBS to remove the primary antibody. DAB, or 3,3‐diaminobenzidine, was added for 5 minutes and then the slides were counterstained with Mayer’s haematoxylin. The sections were dehydrated using descending grades of ethanol (100, 90, &

70%), followed by xylene, and then mounted using Entellan New® (Pro Sci Tech,

Thuringowa, Queensland, Australia). Sections were viewed with an Olympus BX 41 microscope and images were taken using a NikonDXM 1200 camera. [All four quadrants were exposed to all four antibodies using donor 6937L; the superior and medial sections were exposed to the Anti‐Alpha 1 GABA‐A Receptor Monoclonal (QED Biosciences Inc) and the Anti‐GABRR2 (Sigma Aldrich Prestige Antibodies) using donors 6806R and 6813R.]

2.7 Cell Culturing & Flow Cytometry: Experiment #2

Scleral stromal cells obtained from donors 6952 L and 6953L were kindly provided by Assoc

Prof Damien Harkin from QEI and characterised using FC by Dr Laura Bray (also from QEI).

An explant of scleral tissue – 1 cm2 – was washed twice in PBS, chopped finely into 1 mm2 pieces, resuspended in 2 ml fetal bovine serum (FBS), and seeded into a 25 cm2 flask and the pieces were distributed. The flask was inverted and incubated for 5 hours at 37°C in a cell culture incubator (5% CO2) to promote attachment of tissue pieces. The flask was then reverted to normal orientation and 2 mL of culture medium (DMEM/F12 with 10% FBS and

43

Emily F. McDonald: GABA Receptors in Human Sclera

10 mM glutamine, supplemented with 50 U/ml penicillin/50 μg/ml streptomycin antibiotic solution) was added. Out‐growth of stromal cells was clearly visible using a light microscope after 1 week. The cultures were expanded to passage 3 (over a period of 5‐6 weeks) before storage in liquid nitrogen; 7.5 million cells per donor (stored in 90% FBS + 10%

DMSO).

Cellular phenotype analysis was performed using fluorescently labelled mouse anti‐human antibodies (or rat anti‐human antibody in the case of CD44) as follows: IgG1 к isotype control phycoerythrin (PE) (MOPC‐21), CD31 PE (WM‐59, IgG1 к), CD34 fluorescein isothiocyanate (FITC) (581/CD34, IgG1 к), CD44 Pacific Blue (IM7, IgG2b, к), CD45 PE‐ cyanine dye (Cy7) (HI30, IgG1 к), CD73 allophycocyanin (APC) (AD2, IgG1 к), CD90 FITC

(5E10, IgG1 к), CD105 PE (SN6, IgG1 к), and CD141 PE (1A4, IgG1 к). The panel of markers was a standard panel used to determine mesenchymal‐like characteristics. All antibodies were purchased from Becton‐Dickinson (BD Pharmingen, CA, USA), eBioscience (in the case of CD73 and CD105; Jomar Bioscience, SA, Australia), or Biolegend, Australian Biosearch,

WA, Australia (in the case of CD44). Viability was assessed by 7‐amino‐actinomycin D incorporation (BD Viaprobe cell viability solution). Antibody concentrations were used according to manufacturers’ instructions. Purified antibodies against GABAA‐α1, GABAAB‐

2, GABR‐R1, and GABR‐R2 (same as was used for IHC) were also utilised with either a secondary Alexa Fluor 488 (for anti‐mouse) or 594 (for anti‐rabbit) antibody. Forty thousand events were collected on a BD LSRII (BD Biosciences, CA, USA) where possible and analysed using FlowJo software (Tree Star Inc., OR, USA).

2.8 Analysis of GABA Receptor Gene Expression in Ocular Tissues and Cells: Experiment #3

2.8.1 Primer Design

Primers were designed to amplify ~150‐200 base pair (bp) fragments of individual GABA receptors sequences. Individual primers were 21 nucleotides in length and, of the total number, 12‐13 nucleotides consisted of guanine or cytosine. Database searches using determined sequences were performed using the BLAST program to confirm specificity of the primers to their target GABA receptors. The sequences were aligned by using

ClustalW2. The following table (Table 2.2) lists the primers. Primers were obtained from

Sigma Aldrich. As the annealing temperature had to be deduced for each of the primers, the

44

Emily F. McDonald: GABA Receptors in Human Sclera

primers were exposed to three different temperatures: 63.0°C, 65.0°C, and 67.0°C. Analysis for each primer was performed at the three temperatures mentioned and, if expression was observed at a unique temperature, that temperature was determined to be the annealing temperature. The results from the temperature‐range optimisation are shown in Table 2.3.

The remaining four primers not shown in the table – GABAA Alpha 2 v1 & 2, GABAA Alpha

3, GABAA Delta, and GABAC Rho 3 – did not demonstrate expression.

45

Emily F. McDonald: GABA Receptors in Human Sclera

Table 2.2: Individual primers (and expected product size) for each gene, including all known transcript variants where applicable and represented by a ‘V’ in the gene name, representing a GABA receptor subunit. The primer for GAPDH (housekeeping gene) is also shown below. # GABA Gene Primer Product (bp) 1 GABAAΑ1V1,2,3,4,5,6,7 F460 5ʹ AGCCCGCGATGAGGAAAAGTC – 3’ 193 (GABA A ALPHA 1 V1‐V7) R653 5ʹ CCCAATCCTGGTCTCAGGCGA – 3’ 2 GABAAΑ2V1 & 2 F1340 5’ GGGCTTGGGATGGGAAGAGTG – 3’ 164 (GABA A ALPHA 2 V1 & V2) R1504 5’ TGGGTTCTGGCGTGGTTGCAC – 3’ 3 GABAAΑ3 F512 5’ TGGGCTTGGAGATGCAGTGAC – 3’ 191 (GABA A ALPHA 3) R703 5’ TGTGGAAGAAGGTGTCCGGTG – 3’ 4 GABAAΑ4V1‐3 F1867 5’ CTGTCCTCACCATGACCACAC – 3’ 205 (GABA A ALPHA 4 V1‐V3) R2072 5’ CTCTCTCTGCACTGGAGCAGC – 3’ 5 GABAAΑ5V1 & 2 F746 5’ ATCACTCAGGTGAGGACCGAC – 3’ 183 (GABA A ALPHA 5 V1 & V2) R929 5’ TGTCTGGGGTCCAGATCTTGC – 3’ 6 GABAAΑ6 F609 5’ AGGTTGAAGTTTGGGGGGCCA – 3’ 192 (GABA A ALPHA 6) R801 5’ AACCAGCCTCATGGGACAGTC – 3’ 7 GABRB1 F561 5’ GTTGGGATGCGGATCGATGTC – 3’ 170 (GABA A BETA 1) R731 5’ TGGTACCCAGAGTTGGTCAGC – 3’ 8 GABRB2V1 & 2 F1765 5’ CCTCCCACTGGAAGCAAGGAC – 3’ 132 (GABA A BETA 2 V1 & V2) R1897 5’ TGGACCACAGGATAGGCCAGC – 3’ 9 GABRB3V1‐4 F2647 5’ GAGGCAAAGGAGGGCAACCTG – 3’ 127 (GABA A BETA 3 V1‐V4) R2774 5’ GCGTCTATGAAACCGGTGCAC – 3’ 10 GABRG1 F816 5’ AAGCCCTCCGTAGAAGTGGCT – 3’ 248 (GABA A GAMMA 1) R1064 5’ CGATGTTCTTGCAGGCACTGC – 3’ 11 GABRG2V1,2,3 F74 5’ TCTCCTTGTACCCTCCCCCTG – 3’ 183 (GABA A GAMMA 2 V1‐V3) R257 5’ CCACCTGCCTCTAGTAGGTCC – 3’ 12 GABRG3 F1094 5’ TGCTACGCCAGCAAGAACAGC – 3’ 148 (GABA A GAMMA 3) R1242 5’ CGGCGAAGACAAACAGGAAGC – 3’ 13 GABRE F361 5’ GTCAACAGCCTTGGTCCTCTC – 3’ 218 (GABA A EPSILON) R579 5’ GACCATCTGGTTGGGCATGGT – 3’ 14 GABRD F385 5’ ACAGCAGGCTCTCCTACAACC – 3’ 192 (GABA A DELTA) R577 5’ GTGGAGGTGATTCGGATGCTG – 3’ 15 GABRQ F404 5’ GACCCTGGACTATCGGATGCA – 3’ 155 (GABA A THETA) R559 5’ GATCCAGGGAACAAGCTGCTG – 3’ 16 GABRP F452 5’ CCATATACCTCCGACAGCGCT – 3’ 205 (GABA A PI) R657 5’ TCTGAGGGCATACAGGACCGT – 3’ 17 GABBR1, 2, & 3 F928 5’ GACGTGAATAGCCGCAGGGAC – 3’ 194 (GABA B R1) R1122 5’ GAGGTTCCACATCCTAGCAGC – 3’ 18 GABBR2 F2900 5’ ATGCAGCTGCAGGACACACCA – 3’ 181 (GABA B R2) R3081 5’ GTTCGAGAGGGCTCTGTTGTG – 3’ 19 GABRR1 F826 5’ TGAGGCACTACTGGAAGGACG – 3’ 155 (GABA RHO 1) R981 5’ CGTTGTCTGTGGTGGTGTCGT – 3’ 20 GABRR2 F380 5’ TATGACCCTGTACCTGCGGCA – 3’ 201 (GABA RHO 2) R581 5’ CACGTGTCCATCTGGGAACAC – 3’ 21 GABRR3 F339 5’ GAGACCTGGATTTGGAGGGTC – 3’ 152 (GABA RHO 3) R491 5’ GCTGTGCTAGGAAAGGAGAGC – 3’ 22 GAPDH F 5’ GCAAATTCCATGGCACCGT – 3’ 106 R 5’ TCGCCCCACTTGATTTTGG – 3’

46

Emily F. McDonald: GABA Receptors in Human Sclera

Table 2.3: Annealing temperatures for primers following exposure of all cells and tissues to three different temperature ranges: 63°C, 65°C & 67°C. Annealing Temperature Primer Temperature/Primera 63°C GABA A Alpha 1 v1‐7 F: 70.5°C R: 72.7°C GABA A Alpha 5 v1 & 2 F: 65.5°C R: 68.6°C GABA A Beta 1 F: 70.8°C R: 66.3°C GABA A Beta 2 v1 & 2 F: 69.2°C R: 70.5°C GABA A Gamma 2 v1‐3 F: 68.4°C R: 63.8°C GABA A Gamma 3 F: 69.7°C R: 70.0°C GABA A Epsilon F: 65.1°C R: 70.3°C GABA A Theta F: 68.3°C R: 68.1°C GABA A Pi F: 67.1°C R: 67.9°C GABA B R2 F: 71.6°C R: 66.1°C GABA Rho 1 F: 66.5°C R: 68.5°C GABA Rho 2 F: 69.6°C R: 67.8°C 65°C GABA A Alpha 4 v1‐3 F: 65.6°C R: 66.9°C GABA A Alpha 6 F: 72.4°C R: 67.5°C GABA A Beta 3 v1‐4 F: 71.0°C R: 68.7°C 67°C GABA A Gamma 1 F: 67.1°C R: 70.2°C GABA B R1 F: 69.9°C R: 64.9°C a Information supplied by the manufacturer.

2.8.2 RNA Isolation and Reverse‐Transcription

RNA was isolated from tissue samples and cultured scleral cells using TRIzol solution

(Invitrogen). In the case of the tissue samples, each layer was separated. Firstly, the retina was carefully loosened from the choroid and RPE. Due to difficulty separating the choroid from the RPE, both layers remained intact. Finally, the sclera was cleaned of any contamination – easily observed with the eye due to the difference in colours of the layers.

Briefly, tissues were ground to a fine powder under liquid nitrogen using a mortar and pestle and this was then transferred to a 2 ml Eppendorf tube containing 1 ml TRIzol. Total

47

Emily F. McDonald: GABA Receptors in Human Sclera

RNA was extracted from this following the manufacturer’s recommendations. The cells were allowed to incubate at room temperature for five minutes. Cell homogenate was transferred to 1.5 mL Eppendorf tubes. Two hundred L of chloroform was added to each 1 mL cell homogenate. Tubes were mixed vigorously for 15 seconds and then allowed to stand for 2 minutes. Tubes were spun in the cold room (4C) for 15 minutes at 12,000 rpm.

The upper aqueous phase was carefully transferred to new Eppendorf tubes. RNA was precipitated by adding 0.5 mL isopropyl alcohol per 1 mL of tissue homogenate. Tubes were incubated for 10 minutes at room temperature. Tubes were spun at 12,000 rpm at 4C for 10 minutes. Supernatant was carefully discarded and the pellet was washed with 1 mL of 75% ethanol per 1 mL of supernatant and mixed well. Tubes were spun at 7,500 rpm for 5 minutes. The supernatant was carefully removed and discarded. The pellet was resuspended in 30 L of de‐ionised water and the pellet was mashed finely using the tip of a sterile pipette. The RNA was quantitated using a NanoDrop Spectrophotometer (Thermo

Scientific, Wilmington, DE) and 2 g of total RNA was reverse‐transcribed for 10 minutes at

25°C, 60 minutes at 55°C, and 15 minutes at 70°C using 3 μl pD(N)6 primers (Invitrogen), 200

μM each deoxyribonucleotide triphosphate (dNTP) (Pharmacia, Uppsala, Sweden) and 200

U Superscript III reverse transcriptase (Invitrogen); the total reaction volume was 10 μL.

The concentration and purity of the RNA was determined by measurement of the optical density at 260 nm and 280 nm and the results are shown in Table 2.4. The 260/280 nm ratios ranged between 1.17 ‐ 1.99 but were on average 1.67. Lower ratios were seen in samples from frozen tissues and, in particular, those extracted from the retina, which produces retinal pigments, including melanin. Furthermore, it is important to note that the 260 nm/230 nm in the retinal samples were influenced by the melanin found in these tissues but the RNA was still suitable for expression analysis via RT‐PCR. The integrity of the cDNA made using the

RNA extracted from these samples was confirmed using primers to amplify the housekeeping control gene, GAPDH. Attempts were made to extract RNA from donors

6806L, 6813L, and 6815L but the RNA yields were too small to complete the analysis of gene expression for all of the GABA receptors in these samples – between 35.3 and 653.2 ng/μL – so were excluded from the project.

48

Emily F. McDonald: GABA Receptors in Human Sclera

Table 2.4: Results from NanoDrop. Sample Identification Concentration RNA ng/μl 260/280nm 260/230nm 6952L A Sclera 1862.8 1.46 0.77 6952L B Sclera 2902.3 1.8 1.16 6952L C Sclera 3311.7 1.67 1.31 6952L D Sclera 2502.0 1.55 1.02 6952L E Sclera 2295.2 1.56 0.92 6952L F Sclera 2763.5 1.70 1.10

6953L A Sclera 2201.8 1.64 0.89 6953L B Sclera 2677.8 1.37 1.08 6953L C Sclera 2467.0 1.66 0.99 6953L D Sclera 2551.4 1.65 1.02

6954L A Sclera 2455.5 1.77 0.99 6954L B Sclera 2981.6 1.60 1.19 6954L C Sclera 1346.3 1.25 0.57 6954L D Sclera 2303.9 1.69 0.92

6952L A Mesenchymal Stromal Cells 868.3 1.95 1.50 6952L B Mesenchymal Stromal Cells 911.8 1.98 1.88 6952L C Mesenchymal Stromal Cells 892.2 1.98 1.82 6952L D Mesenchymal Stromal Cells 1042.13 1.96 1.84

6953L A Mesenchymal Stromal Cells 1058.5 1.96 1.69 6953L B Mesenchymal Stromal Cells 1244.7 1.99 1.86 6953L C Mesenchymal Stromal Cells 952.6 1.95 1.63 6953L D Mesenchymal Stromal Cells 1087.6 1.97 1.95

6952L A Retina 3688.0 1.62 1.45 6952L B Retina (excluded) 281.2 1.43 0.72

6953L A Retina 3583.5 1.18 1.42

6952L A Choroid/RPE 2915.8 1.64 1.19

6953L A Choroid/RPE 3438.4 1.48 1.40 6953L B Choroid/RPE 3182.1 1.17 1.86

2.8.3 RT‐PCR Amplification of GABA Receptors

Primers specific to all 21 GABA receptor subunits (as shown previously in Table 2.2) and the housekeeping gene GAPDH (glyceraldehyde‐3‐phosphate dehydrogenase) were used to analyse gene expression. RT‐PCR reactions were performed in a PTC‐200 thermocycler

(Perkin Elmer, Waltham, MA) under the following conditions: Two μl cDNA template, 1.5 mM MgCl2, 200 μM each dNTP, 50 ng of each forward and reverse primer, and 0.5 units of

Platinum Taq polymerase in 1 x PCR buffer (Invitrogen); the total reaction volume was 50

μL. Cycling conditions included an initial denaturation at 94°C for 2 minutes, followed by

49

Emily F. McDonald: GABA Receptors in Human Sclera

40 cycles at 94°C for 30 seconds, 63‐67°C for 30 seconds and 72°C for 30 seconds, with a final extension of 72°C for 7 minutes. Amplification products were visualised by ethidium bromide staining following separation by electrophoresis through 2% agarose gels. The housekeeping gene GAPDH was used to confirm the integrity of the cDNA. Controls used:

“PCR‐ve” – water was substituted for template; “housekeeping control” – primer used was for housekeeping gene to confirm integrity of the cDNA sample; “RT‐ve” – Superscript III was not added during reverse‐transcription. The number times a RT‐PCR reaction was performed was once (following optimisation of the annealing temperatures). Purified RT‐

PCR product for each representative GABA gene was sent to the Australian Genome

Research Facility (AGRF) for sequencing. Two hundred L of Promega membrane binding solution was added to each tube of product. The tubes were spun at 14,000 rpm for 1 minute and the flow‐through was discarded. Five hundred L of membrane was solution (from the same kit as the membrane binding solution) was added and the tubes were spun at 14,000 rpm for 1 minute and the flow‐through was discarded. The above steps were repeated (with addition of 500 L of membrane wash solution). The tubes were spun at 14,000 rpm as empty and then the basket was transferred with membrane to a tube (Eppendorf 1.5), 50 L of nuclease‐free water was added (from Promega kit mentioned above), and the tubes were spun at 14,000 rpm for 1 minute. Finally, 6 L of RT‐PCR product was transferred to a 1.5

Eppendorf tube and 1 L of forward primer and 5 L of ultra pure distilled water was added. The samples were sequenced by the AGRF Sanger routine sequencing service using capillary separation on an AB 3730xl Sequencer.

50

Emily F. McDonald: GABA Receptors in Human Sclera

3 results

The purpose of this project was to determine the presence/absence of GABA gene expression in samples obtained from human sclera, choroid, RPE and retina. The results from the IHC component of this project were inconclusive. The results from the RT‐PCR revealed the presence of mRNA representing GABAA and GABAC receptor subunits throughout all ocular layers tested, including the cells grown ex vivo. In addition, the cultured scleral cells and one of the retinal donors yielded positive results for GABAC. Due to unresolvable issues with contamination, we were not able to obtain consistent results for the housekeeping gene,

GAPDH, or any other housekeeping genes attempted. We observed positive results representing the housekeeping control but also positive results in the case of the RT‐ve control (refer to Table A8 in Appendix 3). We believe housekeeping gene contamination may have been present in a communal reagent used during RNA extraction. Cleaned RT‐

PCR product representing each positive result was sent to the AGRF; our results were verified. FC results revealed cell markers consistent with mesenchymal stromal cells.

3.1 Immunohistochemistry: Experiment #1

Shown in Figure 3.1 and Figure 3.2 is a representative example of the IHC (SMA – smooth muscle actin – 1:100 and GABAA Alpha 1 1:100) undertaken during this project using donor

6397L (other donors used: 6806R & 6813R). IHC using all four antibodies was performed on all four regions of the sclera using donor 6397L; no significant difference in staining for each region was observed. Therefore, the data shown only concerns one region – the inferior region – as a representative sample. A negative control was also performed by omission of the primary antibody step. Due to concerns that bleaching may have reduced antigen‐ antibody interactions (Momose et al., 2011), the problem of an increased basophilic tissue, and inconclusive results from the IHC staining, it was decided to employ molecular techniques for future work.

51

Emily F. McDonald: GABA Receptors in Human Sclera

Figure 3.1: IHC – SMA – performed on donor 6397L (sections taken from inferior region). (A) Non‐bleached control showing neural retina, RPE, choroid and some scleral tissue; (B) Non‐bleached SMA (1:100); (C) deeper view of (B); (D) Bleached control showing full width of sclera. Bleaching, in combination with a blocking step, has resulted in tissue oxidation. The tissue now appears washed‐out and the nuclei are pale; (E) Deeper view of (D); (F) Bleached SMA (1:100) showing the cross‐section of a blood vessel.

52

Emily F. McDonald: GABA Receptors in Human Sclera

Figure 3.2: IHC – GABAA Alpha 1 – performed on donor 6397L (sections taken from inferior region). (A) Non‐bleached control showing neural retina, RPE, choroid and some scleral tissue; (B) Non‐bleached GABAA Alpha 1 (1:100); (C) Bleached GABAA Alpha 1 (1:100); (D) Non‐ bleached control showing deeper view of (A); (E) Non‐bleached GABAA Alpha 1 (1:100) showing deeper view of (B); (F) Bleached GABAA Alpha 1 (1:100) showing deeper view of (C); (G) Higher resolution of positive‐stained stromal cells; non‐bleached GABAA Alpha 1 (1:100); (H) Higher resolution of dendritic‐looking cells; non‐bleached GABAA Alpha 1 (1:100), (I) Some potential staining and some background staining; bleached GABAA Alpha 1 (1:100).

3.2 Flow Cytometry: Experiment #2

Crude cultures grown as fibroblast cells to passage 3 from the scleral explants – donors

6952L and 6953L – were characterised using FC and returned the following results for cell surface markers: 99% positive for CD90, CD73, and CD105 and 15‐20% CD45 population.

From these results it could be deduced that the mesenchymal stromal cell population was at

53

Emily F. McDonald: GABA Receptors in Human Sclera

about 80‐85% (Bray et al., 2012, Dominici et al., 2006). The cells were also 98% positive for

CD44 and negative results were obtained for CD31 & CD34. Any results using GABA antibodies were inconclusive. A graph depicting the FC data (Figure 3.3) and the raw data

(Table 3.1) are shown on the following page.

54

Emily F. McDonald: GABA Receptors in Human Sclera

Figure 3.3: Shown above is the percentage of live scleral‐derived stromal cells (passage 3). Ninety‐eight percent of the cells were positive for CD44 and 99% of the cells were positive for CD90, CD73, and CD105 and 15‐20% negative for CD45; based upon the expression of these cell surface antigens, it was determined that the cell cultures were populated with 80‐85% mesenchymal stromal cells. Antibodies against GABAA‐α1, GABAAB‐ 2, GABR‐R1, and GABR‐R2 were also utilised, as shown in the key for the table, but no positive results were obtained.

Table 3.1: Raw data analysis obtained from FC for human scleral stromal cells. Antibody CD31 CD34 CD44 CD45 CD73 CD90 CD105 GABAA‐α1 GABAAB‐2 GABR‐R1 GABR‐R2 1.06 1.97 98.7 20.6 99.3 94.7 99.3 0.11 0 0.00346 0 0.84 2.33 98.9 19.4 99.5 93.9 99.4 0.055 0.00219 0 0.00354 0.14 1.61 99.8 17.4 99.6 94.8 99.1 0.093 0.00416 0.00349 0 19 98.8 97.9 98.3 0.014 0.02 0.00407 0.27 0.4 98.4 15.9 99.6 98.6 99 0.014 0.01 0 0.18 0.26 98.6 15.7 99.3 98.5 98.9 0.01 0.00512 0.015 Mean 0.498 1.314 98.88 18 99.35 96.4 99 0.086 0.007392 0.007012 0.003768 SD 0.37791 0.934949 0.544977 1.98897 0.275379 2.154066 0.389872 0.02816 0.006104 0.006524 0.005812

55

Emily F. McDonald: GABA Receptors in Human Sclera

3.3 Analysis of GABA Receptor Gene Expression in Ocular Tissues and Cells: Experiment #3

3.3.1 RT‐PCR Amplification of GABA Receptors

Expression of the genes for several GABA receptor subunits were found in all layers of the eye – sclera, choroid/RPE, and retina – and the mesenchymal stromal cells. Refer to Table 3.2 for the results and levels of amplification and Appendix 3 for pictures of all gels. Donors

6952 and 6953 presented positive results for GABAA Alpha 4 v1‐3 in all layers of the eye and the mesenchymal stromal cells. Other genes observed throughout various layers and cells were GABAA Beta 2 v1 & 2, GABAA Gamma 1, GABAA Gamma 2 v1‐3, GABAC Rho 1, and

GABAC Rho 2.

The molecular results from the three scleral donors revealed the presence of multiple GABA receptor subtypes. All three donors demonstrated positive results for GABAA Beta 2 v1 & 2,

GABAA Gamma 1, GABAA Gamma 2 v1‐3, GABAC Rho 1, and GABAC Rho 2. Donor 6952 also produced positive results for GABAA Alpha 4 v1‐3 and GABAA Beta 3 v1‐4. Donor 6953 yielded the same results as Donor 6952. Donor 6954 provided positive results for GABAA

Alpha 6 and GABAA Pi as well as the five subtypes mentioned above.

The most variety in the expression of GABA receptor subunits was observed for the scleral‐ derived mesenchymal stromal cells. Donor 6952 yielded positive results for 16 subunits out of a possible 21 and donor 6953 produced positive results for 13. Both tested positive for

GABAA Alpha 1 v1‐7, GABAA Alpha 4 v1‐3, GABAA Beta 1, GABAA Beta 2 v1 & 2, GABAA

Beta 3 v1‐4, GABAA Gamma 1, GABAA Gamma 2 v1‐3, GABAA Epsilon, GABAA Theta,

GABAA Pi, GABAB R1, and GABAC Rho 2. Donor 6952 also tested positive for GABAA Alpha

5 v1 & 2, GABAA Gamma 3, GABAB R2, and GABAC Rho 1. In addition to the shared subunits with donor 6952, donor 6953 tested positive for GABAA Alpha 6.

The only GABA receptor subunit present in choroid/RPE tissues taken from donor 6952 appeared to be GABAA Alpha 4 v1‐3. GABAA Alpha 4 v1‐3 was also present in 6953; other subtypes expressed in this donor included GABAA Beta 2 v1 & 2, GABAA Gamma 1, GABAA

Pi, GABAC Rho 1, and GABAC Rho 2.

In terms of the retinal analysis, both donors yielded positive results for GABAA Alpha 4 v1‐3,

GABAA Beta 2 v1 & 2, GABAA Gamma 2 v1‐3, GABAA Pi, GABAC Rho 1, and GABAC Rho 2.

56

Emily F. McDonald: GABA Receptors in Human Sclera

In addition, donor 6953 tested positive for GABAA Gamma 1, GABAA Gamma 3, and GABAB

R2.

We experienced unresolvable issues with contamination of housekeeping genes despite replacing all stock used during reverse‐transcription and RT‐PCR, trialling communal housekeeping gene primer stock – such as beta‐2‐microglobulin, 18s rRNA, and PBGD, and reordering another batch of GAPDH forward and reverse primers.

To confirm that the RT‐PCR products amplified using the specific primer pairs were in fact the target gene, RT‐PCR products corresponding to each individual amplification reaction were sequenced. This confirmed the specificity of the RT‐PCR products to their intended gene target sequence and validates the results of the RT‐PCR GABA gene expression profiles determined for each of the donor tissue and cell samples. The sequences, and their matched sequence from the Genbank database, are shown in Appendix 4.

57

Emily F. McDonald: GABA Receptors in Human Sclera

Table 3.2: The results for each of the GABA receptor subunit genes as demonstrated by RT‐PCR. Refer below for a key showing the colour shades representing the level of amplification of each gene.

GABA A GABA A GABA A GABA A GABA A GABA A GABA A GABA A GABA A GABA A Tissue/Cells: Donor ALPHA 1 V1‐V7 ALPHA 2 V1 & V2 ALPHA 3 ALPHA 4 V1‐V3 ALPHA 5 V1 & V2 ALPHA 6 BETA 1 BETA 2 V1 & V2 BETA 3 V1‐V4 GAMMA 1

Sclera: 6952

Sclera: 6953

Sclera: 6954

Mesenchymal Stromal Cells: 6952

Mesenchymal Stromal Cells: 6953

Choroid/RPE: 6952

Choroid/RPE: 6953

Retina: 6952

Retina: 6953

Weak Intermediate Strong

58

Emily F. McDonald: GABA Receptors in Human Sclera

GABA A GABA A GABA A GABA A GABA A GABA A GABA B GABA B GABA GABA GABA Tissue/Cells: Donor GAMMA 2 V1‐V3 GAMMA 3 EPSILON DELTA THETA PI R1 R2 RHO 1 RHO 2 RHO 3

Sclera: 6952

Sclera: 6953

Sclera: 6954

Mesenchymal Stromal Cells: 6952

Mesenchymal Stromal Cells: 6953

Choroid/RPE: 6952

Choroid/RPE: 6953

Retina: 6952

Retina: 6953

Weak Intermediate Strong

59

Emily F. McDonald: GABA Receptors in Human Sclera

4 discussion

4.1 Summary of Findings

The major question to be answered by this research project was: “Are GABA receptors present in human scleral tissue?” We predicted there would be GABA receptors present, most likely GABAC Rho 1, based on a recent animal study which found GABAC Rho 1 present in chick sclera (Cheng et al., 2011); note: other receptor subtypes were not studied.

The three scleral donors yielded positive gene expression results for GABAA and GABAC receptor subunits using RT‐PCR. Of interest to this project was the fact that GABA receptors, including GABAA Alpha 1 and GABAC Rho 1, have been found to be present in the human retina (Davanger et al., 1991, Crooks and Kolb, 1992, Vardi and Sterling, 1994, Gussin et al., 2011). As we collected the scleral tissue in the form of eye cups and therefore had access to the tissue, we also investigated the presence of GABA receptors in the choroid/RPE and retina, as well. The choroid/RPE and retinal samples yielded positive results for GABAA and GABAC and one of the retinal donors was positive for GABAB. In addition to the above, human scleral cells were cultured and tested for the presence of GABA receptors. The scleral cells were positive for GABAA, GABAB, and GABAC. Immunophenotyping of these cultures indicated a cell surface expression profile similar to that displayed by mesenchymal stromal cells grown from other human tissue, including the corneal limbus (Bray et al., 2012). It is currently known (based on evidence from animal studies) that the inhibitory neurotransmitter GABA influences eye growth and, accordingly, refractive development

(Stone et al., 2003, Leung et al., 2005, Chebib et al., 2009b). Therefore, the discovery of GABA receptor mRNA, mainly GABAA and GABAC, in different layers of the human eye has important implications for future research in the field of refractive errors.

4.2 Limitations of Immunohistochemistry

The IHC component of the project revealed good evidence of GABA receptor expression in one donor; however, this could not be repeated in two other donors and the requirement for melanin bleach further complicated the clarity of results. Although the results for IHC were variable, it is important to note that the positive results for the SMA antibody might suggest the lack of immunoreactivity is associated only with the GABA antibody‐antigen interactions

(in the case that there is expression and that the lack of immunoreactivity is not simply a lack

60

Emily F. McDonald: GABA Receptors in Human Sclera

of expression). A possible explanation for the variable GABA results could be related to uncontrollable differences in the time between donor death and when the tissue was retrieved and/or ultimately placed in fixative. Another variable is due to the time the tissue spends in storage before being fixed and, in turn, the quality of the tissue. Furthermore, better results may have been obtained if frozen eye sections were available – not just formalin‐fixed – or if the IHC had been performed on cultured scleral cells. Formalin fixation cross‐links proteins and can hinder the antibodies from gaining entry to binding sites. However, despite the fact that frozen eye sections would circumvent this problem, the morphology of the tissue is generally not as high quality. We would recommend future studies utilise epitope, or antigen, retrieval techniques that would reduce cross‐linking and improve binding of antibodies. Further studies utilising a larger number of tissue samples and different staining techniques (e.g., use of different immunoperoxidase chromagen not requiring melanin bleach, such as Fast Red) should hopefully resolve this issue. Given the present time restrictions, however, it was deemed necessary to shift the focus of the project from a histological approach to a gene expression approach.

4.3 Polymerase Chain Reaction Methodological Issues

Utilising RT‐PCR, all 21 genes for the GABA receptor subunits were tested in a minimum of two donors (n=3 for scleral tissue). GABA gene expression was found to be present in all layers of the eye – sclera, choroid/RPE, and retina – and was found to be present in cultured scleral‐derived mesenchymal stromal cells, as well. Whilst the RT‐PCR component yielded results and the IHC component proved variable, it is important to note that it is easier to optimise an RT‐PCR method as the primers are designed to be very specific to the target.

IHC is reliant on interactions between proteins – the antibody, the target, and the environment of the experiment; salt, pH, temperature, and other factors can affect the affinity of the antibody for the GABA receptor protein in the tissue. In addition, the processing of the tissue itself can sometimes mask, or hide, the epitopes that the antibody recognises.

4.4 GABA Receptors in Sclera

GABAA (5/16 possible GABAA receptor subunits for all three donors) and GABAC (2/3

GABAC receptor subunits for all three donors) receptor subunits were found to be present in the three scleral donors. Donors 6952, 6953, and 6954 returned positive results for GABAA

61

Emily F. McDonald: GABA Receptors in Human Sclera

and GABAC receptor subunits (no positive results were observed in any donor for GABAB receptor subunits). To our knowledge, no one has demonstrated the presence of GABA receptors in scleral tissue excepting one study demonstrating the presence of GABAC Rho 1 receptors in chick sclera (Cheng et al., 2011). As mentioned previously, another study found expression of GABARAP, a gene associated with GABAA, in the human sclera (Young et al.,

2003). The majority of GABA receptor subunits were observed in the scleral‐derived mesenchymal stromal cells. Between the two donors, only four out of the twenty‐one GABA receptor subunits analysed were not expressed.

4.5 GABA Receptors in Retinal Pigment Epithelium & Choroid

Of particular note to this project, GABAA and GABAB receptor signalling pathways were recently discovered in the RPE (Booij et al., 2010). The GABAA finding is consistent with our results for the choroid/RPE samples obtained from both donors analysed as receptor subunit(s) for GABAA were found to be present. It has been previously thought that the RPE may have a role in clearing GABA from the subretinal space (species analysed: Rana

Catesbeiana) (Peterson and Miller, 1995). Similarly, Booij et al., 2010 have also suggested that the GABA receptor signalling pathway in human RPE may function to uptake GABA from the subretinal space (Booij et al., 2010). We did not find GABAB present in choroid/RPE from either donor.

4.6 GABA Receptors in Retina

We noted the presence of several GABA receptor subunits in both donors. Some of our results – GABAC Rho 1 and GABAC Rho 2 – from both retinal donors were consistent with published literature (Gussin et al., 2011, Hackam et al., 1997, Wang et al., 1994) and one previous finding (Vardi and Sterling, 1994) – GABAA Alpha 1 – was not observed in this study. In addition, previously unpublished positive results – GABAA Alpha 4 v1‐3, GABAA

Beta 2 v1 & 2, GABAA Gamma 1, GABAA Gamma 2 v1‐3, GABAA Gamma 3, GABAA Pi, and

GABAB R2 – for both donors were also observed. Two studies (Gussin et al., 2011, Hackam et al., 1997) have demonstrated positive findings for GABAC Rho 1 in human retinal tissue; we also found this receptor subtype present in both of our donors. GABAC Rho 2 has been shown previously to be present in human retinal tissue (Hackam et al., 1997, Wang et al.,

1994); we observed positive results for this receptor subtype in our donors. However, a previous study (Vardi and Sterling, 1994) also reported a positive result for the GABAA

62

Emily F. McDonald: GABA Receptors in Human Sclera

Alpha 1 receptor subtype in the plexiform layers and many amacrine and ganglion cell somas in the inner nuclear layer and ganglion cell layer using tissue obtained from human retina. We did not observe positive results for this receptor subtype in either of our two donors (as product for GABAA Alpha 1 was found to be expressed in the mesenchymal stromal cells, it would be assumed that the primer worked and the gene was not expressed in the retinal samples). As well as the positive results for the two receptor subtypes mentioned above – GABAC Rho 1 and GABAC Rho 2 – we also observed positive findings for

GABAA Alpha 4 v1‐3, GABAA Beta 2 v1 & 2, GABAA Gamma 2 v1‐3, and GABAA Pi for both donors. Donor 6953 also demonstrated positive results for GABAA Gamma 1, GABAA

Gamma 3, and GABAB R2.

4.7 Limitations of Flow Cytometry

The FC results using GABA antibodies were inconclusive. The antibodies used for FC correlated with positive results from the RT‐PCR for both donors; the only exception was for the receptor GABAB R2 in donor 6953. Inconclusive, perhaps negative, results may have been due to the processes involved in FC; if the receptors are present on the surface of the cell, the cell surface proteins may have been cleaved and, in the process, the GABA receptors were lost. For example, as we used trypsin during the course of FC, we may have degraded surface antigens (and possibly intracellular antigens). Another possibility is that the receptors are present internally and FC is not the best method to characterise these receptors.

Furthermore, a lack of results for FC may be due to cell culturing conditions not being ideal for preserving the GABA receptors.

4.8 Relevance to Myopia

As mentioned previously, GABAC‐selective antagonists have proven to be more potent than either GABAA‐ or GABAB‐selective antagonists in inhibiting ocular growth (Stone et al., 2003,

Chebib et al., 2009a, Chebib et al., 2009b). Our finding is of significant interest to these previous studies as we found GABAC to be present in each of the layers – sclera, choroid/RPE, and retina (excluding only the choroid/RPE layer of donor 6952) – of both donors’ eyes, as well as being present in the mesenchymal stromal cells. Also of pharmacological interest is the fact that topirimate, an anticonvulsant and GABAA agonist, has been associated with myopia as a notable side effect (Zilliox and Russell, 2011, Craig et al., 2004, Verrotti et al., 2007, Bhattacharyya and Basu, 2005).

63

Emily F. McDonald: GABA Receptors in Human Sclera

4.9 Limitations

Perhaps the most obvious limitation of this study was the use of cadaveric tissue; the study was limited to studying a post‐mortem endpoint rather than being able to examine the sclera

(and other tissues) during the course of onset and development of myopia – unlike animal studies. It must be noted that one major limitation of animal studies are that form‐ deprivation myopia and lens‐induced myopia may involve different mechanisms to those involved in the myopia onset and development observed in humans. However, animal studies are very useful as they can inform and thus guide human‐based work. In many instances, pathways are conserved across species. It is clear that there are pros and cons to both approaches of research.

As part of the post‐mortem processes, the tissue must undergo serological testing before it can be released. The delay for results can be as long as two to three days and, during this period of time, tissue, and definitely the RNA within the tissue, can be subject to degrading and different storage conditions. A housekeeping gene – GAPDH – was used to confirm the integrity of the RNA extracted from the tissues that was then used to make the cDNA template for the RT‐PCR amplification of the GABA receptor sequences. We observed strong expression of the housekeeping gene and, therefore, in accordance with the high RNA yields observed, are confident that the tissue used was of a suitable quality.

As the donors ranged in ages from 61‐86 years, it is possible that the age of the donors impacted on the quality of the tissue. Therefore, it is possible that different results may be obtained from younger eyes. We would only be able to address this potential confounding variable through future research.

As mentioned previously, we were not provided information about the donors’ eyes in terms of the presence of ocular pathologies or refractive error. We can only speculate that the presence of either a diseased state or refractive error may potentially influence the results. It would be interesting to compare results obtained from emmetropic and myopic individuals in future studies, if possible.

It would be recommended that future studies use a larger sample size. For this project, we used two donors for choroidal/RPE, retinal and stromal cell samples; this simply served as a

64

Emily F. McDonald: GABA Receptors in Human Sclera

snapshot and provides preliminary data for future avenues of research.

4.10 Real World Implications

At a practical level, the discovery of GABAC receptor mRNA throughout all layers of the eye, including the scleral‐derived mesenchymal stromal cells, is of particular relevance to pharmacological studies that have demonstrated that GABAC receptor antagonists can inhibit ocular growth. With the knowledge that mRNA for these receptors is present, it supports the hypothesis that GABAC receptors are pharmacological targets in human sclera for agents that may potentially inhibit, or at least slow, the progression of myopia based on results from animal studies.

4.11 Future Directions

There are several questions – both from histological and gene expression perspectives – arising from the current project. Firstly, it would be important to follow‐up the current project with a protein detection and quantification technique, such as Western blot and quantitative RT‐PCR. As we have deduced the presence of mRNA for targeted GABA receptor subtypes, Western blot would allow detection of GABA receptor protein, if present.

We did not undertake quantification studies for this project for a few reasons. This was preliminary work and therefore we were most interested in presence/absence. The RNA was not of the best quality and so there was no real justification for real‐time PCR. However, this study does justify collection of eye tissue under more appropriate conditions for RNA extraction and, under those circumstances, a qualitative study would be worthwhile. It may even be as simple as placing the eye in RNA Later Solution or even more ideal, dissecting the tissue on immediate removal from the patient and snap freezing in liquid nitrogen.

The next big overarching questions to address would be: If GABA protein is present, what could the functional purpose(s) of these receptors be and what is their localisation? GABA receptors are known to play a key inhibitory role in the CNS and may be pharmacologically targeted for improved outcomes for individuals with myopia; specific, key role(s) in the eye itself are yet to be deduced. Given a lack of data regarding the significance of the expression of the different receptor subtypes, interpretation is currently difficult and this is something that could be addressed in future research. If the protein for these GABA receptors is indeed present, it would be interesting to localise where the receptors are within the individual

65

Emily F. McDonald: GABA Receptors in Human Sclera

layers of the eye. Follow‐up work would include IHC and immunocytochemistry using relevant antibodies. As mentioned above, given the similar colour of melanin granules compared with IHC staining using DAB and the complications of melanin bleach, I would, in future, elect to use a different IHC system incorporating use of the chromagen Fast Red, which can be distinguished from melanin.

Another possible avenue of future research would be to determine whether the receptors are up‐regulated or down‐regulated in myopic eyes as compared with emmetropic eyes. mRNA for the receptors is present but a next question to address would be whether they are functional or not and, if so, what their biological contribution to myopia might be. One way this could be undertaken would be through determining the influence of GABA drugs on the different tissues and cells in terms of morphology, proliferation, expression of ECM‐ remodelling enzymes, and production of ECM components. Furthermore, it would be interesting to look into possible growth factors that may be affected by or regulated in the presence of GABAergic receptor modulators, as recommended previously (Leung et al.,

2005).

Furthermore, it would be useful to deduce where a supply of GABA active substance, or

GABA neurotransmitter, would come from. As the retina contains GABAergic neurons, we hypothesise that active substance would most likely be supplied from the retina to the other layers of the eye, including the sclera. It is also important to note, however, that GABA has been shown to be present in cerebral blood vessels; both GAD, the enzyme for GABA synthesis, and GABA‐T, the catabolic enzyme for GABA, occur in cerebral blood vessels

(Imai et al., 1991). More specifically, 25‐50% of the GABA present in whole blood is found within the plasma fraction and the rest is localised in formed elements (Ferkany et al., 1979).

Therefore, an active supply may be present in the choroidal circulation. Finally, it would be interesting to determine if these GABA receptors are involved in other ocular functions, aside from potential involvement in eye growth regulation.

Finally, it would be necessary to consider what the implication(s) would be for a therapeutic aimed at minimising proprioceptive control of scleral growth and the potential impact on

IOP. One rat study (Samuels et al., 2012) found that the use of GABAA receptor antagonist, bicuculline, microinjected into the dorsomedial and perfornical hypothalamus evoked a

66

Emily F. McDonald: GABA Receptors in Human Sclera

substantial increase in IOP. It would be important to undertake further pharmacological research in this area.

4.12 Conclusion

In summary, it appears that expression of GABA receptors – mainly GABAA and GABAC – is present, based on positive mRNA findings, throughout the different layers of the eye, including the scleral layer and scleral‐derived mesenchymal stromal cells. The finding of

GABAC receptor mRNA is of particular note based on previous pharmacological studies using animals that found that GABAC antagonists are capable of inhibiting ocular growth.

This study has provided novel, preliminary gene expression data that may contribute to an understanding of the myopia signalling cascade and further exploration of the contribution of GABA receptors in these tissues will, in due course, hopefully lead to effective preventative strategies for myopic onset or treatments aimed at slowing (or inhibiting) progression.

67

Emily F. McDonald: GABA Receptors in Human Sclera

REFERENCES/BIBLIOGRAPHY

ABBOTT, C. J., GRÜNERT, U., PIANTA, M. J. & MCBRIEN, N. A. 2011. Retinal thinning in tree shrews with induced high myopia: Optical coherence tomography and histological assessment. Vision Research, 51, 376‐385.

AKK, G., COVEY, D. F., EVERS, A. S., STEINBACH, J. H., ZORUMSKI, C. F. & MENNERICK, S. 2007. Mechanisms of neurosteroid interactions with GABAA receptors. Pharmacology & Therapeutics, 116, 35‐57.

ALBRECHT, B. E. & DARLISON, M. G. 1995. Localization of the ρ1‐ and ρ2‐subunit messenger RNAs in chick retina by in situ hybridization predicts the existence of γ‐ aminobutyric acid type C receptor subtypes. Neuroscience Letters, 189, 155‐158.

ALM, A. & BILL, A. 1973. Ocular and optic nerve blood flow at normal and increased intraocular pressures in monkeys (Macaca irus): A study with radioactivity labelled microspheres including flow determination in brain and some other tissues. Experimental Eye Research, 15, 15‐29.

ALM, A. & BILL, A. 1987. Ocular circulation. In: MOSES, R. A. & HART, W. M. (eds.) Adlerʹs Physiology of the Eye. St Louis, USA: Mosby Company.

ALM, A. & NILSSON, S. F. E. 2009. Uveoscleral outflow – A review. Experimental Eye Research, 88, 760‐768.

ATCHISON, D. A., JONES, C. E., SCHMID, K. L., PRITCHARD, N., POPE, J. M., STRUGNELL, W. E. & RILEY, R. A. 2004. Eye shape in emmetropia and myopia. Investigative Ophthalmology & Visual Science, 45, 3380‐3386.

ATCHISON, D. A. & SMITH, G. 2000. The human eye: An overview. Optics of the Human Eye. Edinburgh: Butterworth‐Heinemann.

AYOUB, G. 2008. An organ of exquisite perfection. In: TOMBRAN‐TINK, J. & BARNSTABLE, C. J. (eds.) Visual Transduction & Non‐Visual Light Perception. Totowa, New Jersey: Humana Press.

BAEHR, W., WU, S. M., BIRD, A. C. & PALCZEWSKI, K. 2003. The retinoid cycle and retina disease. Vision Research, 43, 2957‐2958.

BAGLOLE, C. J., RAY, D. M., BERNSTEIN, S. H., FELDON, S. E., SMITH, T. J., SIME, P. J. & PHIPPS, R. P. 2006. More than structural cells, fibroblasts create and orchestrate the tumor microenvironment. Immunological Investigations, 35, 297‐325.

BAIRD, P. N., SCHÄCHE, M. & DIRANI, M. 2010. The GEnes in Myopia (GEM) Study in understanding the aetiology of refractive errors. Progress in Retinal and Eye Research, 29, 520‐542.

68

Emily F. McDonald: GABA Receptors in Human Sclera

BALTUSSEN, R., NAUS, J. & LIMBURG, H. 2009. Cost‐effectiveness of screening and correcting refractive errors in school children in Africa, Asia, America and Europe. Health Policy, 89, 201‐215.

BARATHI, V. & BEUERMAN, R. 2011. Molecular mechanisms of muscarinic receptors in mouse scleral fibroblasts: Prior to and after induction of experimental myopia with atropine treatment. Molecular Vision, 17, 680‐92.

BARATHI, V. A., BOOPATHI, V. G., YAP, E. P. H. & BEUERMAN, R. W. 2008. Two models of experimental myopia in the mouse. Vision Research, 48, 904‐916.

BARATHI, V. A., WEON, S. R. & BEUERMAN, R. W. 2009. Expression of muscarinic receptors in human and mouse sclera and their role in the regulation of scleral fibroblasts proliferation. Molecular Vision, 15, 1277‐1293.

BARNARD, E. A., SKOLNICK, P., OLSEN, R. W., MOHLER, H., SIEGHART, W., BIGGIO, G., BRAESTRUP, C., BATESON, A. N. & LANGER, S. Z. 1998. International Union of Pharmacology. XV. Subtypes of γ‐aminobutyric acid A receptors: Classification on the basis of subunit structure and receptor function. Pharmacological Reviews, 50, 291‐ 314.

BARONI, T., BELLUCCI, C., LILLI, C., PEZZETTI, F., CARINCI, F., BECCHETTI, E., CARINCI, P., STABELLINI, G., CALVITTI, M., LUMARE, E. & BODO, M. 2006. Retinoic acid, GABA‐ergic, and TGF‐β signaling systems are involved in human cleft palate fibroblast phenotype. Molecular Medicine, 12, 237 ‐ 245.

BEN‐ARI, Y. 2002. Excitatory actions of GABA during development: The nature of the nurture. Nature Reviews Neuroscience, 3, 728‐739.

BEN‐ARI, Y., GAIARSA, J.‐L., TYZIO, R. & KHAZIPOV, R. 2007. GABA: A pioneer transmitter that excites immature neurons and generates primitive oscillations. Physiological Reviews, 87, 1215‐1284.

BENAVENTE‐PEREZ, A. 2006. Understanding myopia. The Optician, 231, 16.

BENOIT DE COIGNAC, A., ELSON, G., DELNESTE, Y., MAGISTRELLI, G., JEANNIN, P., AUBRY, J.‐P., BERTHIER, O., SCHMITT, D., BONNEFOY, J.‐Y. & GAUCHAT, J.‐F. 2000. Cloning of MMP‐26. European Journal of Biochemistry, 267, 3323‐3329.

BESCH, D., JÄGLE, H., SCHOLL, H. P. N., SEELIGER, M. W. & ZRENNER, E. 2003. Inherited multifocal RPE‐diseases: Mechanisms for local dysfunction in global retinoid cycle gene defects. Vision Research, 43, 3095‐3108.

BETTLER, B. & TIAO, J. Y.‐H. 2006. Molecular diversity, trafficking and subcellular localization of GABAB receptors. Pharmacology & Therapeutics, 110, 533‐543.

BHATTACHARYYA, K. & BASU, S. 2005. Acute myopia induced by Topiramate: Report of a case and review of the literature.

BLOOM, R. I., FRIEDMAN, I. B. & CHUCK, R. S. 2010. Increasing rates of myopia: The long view. Current Opinion in Ophthalmology, 21, 247‐248.

69

Emily F. McDonald: GABA Receptors in Human Sclera

BOGDANOV, K. 2000. Optics of the eye. Biology in Physics. San Diego: Academic Press.

BOK, D. 1993. The retinal pigment epithelium: A versatile partner in vision. Journal of Cell Science; Supplement, 17, 189.

BOOIJ, J. C., TEN BRINK, J. B., SWAGEMAKERS, S. M. A., VERKERK, A. J. M. H., ESSING, A. H. W., VAN DER SPEK, P. J. & BERGEN, A. A. B. 2010. A new strategy to identify and annotate human RPE‐specific gene expression. PLoS ONE, 5, e9341.

BORMANN, J. 2000. The `ABCʹ of GABA receptors. Trends in Pharmacological Sciences, 21, 16‐ 19.

BORMANN, J. & FEIGENSPAN, A. 1995. GABAc receptors. Trends in Neurosciences, 18, 515‐ 519.

BOUBRIAK, O. A., URBAN, J. P. G. & BRON, A. J. 2003. Differential effects of aging on transport properties of anterior and posterior human sclera. Experimental Eye Research, 76, 701‐713.

BOULTON, M. & DAYHAW‐BARKER, P. 2001. The role of the retinal pigment epithelium: Topographical variation and ageing changes. Eye, 15, 384‐389.

BOWERY, N. 1989. GABAB receptors and their significance in mammalian pharmacology. Trends in Pharmacological Sciences, 10, 401‐407.

BRAND, C., SCHAEFFEL, F. & FELDKAEMPER, M. P. 2007. A microarray analysis of retinal transcripts that are controlled by image contrast in mice. Molecular Vision, 13, 920‐32.

BRAY, L. J., HEAZLEWOOD, C., ATKINSON, K., HUTMACHER, D. W. & HARKIN, D. G. 2012. Evaluation of methods for cultivating limbal mesenchymal stromal cells. Cytotherapy, 14, 936‐47.

BROWN, C. T., VURAL, M., JOHNSON, M. & TRINKAUS‐RANDALL, V. 1994. Age‐related changes of scleral hydration and sulfated glycosaminoglycans. Mechanisms of Ageing and Development, 77, 97‐107.

BURNSTOCK, G. 2007. Purine and pyrimidine receptors. Cellular and Molecular Life Sciences, 64, 1471‐1483.

CANDY, T. R., WANG, J. & RAVIKUMAR, S. 2009. Retinal image quality and postnatal visual experience during infancy. Optometry and vision science : official publication of the American Academy of Optometry, 86, E556‐71.

CAUWE, B., VAN DEN STEEN, P. E. & OPDENAKKER, G. 2007. The biochemical, biological, and pathological kaleidoscope of cell surface substrates processed by matrix metalloproteinases. Critical Reviews in Biochemistry and Molecular Biology, 42, 113‐185.

CHANG, J. H., MCCLUSKEY, P. & WAKEFIELD, D. 2004. Expression of toll‐like receptor 4 and its associated lipopolysaccharide receptor complex by resident antigen‐

70

Emily F. McDonald: GABA Receptors in Human Sclera

presenting cells in the human uvea. Investigative Ophthalmology & Visual Science, 45, 1871‐1878.

CHAPMAN, S. A., AYAD, S., OʹDONOGHUE, E. & BONSHEK, R. E. 1998. Glycoproteins of trabecular meshwork, cornea and sclera. Eye, 12, 440‐448.

CHARMAN, W. N. 2011. Keeping the world in focus: How might this be achieved? Optometry & Vision Science, 88, 373‐376.

CHEBIB, M., GAVANDE, N., WONG, K., PARK, A., PREMOLI, I., MEWETT, K., ALLAN, R., DUKE, R., JOHNSTON, G. R. & HANRAHAN, J. 2009a. Guanidino acids act as ρ1 GABAC receptor antagonists. Neurochemical Research, 34, 1704‐1711.

CHEBIB, M., HINTON, T., SCHMID, K. L., BRINKWORTH, D., QIAN, H., MATOS, S., KIM, H.‐L., ABDEL‐HALIM, H., KUMAR, R. J., JOHNSTON, G. A. R. & HANRAHAN, J. R. 2009b. Novel, potent, and selective GABAC antagonists inhibit myopia development and facilitate learning and memory. Journal of Pharmacology and Experimental Therapeutics, 328, 448‐457.

CHEN, J. C., SCHMID, K. L. & BROWN, B. 2003. The autonomic control of accommodation and implications for human myopia development: A review. Ophthalmic and Physiological Optics, 23, 401‐422.

CHEN, Y.‐P., HOCKING, P. M., WANG, L., POVAŽAY, B., PRASHAR, A., TO, C.‐H., ERICHSEN, J. T., FELDKAEMPER, M., HOFER, B., DREXLER, W., SCHAEFFEL, F. & GUGGENHEIM, J. A. 2011. Selective breeding for susceptibility to myopia reveals a gene–environment interaction. Investigative Ophthalmology & Visual Science, 52, 4003‐ 4011.

CHEN, Y.‐P., PRASHAR, A., HOCKING, P. M., ERICHSEN, J. T., TO, C. H., SCHAEFFEL, F. & GUGGENHEIM, J. A. 2010. Sex, eye size, and the rate of myopic eye growth due to form deprivation in outbred white leghorn chickens. Investigative Ophthalmology & Visual Science, 51, 651‐657.

CHENG, Z.‐Y., CHEBIB, M. & SCHMID, K. L. 2011. rho1 GABAc receptors are expressed in fibrous and cartilaginous layers of chick sclera and located on sclera fibroblasts and chondrocytes. Journal of Neurochemistry, 118, 281‐287.

CHENG, Z.‐Y., CHEBIB, M. & SCHMID, K. L. 2012. Identification of GABA receptors in chick cornea. Molecular Vision, 18, 1107‐1114.

CHENG, Z.‐Y., WANG, X.‐P., SCHMID, K. L. & LIU, L. In Press. Identification of GABA receptors in chick retinal pigment epithelium. Neuroscience Letters.

CHERUBINI, E. & STRATA, F. 1997. GABAC receptors: A novel receptor family with unusual pharmacology. Physiology, 12, 136‐141.

CHOO, V. 2003. A look at slowing progression of myopia. The Lancet, 361, 1622‐1623.

71

Emily F. McDonald: GABA Receptors in Human Sclera

CLARK, I. M., SWINGLER, T. E., SAMPIERI, C. L. & EDWARDS, D. R. 2008. The regulation of matrix metalloproteinases and their inhibitors. The International Journal of Biochemistry & Cell Biology, 40, 1362‐1378.

COLLINS, M. J., BUEHREN, T. & ISKANDER, D. R. 2006. Retinal image quality, reading and myopia. Vision Research, 46, 196‐215.

COLLISON, D. J., COLEMAN, R. A., JAMES, R. S., CAREY, J. & DUNCAN, G. 2000. Characterization of muscarinic receptors in human lens cells by pharmacologic and molecular techniques. Investigative Ophthalmology & Visual Science, 41, 2633‐2641.

CORDAIN, L., EATON, S. B., BRAND MILLER, J., LINDEBERG, S. & JENSEN, C. 2002. An evolutionary analysis of the aetiology and pathogenesis of juvenile‐onset myopia. Acta Ophthalmologica Scandinavica, 80, 125‐135.

CRAIG, J. E., ONG, T. J., LOUIS, D. L. & WELLS, J. M. 2004. Mechanism of Topiramate‐ induced acute‐onset myopia and angle closure glaucoma. American Journal of Ophthalmology, 137, 193‐195.

CREWTHER, D. P. 2000. The role of photoreceptors in the control of refractive state. Progress in Retinal and Eye Research, 19, 421‐457.

CROOKS, J. & KOLB, H. 1992. Localization of GABA, glycine, glutamate and tyrosine hydroxylase in the human retina. The Journal of Comparative Neurology, 315, 287‐302.

CROSSON, C., DEBENEDETTO, R. & GIDDAY, J. 1994. Functional evidence for retinal adenosine receptors, New York, NY, ETATS‐UNIS, Liebert.

CUI, D., TRIER, K., CHEN, X., ZENG, J., YANG, X., HU, J. & GE, J. 2008. Distribution of adenosine receptors in human sclera fibroblasts. Molecular Vision, 14, 523‐529.

CUI, W., BRYANT, M. R., SWEET, P. M. & MCDONNELL, P. J. 2004. Changes in gene expression in response to mechanical strain in human scleral fibroblasts. Experimental Eye Research, 78, 275‐284.

DAVANGER, S., OTTERSEN, O. P. & STORM‐MATHISEN, J. 1991. Glutamate, GABA, and glycine in the human retina: An immunocytochemical investigation. The Journal of Comparative Neurology, 311, 483‐494.

DIETHER, S. & SCHAEFFEL, F. 1997. Local changes in eye growth induced by imposed local refractive error despite active accommodation. Vision Research, 37, 659‐668.

DIETHER, S., SCHAEFFEL, F., LAMBROU, G. N., FRITSCH, C. & TRENDELENBURG, A.‐U. 2007. Effects of intravitreally and intraperitonally injected atropine on two types of experimental myopia in chicken. Experimental Eye Research, 84, 266‐274.

DIRANI, M., SHEKAR, S. N. & BAIRD, P. N. 2008. Evidence of shared genes in refraction and axial length: The Genes in Myopia (GEM) Twin Study. Investigative Ophthalmology & Visual Science, 49, 4336‐4339.

72

Emily F. McDonald: GABA Receptors in Human Sclera

DOMINICI, M., LE, MUELLER, I., SLAPER‐CORTENBACH, I., MARINI, F., KRAUSE, D., DEANS, R., KEATING, A., PROCKOP, D. & HORWITZ, E. 2006. Minimal criteria for defining multipotent mesenchymal stromal cells. The International Society for Cellular Therapy position statement. Cytotherapy, 8, 315‐317.

DORNONVILLE DE LA COUR, M. 1993. Ion transport in the retinal pigment epithelium. A study with double‐barrelled ion‐selective microelectrodes. Acta Ophthalmol Suppl, 1‐ 32.

ELSHEIKH, A., GERAGHTY, B., ALHASSO, D., KNAPPETT, J., CAMPANELLI, M. & RAMA, P. 2010. Regional variation in the biomechanical properties of the human sclera. Experimental Eye Research, 90, 624‐633.

EMBERGER, W., WINDPASSINGER, C., PETEK, E., KROISEL, P. M. & WAGNER, K. 2000. Assignment of the human GABAA receptor delta‐subunit gene (GABRD) to chromosome band 1p36.3 distal to marker NIB1364 by radiation hybrid mapping. Cytogenetic and Genome Research, 89, 281‐282.

ENNA, S. J. 2007. The GABA receptors. In: ENNA, S. J. & MÖHLER, H. (eds.) The GABA Receptors. Humana Press.

ENZ, R. & CUTTING, G. R. 1999. GABAC receptor ρ subunits are heterogeneously expressed in the human CNS and form homo‐ and heterooligomers with distinct physical properties. European Journal of Neuroscience, 11, 41‐50.

FERKANY, J. W., BUTLER, I. J. & ENNA, S. J. 1979. Effect of drugs on rat brain, cerebrospinal fluid and blood GABA content. Journal of Neurochemistry, 33, 29‐33.

FINNEMANN, S. C. 2003. Focal adhesion kinase signaling promotes phagocytosis of integrin‐bound photoreceptors, London, Nature Publishing Group.

FISCHER, A. J., MCGUIRE, J. J., SCHAEFFEL, F. & STELL, W. K. 1999. Light‐ and focus‐ dependent expression of the transcription factor ZENK in the chick retina. Nature Neuroscience, 2, 706‐712.

FISCHER, A. J., MCKINNON, L. A., NATHANSON, N. M. & STELL, W. K. 1998. Identification and localization of muscarinic acetylcholine receptors in the ocular tissues of the chick. The Journal of Comparative Neurology, 392, 273‐284.

FISCHER, A. J. & REH, T. A. 2003. Growth factors induce neurogenesis in the ciliary body. Developmental Biology, 259, 225‐240.

FLITCROFT, D. I. 2012. The complex interactions of retinal, optical and environmental factors in myopia aetiology. Progress in Retinal and Eye Research, 31, 622‐660.

FREDRICK, D. R. 2002. Myopia. British Medical Journal, 324, 1195‐1199.

FRITSCHY, J.‐M., SIDLER, C., PARPAN, F., GASSMANN, M., KAUPMANN, K., BETTLER, B. & BENKE, D. 2004. Independent maturation of the GABAB receptor subunits GABAB1 and GABAB2 during postnatal development in rodent brain. The Journal of Comparative Neurology, 477, 235‐252.

73

Emily F. McDonald: GABA Receptors in Human Sclera

FROST, M. & NORTON, T. T. 2007. Differential protein expression in tree shrew sclera during development of lens‐induced myopia and recovery. Molecular Vision, 13, 1580‐ 1588.

FUKUCHI, T., UEDA, J., ABE, H. & SAWAGUCHI, S. 2001. Cell adhesion glycoproteins in the human lamina cribrosa. Japanese Journal of Ophthalmology, 45, 363‐367.

FULLWOOD, N. J., MARTIN, F. L., BENTLEY, A. J., LEE, J. P. & LEE, S. J. 2011. Imaging sclera with hard x‐ray microscopy. Micron, 42, 506‐511.

GABELT, B. T. & KAUFMAN, P. L. 1992. Inhibition of outflow facility and accommodative and miotic responses to pilocarpine in rhesus monkeys by muscarinic receptor subtype antagonists. Journal of Pharmacology and Experimental Therapeutics, 263, 1133‐ 1139.

GAL, A., LI, Y.‐J., THOMPSON, D. A., WEIR, J., ORTH, U., JACOBSON, S., APFELSTEDT‐ SYLLA, E. & VOLLRATH, D. 2000. Mutations in MERTK, the human orthologue of the RCS rat retinal dystrophy gene, causes retinitis pigmentosa. Nature Genetics, 26, 270‐271.

GANESAN, P. & WILDSOET, C. F. 2010. Pharmaceutical intervention for myopia control. Expert Review of Ophthalmology, 5, 759‐787.

GENTLE, A., LIU, Y., MARTIN, J. E., CONTI, G. L. & MCBRIEN, N. A. 2003. Collagen gene expression and the altered accumulation of scleral collagen during the development of high myopia. Journal of Biological Chemistry, 278, 16587‐16594.

GIAMBERNARDI, T. A., SAKAGUCHI, A. Y., GLUHAK, J., PAVLIN, D., TROYER, D. A., DAS, G., RODECK, U. & KLEBE, R. J. 2001. Neutrophil collagenase (MMP‐8) is expressed during early development in neural crest cells as well as in adult melanoma cells. Matrix Biology, 20, 577‐587.

GIL, D. W., KRAUSS, H. A., BOGARDUS, A. M. & WOLDEMUSSIE, E. 1997. Muscarinic receptor subtypes in human iris‐ciliary body measured by immunoprecipitation. Investigative Ophthalmology & Visual Science, 38, 1434‐42.

GILMARTIN, B. 2004. Myopia: Precedents for research in the Twenty‐First Century. Clinical & Experimental Ophthalmology, 32, 305‐324.

GÖHLICH, G., KUHN, W., HÖHN, H. & PRZUNTEK, H. 1984. Huntingtonʹs disease: Biochemical prediction by determination of GABA synthesis of cultured fibroblasts. Journal of Neurology, 231, 50‐51.

GOLDSCHMIDT, E. & JACOBSEN, N. 2014. Genetic and environmental effects on myopia development and progression. Eye, 28, 126‐133.

GOLLENDER, M., THORN, F. & ERICKSON, P. 1979. Development of axial ocular dimensions following eyelid suture in the cat. Vision Research, 19, 221‐223.

GOTTESMANN, C. 2002. GABA mechanisms and sleep. Neuroscience, 111, 231‐239.

74

Emily F. McDonald: GABA Receptors in Human Sclera

GOTTLIEB, M. D., JOSHI, H. B. & NICKLA, D. L. 1990. Scleral changes in chicks with form‐ deprivation myopia. Current Eye Research, 9, 1157‐1165.

GU, J. & IYER, V. R. 2006. PI3K signaling and miRNA expression during the response of quiescent human fibroblasts to distinct proliferative stimuli. Genome Biology, 7, 1‐15.

GUPTA, N., DRANCE, S., MCALLISTER, R., PRASAD, S., ROOTMAN, J. & CYNADER, M. 1994. Localization of M3 muscarinic receptor subtype and mRNA in the human eye. Ophthalmic Research, 26, 207‐13.

GUSSIN, H. A., KHASAWNEH, F. T., XIE, A., FENG, F., MEMIC, A., QIAN, H., LE BRETON, G. C. & PEPPERBERG, D. R. 2011. Subunit‐specific polyclonal antibody targeting human ρ1 GABAC receptor. Experimental Eye Research, 93, 59‐64.

GUYER, D. R., SCHACHAT, A. P. & GREEN, W. R. 2005. The choroid: Structural considerations. In: RYAN, S. J., HINTON, D. R., SCHACHAT, A. P. & WILKINSON, C. P. (eds.) Retina, 4th ed.

HACKAM, A. S., WANG, T.‐L., GUGGINO, W. B. & CUTTING, G. R. 1997. The N‐terminal domain of human GABA receptor ρ1 subunits contains signals for homooligomeric and heterooligomeric interaction. Journal of Biological Chemistry, 272, 13750‐13757.

HAMANN, S. 2002. Molecular mechanisms of water transport in the eye. International Review of Cytology, 215, 395.

HAMMOND, C. J., ANDREW, T., TAT MAK, Y. & SPECTOR, T. D. 2004. A susceptibility locus for myopia in the normal population is linked to the PAX6 gene region on chromosome 11: A genomewide scan of dizygotic twins. The American Journal of Human Genetics, 75, 294‐304.

HAN, D., KIM, H.‐Y., LEE, H.‐J., SHIM, I. & HAHM, D.‐H. 2007. Wound healing activity of gamma‐aminobutyric acid (GABA) in rats. Journal of Microbiology and Biotechnology, 17, 1661‐1669.

HERING, H. & KRÖGER, S. 1996. Formation of synaptic specializations in the inner plexiform layer of the developing chick retina. The Journal of Comparative Neurology, 375, 393‐405.

HODOS, W. & KUENZEL, W. J. 1984. Retinal‐image degradation produces ocular enlargement in chicks. Investigative Ophthalmology and Visual Science, 25, 652‐659.

HORNBEAK, D. M. & YOUNG, T. L. 2009. Myopia genetics: A review of current research and emerging trends. Current Opinion in Ophthalmology, 20, 356‐362 10.1097/ICU.0b013e32832f8040.

HOWLETT, M. & MCFADDEN, S. 2002. A fast and effective mammalian model to study the visual regulation of eye growth. Investigative Ophthalmology & Visual Science, 43, 2928‐.

IHANAMÄKI, T., PELLINIEMI, L. J. & VUORIO, E. 2004. Collagens and collagen‐related matrix components in the human and mouse eye. Progress in Retinal and Eye Research, 23, 403‐434.

75

Emily F. McDonald: GABA Receptors in Human Sclera

IMAI, H., OKUNO, T., WU, J. Y. & LEE, T. J. F. 1991. GABAergic innervation in cerebral blood vessels: An immunohistochemical demonstration of l‐glutamic acid decarboxylase and GABA transaminase. Journal of Cerebral Blood Flow & Metabolism, 11, 129‐134.

ISHIDA, K., PANJWANI, N., CAO, Z. & STREILEIN, J. W. 2003. Participation of pigment epithelium in ocular immune privilege. 3. Epithelia cultured from iris, ciliary body, and retina suppress T‐Cell activation by partially non‐overlapping mechanisms. Pathology International, 11, 91‐105.

ITO, K., TANAKA, K., NISHIBE, Y., HASEGAWA, J. & UENO, H. 2007. GABA‐synthesizing enzyme, GAD67, from dermal fibroblasts: Evidence for a new skin function. Biochimica et Biophysica Acta (BBA) ‐ General Subjects, 1770, 291‐296.

JACOBI, F. K. & PUSCH, C. M. 2010. A decade in search of myopia genes. Frontiers in Bioscience, 15, 359.

JESTER, J. V. & HO‐CHANG, J. 2003. Modulation of cultured corneal keratocyte phenotype by growth factors/cytokines control in vitro contractility and extracellular matrix contraction. Experimental Eye Research, 77, 581‐592.

JESTER, J. V., HUANG, J., MATTHEW PETROLL, W. & DWIGHT CAVANAGH, H. 2002. TGFβ induced myofibroblast differentiation of rabbit keratocytes requires synergistic TGFβ, PDGF and integrin signaling. Experimental Eye Research, 75, 645‐657.

JINREN, N. & SMITH III, E. L. 1989. Effects of chronic optical defocus on the kittenʹs refractive status. Vision Research, 29, 929‐938.

JOBLING, A. I., GENTLE, A., METLAPALLY, R., MCGOWAN, B. J. & MCBRIEN, N. A. 2009. Regulation of scleral cell contraction by transforming growth factor‐β and stress. Journal of Biological Chemistry, 284, 2072‐2079.

JOBLING, A. I., NGUYEN, M., GENTLE, A. & MCBRIEN, N. A. 2004. Isoform‐specific changes in scleral transforming growth factor‐β expression and the regulation of collagen synthesis during myopia progression. Journal of Biological Chemistry, 279, 18121‐18126.

JOHNSON, J. M., YOUNG, T. L. & SUMMERS RADA, J. A. 2006. Small leucine rich repeat proteoglycans (SLRPs) in the human sclera: Identification of abundant levels of PRELP. Molecular Vision, 12, 1057‐1066.

JOHNSTON, G. A. R. 1996. GABAC receptors: Relatively simple transmitter‐gated ion channels? Trends in Pharmacological Sciences, 17, 319‐323.

JONES‐JORDAN, L. A., SINNOTT, L. T., MANNY, R. E., COTTER, S. A., KLEINSTEIN, R. N., MUTTI, D. O., TWELKER, J. D., ZADNIK, K., ETHNICITY, T. C. L. E. O. & GROUP, R. E. S. 2010. Early childhood refractive error and parental history of myopia as predictors of myopia. Investigative Ophthalmology & Visual Science, 51, 115‐121.

JONES, B. E., THOMPSON, E. W., HODOS, W., WALDBILLIG, R. & CHADER, G. J. 1996. Scleral matrix metalloproteinases, serine proteinase activity and hydrational capacity

76

Emily F. McDonald: GABA Receptors in Human Sclera

are increased in myopia induced by retinal image degradation. Experimental Eye Research, 63, 369‐381.

JONES, L. A., SINNOTT, L. T., MUTTI, D. O., MITCHELL, G. L., MOESCHBERGER, M. L. & ZADNIK, K. 2007. Parental history of myopia, sports and outdoor activities, and future myopia. Investigative Ophthalmology & Visual Science, 48, 3524‐3532.

KANEDA, M., ANDRASFALVY, B. & KANEKO, A. 2000. Modulation by Zn2+ of GABA responses in bipolar cells of the mouse retina. Visual Neuroscience, 17, 273‐281.

KANNO, H., HORIKAWA, Y., HODGES, R. R., ZOUKHRI, D., SHATOS, M. A., RIOS, J. D. & DARTT, D. A. 2003. Cholinergic agonists transactivate EGFR and stimulate MAPK to induce goblet cell secretion. American Journal of Physiology ‐ Cell Physiology, 284, C988‐C998.

KASHIWAGI, Y., NISHITSUKA, K., NAMBA, H., KAMIRYO, M., TAKAMURA, H. & YAMASHITA, H. 2010. Cloning and characterization of cell strains derived from human corneal stroma and sclera. Japanese Journal of Ophthalmology, 54, 74‐80.

KAUFMAN, P. L. 1984. Mechanisms of action of cholinergic drugs in the eye. In: DRANCE, S. & NEUFELD, A. H. (eds.) Glaucoma. Orlando: Grune and Stratton.

KHADER, Y., BATAYHA, W., ABDUL‐AZIZ, S. & AL‐SHIEKH‐KHALIL, M. 2006. Prevalence and risk indicators of myopia among schoolchildren in Amman, Jordan. Eastern Mediterranean Health Journal, 12, 434‐439.

KIEFER, A. K., TUNG, J. Y., DO, C. B., HINDS, D. A., MOUNTAIN, J. L., FRANCKE, U. & ERIKSSON, N. 2013. Genome‐wide analysis points to roles for extracellular matrix remodeling, the visual cycle, and neuronal development in myopia. PLoS Genet, 9, e1003299.

KIILGAARD, J. F. & JENSEN, P. K. 2005. The choroid and optic nerve head. In: FISCHBARG, J. (ed.) Advances in Organ Biology. Elsevier.

KLEINMAN, H. K., CANNON, F. B., LAURIE, G. W., HASSELL, J. R., AUMAILLEY, M., TERRANOVA, V. P., MARTIN, G. R. & DUBOIS‐DALCQ, M. 1985. Biological activities of laminin. Journal of Cellular Biochemistry, 27, 317‐325.

KLEINMAN, H. K., KLEBE, R. J. & MARTIN, G. R. 1981. Role of collagenous matrices in the adhesion and growth of cells. The Journal of Cell Biology, 88, 473‐485.

KLEINSTEIN, R. N., JONES, L. A., HULLETT, S., KWON, S., LEE, R. J., FRIEDMAN, N. E., MANNY, R. E., MUTTI, D. O., YU, J. A. & ZADNIK, K. 2003. Refractive error and ethnicity in children. Archives of Ophthalmology, 121, 1141‐1147.

KNUDSON, C. B. & KNUDSON, W. 1993. Hyaluronan‐binding proteins in development, tissue homeostasis, and disease. The FASEB Journal, 7, 1233‐41.

KROGSGAARD‐LARSEN, P., FRLUND, B., KRISTIANSEN, U., FRYDENVANG, K. & EBERT, B. 1997. GABAA and GABAB receptor agonists, partial agonists, antagonists

77

Emily F. McDonald: GABA Receptors in Human Sclera

and modulators: design and therapeutic prospects. European Journal of Pharmaceutical Sciences, 5, 355‐384.

KUMAR, R. J., CHEBIB, M., HIBBS, D. E., KIM, H.‐L., JOHNSTON, G. A. R., SALAM, N. K. & HANRAHAN, J. R. 2008. Novel γ‐aminobutyric acid p[1] receptor antagonists; Synthesis, pharmacological activity and structure‐activity relationships, Columbus, OH, ETATS‐UNIS, American Chemical Society.

KUSAKARI, T., SATO, T. & TOKORO, T. 1997. Regional scleral changes in form‐deprivation myopia in chicks. Experimental Eye Research, 64, 465‐476.

LAURENT, T. C. & FRASER, J. R. 1992. Hyaluronan. The FASEB Journal, 6, 2397‐404.

LEO, S.‐W. & YOUNG, T. L. 2011. An evidence‐based update on myopia and interventions to retard its progression. Journal of American Association for Pediatric Ophthalmology and Strabismus, 15, 181‐189.

LEUNG, C. K. S., YEUNG, C. K., CHIANG, S. W. Y., CHAN, K. P., PANG, C. P. & LAM, D. S. C. 2005. GABAA and GABAC (GABAA0r) receptors affect ocular growth and form‐ deprivation myopia. Cutaneous and Ocular Toxicology, 24, 187‐196.

LIANG, C.‐L., YEN, E., SU, J.‐Y., LIU, C., CHANG, T.‐Y., PARK, N., WU, M.‐J., LEE, S., FLYNN, J. T. & JUO, S.‐H. H. 2004. Impact of family history of high myopia on level and onset of myopia. Investigative Ophthalmology & Visual Science, 45, 3446‐3452.

LIN, H.‐J., WAN, L., TSAI, Y., CHEN, W.‐C., TSAI, S.‐W. & TSAI, F.‐J. 2009. Muscarinic acetylcholine receptor 1 gene polymorphisms associated with high myopia. Molecular Vision, 15, 1774‐1780.

LIND, G. J. & CAVANAGH, H. D. 1995. Identification and subcellular distribution of muscarinic acetylcholine receptor‐related proteins in rabbit corneal and chinese hamster ovary cells. Investigative Ophthalmology & Visual Science, 36, 1492‐507.

LOUGHEED, T. 2014. Myopia. Environmental Health Perspectives, 122, A12‐9.

LUFT, W. A., MING, Y. & STELL, W. K. 2003. Variable effects of previously untested muscarinic receptor antagonists on experimental myopia. Investigative Ophthalmology & Visual Science, 44, 1330‐1338.

LUKASIEWICZ, P. D. & SHIELDS, C. R. 1998. A diversity of GABA receptors in the retina. Seminars in Cell & Developmental Biology, 9, 293‐299.

LUNDSTRÖM, L., MIRA‐AGUDELO, A. & ARTAL, P. 2009. Peripheral optical errors and their change with accommodation differ between emmetropic and myopic eyes. Journal of Vision, 9.

LYHNE, N., SJØLIE, A. K., KYVIK, K. O. & GREEN, A. 2001. The importance of genes and environment for ocular refraction and its determiners: A population‐based study among 20–45 year‐old twins. British Journal of Ophthalmology, 85, 1470‐1476.

78

Emily F. McDonald: GABA Receptors in Human Sclera

MACDONALD, R. L., KANG, J.‐Q., GALLAGHER, M. J. & FENG, H.‐J. 2007. GABAA‐ receptor mutations associated with idiopathic generalized epilepsies and febrile seizures. In: ENNA, S. J. & MÖHLER, H. (eds.) The GABA Receptors. Humana Press.

MAJAVA, M., BISHOP, P. N., HÄGG, P., SCOTT, P. G., RICE, A., INGLEHEARN, C., HAMMOND, C. J., SPECTOR, T. D., ALA‐KOKKO, L. & MÄNNIKKÖ, M. 2007. Novel mutations in the small leucine‐rich repeat protein/proteoglycan (SLRP) genes in high myopia. Human Mutation, 28, 336‐344.

MARMOR, M. 1999. Mechanisms of fluid accumulation in retinal edema. Documenta Ophthalmologica, 97, 239.

MASSEY, S. C. 2005. Functional anatomy of the mammalian retina. In: RYAN, S. J., HINTON, D. R., SCHACHAT, A. P. & WILKINSON, C. P. (eds.) Retina, 4th ed.

MATHUR, A., ATCHISON, D. A. & CHARMAN, W. N. 2009. Myopia and peripheral ocular aberrations. Journal of Vision, 9.

MATTHIESEN, S., BAHULAYAN, A., KEMPKENS, S., HAAG, S., FUHRMANN, M., STICHNOTE, C., JUERGENS, U. R. & RACKÉ, K. 2006. Muscarinic receptors mediate stimulation of human lung fibroblast proliferation. American Journal of Respiratory Cell and Molecular Biology, 35, 621‐627.

MAZA, M. S. D. L., TAUBER, J. & FOSTER, C. S. 2012. Structural considerations of the sclera. The Sclera. Springer Science + Business Media, LLC.

MCBRIEN, N. A., CORNELL, L. M. & GENTLE, A. 2001a. Structural and ultrastructural changes to the sclera in a mammalian model of high myopia. Investigative Ophthalmology & Visual Science, 42, 2179‐2187.

MCBRIEN, N. A., COTTRIAL, C. L. & ANNIES, R. 2001b. Retinal acetylcholine content in normal and myopic eyes: A role in ocular growth control? Visual Neuroscience, 18, 571‐ 580.

MCBRIEN, N. A. & GENTLE, A. 2003. Role of the sclera in the development and pathological complications of myopia. Progress in Retinal and Eye Research, 22, 307‐338.

MCBRIEN, N. A., JOBLING, A. I. & GENTLE, A. 2009. Biomechanics of the sclera in myopia: Extracellular and cellular factors. Optometry & Vision Science, 86, E23‐E30 10.1097/OPX.0b013e3181940669.

MCBRIEN, N. A., LAWLOR, P. & GENTLE, A. 2000. Scleral remodeling during the development of and recovery from axial myopia in the tree shrew. Investigative Ophthalmology & Visual Science, 41, 3713‐3719.

MCBRIEN, N. A., METLAPALLY, R., JOBLING, A. I. & GENTLE, A. 2006. Expression of collagen‐binding integrin receptors in the mammalian sclera and their regulation during the development of myopia. Investigative Ophthalmology & Visual Science, 47, 4674‐4682.

79

Emily F. McDonald: GABA Receptors in Human Sclera

MCBRIEN, N. A., MOGHADDAM, H. O., NEW, R. & WILLIAMS, L. R. 1993. Experimental myopia in a diurnal mammal (Sciurus carolinensis) with no accommodative ability. The Journal of Physiology, 469, 427‐441.

MCCLUSKEY, P. (ed.) 2001. Scleritis, London: BMJ Books.

MCEWAN, P. A., SCOTT, P. G., BISHOP, P. N. & BELLA, J. 2006. Structural correlations in the family of small leucine‐rich repeat proteins and proteoglycans. Journal of Structural Biology, 155, 294‐305.

MEDZHITOV, R., PRESTON‐HURLBURT, P. & JANEWAY, C. A. 1997. A human homologue of the drosophila toll protein signals activation of adaptive immunity. Nature, 388, 394‐397.

MEEK, K. M. & FULLWOOD, N. J. 2001. Corneal and scleral collagens‐‐A microscopistʹs perspective. Micron, 32, 261‐272.

MENG, W., BUTTERWORTH, J., MALECAZE, F. & CALVAS, P. 2011. Axial length of myopia: A review of current research. Ophthalmologica, 225, 127‐134.

METLAPALLY, S. & MCBRIEN, N. A. 2008. The effect of positive lens defocus on ocular growth and emmetropization in the tree shrew. Journal of Vision, 8.

MILLER, S. S. & EDELMAN, J. L. 1990. Active ion transport pathways in the bovine retinal pigment epithelium. The Journal of Physiology, 424, 283‐300.

MITRA, A. K., ANAND, B. S. & DUVVURI, S. 2005. Drug delivery to the eye. In: FISCHBARG, J. (ed.) Advances in Organ Biology. Elsevier.

MOMOSE, M., OTA, H. & HAYAMA, M. 2011. Re‐evaluation of melanin bleaching using warm diluted hydrogen peroxide for histopathological analysis. Pathology International, 61, 345‐350.

MORENO, M., MUNOZ, R., AROCA, F., LABARACA, M., BRANDAN, E. & LARRAIN, J. 2005. Biglycan is a new extracellular component of the chordin‐BMP4 signaling pathway. The EMBO Journal, 24, 1397‐1405.

MORGAN, I. G. 2003. The biological basis of myopic refractive error. Clinical and Experimental Optometry, 86, 276‐288.

MORING, A. G., BAKER, J. R. & NORTON, T. T. 2007. Modulation of glycosaminoglycan levels in tree shrew sclera during lens‐induced myopia development and recovery. Investigative Ophthalmology & Visual Science, 48, 2947‐2956.

MOSES, R. A., GRODZKI, W. J., STARCHER, B. C. & GALIONE, M. J. 1978. Elastin content of the scleral spur, trabecular mesh, and sclera. Investigative Ophthalmology & Visual Science, 17, 817‐8.

MUTNEJA, M., BERTON, F., SUEN, K.‐F., LÜSCHER, C. & SLESINGER, P. A. 2005. Endogenous RGS proteins enhance acute desensitization of GABAB receptor‐

80

Emily F. McDonald: GABA Receptors in Human Sclera

activated GIRK currents in HEK‐293T cells. Pflügers Archiv European Journal of Physiology, 450, 61‐73.

MUTTI, D. O., HAYES, J. R., MITCHELL, G. L., JONES, L. A., MOESCHBERGER, M. L., COTTER, S. A., KLEINSTEIN, R. N., MANNY, R. E., TWELKER, J. D. & ZADNIK, K. 2007. Refractive error, axial length, and relative peripheral refractive error before and after the onset of myopia. Investigative Ophthalmology & Visual Science, 48, 2510‐2519.

MUTTI, D. O. & MARKS, A. R. 2011. Blood levels of vitamin D in teens and young adults with myopia. Optometry & Vision Science, 88, 377‐382.

NAGAI, Y., AKASHI, S., NAGAFUKU, M., OGATA, M., IWAKURA, Y., AKIRA, S., KITAMURA, T., KOSUGI, A., KIMOTO, M. & MIYAKE, K. 2002. Essential role of MD‐2 in LPS responsiveness and TLR4 distribution. Nat Immunol, 3, 667‐672.

NARUMIYA, S., SUGIMOTO, Y. & USHIKUBI, F. 1999. Prostanoid receptors: Structures, properties, and functions. Physiological Reviews, 79, 1193‐1226.

NG, C., KIM, H., GAVANDE, N., YAMAMOTO, I., KUMAR, R., MEWETT, K., JOHNSTON, G., HANRAHAN, J. & CHEBIB, M. 2011. Medicinal chemistry of ρ GABAC receptors. Future Medicinal Chemistry, 3, 197‐209.

NGUYEN‐LEGROS, J., VERSAUX‐BOTTERI, C. & SAVY, C. 1997. Dopaminergic and GABAergic retinal cell populations in mammals. Microscopy Research and Technique, 36, 26‐42.

NICKLA, D. 2006. The phase relationships between the diurnal rhythms in axial length and choroidal thickness and the association with ocular growth rate in chicks. Journal of Comparative Physiology A, 192, 399‐407.

NICKLA, D. L. & WALLMAN, J. 2010. The multifunctional choroid. Progress in Retinal and Eye Research, 29, 144‐168.

NICKLA, D. L., WILDSOET, C. & WALLMAN, J. 1998. Visual influences on diurnal rhythms in ocular length and choroidal thickness in chick eyes. Experimental Eye Research, 66, 163‐181.

NORTON, T. T., ESSINGER, J. A. & MCBRIEN, N. A. 1994. Lid‐suture myopia in tree shrews with retinal ganglion cell blockade. Visual Neuroscience, 11, 143‐153.

OLSEN, R. W. & BETZ, H. 2006. Energy metabolism of the brain. In: SIEGEL, G., AGRANOFF, B., ALBERS, R. & FISHER, S. (eds.) Basic Neurochemistry: Molecular, Cellular, and Medical Aspects. 7th Edition ed. Philadelphia: Lippincott‐Raven.

ORCHARD, G. E. & CALONJE, E. 1998. The effect of melanin bleaching on immunohistochemical staining in heavily pigmented melanocytic neoplasms. The American Journal of Dermatopathology, 20, 357‐361.

PAGET, S., JULIA, S., VITEZICA, Z., SOLER, V., MALECAZE, F. & CALVAS, P. 2008. Linkage analysis of high myopia susceptibility locus in 26 families. Molecular Vision, 14, 2566‐2574.

81

Emily F. McDonald: GABA Receptors in Human Sclera

PALURU, P. C., SCAVELLO, G. S., GANTER, W. R. & YOUNG, T. L. 2004. Exclusion of lumican and fibromodulin as candidate genes in MYP3 linked high grade myopia. Molecular Vision, 10, 917‐922.

PAN, C.‐W., RAMAMURTHY, D. & SAW, S.‐M. 2012. Worldwide prevalence and risk factors for myopia. Ophthalmic and Physiological Optics, 32, 3‐16.

PAPASTERGIOU, G. I., SCHMID, G. F., RIVA, C. E., MENDEL, M. J., STONE, R. A. & LATIES, A. M. 1998. Ocular Axial Length and Choroidal Thickness in Newly Hatched Chicks and One‐year‐old Chickens Fluctuate in a Diurnal Pattern that is Influenced by Visual Experience and Intraocular Pressure Changes. Experimental Eye Research, 66, 195‐205.

PARVER, L., AUKER, C. & CARPENTER, D. 1980. Choroidal blood flow as a heat dissipating mechanism in the macula. American Journal of Ophthalmology, 89, 641‐6.

PENHA, A. M., SCHAEFFEL, F. & FELDKAEMPER, M. 2011. Insulin, insulin‐like growth factor‐1, insulin receptor, and insulin like growth factor‐1 receptor expression in the chick eye and their regulation with imposed myopic or hyperopic defocus. Mol Vis, 17, 1436‐1448.

PETERSON, W. M. & MILLER, S. S. 1995. Identification and functional characterization of a dual GABA/taurine transporter in the bullfrog retinal pigment epithelium. The Journal of General Physiology, 106, 1089‐1122.

PIERCE, K. L., PREMONT, R. T. & LEFKOWITZ, R. J. 2002. Seven‐transmembrane receptors. Nature Reviews Molecular Cell Biology, 3, 639‐650.

PIRILÄ, E., KORPI, J. T., KORKIAMÄKI, T., JAHKOLA, T., GUTIERREZ‐FERNANDEZ, A., LOPEZ‐OTIN, C., SAARIALHO‐KERE, U., SALO, T. & SORSA, T. 2007. Collagenase‐ 2 (MMP‐8) and matrilysin‐2 (MMP‐26) expression in human wounds of different etiologies. Wound Repair and Regeneration, 15, 47‐57.

QIAN, H. & RIPPS, H. 2009. Focus on molecules: The GABAC receptor. Experimental Eye Research, 88, 1002‐1003.

QU, J., ZHOU, X., XIE, R., ZHANG, L., HU, D., LI, H. & LU, F. 2006. The presence of M1 to M5 receptors in human sclera: Evidence of the sclera as a potential site of action for muscarinic receptor antagonists. Current Eye Research, 31, 587‐597.

RADA, J. A., ACHEN, V. R., PERRY, C. A. & FOX, P. W. 1997. Proteoglycans in the human sclera. Evidence for the presence of aggrecan. Investigative Ophthalmology & Visual Science, 38, 1740‐51.

RADA, J. A., NICKLA, D. L. & TROILO, D. 2000. Decreased proteoglycan synthesis associated with form deprivation myopia in mature primate eyes. Investigative Ophthalmology & Visual Science, 41, 2050‐2058.

RAMRATTAN, R. S., VAN DER SCHAFT, T. L., MOOY, C. M., DE BRUIJN, W. C., MULDER, P. G. & DE JONG, P. T. 1994. Morphometric analysis of Bruchʹs

82

Emily F. McDonald: GABA Receptors in Human Sclera

membrane, the choriocapillaris, and the choroid in aging. Investigative Ophthalmology & Visual Science, 35, 2857‐64.

RAVIOLA, E. & WIESEL, T. N. 2007. Neural control of eye growth and experimental myopia in primates. Ciba Foundation Symposium 155 ‐ Myopia and the Control of Eye Growth. John Wiley & Sons, Ltd.

ROBERTS, E. & FRANKEL, S. 1950. γ‐Aminobutyric acid in brain: Its formation from glutamic acid. Journal of Biological Chemistry, 187, 55‐63.

ROHEN, J. 1964. Handbuch der mikroskoplschen anatomie des menschen. Haut and sinnesorgane. IV. Das auge und seine hilfsogane, Berlin, Springer‐Verlag.

ROSE, K. A., MORGAN, I. G., IP, J., KIFLEY, A., HUYNH, S., SMITH, W. & MITCHELL, P. 2008a. Outdoor activity reduces the prevalence of myopia in children. Ophthalmology, 115, 1279‐1285.

ROSE, K. A., MORGAN, I. G., SMITH, W., BURLUTSKY, G., MITCHELL, P. & SAW, S.‐M. 2008b. Myopia, lifestyle, and schooling in students of Chinese ethnicity in Singapore and Sydney. Archives of Ophthalmology, 126, 527‐530.

RYBERG, A. T., WARFVINGE, G., AXELSSON, L., SOUKUP, O., GÖTRICK, B. & TOBIN, G. 2008. Expression of muscarinic receptor subtypes in salivary glands of rats, sheep and man. Archives of Oral Biology, 53, 66‐74.

RYMER, J. & WILDSOET, C. 2005. The role of the retinal pigment epithelium in eye growth regulation and myopia: A review. Visual Neuroscience, 22, 251‐261.

SAMUELS, B. C., HAMMES, N. M., JOHNSON, P. L., SHEKHAR, A., MCKINNON, S. J. & ALLINGHAM, R. R. 2012. Dorsomedial/perifornical hypothalamic stimulation increases intraocular pressure, intracranial pressure, and the translaminar pressure gradient. Investigative Ophthalmology & Visual Science, 53, 7328‐7335.

SANDBERG‐LALL, M., HÄGG, P. O., WAHLSTRÖM, I. & PIHLAJANIEMI, T. 2000. Type XIII collagen is widely expressed in the adult and developing human eye and accentuated in the ciliary muscle, the optic nerve and the neural retina. Experimental Eye Research, 70, 401‐410.

SANTRA, M., REED, C. C. & IOZZO, R. V. 2002. Decorin binds to a narrow region of the epidermal growth factor (EGF) receptor, partially overlapping but distinct from the EGF‐binding epitope. Journal of Biological Chemistry, 277, 35671‐35681.

SARANG, S. S., PLOTKIN, M. D., GULLANS, S. R., CUMMINGS, B. S., GRANT, D. F. & SCHNELLMANN, R. G. 2001. Identification of the γ‐aminobutyric acid receptor β2 and β3 subunits in rat, rabbit, and human kidneys. Journal of the American Society of Nephrology, 12, 1107‐1113.

SAW, S.‐M., GAZZARD, G., SHIH‐YEN, E. C. & CHUA, W.‐H. 2005. Myopia and associated pathological complications. Ophthalmic and Physiological Optics, 25, 381‐391.

83

Emily F. McDonald: GABA Receptors in Human Sclera

SCHAEFER, L. & IOZZO, R. V. 2008. Biological functions of the small leucine‐rich proteoglycans: From genetics to signal transduction. Journal of Biological Chemistry, 283, 21305‐21309.

SCHAEFFEL, F., BARTMANN, M., HAGEL, G. & ZRENNER, E. 1995. Studies on the role of the retinal dopamine/melatonin system in experimental refractive errors in chickens. Vision Research, 35, 1247‐1264.

SCHAEFFEL, F., GLASSER, A. & HOWLAND, H. C. 1988. Accommodation, refractive error and eye growth in chickens. Vision Research, 28, 639‐657.

SCHLÖTZER‐SCHREHARDT, U., ZENKEL, M. & NÜSING, R. M. 2002. Expression and localization of FP and EP prostanoid receptor subtypes in human ocular tissues. Investigative Ophthalmology & Visual Science, 43, 1475‐1487.

SCHNARE, M., BARTON, G. M., HOLT, A. C., TAKEDA, K., AKIRA, S. & MEDZHITOV, R. 2001. Toll‐like receptors control activation of adaptive immune responses. Nat Immunol, 2, 947‐950.

SCHOUSBOE, A. & WAAGEPETERSEN, H. S. 2003. Role of astrocytes in homeostasis of glutamate and GABA during physiological and pathophysiological conditions. In: LEIF, H. (ed.) Advances in Molecular and Cell Biology. Elsevier.

SCHOUSBOE, A. & WAAGEPETERSEN, H. S. 2008. GABA neurotransmission: An overview. In: LAJTHA, A. & VIZI, E. S. (eds.) Handbook of Neurochemistry and Molecular Neurobiology. Springer US.

SCUTT, A., MEGHJI, S. & HARVEY, W. 1987. Stimulation of human fibroblast collagen synthesis in vitro by γ‐aminobutyric acid. Biochemical Pharmacology, 36, 1333‐1335.

SEKO, Y., AZUMA, N., TAKAHASHI, Y., MAKINO, H., MORITO, T., MUNETA, T., MATSUMOTO, K., SAITO, H., SEKIYA, I. & UMEZAWA, A. 2008. Human sclera maintains common characteristics with cartilage throughout evolution. PLoS ONE, 3, e3709.

SHELTON, L. & SUMMERS RADA, J. A. 2009. TGFBIp inhibits the attachment of human scleral fibroblasts to collagen type I. Investigative Ophthalmology & Visual Science, 50, 3542‐3552.

SHEN, W., VIJAYAN, M. & SIVAK, J. G. 2005. Inducing form‐deprivation myopia in fish. Investigative Ophthalmology & Visual Science, 46, 1797‐1803.

SHERMAN, S. M., NORTON, T. T. & CASAGRANDE, V. A. 1977. Myopia in the lid‐sutured tree shrew (Tupaia glis). Brain Research, 124, 154‐157.

SHIMAZU, R., AKASHI, S., OGATA, H., NAGAI, Y., FUKUDOME, K., MIYAKE, K. & KIMOTO, M. 1999. MD‐2, a molecule that confers lipopolysaccharide responsiveness on toll‐like receptor 4. The Journal of Experimental Medicine, 189, 1777‐1782.

SIEGHART, W. 2006. Structure, pharmacology, and function of GABAA receptor subtypes. In: ENNA, S. J. (ed.) Advances in Pharmacology. Academic Press.

84

Emily F. McDonald: GABA Receptors in Human Sclera

SONG, X. Q., MENG, F., RAMSEY, D. J., RIPPS, H. & QIAN, H. 2005. The GABA ρ1 subunit interacts with a cellular retinoic acid binding protein in mammalian retina. Neuroscience, 136, 467‐475.

STEINBERG, R. H. 1985. Interactions between the retinal pigment epithelium and the neural retina. Documenta Ophthalmologica, 60, 327‐346.

STEINBERG, R. H., LINSENMEIER, R. A. & GRIFF, E. R. 1983. Three light‐evoked responses of the retinal pigment epithelium. Vision Research, 23, 1315‐1323.

STONE, R. A., LIU, J., SUGIMOTO, R., CAPEHART, C., ZHU, X. & PENDRAK, K. 2003. GABA, experimental myopia, and ocular growth in chick. Investigative Ophthalmology & Visual Science, 44, 3933‐3946.

STRAUSS, O. 2005. The retinal pigment epithelium in visual function. Physiological Reviews, 85, 845‐881.

STRAUSS, O., STUMPFF, F., MERGLER, S., WIENRICH, M. & WIEDERHOLT, M. 1998. The Royal College of Surgeons Rat: An animal model for inherited retinal degeneration with a still unknown genetic defect. Cells Tissues Organs, 162, 101‐111.

STREILEIN, J. W., MA, N., WENKEL, H., FONG NG, T. & ZAMIRI, P. 2002. Immunobiology and privilege of neuronal retina and pigment epithelium transplants. Vision Research, 42, 487‐495.

SUMMERS, J. A. 2013. The choroid as a sclera growth regulator. Experimental Eye Research, 114, 120‐127.

SUMMERS RADA, J. A. & HOLLAWAY, L. R. 2011. Regulation of the biphasic decline in scleral proteoglycan synthesis during the recovery from induced myopia. Experimental Eye Research, 92, 394‐400.

SUMMERS RADA, J. A., SHELTON, S. & NORTON, T. T. 2006. The sclera and myopia. Experimental Eye Research, 82, 185‐200.

TAN, J., DENG, Z.‐H., LIU, S.‐Z., WANG, J.‐T. & HUANG, C. 2010. TGF‐β2 in human retinal pigment epithelial cells: Expression and secretion regulated by cholinergic signals in vitro. Current Eye Research, 35, 37‐44.

TANIHARA, H., INATANI, M. & HONDA, Y. 1997. Growth factors and their receptors in the retina and pigment epithelium. Progress in Retinal and Eye Research, 16, 271‐301.

THOMPSON, D. A. & GAL, A. 2003. Genetic defects in vitamin A metabolism of the retinal pigment epithelium. Genetics in Ophthalmology, 37, 141‐154.

TIAN, B., GABELT, B. A. T., CROSSON, C. E. & KAUFMAN, P. L. 1997. Effects of adenosine agonists on intraocular pressure and aqueous humor dynamics in cynomolgus monkeys. Experimental Eye Research, 64, 979‐989.

85

Emily F. McDonald: GABA Receptors in Human Sclera

TOMASEK, J. J., GABBIANI, G., HINZ, B., CHAPONNIER, C. & BROWN, R. A. 2002. Myofibroblasts and mechano‐regulation of connective tissue remodelling. Nature Reviews Molecular Cell Biology, 3, 349‐363.

TOMITA, T., NAKASE, T., KANEKO, M., SHI, K., TAKAHI, K., OCHI, T. & YOSHIKAWA, H. 2002. Expression of extracellular matrix metalloproteinase inducer and enhancement of the production of matrix metalloproteinases in rheumatoid arthritis. Arthritis & Rheumatism, 46, 373‐378.

TORCZYNSKI, E. 1987. Choroid and suprachoroid. In: DUANE, T. & JAEGER, E. (eds.) Biomedical Foundations of Ophthalmology. Philadelphia: Harper and Row.

TORNQVIST, K. & EHINGER, B. 1988. Peptide immunoreactive neurons in the human retina. Investigative Ophthalmology & Visual Science, 29, 680‐6.

TRIER, K. 2005. The sclera. In: FISCHBARG, J. (ed.) Advances in Organ Biology. Elsevier.

TRIPATHI, B. J., TRIPATHI, R. C., LIVINGSTON, A. M. & BORISUTH, N. C. 1991. The role of growth factors in the embryogenesis and differentiation of the eye. American Journal of Anatomy, 192, 442‐471.

TROILO, D., GOTTLIEB, M. D. & WALLMAN, J. 1987. Visual deprivation causes myopia in chicks with optic nerve section. Current Eye Research, 6, 993‐999.

TROILO, D. & JUDGE, S. J. 1993. Ocular development and visual deprivation myopia in the common marmoset (Callithrix jacchus). Vision Research, 33, 1311‐1324.

TROILO, D., NICKLA, D. L., MERTZ, J. R. & RADA, J. A. S. 2006. Change in the synthesis rates of ocular retinoic acid and scleral glycosaminoglycan during experimentally altered eye growth in marmosets. Investigative Ophthalmology & Visual Science, 47, 1768‐1777.

TROILO, D., QUINN, N. & BAKER, K. 2007. Accommodation and induced myopia in marmosets. Vision Research, 47, 1228‐1244.

TSAI, J., DENNISTON, A. & MURRAY, P. 2010. Sclera. Oxford American Handbook of Ophthalmology. USA: Oxford University Press.

TSENG, J. J., TURANO JR, M. R., LANGTON, K. & CHANG, S. 2004. Measurement of retinal thickness by ocular coherence tomography in a case of scleral transparency in high myopia. American Journal of Ophthalmology, 138, 169‐170.

TYAGI, N., LOMINADZE, D., GILLESPIE, W., MOSHAL KARNI, S., SEN, U., ROSENBERGER DOROTHEA, S., STEED, M. & TYAGI SURESH, C. 2007. Differential expression of γ‐aminobutyric acid receptor A (GABAA) and effects of homocysteine. Clinical Chemical Laboratory Medicine.

VAN DER ZEYDEN, M., OLDENZIEL, W. H., REA, K., CREMERS, T. I. & WESTERINK, B. H. 2008. Microdialysis of GABA and glutamate: Analysis, interpretation and comparison with microsensors. Pharmacology Biochemistry and Behavior, 90, 135‐147.

86

Emily F. McDonald: GABA Receptors in Human Sclera

VARDI, N. & STERLING, P. 1994. Subcellular localization of GABAA receptor on bipolar cells in macaque and human retina. Vision Research, 34, 1235‐1246.

VERROTTI, A., MANCO, R., MATRICARDI, S., FRANZONI, E. & CHIARELLI, F. 2007. Antiepileptic drugs and visual function. Pediatric Neurology, 36, 353‐360.

VIRIYAKOSOL, S., MATHISON, J. C., TOBIAS, P. S. & KIRKLAND, T. N. 2000. Structure‐ function analysis of CD14 as a soluble receptor for lipopolysaccharide. Journal of Biological Chemistry, 275, 3144‐3149.

VITHLANI, M., TERUNUMA, M. & MOSS, S. J. 2011. The dynamic modulation of GABAA receptor trafficking and its role in regulating the plasticity of inhibitory synapses. Physiological Reviews, 91, 1009‐1022.

VYNIOS, D. H., PAPAGEORGAKOPOULOU, N., SAZAKLI, H. & TSIGANOS, C. P. 2001. The interactions of cartilage proteoglycans with collagens are determined by their structures. Biochimie, 83, 899‐906.

WAAGEPETERSEN, H. S. & SCHOUSBOE, A. 2009. Glial glutamate and GABA metabolism. In: LARRY, R. S. (ed.) Encyclopedia of Neuroscience. Oxford: Academic Press.

WAAGEPETERSEN, H. S., SONNEWALD, U. & SCHOUSBOE, A. 2007. Glutamine, glutamate, and GABA: Metabolic aspects. In: LAJTHA, A., OJA, S. S., SCHOUSBOE, A. & SARANSAARI, P. (eds.) Handbook of Neurochemistry and Molecular Neurobiology. Springer US.

WALLMAN, J. 1993. Retinal control of eye growth and refraction. Progress in Retinal Research, 12, 133‐153.

WALLMAN, J., GOTTLIEB, M., RAJARAM, V. & FUGATE‐WENTZEK, L. 1987. Local retinal regions control local eye growth and myopia. Science, 237, 73‐77.

WALLMAN, J., TURKEL, J. & TRACHTMAN, J. 1978. Extreme myopia produced by modest change in early visual experience. Science, 201, 1249‐1251.

WALLMAN, J., WILDSOET, C., XU, A., GOTTLIEB, M. D., NICKLA, D. L., MARRAN, L., KREBS, W. & CHRISTENSEN, A. M. 1995. Moving the retina: Choroidal modulation of refractive state. Vision Research, 35, 37‐50.

WALLMAN, J. & WINAWER, J. 2004. Homeostasis of eye growth and the question of myopia. Neuron, 43, 447‐468.

WANG, Q., ZHAO, G., XING, S., ZHANG, L. & YANG, X. 2011. Role of bone morphogenetic proteins in form‐deprivation myopia sclera. Molecular Vision, 17, 647‐657.

WANG, T., GUGGINO, W. & CUTTING, G. 1994. A novel gamma‐aminobutyric acid receptor subunit (rho 2) cloned from human retina forms bicuculline‐insensitive homooligomeric receptors in Xenopus oocytes. The Journal of Neuroscience, 14, 6524‐ 6531.

87

Emily F. McDonald: GABA Receptors in Human Sclera

WATSON, P. G. & YOUNG, R. D. 2004. Scleral structure, organisation and disease. A review. Experimental Eye Research, 78, 609‐623.

WESSEL, H., ANDERSON, S., FITE, D., HALVAS, E., HEMPEL, J. & SUNDARRAJ, N. 1997. Type XII collagen contributes to diversities in human corneal and limbal extracellular matrices. Investigative Ophthalmology & Visual Science, 38, 2408‐22.

WIESEL, T. N. & RAVIOLA, E. 1977. Myopia and eye enlargement after neonatal lid fusion in monkeys. Nature, 266, 66‐68.

WILDSOET, C. & WALLMAN, J. 1995. Choroidal and scleral mechanisms of compensation for spectacle lenses in chicks. Vision Research, 35, 1175‐1194.

WILDSOET, C. F. 2003. Neural pathways subserving negative lens‐induced emmetropization in chicks – Insights from selective lesions of the optic nerve and ciliary nerve. Current Eye Research, 27, 371‐385.

WILDSOET, C. F. & PETTIGREW, J. D. 1988. Experimental myopia and anamalous eye growth patterns unaffected by optic nerve section in chickens: Evidence for local control of eye growth. Clinical Vision Sciences, 3, 99‐107.

WILSON, H. R. & COWAN, J. D. 1972. Excitatory and inhibitory interactions in localized populations of model neurons. Biophysical Journal, 12, 1‐24.

WISTOW, G., BERNSTEIN, S. L., WYATT, K. M., FARISS, R. N., BEHAL, A., TOUCHMAN, J. W., BOUFFARD, G., SMITH, D. & PETERSEN, K. 2002. Expressed sequence tag analysis of human RPE/choroid for the NEIBank Project: Over 6000 non‐redundant transcripts, novel genes and splice variants. Molecular Vision, 8, 205‐220.

WOOLEY, D. 1984. Mammalian collagenases. In: PIEZ, K. & REDDI, A. (eds.) Extracellular Matrix Biochemistry. New York: Elsevier.

WRIDE, M. A., GEATRELL, J. & GUGGENHEIM, J. A. 2006. Proteases in eye development and disease. Birth Defects Research Part C: Embryo Today: Reviews, 78, 90‐105.

YAMADA, K. M., KENNEDY, D. W., KIMATA, K. & PRATT, R. M. 1980. Characterization of fibronectin interactions with glycosaminoglycans and identification of active proteolytic fragments. Journal of Biological Chemistry, 255, 6055‐63.

YANG, X.‐L. 2004. Characterization of receptors for glutamate and GABA in retinal neurons. Progress in Neurobiology, 73, 127‐150.

YANG, Y., LI, X., YAN, N., CAI, S. & LIU, X. 2009. Myopia: A collagen disease? Medical Hypotheses, 73, 485‐487.

YAZULLA, S. 2010. GABA receptors in the retina. In: EDITOR‐IN‐CHIEF: DARLENE, A. D. (ed.) Encyclopedia of the Eye. Oxford: Academic Press.

YOUNG, T. 2004. Dissecting the genetics of human high myopia: A molecular biologic approach. Transactions of the American Ophthalmological Society, 102, 423‐446.

88

Emily F. McDonald: GABA Receptors in Human Sclera

YOUNG, T., GUO, X., KING, R. & RADA, J. 2003. Identification of genes expressed in a human scleral cDNA library. Investigative Ophthalmology & Visual Science, 43, 2466‐.

YOUNG, T. L. 2010. Chapter 55 ‐ Myopia. In: LEONARD, A. L., MD, PHD & DANIEL M. ALBERT, M. M. (eds.) Ocular Disease. Edinburgh: W.B. Saunders.

YOUNG, T. L., METLAPALLY, R. & SHAY, A. E. 2007. Complex trait genetics of refractive error. Archives of Ophthalmology, 125, 38‐48.

YOUNG, T. L., SCAVELLO, G. S., PALURU, P. C., CHOI, J. D., RAPPAPORT, E. F. & RADA, J. A. 2004. Microarray analysis of gene expression in human donor sclera. Molecular Vision, 10, 163‐76.

ZHANG, G., CHEN, S., GOLDONI, S., CALDER, B. W., SIMPSON, H. C., OWENS, R. T., MCQUILLAN, D. J., YOUNG, M. F., IOZZO, R. V. & BIRK, D. E. 2009. Genetic evidence for the coordinated regulation of collagen fibrillogenesis in the cornea by decorin and biglycan. Journal of Biological Chemistry, 284, 8888‐8897.

ZHANG, X., HERNANDEZ, M. R., YANG, H. & ERICKSON, K. 1995. Expression of muscarinic receptor subtype mRNA in the human ciliary muscle. Investigative Ophthalmology & Visual Science, 36, 1645‐57.

ZILLIOX, L. & RUSSELL, J. 2011. Treatment of diabetic sensory polyneuropathy. Current Treatment Options in Neurology, 13, 143‐159.

89

Emily F. McDonald: GABA Receptors in Human Sclera

Appendix one: ANIMAL STUDIES – background

Animal models have provided invaluable insights into some of the processes occurring during the onset and progression of myopia. The development of animal models of myopia occurred when Wiesel and Raviola discovered that suturing the eyes of monkeys induced myopia (Wiesel and Raviola, 1977). In the intervening years, experiments using techniques, such as form‐deprivation (Wiesel and Raviola, 1977) and optical defocus (Schaeffel et al.,

1988), have demonstrated the role of vision in the regulation (and alteration) of eye growth

(Collins et al., 2006). [However, it must be noted that it is still unclear how correlative induced myopia in animals may be to physiologic myopia in humans (Leo and Young,

2011).] Refer to Figure A1 for a diagrammatic representation of the processes occurring during form‐deprivation and myopic defocus in animal studies.

Figure A1: Animal models depicting the processes involved during induced‐hyperopia myopic defocus (portrayed on the left) and induced‐myopia hyperopic defocus (portrayed on the right) (Rymer and Wildsoet, 2005).

Several animal models have been used to date (refer to Table A1); the most common model is the chick model (Metlapally and McBrien, 2008). While chick models, in particular, have allowed greater understanding of myopia, there are some fundamental and important differences – in comparison to mammalian eyes – in both the structure of the eye and in the way the eye changes in the context of myopia (Morgan, 2003). For example, chick sclera is bi‐layered: it consists largely of cartilaginous tissue but contains a small layer of fibrous

90

Emily F. McDonald: GABA Receptors in Human Sclera

tissue (Morgan, 2003). The human eye consists of a single fibrous layer only (Summers Rada et al., 2006). In most animals, the sclera is supported with cartilage and even bone; is thought that the less rigid fibrous structure of the human sclera allows a more even distribution of the blood supply to the choroid, and hence the retina, during large rotations of the eyeball (Watson and Young, 2004). Another notable feature of the chick eye ‐ absent in the human eye – is the presence of ossicles, or rings of bony structures, located near the corneal limbus (Wallman and Winawer, 2004).

Table A1: Recent examples of animal models used for myopia research [for an extensive list of original papers representing studies for each of these species, refer to (Barathi et al., 2008)]. Species References Avian: Gallus gallus domesticus (Chen et al., 2010, Summers Rada et al., 2006, Wallman et al., 1978) Cat (Jinren and Smith III, 1989, Gollender et al., 1979) Fish: Oreochromis niloticus (Shen et al., 2005) Guinea Pig: Cavia porcellus (Howlett and McFadden, 2002) Marmoset: Callithrix jacchus (Troilo and Judge, 1993, Troilo et al., 2006, Troilo et al., 2007) Monkey: Macaca mulatta (Wiesel and Raviola, 1977, Summers Rada et al., 2006) Mouse: Mus musculus (Barathi and Beuerman, 2011, Barathi et al., 2008) Squirrel: Sciurus carolinensis (McBrien et al., 1993) Tree Shrew: Tupaia glis belangeri (Abbott et al., 2011, Sherman et al., 1977, Summers Rada et al., 2006)

91

Emily F. McDonald: GABA Receptors in Human Sclera

Appendix Two: Gross Anatomy of Human Sclera

Following are a series of figures (Figures A2 – A7) outlining the relative positions of the major muscles and blood vessels surrounding the human eye. These landmarks were used to orient the regions of interest – superior, inferior, medial, and lateral – of the eyes used for the immunohistochemical component of this project.

Figure A2: Some of the major muscles surrounding the eyeball; shown are the relative positions of the insertions of the horizontal and vertical rectus muscles (Maza et al., 2012).

Figure A3: The insertions of the superior oblique and inferior oblique muscles (Maza et al., 2012).

92

Emily F. McDonald: GABA Receptors in Human Sclera

Figure A4: Vascular supply to the globe, highlighting the relationships between the internal carotid, ophthalmic, central retina, long posterior ciliary, short posterior ciliary, anterior ciliary, and lacrimal arteries (Maza et al., 2012).

Figure A5: Sites of perforation of the sclera by the long and short posterior ciliary arteries, the short posterior ciliary veins, and the inferior and superior vortex veins (Maza et al., 2012).

93

Emily F. McDonald: GABA Receptors in Human Sclera

Figure A6: The relationships between the lacrimal, vortex, short posterior ciliary, inferior ophthalmic, retinal, supraorbital, and superior ophthalmic veins (Maza et al., 2012).

Figure A7: The relationships, shown as a transverse section of the globe, between the short posterior ciliary, long posterior ciliary, and anterior ciliary arteries and short posterior ciliary, anterior ciliary, and vortex veins (Maza et al., 2012).

94

Emily F. McDonald: GABA Receptors in Human Sclera

Appendix Three: Gel results

The following tables provide all results for polymerase chain reaction undertaken during this project. We observed results consistent with intron genomic DNA and splice variants, for example. We have included maps in Appendix 5 that outlines the positions of the primers with respect to introns and exons.

Table A2: RT‐PCR results for mesenchymal stromal cells obtained from donor 6952. The aim of this study was to determine the presence or absence of GABA receptors in human scleral tissue and cultured human scleral cells, as well as choroidal/RPE and retinal tissue. Scleral Stromal Cells – 6952 – 65°C (Pages 87‐88 of Laboratory Notebook)

Lane: Top Row Primer Notes 1 Marker VIII 2 Primer #1: GABA A Alpha 1v1‐7 3 Primer #2: GABA A Alpha 2v1&2 4 Primer #3: GABA A Alpha 3 5 Primer #4: GABA A Alpha 4v1‐3 Intermediate expression 6 Primer #5: GABA A Alpha 5v1&2 7 Primer #6: GABA A Alpha 6 Intermediate expressiona 8 Primer #7: GABA A Beta 1 9 Primer #8: GABA A Beta 2v1&2 Weak expression 10 Primer #9: GABA A Beta 3v1‐4 Strong expression 11 Primer #10: GABA A Gamma 1 12 Primer #11: GABA A Gamma 2v1‐3 13 Primer #12: GABA A Gamma 3

95

Emily F. McDonald: GABA Receptors in Human Sclera

14 Primer #13: GABA A Epsilon Presence of faint band 15 Primer #14: GABA A Delta 16 Primer #15: GABA A Theta 17 Primer #16: GABA A Pi 18 Primer #17: GABA B R1 Weak expression 19 Primer #18: GABA B R2 Weak expression 20 Primer #19: GABA C Rho 1 Weak expression 21 Primer # 20: GABA C Rho 2 22 Primer #21: GABA C Rho 3 Lane: Bottom Row Primer Notes 1 Marker VIII 2 Housekeeping control Housekeeping gene: GAPDH – No expression 3 RT‐ve control Housekeeping gene: GAPDH 4 Primer #1: GABA A Alpha 1v1‐7 PCR‐ve control 5 Primer #2: GABA A Alpha 2v1&2 PCR‐ve control 6 Primer #3: GABA A Alpha 3 PCR‐ve control 7 Primer #4: GABA A Alpha 4v1‐3 PCR‐ve control 8 Primer #5: GABA A Alpha 5v1&2 PCR‐ve control 9 Primer #6: GABA A Alpha 6 PCR‐ve control 10 Primer #7: GABA A Beta 1 PCR‐ve control 11 Primer #8: GABA A Beta 2v1&2 PCR‐ve control a As the band appears too high based on the predicted base pair, we suspect that this is caused by intron genomic DNA. The primer worked but the gene was not present and, therefore, the primer serves as an internal control.

96

Emily F. McDonald: GABA Receptors in Human Sclera

Table A3: RT‐PCR results for mesenchymal stromal cells obtained from donor 6953. The aim of this study was to determine the presence or absence of GABA receptors in human scleral tissue and cultured human scleral cells, as well as choroidal/RPE and retinal tissue. Scleral Stromal Cells – 6953 – 65°C (Pages 89‐90 of Laboratory Notebook)

Lane: Top Row Primer Notes 1 Marker VIII 2 Primer #1: GABA A Alpha 1v1‐7 3 Primer #2: GABA A Alpha 2v1&2 4 Primer #3: GABA A Alpha 3 5 Primer #4: GABA A Alpha 4v1‐3 6 Primer #5: GABA A Alpha 5v1&2 7 Primer #6: GABA A Alpha 6 Strong expression 8 No load 9 Primer #7: GABA A Beta 1 10 Primer #8: GABA A Beta 2v1&2 Weak expression 11 Primer #9: GABA A Beta 3v1‐4 Strong expression 12 Primer #10: GABA A Gamma 1 Presence of faint band 13 Primer #11: GABA A Gamma 2v1‐3 14 Primer #12: GABA A Gamma 3 15 Primer #13: GABA A Epsilon 16 Primer #14: GABA A Delta 17 Primer #15: GABA A Theta 18 Primer #16: GABA A Pi Weak expressiona 19 Primer #17: GABA B R1 20 Primer #18: GABA B R2 21 Primer #19: GABA C Rho 1 22 Primer # 20: GABA C Rho 2 Weak expressiona 23 Primer #21: GABA C Rho 3 Lane: Bottom Row Primer Notes 1 Marker VIII 2 Primer #1: GABA A Alpha 1v1‐7 PCR‐ve control 3 Primer #2: GABA A Alpha 2v1&2 PCR‐ve control 4 Primer #3: GABA A Alpha 3 PCR‐ve control

97

Emily F. McDonald: GABA Receptors in Human Sclera

5 Primer #4: GABA A Alpha 4v1‐3 PCR‐ve control 6 Primer #5: GABA A Alpha 5v1&2 PCR‐ve control 7 Primer #6: GABA A Alpha 6 PCR‐ve control 8 Primer #7: GABA A Beta 1 PCR‐ve control 9 Primer #8: GABA A Beta 2v1&2 PCR‐ve control 10 RT‐ve control Housekeeping gene: GAPDH 11 Housekeeping control GAPDH – Strong expression a As the bands appear too low for the predicted base pair, it is possible that this is caused by a splice variant.

98

Emily F. McDonald: GABA Receptors in Human Sclera

Table A4: RT‐PCR results for mesenchymal stromal cells obtained from donor 6952. The aim of this study was to determine the presence or absence of GABA receptors in human scleral tissue and cultured human scleral cells, as well as choroidal/RPE and retinal tissue. Scleral Stromal Cells – 6952 & 6953 – 63°C (Pages 91‐92 of Laboratory Notebook)

Lane: Top Row Primer Notes 1 Marker VIII 2 Primer #1: GABA A Alpha 1v1‐7 6952 3 Primer #2: GABA A Alpha 2v1&2 6952 4 Primer #3: GABA A Alpha 3 6952 5 Primer #5: GABA A Alpha 5v1&2 6952 – Weak expression 6 Primer #7: GABA A Beta 1 6952 7 Primer #8: GABA A Beta 2v1&2 6952 – Strong expression 8 Primer #10: GABA A Gamma 1 6952 – Weak expression 9 Primer #11: GABA A Gamma 2v1‐3 6952 – Strong expression 10 Primer #12: GABA A Gamma 3 6952 11 Primer #13: GABA A Epsilon 6952 – Intermediate expression 12 Primer #14: GABA A Delta 6952 13 Primer #15: GABA A Theta 6952 14 Primer #16: GABA A Pi 6953 – Strong expression 15 Primer #17: GABA B R1 6952 – Weak expression 16 Primer #18: GABA B R2 6952 – Intermediate expression 17 Primer #19: GABA C Rho 1 6952 – Intermediate expression 18 Primer # 20: GABA C Rho 2 6953 – Strong expression 19 Primer #21: GABA C Rho 3 6952 Lane: Bottom Row Primer Notes 1 Marker VIII All of the following: 6952 2 Housekeeping control GAPDH – Strong expression 3 RT‐ve control Housekeeping gene: GAPDH 4 Primer #1: GABA A Alpha 1v1‐7 PCR‐ve control

99

Emily F. McDonald: GABA Receptors in Human Sclera

5 Primer #2: GABA A Alpha 2v1&2 PCR‐ve control 6 Primer #3: GABA A Alpha 3 PCR‐ve control 7 Primer #5: GABA A Alpha 5v1&2 PCR‐ve control 8 Primer #7: GABA A Beta 1 PCR‐ve control 9 Primer #11: GABA A Gamma 2v1‐3 PCR‐ve control 10 Primer #12: GABA A Gamma 3 PCR‐ve control 11 Primer #14: GABA A Delta PCR‐ve control

100

Emily F. McDonald: GABA Receptors in Human Sclera

Table A5: RT‐PCR results for mesenchymal stromal cells obtained from donors 6952 & 6953. The aim of this study was to determine the presence or absence of GABA receptors in human scleral tissue and cultured human scleral cells, as well as choroidal/RPE and retinal tissue. Scleral Stromal Cells – 6952 & 6953 – 67°C (Pages 94‐97 of Laboratory Notebook)

Lane: Top Row Primer Notes 1 Marker VIII 2 Primer #1: GABA A Alpha 1v1‐7 6952 3 Primer #2: GABA A Alpha 2v1&2 6952 4 Primer #3: GABA A Alpha 3 6952 5 Primer #5: GABA A Alpha 5v1&2 6952 6 Primer #7: GABA A Beta 1 6952 7 Primer #10: GABA A Gamma 1 6952 – Strong expression 8 Primer #12: GABA A Gamma 3 6952 9 Primer #14: GABA A Delta 6952 10 Primer #15: GABA A Theta 6952 11 Primer #17: GABA B R1 6952 – Strong expression 12 Primer #21: GABA C Rho 3 6952 13 Primer #1: GABA A Alpha 1v1‐7 6953 14 Primer #2: GABA A Alpha 2v1&2 6953 15 Primer #3: GABA A Alpha 3 6953 16 Primer #5: GABA A Alpha 5v1&2 6953 17 Primer #7: GABA A Beta 1 6953 18 Primer #10: GABA A Gamma 1 6953 – Strong expression 19 Primer #12: GABA A Gamma 3 6953 20 Primer #14: GABA A Delta 6953 21 Primer #15: GABA A Theta 6953 22 Primer #17: GABA B R1 6953 23 Primer #21: GABA C Rho 3 6953 Lane: Bottom Row Primer Notes 1 Marker VIII 2 Housekeeping control (6952) GAPDH – Strong expression 3 RT‐ve control (6952) Housekeeping gene: GAPDH 4 Primer #1: GABA A Alpha 1v1‐7 PCR‐ve control (6952)

101

Emily F. McDonald: GABA Receptors in Human Sclera

5 Primer #2: GABA A Alpha 2v1&2 PCR‐ve control (6952) 6 Primer #3: GABA A Alpha 3 PCR‐ve control (6952) 7 Primer #5: GABA A Alpha 5v1&2 PCR‐ve control (6953) 8 Primer #7: GABA A Beta 1 PCR‐ve control (6953) 9 Primer #10: GABA A Gamma 1 PCR‐ve control (6953)

102

Emily F. McDonald: GABA Receptors in Human Sclera

Table A6: RT‐PCR results for mesenchymal stromal cells obtained from donor 6953. The aim of this study was to determine the presence or absence of GABA receptors in human scleral tissue and cultured human scleral cells, as well as choroidal/RPE and retinal tissue. Scleral Stromal Cells – 6953 – 63°C (Pages 98‐100 of Laboratory Notebook)

Lane: Top Row Primer Notes 1 Marker VIII 2 Primer #1: GABA A Alpha 1v1‐7 Weak expression 3 Primer #2: GABA A Alpha 2v1&2 4 Primer #3: GABA A Alpha 3 5 Primer #5: GABA A Alpha 5v1&2 6 Primer #7: GABA A Beta 1 Weak expression 8 Primer #12: GABA A Gamma 3 9 Primer #14: GABA A Delta 10 Primer #15: GABA A Theta Weak expression 12 Primer #21: GABA C Rho 3 Lane: Bottom Row Primer Notes 1 Marker VIII 2 Housekeeping control Housekeeping gene: GAPDH – Strong expression 3 RT‐ve control Housekeeping gene: GAPDH 4 Primer #1: GABA A Alpha 1v1‐7 PCR‐ve control 5 Primer #2: GABA A Alpha 2v1&2 PCR‐ve control 6 Primer #3: GABA A Alpha 3 PCR‐ve control 7 Primer #5: GABA A Alpha 5v1&2 PCR‐ve control 8 Primer #7: GABA A Beta 1 PCR‐ve control 9 Primer #10: GABA A Gamma 1 PCR‐ve control

103

Emily F. McDonald: GABA Receptors in Human Sclera

Table A7: RT‐PCR results for choroid/RPE, retina, and mesenchymal stromal cells obtained from donors 6952 & 6953. The aim of this study was to determine the presence or absence of GABA receptors in human scleral tissue and cultured human scleral cells, as well as choroidal/RPE and retinal tissue. Choroid/RPE, Retina, Scleral Stromal Cells – 6952 & 6953 – 67°C (Pages 104‐105 of Laboratory Notebook)

Lane: Top Row Primer Notes 1 Marker VIII 2 Primer #1: GABA A Alpha 1v1‐7 Choroid/RPE – 6952 3 Primer #2: GABA A Alpha 2v1&2 Choroid/RPE – 6952 4 Primer #10: GABA A Gamma 1 Choroid/RPE – 6952 5 Primer #12: GABA A Gamma 3 Choroid/RPE – 6952 6 Primer #14: GABA A Delta Choroid/RPE – 6952 7 Primer #17: GABA B R1 Choroid/RPE – 6952 8 Primer #21: GABA C Rho 3 Choroid/RPE – 6952 9 Primer #1: GABA A Alpha 1v1‐7 PCR‐ve control (Choroid/RPE – 6952) 10 Primer #2: GABA A Alpha 2v1&2 PCR‐ve control (Choroid/RPE – 6952) 11 Primer #10: GABA A Gamma 1 PCR‐ve control (Choroid/RPE – 6952) 12 Primer #1: GABA A Alpha 1v1‐7 RT‐ve control (Choroid/RPE – 6952) 13 Housekeeping control GAPDH – Strong expression 14 Primer #1: GABA A Alpha 1v1‐7 Choroid/RPE – 6953 15 Primer #2: GABA A Alpha 2v1&2 Choroid/RPE – 6953 16 Primer #10: GABA A Gamma 1 Choroid/RPE – 6953 – Strong expression 17 Primer #12: GABA A Gamma 3 Choroid/RPE – 6953 18 Primer #14: GABA A Delta Choroid/RPE – 6953 19 Primer #17: GABA B R1 Choroid/RPE – 6953 20 Primer #21: GABA C Rho 3 Choroid/RPE – 6953 21 Primer #1: GABA A Alpha 1v1‐7 PCR‐ve control (Choroid/RPE – 6953) 22 Primer #2: GABA A Alpha 2v1&2 PCR‐ve control (Choroid/RPE – 6953) 23 Primer #10: GABA A Gamma 1 PCR‐ve control (Choroid/RPE – 6953) 24 Primer #1: GABA A Alpha 1v1‐7 RT‐ve control (Choroid/RPE – 6953) 25 Housekeeping control GAPDH – Strong expression 26 Primer #10: GABA A Gamma 1 Scleral Stromal Cells– 6952 – Strong expression 27 Primer #17: GABA B R1 Scleral Stromal Cells – 6952 28 Primer #10: GABA A Gamma 1 PCR‐ve control (Scleral Stromal Cells – 6953) 29 Primer #17: GABA B R1 PCR‐ve control (Scleral Stromal Cells – 6953) 30 Marker VIII

104

Emily F. McDonald: GABA Receptors in Human Sclera

Lane: Bottom Row Primer Notes 1 Marker VIII 2 Primer #1: GABA A Alpha 1v1‐7 Retina – 6952 3 Primer #2: GABA A Alpha 2v1&2 Retina – 6952 4 Primer #10: GABA A Gamma 1 Retina – 6952 5 Primer #12: GABA A Gamma 3 Retina – 6952 6 Primer #14: GABA A Delta Retina – 6952 7 Primer #17: GABA B R1 Retina – 6952 8 Primer #21: GABA C Rho 3 Retina – 6952 9 Primer #1: GABA A Alpha 1v1‐7 PCR‐ve control (Retina – 6952) 10 Primer #2: GABA A Alpha 2v1&2 PCR‐ve control (Retina – 6952) 11 Primer #10: GABA A Gamma 1 PCR‐ve control (Retina – 6952) 12 Primer #1: GABA A Alpha 1v1‐7 RT‐ve control (Retina – 6952) 13 Housekeeping control GAPDH – Strong expression 14 Primer #1: GABA A Alpha 1v1‐7 Retina – 6953 15 Primer #2: GABA A Alpha 2v1&2 Retina – 6953 16 Primer #10: GABA A Gamma 1 Retina – 6953 – Strong expression 17 Primer #12: GABA A Gamma 3 Retina – 6953 18 Primer #14: GABA A Delta Retina – 6953 19 Primer #17: GABA B R1 Retina – 6953 20 Primer #21: GABA C Rho 3 Retina – 6953 21 Primer #1: GABA A Alpha 1v1‐7 PCR‐ve control (Retina – 6953) 22 Primer #2: GABA A Alpha 2v1&2 PCR‐ve control (Retina – 6953) 23 Primer #10: GABA A Gamma 1 PCR‐ve control (Retina – 6953) 24 Primer #1: GABA A Alpha 1v1‐7 RT‐ve control (Retina – 6953) 25 Housekeeping control GAPDH – Strong expression 26 Primer #1: GABA A Alpha 1v1‐7 RT‐ve control (Stromal Cells – 6952) 27 Housekeeping control Housekeeping gene: GAPDH – No expression 30 Marker VIII

105

Emily F. McDonald: GABA Receptors in Human Sclera

Table A8: RT‐PCR results for choroid/RPE, retina, sclera, and mesenchymal stromal cells obtained from donors 6952 & 6953. The aim of this study was to determine the presence or absence of GABA receptors in human scleral tissue and cultured human scleral cells, as well as choroidal/RPE and retinal tissue. Choroid/RPE, Retina, Sclera, Scleral Stromal Cells – 6952 & 6953 – 60/67°C (Pages 106‐107 of Notebook)

Lane: Top Row Primer Notes 1 Marker VIII 2 GAPDH – Sclera – 6952 Housekeeping control – Expression 3 GAPDH – Sclera – 6953 Housekeeping control – Expression 4 GAPDH – Sclera – 6954 Housekeeping control – Expression 5 GAPDH – Choroid/RPE – 6952 Housekeeping control – Expression 6 GAPDH – Choroid/RPE – 6953 Housekeeping control – Expression 7 GAPDH – Retina – 6952 Housekeeping control – Expression 8 GAPDH – Retina – 6953 Housekeeping control – Expression 9 GAPDH – Scleral Stromal Cells – 6952 Housekeeping control – Expression 10 GAPDH – Scleral Stromal Cells – 6953 Housekeeping control – Expression 11 Marker VIII 13 Primer #10: GABA A Gamma 1 Cells – 6952 – Strong expression 14 Primer #17: GABA B R1 Cells – 6953 – Intermediate expression Lane: Bottom Row Primer Notes 1 Marker VIII 2 GAPDH – Sclera – 6952 PCR‐ve control 3 GAPDH – Sclera – 6953 PCR‐ve control 4 GAPDH – Sclera – 6954 PCR‐ve control 5 GAPDH – Choroid/RPE – 6952 PCR‐ve control – Expression 6 GAPDH – Choroid/RPE – 6953 PCR‐ve control 7 GAPDH – Retina – 6952 PCR‐ve control 8 GAPDH – Retina – 6953 PCR‐ve control 9 GAPDH – Scleral Stromal Cells – 6952 PCR‐ve control 10 GAPDH – Scleral Stromal Cells – 6953 PCR‐ve control

106

Emily F. McDonald: GABA Receptors in Human Sclera

13 GAPDH – Sclera – 6952 RT‐ve control – Expression 14 GAPDH – Sclera – 6953 RT‐ve control – Expression 15 GAPDH – Sclera – 6954 RT‐ve control – Expression 16 GAPDH – Choroid/RPE – 6952 RT‐ve control – Expression 17 GAPDH – Choroid/RPE – 6953 RT‐ve control – Expression 18 GAPDH – Retina – 6952 RT‐ve control – Expression 19 GAPDH – Retina – 6953 RT‐ve control – Expression 20 GAPDH – Scleral Stromal Cells – 6952 RT‐ve control – Expression 21 GAPDH – Scleral Stromal Cells – 6953 RT‐ve control – Expression 22 Marker VIII

107

Emily F. McDonald: GABA Receptors in Human Sclera

Table A9: RT‐PCR results for sclera obtained from donor 6952. The aim of this study was to determine the presence or absence of GABA receptors in human scleral tissue and cultured human scleral cells, as well as choroidal/RPE and retinal tissue. Sclera – 6952 – 60/63°C (Pages 112‐113 of Laboratory Notebook)

Lane: Top Row Primer Notes 1 Marker VIII 2 Primer #1: GABA A Alpha 1v1‐7 Sclera – 6952 3 Primer #3: GABA A Alpha 3 Sclera – 6952 4 Primer #5: GABA A Alpha 5v1&2 Sclera – 6952 5 Primer #7: GABA A Beta 1 Sclera – 6952 6 Primer #8: GABA A Beta 2v1&2 Sclera – 6952 – Strong expression 7 Primer #11: GABA A Gamma 2v1‐3 Sclera – 6952 – Intermediate expression 8 Primer #12: GABA A Gamma 3 Sclera – 6952 9 Primer #13: GABA A Epsilon Sclera – 6952 10 Primer #14: GABA A Delta Sclera – 6952 11 Primer #15: GABA A Theta Sclera – 6952 12 Primer #16: GABA A Pi Sclera – 6952 13 Primer #18: GABA B R2 Sclera – 6952 14 Primer #19: GABA C Rho 1 Sclera – 6952 – Weak expression 15 Primer # 20: GABA C Rho 2 Sclera – 6952 – Intermediate expression 16 Primer #21: GABA C Rho 3 Sclera – 6952 17 GAPDH – Sclera – 6952 Housekeeping control – Expression 18 GAPDH – Sclera – 6952 RT‐ve control – Expression 19 Primer #1: GABA A Alpha 1v1‐7 PCR‐ve control 20 Primer #3: GABA A Alpha 3 PCR‐ve control 21 Primer #5: GABA A Alpha 5v1&2 PCR‐ve control 22 Primer #7: GABA A Beta 1 PCR‐ve control 23 Primer #8: GABA A Beta 2v1&2 PCR‐ve control 24 Primer #11: GABA A Gamma 2v1‐3 PCR‐ve control 25 Marker VIII

108

Emily F. McDonald: GABA Receptors in Human Sclera

Table A10: RT‐PCR results for sclera obtained from donor 6953. The aim of this study was to determine the presence or absence of GABA receptors in human scleral tissue and cultured human scleral cells, as well as choroidal/RPE and retinal tissue. Sclera – 6953 – 60/63°C (Pages 114‐115 of Laboratory Notebook)

Lane: Top Row Primer Notes 1 Marker VIII 2 Primer #1: GABA A Alpha 1v1‐7 Sclera – 6953 3 Primer #3: GABA A Alpha 3 Sclera – 6953 4 Primer #5: GABA A Alpha 5v1&2 Sclera – 6953 5 Primer #7: GABA A Beta 1 Sclera – 6953 6 Primer #8: GABA A Beta 2v1&2 Sclera – 6953 – Strong expression 7 Primer #11: GABA A Gamma 2v1‐3 Sclera – 6953 – Intermediate expression 8 Primer #12: GABA A Gamma 3 Sclera – 6953 9 Primer #13: GABA A Epsilon Sclera – 6953 10 Primer #14: GABA A Delta Sclera – 6953 11 Primer #15: GABA A Theta Sclera – 6953 12 Primer #16: GABA A Pi Sclera – 6953 13 Primer #18: GABA B R2 Sclera – 6953 14 Primer #19: GABA C Rho 1 Sclera – 6953 – Intermediate expression 15 Primer # 20: GABA C Rho 2 Sclera – 6953 – Strong expression 16 Primer #21: GABA C Rho 3 Sclera – 6953 17 GAPDH – Sclera – 6953 Housekeeping control – Expression 18 GAPDH – Sclera – 6953 RT‐ve control – Expression 19 Primer #1: GABA A Alpha 1v1‐7 PCR‐ve control 20 Primer #3: GABA A Alpha 3 PCR‐ve control 21 Primer #5: GABA A Alpha 5v1&2 PCR‐ve control 22 Primer #7: GABA A Beta 1 PCR‐ve control 23 Primer #8: GABA A Beta 2v1&2 PCR‐ve control 24 Primer #11: GABA A Gamma 2v1‐3 PCR‐ve control 25 Marker VIII

109

Emily F. McDonald: GABA Receptors in Human Sclera

Table A11: RT‐PCR results for sclera obtained from donor 6954. The aim of this study was to determine the presence or absence of GABA receptors in human scleral tissue and cultured human scleral cells, as well as choroidal/RPE and retinal tissue. Sclera – 6954 – 60/63°C (Pages 116‐117 of Laboratory Notebook)

Lane: Top Row Primer Notes 1 Marker VIII 2 Primer #1: GABA A Alpha 1v1‐7 Sclera – 6954 3 Primer #2: GABA A Alpha 2v1&2 Sclera – 6952 4 Primer #2: GABA A Alpha 2v1&2 Sclera – 6953 5 Primer #2: GABA A Alpha 2v1&2 Sclera – 6954 6 Primer #3: GABA A Alpha 3 Sclera – 6954 7 Primer #5: GABA A Alpha 5v1&2 Sclera – 6954 8 Primer #7: GABA A Beta 1 Sclera – 6954 9 Primer #8: GABA A Beta 2v1&2 Sclera – 6954 – Strong expression 10 Primer #11: GABA A Gamma 2v1‐3 Sclera – 6954 – Strong expression 11 Primer #12: GABA A Gamma 3 Sclera – 6954 12 Primer #13: GABA A Epsilon Sclera – 6954 13 Primer #14: GABA A Delta Sclera – 6954 14 Primer #15: GABA A Theta Sclera – 6954 15 Primer #16: GABA A Pi Sclera – 6954 – Intermediate expression 16 Primer #18: GABA B R2 Sclera – 6954 17 Primer #19: GABA C Rho 1 Sclera – 6954 – Intermediate expression 18 Primer # 20: GABA C Rho 2 Sclera – 6954 – Strong expression 19 Primer #21: GABA C Rho 3 Sclera – 6954 30 Marker VIII Lane: Bottom Row Primer Notes 1 Marker VIII 2 GAPDH – Sclera – 6954 Housekeeping control 3 GAPDH – Sclera – 6952 RT‐ve control 4 GAPDH – Sclera – 6953 RT‐ve control 5 GAPDH – Sclera – 6954 RT‐ve control 6 Primer #1: GABA A Alpha 1v1‐7 PCR‐ve control 7 Primer #2: GABA A Alpha 2v1&2 PCR‐ve control 8 Primer #2: GABA A Alpha 2v1&2 PCR‐ve control 9 Primer #2: GABA A Alpha 2v1&2 PCR‐ve control 10 Primer #3: GABA A Alpha 3 PCR‐ve control 11 Primer #5: GABA A Alpha 5v1&2 PCR‐ve control 12 Primer #7: GABA A Beta 1 PCR‐ve control 13 Primer #8: GABA A Beta 2v1&2 PCR‐ve control 30 Marker VIII

110

Emily F. McDonald: GABA Receptors in Human Sclera

Table A12: RT‐PCR results for sclera obtained from donors 6952, 6953, & 6954. The aim of this study was to determine the presence or absence of GABA receptors in human scleral tissue and cultured human scleral cells, as well as choroidal/RPE and retinal tissue. Sclera – 6952, 6953, & 6954 – 65°C (Pages 118‐119 of Laboratory Notebook)

Lane: Top Row Primer Notes 1 Marker VIII 2 Primer #1: GABA A Alpha 1v1‐7 Sclera – 6952 3 Primer #2: GABA A Alpha 2v1&2 Sclera – 6952 4 Primer #3: GABA A Alpha 3 Sclera – 6952 5 Primer #4: GABA A Alpha 4v1‐3 Sclera – 6952 – Strong expression 6 Primer #5: GABA A Alpha 5v1&2 Sclera – 6952 7 Primer #6: GABA A Alpha 6 Sclera – 6952 8 Primer #9: GABA A Beta 3v1‐4 Sclera – 6952 – Strong expression 9 Primer #12: GABA A Gamma 3 Sclera – 6952 10 Primer #14: GABA A Delta Sclera – 6952 11 Primer #21: GABA C Rho 3 Sclera – 6952 12 GAPDH – Sclera – 6952 Housekeeping control 13 GAPDH – Sclera – 6952 RT‐ve control 14 Primer #1: GABA A Alpha 1v1‐7 PCR‐ve control 15 Primer #2: GABA A Alpha 2v1&2 PCR‐ve control 16 Primer #1: GABA A Alpha 1v1‐7 Sclera – 6953 17 Primer #2: GABA A Alpha 2v1&2 Sclera – 6953 18 Primer #3: GABA A Alpha 3 Sclera – 6953 19 Primer #4: GABA A Alpha 4v1‐3 Sclera – 6953 – Weak expression 20 Primer #5: GABA A Alpha 5v1&2 Sclera – 6953 21 Primer #6: GABA A Alpha 6 Sclera – 6953 22 Primer #9: GABA A Beta 3v1‐4 Sclera – 6953 – Strong expression 23 Primer #12: GABA A Gamma 3 Sclera – 6953 24 Primer #14: GABA A Delta Sclera – 6953 25 Primer #21: GABA C Rho 3 Sclera – 6953 26 GAPDH – Sclera – 6953 Housekeeping control 27 GAPDH – Sclera – 6953 RT‐ve control 28 Primer #3: GABA A Alpha 3 PCR‐ve control 29 Primer #4: GABA A Alpha 4v1‐3 PCR‐ve control 30 Marker VIII Lane: Bottom Row Primer Notes 1 Marker VIII

111

Emily F. McDonald: GABA Receptors in Human Sclera

2 Primer #1: GABA A Alpha 1v1‐7 Sclera – 6954 3 Primer #2: GABA A Alpha 2v1&2 Sclera – 6954 4 Primer #3: GABA A Alpha 3 Sclera – 6954 5 Primer #4: GABA A Alpha 4v1‐3 Sclera – 6954 6 Primer #5: GABA A Alpha 5v1&2 Sclera – 6954 7 Primer #6: GABA A Alpha 6 Sclera – 6954 – Strong expression 8 Primer #9: GABA A Beta 3v1‐4 Sclera – 6954 9 Primer #12: GABA A Gamma 3 Sclera – 6954 10 Primer #14: GABA A Delta Sclera – 6954 11 Primer #21: GABA C Rho 3 Sclera – 6954 12 GAPDH – Sclera – 6954 Housekeeping control 13 GAPDH – Sclera – 6954 RT‐ve control 14 Primer #5: GABA A Alpha 5v1&2 PCR‐ve control 15 Primer #6: GABA A Alpha 6 PCR‐ve control 30 Marker VIII

112

Emily F. McDonald: GABA Receptors in Human Sclera

Table A13: RT‐PCR results for sclera obtained from donors 6952, 6953, & 6954. The aim of this study was to determine the presence or absence of GABA receptors in human scleral tissue and cultured human scleral cells, as well as choroidal/RPE and retinal tissue. Sclera – 6952, 6953, & 6954 – 60/67°C (Pages 120‐121 of Laboratory Notebook)

Lane: Top Row Primer Notes 1 Marker VIII 2 Primer #1: GABA A Alpha 1v1‐7 Sclera – 6952 3 Primer #2: GABA A Alpha 2v1&2 Sclera – 6952 4 Primer #10: GABA A Gamma 1 Sclera – 6952 – Strong expression 5 Primer #12: GABA A Gamma 3 Sclera – 6952 6 Primer #14: GABA A Delta Sclera – 6952 7 Primer #17: GABA B R1 Sclera – 6952 8 Primer #21: GABA C Rho 3 Sclera – 6952 9 GAPDH – Sclera – 6952 Housekeeping control 10 GAPDH – Sclera – 6952 RT‐ve control – Contamination? 11 Primer #1: GABA A Alpha 1v1‐7 PCR‐ve control 12 Primer #10: GABA A Gamma 1 PCR‐ve control 13 Primer #17: GABA B R1 PCR‐ve control 14 Primer #1: GABA A Alpha 1v1‐7 Sclera – 6953 15 Primer #2: GABA A Alpha 2v1&2 Sclera – 6953 16 Primer #10: GABA A Gamma 1 Sclera – 6953 – Strong expression 17 Primer #12: GABA A Gamma 3 Sclera – 6953 18 Primer #14: GABA A Delta Sclera – 6953 19 Primer #17: GABA B R1 Sclera – 6953 20 Primer #21: GABA C Rho 3 Sclera – 6953 21 GAPDH – Sclera – 6953 Housekeeping control 22 GAPDH – Sclera – 6953 RT‐ve control 23 Primer #1: GABA A Alpha 1v1‐7 PCR‐ve control 24 Primer #10: GABA A Gamma 1 PCR‐ve control 25 Primer #17: GABA B R1 PCR‐ve control 26 Primer #1: GABA A Alpha 1v1‐7 Sclera – 6954 27 Primer #2: GABA A Alpha 2v1&2 Sclera – 6954 28 Primer #10: GABA A Gamma 1 Sclera – 6954 – Intermediate expression 29 Primer #12: GABA A Gamma 3 Sclera – 6954 30 Marker VIII Lane: Bottom Row Primer Notes 1 Primer #14: GABA A Delta Sclera – 6954 2 Primer #17: GABA B R1 Sclera – 6954

113

Emily F. McDonald: GABA Receptors in Human Sclera

3 Primer #21: GABA C Rho 3 Sclera – 6954 4 GAPDH – Sclera – 6954 Housekeeping control 5 GAPDH – Sclera – 6954 RT‐ve control – Contamination? 6 Primer #1: GABA A Alpha 1v1‐7 PCR‐ve control 7 Primer #10: GABA A Gamma 1 PCR‐ve control 8 Primer #17: GABA B R1 PCR‐ve control 29 Marker VIII

114

Emily F. McDonald: GABA Receptors in Human Sclera

Table A14: RT‐PCR results for choroid/RPE obtained from donor 6952. The aim of this study was to determine the presence or absence of GABA receptors in human scleral tissue and cultured human scleral cells, as well as choroidal/RPE and retinal tissue. Choroid/RPE – 6952 – 60/63°C (Pages 122‐123 of Laboratory Notebook)

Lane: Top Row Primer Notes 1 Marker VIII 2 Primer #1: GABA A Alpha 1v1‐7 Choroid/RPE – 6952 3 Primer #2: GABA A Alpha 2v1&2 Choroid/RPE – 6952 4 Primer #3: GABA A Alpha 3 Choroid/RPE – 6952 5 Primer #5: GABA A Alpha 5v1&2 Choroid/RPE – 6952 6 Primer #7: GABA A Beta 1 Choroid/RPE – 6952 7 Primer #8: GABA A Beta 2v1&2 Choroid/RPE – 6952 8 Primer #11: GABA A Gamma 2v1‐3 Choroid/RPE – 6952 9 Primer #12: GABA A Gamma 3 Choroid/RPE – 6952 10 Primer #13: GABA A Epsilon Choroid/RPE – 6952 11 Primer #14: GABA A Delta Choroid/RPE – 6952 12 Primer #15: GABA A Theta Choroid/RPE – 6952 13 Primer #16: GABA A Pi Choroid/RPE – 6952 14 Primer #18: GABA B R2 Choroid/RPE – 6952 15 Primer #19: GABA C Rho 1 Choroid/RPE – 6952 16 Primer # 20: GABA C Rho 2 Choroid/RPE – 6952 17 Primer #21: GABA C Rho 3 Choroid/RPE – 6952 18 18s rRNA – Choroid/RPE – 6952 Housekeeping control – Expression 19 18s rRNA – Choroid/RPE – 6952 RT‐ve control 20 Primer #1: GABA A Alpha 1v1‐7 PCR‐ve control 21 Primer #2: GABA A Alpha 2v1&2 PCR‐ve control 22 Primer #3: GABA A Alpha 3 PCR‐ve control 30 Marker VIII

115

Emily F. McDonald: GABA Receptors in Human Sclera

Table A15: RT‐PCR results for choroid/RPE & retina obtained from donors 6952 & 6953. The aim of this study was to determine the presence or absence of GABA receptors in human scleral tissue and cultured human scleral cells, as well as choroidal/RPE and retinal tissue. Choroid/RPE & Retina – 6952 & 6953 – 65/67°C (Pages 124‐125 of Laboratory Notebook)

Lane: Top Row Primer Notes 1 Marker VIII 2 Primer #1: GABA A Alpha 1v1‐7 Choroid/RPE – 6952 3 Primer #2: GABA A Alpha 2v1&2 Choroid/RPE – 6952 4 Primer #10: GABA A Gamma 1 Choroid/RPE – 6952 5 Primer #12: GABA A Gamma 3 Choroid/RPE – 6952 6 Primer #14: GABA A Delta Choroid/RPE – 6952 7 Primer #17: GABA B R1 Choroid/RPE – 6952 8 Primer #21: GABA C Rho 3 Choroid/RPE – 6952 9 B2M – Choroid/RPE – 6952 Housekeeping control – Expression 10 B2M – Choroid/RPE – 6952 RT‐ve control 11 Primer #1: GABA A Alpha 1v1‐7 PCR‐ve control 12 Primer #2: GABA A Alpha 2v1&2 PCR‐ve control 13 Primer #1: GABA A Alpha 1v1‐7 Choroid/RPE – 6953 14 Primer #2: GABA A Alpha 2v1&2 Choroid/RPE – 6953 15 Primer #10: GABA A Gamma 1 Choroid/RPE – 6953 – Intermediate expression 16 Primer #12: GABA A Gamma 3 Choroid/RPE – 6953 17 Primer #14: GABA A Delta Choroid/RPE – 6953 18 Primer #17: GABA B R1 Choroid/RPE – 6953 19 Primer #21: GABA C Rho 3 Choroid/RPE – 6953 20 B2M – Choroid/RPE – 6953 Housekeeping control – Expression 21 B2M – Choroid/RPE – 6953 RT‐ve control 22 Primer #1: GABA A Alpha 1v1‐7 PCR‐ve control 23 Primer #2: GABA A Alpha 2v1&2 PCR‐ve control 24 Primer #1: GABA A Alpha 1v1‐7 Retina – 6952 25 Primer #2: GABA A Alpha 2v1&2 Retina – 6952 26 Primer #10: GABA A Gamma 1 Retina – 6952 27 Primer #12: GABA A Gamma 3 Retina – 6952 28 Primer #14: GABA A Delta Retina – 6952 29 Primer #17: GABA B R1 Retina – 6952

116

Emily F. McDonald: GABA Receptors in Human Sclera

30 Marker VIII Lane: Bottom Row Primer Notes 1 Marker VIII 2 Primer #21: GABA C Rho 3 Retina – 6952 3 B2M – Retina – 6952 Housekeeping control – Expression 4 B2M – Retina – 6952 RT‐ve control 5 Primer #1: GABA A Alpha 1v1‐7 PCR‐ve control 6 Primer #2: GABA A Alpha 2v1&2 PCR‐ve control 7 Primer #1: GABA A Alpha 1v1‐7 Retina – 6953 8 Primer #2: GABA A Alpha 2v1&2 Retina – 6953 9 Primer #10: GABA A Gamma 1 Retina – 6953 – Strong expression 10 Primer #12: GABA A Gamma 3 Retina – 6953 11 Primer #14: GABA A Delta Retina – 6953 12 Primer #17: GABA B R1 Retina – 6953 13 Primer #21: GABA C Rho 3 Retina – 6953 14 B2M – Retina – 6953 Housekeeping control – Expression 15 B2M – Retina – 6953 RT‐ve control 16 Primer #1: GABA A Alpha 1v1‐7 PCR‐ve control 17 Primer #2: GABA A Alpha 2v1&2 PCR‐ve control 30 Marker VIII

117

Emily F. McDonald: GABA Receptors in Human Sclera

Table A16: RT‐PCR results for retina obtained from donor 6953. The aim of this study was to determine the presence or absence of GABA receptors in human scleral tissue and cultured human scleral cells, as well as choroidal/RPE and retinal tissue. Retina – 6953 – 63/65°C (Pages 126‐127 of Laboratory Notebook)

Lane: Top Row Primer Notes 1 Marker VIII 2 Primer #1: GABA A Alpha 1v1‐7 Retina – 6953 3 Primer #2: GABA A Alpha 2v1&2 Retina – 6953 4 Primer #3: GABA A Alpha 3 Retina – 6953 5 Primer #5: GABA A Alpha 5v1&2 Retina – 6953 6 Primer #7: GABA A Beta 1 Retina – 6953 7 Primer #8: GABA A Beta 2v1&2 Retina – 6953 – Strong expression 8 Primer #11: GABA A Gamma 2v1‐3 Retina – 6953 – Strong expression 9 Primer #12: GABA A Gamma 3 Retina – 6953 – Intermediate expression 10 Primer #13: GABA A Epsilon Retina – 6953 11 Primer #14: GABA A Delta Retina – 6953 12 Primer #15: GABA A Theta Retina – 6953 13 Primer #16: GABA A Pi Retina – 6953 – Strong expression 14 Primer #18: GABA B R2 Retina – 6953 – Intermediate expression 15 Primer #19: GABA C Rho 1 Retina – 6953 – Strong expression 16 Primer # 20: GABA C Rho 2 Retina – 6953 – Strong expression 17 Primer #21: GABA C Rho 3 Retina – 6953 18 B2M – Retina – 6953 Housekeeping control – Expression 19 B2M – Retina – 6953 RT‐ve control 20 Primer #1: GABA A Alpha 1v1‐7 PCR‐ve control 21 Primer #2: GABA A Alpha 2v1&2 PCR‐ve control 22 Primer #3: GABA A Alpha 3 PCR‐ve control 30 Marker VIII

118

Emily F. McDonald: GABA Receptors in Human Sclera

Table A17: RT‐PCR results for retina, choroid/RPE, sclera, and mesenchymal stromal cells obtained from donor 6952. The aim of this study was to determine the presence or absence of GABA receptors in human scleral tissue and cultured human scleral cells, as well as choroidal/RPE and retinal tissue. Retina, Choroid/RPE, Sclera, & Scleral Stromal Cells – 6952, 3 & 4 – 63/65°C (Pages 130‐131 of Notebook)

Lane: Top Row Primer Notes 1 Marker VIII 2 GAPDH – Choroid/RPE – 6952 Housekeeping control 3 GAPDH – Choroid/RPE – 6953 Housekeeping control 4 GAPDH – Retina – 6952 Housekeeping control 5 GAPDH – Retina – 6953 Housekeeping control 6 GAPDH – Sclera – 6952 Housekeeping control 7 GAPDH – Sclera – 6953 Housekeeping control 8 GAPDH – Sclera – 6954 Housekeeping control 9 GAPDH – Scleral Stromal Cells – 6952 Housekeeping control 10 GAPDH – Scleral Stromal Cells – 6953 Housekeeping control 21 B2M – Choroid/RPE – 6952 Housekeeping control 22 B2M – Choroid/RPE – 6953 Housekeeping control 23 B2M – Retina – 6952 Housekeeping control 24 B2M – Retina – 6953 Housekeeping control 25 B2M – Sclera – 6952 Housekeeping control 26 B2M – Sclera – 6953 Housekeeping control 27 B2M – Sclera – 6954 Housekeeping control 28 B2M – Scleral Stromal Cells – 6952 Housekeeping control 29 B2M – Scleral Stromal Cells – 6953 Housekeeping control – Faint expression 30 Marker VIII Lane: Bottom Row Primer Notes 1 Marker VIII 2 GAPDH – Choroid/RPE – 6952 RT‐ve control 3 GAPDH – Choroid/RPE – 6953 RT‐ve control 4 GAPDH – Retina – 6952 RT‐ve control 5 GAPDH – Retina – 6953 RT‐ve control 6 GAPDH – Sclera – 6952 RT‐ve control

119

Emily F. McDonald: GABA Receptors in Human Sclera

7 GAPDH – Sclera – 6953 RT‐ve control 8 GAPDH – Sclera – 6954 RT‐ve control 9 GAPDH – Scleral Stromal Cells – 6952 RT‐ve control 10 GAPDH – Scleral Stromal Cells – 6953 RT‐ve control 21 B2M – Choroid/RPE – 6952 RT‐ve control 22 B2M – Choroid/RPE – 6953 RT‐ve control 23 B2M – Retina – 6952 RT‐ve control 24 B2M – Retina – 6953 RT‐ve control 25 B2M – Sclera – 6952 RT‐ve control 26 B2M – Sclera – 6953 RT‐ve control 27 B2M – Sclera – 6954 RT‐ve control – Faint expression 28 B2M – Scleral Stromal Cells – 6952 RT‐ve control 29 B2M – Scleral Stromal Cells – 6953 RT‐ve control 30 Marker VIII

120

Emily F. McDonald: GABA Receptors in Human Sclera

Table A18: RT‐PCR results for choroid/RPE – donor 6953 – & retina – donor 6952. The aim of this study was to determine the presence or absence of GABA receptors in human scleral tissue and cultured human scleral cells, as well as choroidal/RPE and retinal tissue. Choroid/RPE (6953) & Retina (6952) – 63°C (Pages 132‐133 of Laboratory Notebook)

Lane: Top Row Primer Notes 1 Marker VIII 2 Primer #1: GABA A Alpha 1v1‐7 Choroid/RPE – 6953 3 Primer #2: GABA A Alpha 2v1&2 Choroid/RPE – 6953 4 Primer #3: GABA A Alpha 3 Choroid/RPE – 6953 5 Primer #5: GABA A Alpha 5v1&2 Choroid/RPE – 6953 6 Primer #7: GABA A Beta 1 Choroid/RPE – 6953 7 Primer #8: GABA A Beta 2v1&2 Choroid/RPE – 6953 – Weak expression 8 Primer #11: GABA A Gamma 2v1‐3 Choroid/RPE – 6953 9 Primer #12: GABA A Gamma 3 Choroid/RPE – 6953 10 Primer #13: GABA A Epsilon Choroid/RPE – 6953 11 Primer #14: GABA A Delta Choroid/RPE – 6953 12 Primer #15: GABA A Theta Choroid/RPE – 6953 13 Primer #16: GABA A Pi Choroid/RPE – 6953 – Strong expression 14 Primer #18: GABA B R2 Choroid/RPE – 6953 15 Primer #19: GABA C Rho 1 Choroid/RPE – 6953‐ Strong expression 16 Primer # 20: GABA C Rho 2 Choroid/RPE – 6953 – Strong expression 17 Primer #21: GABA C Rho 3 Choroid/RPE – 6953 18 Primer #1: GABA A Alpha 1v1‐7 PCR‐ve control 19 Primer #2: GABA A Alpha 2v1&2 PCR‐ve control 20 Primer #3: GABA A Alpha 3 PCR‐ve control 21 Primer #1: GABA A Alpha 1v1‐7 Retina – 6952 22 Primer #2: GABA A Alpha 2v1&2 Retina – 6952 23 Primer #3: GABA A Alpha 3 Retina – 6952 24 Primer #5: GABA A Alpha 5v1&2 Retina – 6952 25 Primer #7: GABA A Beta 1 Retina – 6952 26 Primer #8: GABA A Beta 2v1&2 Retina – 6952 – Intermediate expression 27 Primer #11: GABA A Gamma 2v1‐3 Retina – 6952 – Strong expression 28 Primer #12: GABA A Gamma 3 Retina – 6952

121

Emily F. McDonald: GABA Receptors in Human Sclera

29 Primer #13: GABA A Epsilon Retina – 6952 30 Marker VIII Lane: Bottom Row Primer Notes 1 Marker VIII 2 Primer #14: GABA A Delta Retina – 6952 3 Primer #15: GABA A Theta Retina – 6952 4 Primer #16: GABA A Pi Retina – 6952 – Weak expression 5 Primer #18: GABA B R2 Retina – 6952 6 Primer #19: GABA C Rho 1 Retina – 6952 – Weak expression 7 Primer # 20: GABA C Rho 2 Retina – 6952 – Weak expression 8 Primer #21: GABA C Rho 3 Retina – 6952 9 Primer #1: GABA A Alpha 1v1‐7 PCR‐ve control 10 Primer #2: GABA A Alpha 2v1&2 PCR‐ve control 11 Primer #3: GABA A Alpha 3 PCR‐ve control 30 Marker VIII

122

Emily F. McDonald: GABA Receptors in Human Sclera

Table A19: RT‐PCR results for choroid/RPE & retina obtained from donors 6952 & 6953. The aim of this study was to determine the presence or absence of GABA receptors in human scleral tissue and cultured human scleral cells, as well as choroidal/RPE and retinal tissue. Choroid/RPE & Retina – 6952 & 6953 – 65°C (Pages 134‐135 of Laboratory Notebook)

Lane: Top Row Primer Notes 1 Marker VIII 2 Primer #1: GABA A Alpha 1v1‐7 Choroid/RPE – 6952 3 Primer #2: GABA A Alpha 2v1&2 Choroid/RPE – 6952 4 Primer #3: GABA A Alpha 3 Choroid/RPE – 6952 5 Primer #4: GABA A Alpha 4v1‐3 Choroid/RPE – 6952 – Strong expression 6 Primer #5: GABA A Alpha 5v1&2 Choroid/RPE – 6952 7 Primer #6: GABA A Alpha 6 Choroid/RPE – 6952 8 Primer #9: GABA A Beta 3v1‐4 Choroid/RPE – 6952 9 Primer #12: GABA A Gamma 3 Choroid/RPE – 6952 10 Primer #14: GABA A Delta Choroid/RPE – 6952 11 Primer #21: GABA C Rho 3 Choroid/RPE – 6952 12 B2M – Choroid/RPE – 6952 Housekeeping control 13 B2M – Choroid/RPE – 6952 RT‐ve control 14 Primer #1: GABA A Alpha 1v1‐7 PCR‐ve control 15 Primer #2: GABA A Alpha 2v1&2 PCR‐ve control 16 Primer #1: GABA A Alpha 1v1‐7 Choroid/RPE – 6953 17 Primer #2: GABA A Alpha 2v1&2 Choroid/RPE – 6953 18 Primer #3: GABA A Alpha 3 Choroid/RPE – 6953 19 Primer #4: GABA A Alpha 4v1‐3 Choroid/RPE – 6953 – Strong expression 20 Primer #5: GABA A Alpha 5v1&2 Choroid/RPE – 6953 21 Primer #6: GABA A Alpha 6 Choroid/RPE – 6953 22 Primer #9: GABA A Beta 3v1‐4 Choroid/RPE – 6953 23 Primer #12: GABA A Gamma 3 Choroid/RPE – 6953 24 Primer #14: GABA A Delta Choroid/RPE – 6953 25 Primer #21: GABA C Rho 3 Choroid/RPE – 6953 26 B2M – Choroid/RPE – 6953 Housekeeping control 27 B2M – Choroid/RPE – 6953 RT‐ve control 28 Primer #1: GABA A Alpha 1v1‐7 PCR‐ve control 29 Primer #2: GABA A Alpha 2v1&2 PCR‐ve control

123

Emily F. McDonald: GABA Receptors in Human Sclera

30 Marker VIII Lane: Bottom Row Primer Notes 1 Marker VIII 2 Primer #1: GABA A Alpha 1v1‐7 Retina – 6952 3 Primer #2: GABA A Alpha 2v1&2 Retina – 6952 4 Primer #3: GABA A Alpha 3 Retina – 6952 5 Primer #4: GABA A Alpha 4v1‐3 Retina – 6952 – Strong expression 6 Primer #5: GABA A Alpha 5v1&2 Retina – 6952 7 Primer #6: GABA A Alpha 6 Retina – 6952 8 Primer #9: GABA A Beta 3v1‐4 Retina – 6952 9 Primer #12: GABA A Gamma 3 Retina – 6952 10 Primer #14: GABA A Delta Retina – 6952 11 Primer #21: GABA C Rho 3 Retina – 6952 12 B2M – Retina – 6952 Housekeeping control – Expression 13 B2M – Retina – 6952 RT‐ve control 14 Primer #1: GABA A Alpha 1v1‐7 PCR‐ve control 15 Primer #2: GABA A Alpha 2v1&2 PCR‐ve control 16 Primer #1: GABA A Alpha 1v1‐7 Retina – 6953 17 Primer #2: GABA A Alpha 2v1&2 Retina – 6953 18 Primer #3: GABA A Alpha 3 Retina – 6953 19 Primer #4: GABA A Alpha 4v1‐3 Retina – 6953 – Strong expression 20 Primer #5: GABA A Alpha 5v1&2 Retina – 6953 21 Primer #6: GABA A Alpha 6 Retina – 6953 22 Primer #9: GABA A Beta 3v1‐4 Retina – 6953 23 Primer #12: GABA A Gamma 3 Retina – 6953 24 Primer #14: GABA A Delta Retina – 6953 25 Primer #21: GABA C Rho 3 Retina – 6953 26 B2M – Retina – 6953 Housekeeping control 27 B2M – Retina – 6953 RT‐ve control 28 Primer #1: GABA A Alpha 1v1‐7 PCR‐ve control 29 Primer #2: GABA A Alpha 2v1&2 PCR‐ve control 30 Marker VIII

124

Emily F. McDonald: GABA Receptors in Human Sclera

Table A20: RT‐PCR results for retina, choroid/RPE, sclera, and mesenchymal stromal cells obtained from donor 6952. The aim of this study was to determine the presence or absence of GABA receptors in human scleral tissue and cultured human scleral cells, as well as choroidal/RPE and retinal tissue. Retina, Choroid/RPE, Sclera, & Scleral Stromal Cells – 6952, 3 & 4 – 63/65°C (Pages 130‐131 of Notebook)

Lane: Top Row Primer Notes 1 Marker VIII 2 PBGD – Choroid/RPE – 6952 Housekeeping control 3 PBGD – Choroid/RPE – 6953 Housekeeping control 4 PBGD – Retina – 6952 Housekeeping control 5 PBGD – Retina – 6953 Housekeeping control 6 PBGD – Sclera – 6952 Housekeeping control – Faint expression 7 PBGD – Sclera – 6953 Housekeeping control 8 PBGD – Sclera – 6954 Housekeeping control 9 PBGD – Scleral Stromal Cells – 6952 Housekeeping control 10 PBGD – Scleral Stromal Cells – 6953 Housekeeping control 21 B2M – Choroid/RPE – 6952 Housekeeping control 22 B2M – Choroid/RPE – 6953 Housekeeping control 23 B2M – Retina – 6952 Housekeeping control 24 B2M – Retina – 6953 Housekeeping control 25 B2M – Sclera – 6952 Housekeeping control 26 B2M – Sclera – 6953 Housekeeping control 27 B2M – Sclera – 6954 Housekeeping control 28 B2M – Scleral Stromal Cells – 6952 Housekeeping control 29 B2M – Scleral Stromal Cells – 6953 Housekeeping control 30 Marker VIII Lane: Bottom Row Primer Notes 1 Marker VIII 2 PBGD – Choroid/RPE – 6952 RT‐ve control 3 PBGD – Choroid/RPE – 6953 RT‐ve control 4 PBGD – Retina – 6952 RT‐ve control 5 PBGD – Retina – 6953 RT‐ve control 6 PBGD – Sclera – 6952 RT‐ve control

125

Emily F. McDonald: GABA Receptors in Human Sclera

7 PBGD – Sclera – 6953 RT‐ve control 8 PBGD – Sclera – 6954 RT‐ve control 9 PBGD – Scleral Stromal Cells – 6952 RT‐ve control 10 PBGD – Scleral Stromal Cells – 6953 RT‐ve control 21 B2M – Choroid/RPE – 6952 RT‐ve control 22 B2M – Choroid/RPE – 6953 RT‐ve control 23 B2M – Retina – 6952 RT‐ve control 24 B2M – Retina – 6953 RT‐ve control 25 B2M – Sclera – 6952 RT‐ve control 26 B2M – Sclera – 6953 RT‐ve control 27 B2M – Sclera – 6954 RT‐ve control 28 B2M – Scleral Stromal Cells – 6952 RT‐ve control 29 B2M – Scleral Stromal Cells – 6953 RT‐ve control 30 Marker VIII

126

Emily F. McDonald: GABA Receptors in Human Sclera

Table A21: RT‐PCR results for mesenchymal stromal cells obtained from donor 6953. The aim of this study was to determine the presence or absence of GABA receptors in human scleral tissue and cultured human scleral cells, as well as choroidal/RPE and retinal tissue. Scleral Stromal Cells – 6953 – Varied°C (Pages 143‐144 of Laboratory Notebook)

Lane: Top Row Primer Notes 1 Marker VIII 2 Primer #1: GABA A Alpha 1v1‐7 3 Primer #2: GABA A Alpha 2v1&2 4 Primer #3: GABA A Alpha 3 5 Primer #4: GABA A Alpha 4v1‐3 Weak expression 6 Primer #5: GABA A Alpha 5v1&2 7 Primer #6: GABA A Alpha 6 8 Primer #7: GABA A Beta 1 Intermediate expression 9 Primer #8: GABA A Beta 2v1&2 Intermediate expression 10 Primer #9: GABA A Beta 3v1‐4 Strong expression 11 Primer #10: GABA A Gamma 1 12 Primer #11: GABA A Gamma 2v1‐3 Strong expression 13 Primer #12: GABA A Gamma 3 14 Primer #13: GABA A Epsilon Intermediate expression 15 Primer #14: GABA A Delta 16 Primer #15: GABA A Theta 17 Primer #16: GABA A Pi Weak expression 18 Primer #17: GABA B R1 19 Primer #18: GABA B R2 20 Primer #19: GABA C Rho 1 21 Primer # 20: GABA C Rho 2 Weak expression 22 Primer #21: GABA C Rho 3 23 Marker VIII

127

Emily F. McDonald: GABA Receptors in Human Sclera

Table A22: RT‐PCR results for mesenchymal stromal cells obtained from donor 6952. The aim of this study was to determine the presence or absence of GABA receptors in human scleral tissue and cultured human scleral cells, as well as choroidal/RPE and retinal tissue. Scleral Stromal Cells – 6952 – Varied°C (Page 149 of Laboratory Notebook)

Lane: Top Row Primer Notes 1 Marker VIII 2 Primer #1: GABA A Alpha 1v1‐7 Intermediate expression 3 Primer #2: GABA A Alpha 2v1&2 4 Primer #3: GABA A Alpha 3 5 Primer #4: GABA A Alpha 4v1‐3 Strong expression 6 Primer #5: GABA A Alpha 5v1&2 Strong expression 7 Primer #6: GABA A Alpha 6 8 Primer #7: GABA A Beta 1 Strong expression 9 Primer #8: GABA A Beta 2v1&2 Strong expression 10 Primer #9: GABA A Beta 3v1‐4 Strong expression 11 Primer #10: GABA A Gamma 1 Strong expression 12 Primer #11: GABA A Gamma 2v1‐3 Strong expression 13 Primer #12: GABA A Gamma 3 Weak expression 14 Primer #13: GABA A Epsilon Strong expression 15 Primer #14: GABA A Delta 16 Primer #15: GABA A Theta Strong expression 17 Primer #16: GABA A Pi Strong expression 18 Primer #17: GABA B R1 Strong expression 19 Primer #18: GABA B R2 Strong expression 20 Primer #19: GABA C Rho 1 Strong expression 21 Primer # 20: GABA C Rho 2 Strong expression 22 Primer #21: GABA C Rho 3 23 Marker VIII

128

Emily F. McDonald: GABA Receptors in Human Sclera

Appendix Four: GABA RECEPTOR GENE SEQUENCING

Representative RT‐PCR product for each GABA receptor for which a positive result was obtained was sent to the Australian Genome Research Facility (AGRF) for independent sequencing. Firstly, the product was cleaned and each product was assigned an identifying label solely (USS1‐17; no further information was supplied to the AGRF). Each label corresponded to the different GABA receptor genes as shown below. Refer to Table A2 for

Blast results.

USS1: GABA A Alpha 1 USS2: GABA A Alpha 4 USS3: GABA A Alpha 5 USS4: GABA A Alpha 6 USS5: GABA A Beta 1 USS6: GABA A Beta 2 USS7: GABA A Beta 3 USS8: GABA A Gamma 1 USS9: GABA A Gamma 2 USS10: GABA A Gamma 3 USS11: GABA A Epsilon USS12: GABA A Theta USS13: GABA A Pi USS14: GABA B R1 USS15: GABA B R2 USS16: GABA A Rho 1 USS17: GABA A Rho 2

129

Emily F. McDonald: GABA Receptors in Human Sclera

Table A23: Relevant Blast results obtained from the AGRF for each product representative of potential positive results for GABA receptor genes. Code USS1 Gene >gi|21265167|gb|BC030696.1| Homo sapiens gamma-aminobutyric acid (GABA) A receptor, alpha 1, mRNA (cDNA clone MGC:26564 IMAGE:4820972), complete cds Length 3440 Score 291 bits (147) Expect 5e‐76 Identities 147/147 (100%) Strand Plus/Plus Blast Result ctggatcctccttctgagcacactgactggaagaagctatggacagccgtcattacaaga |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ctggatcctccttctgagcacactgactggaagaagctatggacagccgtcattacaaga tgaacttaaagacaataccactgtcttcaccaggattttggacagactcctagatggtta |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| tgaacttaaagacaataccactgtcttcaccaggattttggacagactcctagatggtta tgacaatcgcctgagaccaggattggg 147 ||||||||||||||||||||||||||| tgacaatcgcctgagaccaggattggg 254

Code USS2 Gene >gi|34452722|ref|NM_000809.2| Homo sapiens gamma- aminobutyric acid (GABA) A receptor, alpha 4 (GABRA4), mRNA Length 11143 Score 333 bits (168) Expect 2e‐88 Identities 174/176 (98%) Strand Plus/Plus Blast Result aagtgtcctatgctaccgccatggactggttcatagctgtctgctttgcttttgtatttt |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| aagtgtcctatgctaccgccatggactggttcatagctgtctgctttgcttttgtatttt cggcccttatcgagtttgctgctgtcaactatttcaccaatattcaaatggaaaaagcca |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| cggcccttatcgagtttgctgctgtcaactatttcaccaatattcaaatggaaaaagcca aaaggaagacatcaaagccccctcaggaagttcccgctgctccatggcagagagag 184 |||||||||||||||||||||||||||||||||||||||||||| |||||||||| Aaaggaagacatcaaagccccctcaggaagttcccgctgctccagtgcagagagag 1249

Code USS3 Gene >gi|182915|gb|L08485.1|HUMGABRA5Y Human GABA-benzodiazepine receptor alpha-5-subunit (GABRA5) mRNA, complete cds Length 2318 Score 248 bits (125) Expect 6e‐63 Identities 125/125 (100%) Strand Plus/Plus Sequence aatggagtacaccatagacgtgtttttccgacaaagctggaaagatgaaaggcttcggtt |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| aatggagtacaccatagacgtgtttttccgacaaagctggaaagatgaaaggcttcggtt taaggggcccatgcagcgcctccctctcaacaacctccttgccagcaagatctggacccc |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| taaggggcccatgcagcgcctccctctcaacaacctccttgccagcaagatctggacccc agaca 128 |||||

130

Emily F. McDonald: GABA Receptors in Human Sclera

agaca 702

Code USS4 Gene >gi|109731537|gb|BC099641.3| Homo sapiens gamma-aminobutyric acid(GABA) A receptor, alpha 6, mRNA (cDNA clone MGC:116904 IMAGE:40005679), complete cds Length 1539 Score 250 bits (126) Expect 3e-63 Identities 133/134 (99%) Strand Plus/Plus Sequence atttgatggtcagtaaa-tctggacgcctgacacctttttcagaaatggtaaaaagtcca ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| atttgatggtcagtaaaatctggacgcctgacacctttttcagaaatggtaaaaagtcca ttgctcacaacatgacaactcctaataaactcttcagaataatgcagaatggaaccattt |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ttgctcacaacatgacaactcctaataaactcttcagaataatgcagaatggaaccattt tatacaccatgagg 135 |||||||||||||| tatacaccatgagg 473

Code USS5 Gene >gi|182918|gb|M59213.1|HUMGABRB12 Human gamma-aminobutyric acid-A (GABA-A) receptor beta-1 subunit, exon 4 Length 2165 Score 218 bits (110) Expect 4e-54 Identities 110/110 (100%) Strand Plus/Plus Sequence atacactcaccatgtatttccagcagtcttggaaagacaaaaggctttcttattctggaa |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| atacactcaccatgtatttccagcagtcttggaaagacaaaaggctttcttattctggaa tcccactgaacctcaccctagacaatagggtagctgaccaactctgggta 110 |||||||||||||||||||||||||||||||||||||||||||||||||| tcccactgaacctcaccctagacaatagggtagctgaccaactctgggta 889

Code USS6 Gene >gi|71043451|gb|BC099719.1| Homo sapiens gamma-aminobutyric acid (GABA) A receptor, beta 2, mRNA (cDNA clone MGC:119389 IMAGE:40006779), complete cds Length 1977 Score 127 (64) Expect 6e-27 Identities 64/64 (100%) Strand Plus/Plus Sequence acacatcaatccaggacaaaagtgacgctaaaataccttagttgctggcctatcctgtgg |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| acacatcaatccaggacaaaagtgacgctaaaataccttagttgctggcctatcctgtgg tcca 64 |||| tcca 1948

Code USS7 Gene >gi|14714964|gb|BC010641.1| Homo sapiens gamma-aminobutyric acid (GABA) A receptor, beta 3, mRNA (cDNA clone MGC:9051 IMAGE:3871111), complete cds

131

Emily F. McDonald: GABA Receptors in Human Sclera

Length 2994 Score 129 bits (65) Expect 1e-27 Identities 65/65 (100%) Strand Plus/Plus Sequence gcctcatcagtatttggactttttaaagctcgtagaaacaagacaaggtgcaccggtttc |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| gcctcatcagtatttggactttttaaagctcgtagaaacaagacaaggtgcaccggtttc ataga 65 ||||| ataga 2939

Code USS8 Gene >gi|21411385|gb|BC031087.1| Homo sapiens gamma-aminobutyric acid (GABA) A receptor, gamma 1, mRNA (cDNA clone MGC:33838 IMAGE:5289008), complete cds Length 2264 Score 216 bits (109) Expect 5e-53 Identities 125/133 (93%) Strand Plus/Plus Sequence ggggattatgttatcatgacaannnnnnnngacctgagcagaagaatgggatatttcact |||||||||||||||||||||| |||||||||||||||||||||||||||||| ggggattatgttatcatgacaattttttttgacctgagcagaagaatgggatatttcact attcagacctacattccatgcattctgacagttgttctttcttgggtgtctttttggatc |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| attcagacctacattccatgcattctgacagttgttctttcttgggtgtctttttggatc aataaagatgcag 293 ||||||||||||| aataaagatgcag 983

Code USS9 Gene >gi|189083761|ref|NM_198903.2| Homo sapiens gamma- aminobutyric acid (GABA) A receptor, gamma 2 (GABRG2), transcript variant 3, mRNA Length 4077 Score 260 bits (131) Expect 2e-66 Identities 131/131 (100%) Strand Plus/Plus Sequence ccgctgccagagtgacgctttgatggtatctgcaagcgtttttgctgatcttatctctgc |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ccgctgccagagtgacgctttgatggtatctgcaagcgtttttgctgatcttatctctgc cccctgaatattaattccctaatctggtagcaatccatctccccagtgaaggacctacta |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| cccctgaatattaattccctaatctggtagcaatccatctccccagtgaaggacctacta gaggcaggtgg 131 ||||||||||| gaggcaggtgg 257

Code USS10 Gene >gi|110556626|ref|NM_033223.3| Homo sapiens gamma- aminobutyric acid (GABA) A receptor, gamma 3 (GABRG3), mRNA Length 1677 Score 190 bits (96) Expect 8e-46

132

Emily F. McDonald: GABA Receptors in Human Sclera

Identities 96/96 (100%) Strand Plus/Plus Sequence ccctgagcaccatcgccaggaagtccttgccacgcgtgtcctacgtgaccgccatggacc |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ccctgagcaccatcgccaggaagtccttgccacgcgtgtcctacgtgaccgccatggacc tttttgtgaccgtgtgcttcctgtttgtcttcgccg 96 |||||||||||||||||||||||||||||||||||| tttttgtgaccgtgtgcttcctgtttgtcttcgccg 1154

Code USS11 Gene >gi|1857125|gb|U66661.1|HSU66661 Human GABA-A receptor epsilon subunit mRNA, complete cds Length 3154 Score 274 bits (138) Expect 1e-70 Identities 144/146 (98%) Strand Plus/Plus Sequence ggtacgacgaacgcctctgttacaacgacacctttgagtctcttgttctgaatggcaatg |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ggtacgacgaacgcctctgttacaacgacacctttgagtctcttgttctgaatggcaatg tggtgagccagctatggatcccggacaccttttttaggaattctaagaggacccacgagc |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| tggtgagccagctatggatcccggacaccttttttaggaattctaagaggacccacgagc atgagatcaccatgccaacccagatg 158 |||||||||||||||| | ||||||| atgagatcaccatgcccaaccagatg 562

Code USS12 Gene >gi|5764186|gb|AF144648.1|AF144648 Homo sapiens GABA-A receptor theta (theta) mRNA, complete cds Length 1884 Score 232 bits (117) Expect 3e-58 Identities 117/117 (100%) Strand Plus/Plus Sequence acagcaaggatgctttcgtgcatgatgtgactgtggagaatcgcgtgtttcagcttcacc |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| acagcaaggatgctttcgtgcatgatgtgactgtggagaatcgcgtgtttcagcttcacc cagatggaacggtgcggtacggcatccgactcaccactacagcagcttgttccctgg485 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| cagatggaacggtgcggtacggcatccgactcaccactacagcagcttgttccctgg541

Code USS13 Gene >gi|2197000|gb|U95367.1|HSU95367 Human GABA-A receptor pi subunit mRNA, complete cds Length 3282 Score 307 bits (155) Expect 9e-81 Identities 155/155 (100%) Strand Plus/Plus Sequence acaagagcttcactctggatgcccgcctcgtggagttcctctgggtgccagatacttaca |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| acaagagcttcactctggatgcccgcctcgtggagttcctctgggtgccagatacttaca ttgtggagtccaagaagtccttcctccatgaagtcactgtgggaaacaggctcatccgcc |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ttgtggagtccaagaagtccttcctccatgaagtcactgtgggaaacaggctcatccgcc

133

Emily F. McDonald: GABA Receptors in Human Sclera

tcttctccaatggcacggtcctgtatgccctcaga 159 ||||||||||||||||||||||||||||||||||| tcttctccaatggcacggtcctgtatgccctcaga 615

Code USS14 Gene >gi|4063891|gb|AF099148.1|AF099148 Homo sapiens GABA-B1a receptor mRNA, complete cds Length 3192 Score 293 bits (148) Expect 1e-76 Identities 148/148 (100%) Strand Plus/Plus Sequence gctcatccaccacgacagcaagtgtgatccaggccaagccaccaagtacctatatgagct |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| gctcatccaccacgacagcaagtgtgatccaggccaagccaccaagtacctatatgagct gctctacaacgaccctatcaagatcatccttatgcctggctgcagctctgtctccacgct |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| gctctacaacgaccctatcaagatcatccttatgcctggctgcagctctgtctccacgct ggtggctgaggctgctaggatgtggaac 148 |||||||||||||||||||||||||||| ggtggctgaggctgctaggatgtggaac 891

Code USS15 Gene >gi|4836217|gb|AF095784.1|AF095784 Homo sapiens GABA-B receptor R2 (GABBR2) mRNA, complete cds Length 3240 Score 256 bits (129) Expect 2e-65 Identities 129/129 (100%) Strand Plus/Plus Sequence ctaccaagagctcaatgacatcctcaacctgggaaacttcactgagagcacagatggagg |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ctaccaagagctcaatgacatcctcaacctgggaaacttcactgagagcacagatggagg aaaggccattttaaaaaatcacctcgatcaaaatccccagctacagtggaacacaacaga |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| aaaggccattttaaaaaatcacctcgatcaaaatccccagctacagtggaacacaacaga gccctctcg 129 ||||||||| gccctctcg 2749

Code USS16 Gene >gi|120659825|gb|BC130344.1| Homo sapiens gamma-aminobutyric acid (GABA) receptor, rho 1, mRNA (cDNA clone MGC:163216 IMAGE:40146375), complete cds Length 1862 Score 194 bits (98) Expect 5e-47 Identities 101/102 (99%) Strand Plus/Plus Sequence gcatgacgtttgacggccggctggtcaagaagatctgggtccctgacatgtttttcgtgc ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| gcatgacgtttgatggccggctggtcaagaagatctgggtccctgacatgtttttcgtgc actccaaacgctccttcatccacgacaccaccacagacaacg 102 |||||||||||||||||||||||||||||||||||||||||| actccaaacgctccttcatccacgacaccaccacagacaacg 535

134

Emily F. McDonald: GABA Receptors in Human Sclera

Code USS17 Gene >gi|182912|gb|M86868.1|HUMGABARHO Human gamma amino butyric acid (GABA rho2) gene mRNA, complete cds Length 1628 Score 283 bits (143) Expect 1e-73 Identities 150/151 (99%) Gaps 1/151 (0%) Strand Plus/Plus Sequence cagcgccagca-caagagcatgaccttcgatggccggctggtgaagaagatctgggtccc ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| cagcgccagcaacaagagcatgaccttcgatggccggctggtgaagaagatctgggtccc tgatgtcttctttgttcactccaaaagatcgttcactcatgacaccaccactgacaacat |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| tgatgtcttctttgttcactccaaaagatcgttcactcatgacaccaccactgacaacat catgctgagggtgttcccagatggacacgtg 157 ||||||||||||||||||||||||||||||| catgctgagggtgttcccagatggacacgtg 578

135

Emily F. McDonald: GABA Receptors in Human Sclera

Appendix Five: Genome mAPS

Shown below are representative genome maps for thirteen of the primers used for the RT‐

PCR component of this project.

136

Emily F. McDonald: GABA Receptors in Human Sclera

137