Karymorphological and Molecular Studies on Seven Species in Polygonoideae (Polygonaceae) in Egypt

Karymorphological and molecular studies on seven species in Polygonoideae (Polygonaceae) in Egypt

Magdy Hussein Abd El-Twab1, Ahmed M. Abdel-Hamid and Hagar Ata A. Mohamed

Department of Botany and Microbiology, Faculty of Science, Minia University 61519, El-Minia City, Egypt

1Author for correspondence: ([email protected]) Received January 22, 2012; accepted February 29, 2012

ABSTRACT. Seven species in four genera of the Polygonoideae (Polygonaceae) in Egypt were subjected to karyomorphological and molecular studies in order to identify their chromosomal characteristics and investigate their phylogenetical relationships by the conventional staining method and the 5S rDNA PCR. Seed germination after treatment with low temperature stratifi cation and acidifi cation by concentrated H2SO4 was studied. Three rates of germination were obtained in response to the cold stratifi cation and acidifi cation: 1) High in Polygonum equisetiforme, Persicaria lanigera, Pe. lapathifolia and Pe. salicifolia; 2) low in Rumex dentatus; 3) no effect in R. pictus and Emex spinosa. Variation in the chromosome complements number, length and structure were detected for Po. equisetiforme (2n=58; new count); Pe. lanigera (2n=40; new count); Pe. lapathifolia (2n=22); Pe. salicifolia (2n=60); Emex spinosa (2n=18; a new count); Rumex dentatus (2n=40); and R. pictus (2n=18; a new count). Eighteen polymorphic bands of 5S rDNA were used to determine the similarities among the taxa with the similarity coeffi cient ranging between 0.2 and 0.67.

KEYWORDS: Acidiﬁ cation, Chromosomes, 5S rDNA, Polygonaceae, Stratiﬁ cation.

The Polygonaceae is cosmopolitic to temperate regions have been widely used to elucidate generic relationships (Täckholm 1974; Boulos 1999). The family is taxonomi- and circumscriptions (Stebbins 1971; Raven 1975; Hong cally divided into two subfamilies, Polygonoideae and 1990). Many karyological studies were performed in the Eriogonoideae. The subfamily Polygonoideae includes Polygonaceae species such as: Polygonum (Simmonds fi ve tribes: Calligoneae (Calligonum and Petroxygonum 1945), Fagopyrum (Chen 1999), Koenigia (Hedberg group), Fagopyreae (Fallopia group), Persicarieae 1997) Rumex (Baltisberger and Widmer 2006) and Rheum (Persicaria group), Polygoneae (Polygonum and (Hu et al. 2007). Atraphaxis group), and Rumiceae (Rumex and Emex In addition to karyological studies, molecular markers group) (Burke et al. 2010). There are 46 genera with 1100 provide a powerful tool in identifi cation and phylogenetic species in the world (Boulos 1999). In Egypt, the family is studies. In higher eukaryotes, the 5S ribosomal DNA (5S represented by 28 species belonging to seven genera, if rDNA) represents multiple copies of highly conserved Persicaria is considered as a section within Polygonum 120 base pairs coding sequences, separated from each (Davis 1967; Täckholm 1974; Zohary 1981; Meikle other by variable non-transcribed spacers (Long and 1985), or eight genera after they were separated into two David 1980). The 5S rDNA is considered a suitable genera (Boulos 1999; Chaudhary 1999). candidate for PCR-based genetic studies. It is highly The seed in stage is the most important stage in the life conserved even among distantly related species and cycle for survival of higher plants. In the Polygonaceae, consequently, it is possible to amplify the 5S rDNA the plants suffer from seed dormancy by unknown reasons repeats by PCR, even in the presence of poor DNA quality (Metzger 1992) and consequently they are diffi cult to and quantity due to their tandem nature and small size germinate in the laboratory. In conditions of natural (Martins and Wakso 2004). environment, those seeds germinate by seasonal fl uctuation The present study is conducted in order to: 1) study the of temperature (Roberts and Totterdell 1981; Pye and chromosome characteristics of seven species belonging to Andersson 2009) but light appeared to be not critical for four genera of the Polygonoideae (Polygonaceae) in germination (Bouwmeester and Karssen 1992). Dormancy Egypt; 2) compare their 5S rDNA PCR profi les; 3) and germination are natural mechanisms, by which the investigate the genetical relationship between Polygonum seed is often well equipped to survive extended periods of and Persicaria. unfavorable conditions, and the embryo is protected by one or several layers of tissues, which play an important MATERIALS AND METHODS part in the regulation of dormancy and germination Plant materials Polygonum equisetiforme Sibth., Persi- (Michael et al. 1998). caria lanigera (R. Br.), P. lapathifolia (L.) Delarbre, Pe. Karyological studies are considered of great importance salicifolia (Brouss. & Willd.) Assenov., Rumex denatus L., for taxonomical and evolutionary studies of plants and R. pictus Foessk and Emex spinosa (L.) Campd. (Table 1) 18 ABD EL-TWAB ET AL

Table 1. Rate and duration of seed germination of the control and H2SO4 treated seeds of the selected Polygonaceae taxa

Rate of seed germination Duration of seed Taxa germination Control (without acid) Conc. H2SO4 Po. equisetiforme 80% 0% 15 days E. spinosa 0% 60% 10 days R. dentatus 60% 98% 5 to 7 days R. pictus 0% 98% 5 to 7 days Pe. lanigera 60% 0% 15 days Pe. lapathifolia 85% 0% 30 to 35 days Pe. salicifolia 70% 0% 15 to 22 days were studied. Their plants at fl owering and fruiting stages ground tissue (500 mg) was transferred into 1.5 ml were collected in various regions in Egypt such as eppendorf tube and 650 μl of pre-warmed lyses buffer of Mediterranean, Eastern Desert and Nile Islands. 2% CTAB solution was added. Tubes were then incubated at 65 °C for about 1 - 1.5 h with gentle shaking every 10 Stoppage of seed dormancy The collected seeds were min. After centrifugation at 12,000 rpm for 10 min, the subjected to two different treatments; acidifi cation and supernatant was transferred into another tube, washed by low-temperature stratifi cation simultaneously. Seeds were a double volume of chloroform: isoamyl alcohol (24:1) fi rstly sterilized by soaking in diluted NaOCl at non- mixture with gentle vortexing for 10 min. washing was inhibitory concentration for 5 min (Oyebanji et al. 2009; repeated until the supernatant became completely clear.

Talei et al. 2011), washed by sterilized distilled H2O, The supernatant was transferred to another tube and an treated by concentrated H2SO4 for 15 min and then washed equal volume of absolute ethanol was added and left on by running tap H2O for 30 min. Control seeds were planted ice for at least one hour to precipitate DNA strands. without treatment. Mature H2SO4-treated seeds were Suspension was then spun down to precipitate DNA in the planted in Petri dishes under different ranges of low form of pellet on the tube wall. Pellets were washed with temperatures; 2 °C for 20 h, 10 °C for 4 h and 25 °C for 24 70% ethanol and left to evaporate the excess of alcohol, h (Metzger 1992). eluted in 100 μl of either Tris-EDTA (TE) buffer or distilled water. Chromosomal preparation Seedlings ca 1 cm long were collected in the early morning, treated with 0.002 M Amplifi cation of 5S rDNA Amplifi cation of 5S rRNA 8-hydroxyquinoline for 4 h at 4 °C (Kondo et al. 1992; was conducted as described by Hizume (1993) and Abd Abd El-Twab et al. 2008), fi xed in freshly prepared acetic- El-Twab and Kondo (2002). Two primers were used: ethanol (1:3) at room temperature overnight, and then (forward) 5’- CGGTGCATTAATGCTGGTAT - 3’ and preserved in 70% ethanol. Preserved seedlings were (reverse) 5’- CCATCAGAACTCCGCAGTTA - 3’. The washed briefl y with distilled water and then hydrolyzed in PCR reaction mixture (20 μl) consisted of PCR-master a mixture of 1 N HCl-glacial acetic acid (2:1) at 60 °C for mix beads (Taq-polymerase, dNTPs, Tris-HCl (pH=9),

30-60 sec, followed by aceto-orcein squash technique. MgCl2 and KCl), 2μl of template DNA, 1.5 μl of each

Root tips were subjected to 0.2% aceto-orcein solution for primer and free nuclease H2O. PCR was performed using 5:10 min, and then mounted on slides. Slides were Hybaid Thermal Cycler according to the following dehydrated and fi xed by quick freezing and fi nally program: one cycle for initial denaturation at 94 °C for 5 examined. Examination of slides was done by Zeiss min, 30 cycles of 94 °C for 45 sec, 56 °C for 45 sec and 72 microscope and photographs were taken by a microscope- °C for 45 sec. A fi nal extension step was performed for computer digital camera “Ulead explorer”. Some karyotype one cycle at 72 °C for 10 min. The PCR-products were criteria were measured from 2 to 3 chromosome always kept at 4 °C. The 5S rDNA amplifi cation products complements, which were the mean of total chromosome were separated onto 1.5% Agarose Gel, stained by 0.5 μg/ length (μm), chromosome form following Levan et al. ml Ethidium Bromide and visualized by UV light. (1964) and total form percent (TF %) following Huziwara Analysis was determined by variation in band numbers (1962). The TF % was used to evaluate the karyotype and sizes of 5S rDNA. Sizes of the amplifi ed bands were symmetry/asymmetry and the karyotypic relationship determined using DNA ladder (100 bp - 3000 bp Axygen). among species Calculation of the similarity matrix (Jaccard) and cluster analysis were done by PAST computer statistical Plant genomic DNA extraction Genomic DNA was program, that was used for hierarchical clustering analysis extracted by the CTAB method according to Abd El-Twab based on outweighed pair group method with arithmetic and Zahran (2008). Young fresh or sterilized dried leaves mean to generate a dendrogram and to describe were ground with liquid nitrogen to fi ne powder. The relationships among genotypes. KARYOMORPHOLOGICAL AND MOLECULAR STUDIES OF POLYGONACEAE IN EGYPT 19

RESULTS AND DISCUSSION with those of Metzger (1992) where treatment of seeds The effect of concentrated sulfuric acid and low temperature with concentrated sulfuric acid coupled with low treatments on the germination rates and durations of the temperature induced the germination of Polygonum and seven chosen Polygonoideae taxa is shown in Table 1. Persicaria. Seeds responded to the acidifi cation by Rates of seed germination at 10 °C of Polygonum concentrated sulfuric acid at low temperature (10 °C) equisetiforme, Persicaria lanigera, Pe. lapathifolia and yielding high germination rates. However, germination of Pe. salicifolia were 80%, 60%, 85% and 70%, respectively. Rumex dentatus, R. pictus and Emex spinosa was possible Rumex dentatus showed high germination rate (98%) at only at low temperature stratifi cation. On the other hand, low temperature stratifi cation compared with 60% when acidifi cation badly affected the rate of R. dentatus treated with acid exposure. Emex spinosa and R. pictus germination and inhibited the germination of both E. germinated only at low temperatures with germination spinosa and R. pictus completely. rate of 60% and 98% respectively. At this temperature Chromosome complement of Polygonum equisetiforme panel that mimics the natural conditions at which these was 2n=58 (Figs. 1, 2 A), mean length of 21.39 μm (Table plants grow, germination started after 1-3 weeks. 2) and consisted of 46 median- and 12 submedian- Metzger (1992) suggested that seed dormancy is due to centromeric chromosomes. Emex spinosa was 2n=18 either embryo-covering structure that might prevent gas (Figs. 1, 2 B), 19 μm (Table 2) and 8 median-, 6 submedian- exchange and\or water uptake or the presence of and 4 subterminal-centromeric chromosomes. Rumex germination inhibitors. Therefore, different strategies dentatus was 2n=40 (Figs. 1, 2C), 21.88 μm (Table 2) and were established to overcome seed dormancy in Polygo- 22 median-, 15 submedian- and 3 subterminal-centromeric naceae: 1) removal of the pericarp portion of Polygonum chromosomes. Rumex pictus had 2n=18 (Figs. 1, 2D), seeds by exposure to low temperatures (Metzger 1992); 2) 26.12 μm (Table 2) and 2 median-, 14 submedian- and 2 applying both cold and acid stratifi cation to destabilize the subterminal-centromeric chromosomes. Pe. lanigera was embryo-covering structures (Al-Helai 1996); 3) cold 2n=40 (Figs. 1, 2E), 29.4 μm (Table 2) and 20 median-, 17 stratifi cation and gibberellic acid to lyse the hard covering submedian- and 3 subterminal-centromeric chromosomes. structures; 4) treatment with enzymes to lyse the pericarp Pe. lapathifolia was 2n=22 (Figs. 1, 2F), 27.056 μm (Daniels 1998; Al-Turki et al. 2000); 5) exposure to (Table 2), 18 median- and 4 submedian-centromeric different physiological factors such as temperature, light, pH, seed age and soil depth, to optimize germination conditions (Yilmaz et al. 2007). Our results are consistent

Fig. 1. A-G. Aceto-carmen stained metaphase plates for Fig. 2. A-G. Karyograms of metaphase chromosomes the selected Polygonaceae taxa. A. Po. equisetiforme. B. for the selected Polygonaceae taxa. A. Po. equisetiforme. E. spinosa. C. R. dentatus. D. R. pictus. E. Pe. lanigera. F. B. E. spinosa. C. R. dentatus. D. R. pictus. E. Pe. lanigera. Pe. lapathifolia. G. Pe. salicifolia. Bar= 5 μm. F. Pe. lapathifolia. G. Pe. salicifolia. Bar= 5 μm. 20 ABD EL-TWAB ET AL

Table 2. Chromosome characteristics of the selected Polygonaceae taxa

Chromosome length Mean of Total Chromosome Shortest Longest chromosome Form TF%b Species Number Complement 2n chromosome chromosome ±SDa μm ±SD mμ length μm Po .equisetiforme 58 0.09±0.023 0.6±0.164 21.39±0.722 46 m, 12 sm 40.99% E. spinosa 18 0.36±0.03 1.30±0.05 19.00±0.3 8 m, 6 sm, 4 st 31.59% R. dentatus 40 0.30±0.13 1.60±0.03 21.88±1.93 22 m, 15 sm, 3 st 37.10% R. pictus 18 0.70±0.48 1.45±0.11 26.12±1.76 2 m, 14 sm, 2 st 28.79% Pe. lanigera 40 0.18±0.02 2.20±0.21 29.40±0.283 20 m, 17 sm, 3 st 36.73% Pe. lapathifolia 22 0.45±0.55 1.44±0.19 27.06±1.09 18 m, 4 sm 41.90% Pe. salicifoliaa 60 0.09±0.1 1.60±0.2 27.5±0.03 28 m, 32 sm 38.55% a: Standard deviation b: Total form percentage = Total short arm length/total length of all chromosomes X 10 chromosomes; Pe. salicifolia was 2n=60 (Figs. 1, 2G), fi lamentous stamens with the number reduced mostly in 27.5 μm (Table 2) and 28 median- and 32 submedian- the outer whorl and the presence of nectaries, trifi d petal centromeric chromosomes. The karyotypes of the studied venation, and the mostly rectangular to elongated tepal species showed asymmetry. The degree of karyotype epidermis cell (Decraene and Akeroyed 1988; Decraene et asymmetry as indicated by TF % values ranged between al. 2000). Karyotype evolutions are one of the most 28.79% in Rumex pictus and 41.9% in Persicaria important aspects of the whole evolutionary processes lapathifolia (Table 2). (Imai et al. 1986) and considered as an isolating The use of chromosomal data to solve systematic mechanism in speciation and have their own evolutionary problems was introduced early in the last century, and its trends independent of genetic evolution (Imai et al. 2001). importance has grown gradually as the nature of Therefore, karyotype evolution generally tends towards chromosomes became more understood mean while faster an increasing number and terminal centromeric and better methods for the study of chromosomes were chromosomes (acrocentric). The opposite tendency, the developed (Tanaka 1959). Using differences in basic reduction of chromosome number and formation of chromosome number, morphology and ploidy in taxonomy median centromeric chromosomes (metacentric) are proved to be valuable. Such information is very useful in primitive (Imai et al. 2001). Accordingly, the karyotype in verifying the integrity of species, especially when they the hexaploid chromosome complement of Pe. salcifolia have different chromosome numbers, for providing a is considered the most advanced karyotype and Pe. reliable characteristic to distinguish species (Davis and lapathifolia the most primitive among the Persicaria Bowmer 1966; Lewis 1970; Watanabe 1977; Hedberg and presented species. The evolution of chromosome shape, Hedberg 1995). This is particularly true when size, composition, number and redundancy might result in chromosomal differences are correlated to morphological a wide diversity of karyotypes. variations (Mohamed 1997). The present study provides The species showed polyploidy complex with a basic the fi rst record for Polygonum equisetiforme to have chromosome number of x=9 (Mao et al., 1983), x=10 2n=58 (aneupolyploidy). The chromosome numbers of (Wolf and McNeill 1987), x=11 (Xinmin et al. 2009), and some taxa were consistent with other reports as in aneuploidy (Mohamed 1997). The present preliminary Persicaria lapathifolia of 2n=22 (Probatova and study on the taxa in Polygonoideae showed variation in Sokolovskaya 1989; Dempsey et al. 1994; Probatova the basic chromosome number of x=9 (Emex spinosa and 2005) and Pe. salicifolia of 2n=60 (Mohamed 1997). Rumex pictus), x=10 (Persicaria lanigera, Pe. salicifolia Persicaria lanigera showed a new chromosome count of and Rumex dentatus), x=11 (Pe. lapathifolia), and aneuploidy 2n=40, which is different from the previously reported (Polygonum equisetiforme) and variation in both the number 2n=46 (Mohamed 1997). Rumex dentatus of 2n= chromosome complement lengths and structure, which 40 was in agreement with previous reports (Bir and Sidhu might suggest that the species come from different origins 1979; Bir and Sidhu 1980; Al-Turki et al. 2000), while R. or natural hybridization with the closely related taxa. pictus of 2n=18 showed a new count that is different from Eighteen reproducible polymorphic bands were the number (2n=20) reported by Lifante et al. 1992. obtained from the 5S rDNA PCR amplifi cation (Fig. 3). Similarly, Emex spinosa exhibited a new count (2n=18) These bands were used for studying the genetics similarity which is different from that (2n=20) reported previously among the species. The average similarity coeffi cient (Putievsky et al. 1980; Querios 1983; Querios 1991; ranged from 0.2 to 0.67 (Table 3). Different species Fiorini and Raffaelli 1996; Runemark 1996; Mohamed exhibited distinctive band numbers and sizes. Po. 1997; Vogt and Aparicio 1999). equisetiforme of 22.2 %, showed four bands (500 bp, 120 Morphologically, Persicarieae is distinguished from kbp, 100 bp and 80 bp). Both Pe. lapathifolia and R. the other major tribe Polygoneae by having non-dilated dentatus with 16.67% and three amplifi ed bands (400 bp, KARYOMORPHOLOGICAL AND MOLECULAR STUDIES OF POLYGONACEAE IN EGYPT 21

Table 3. 5S rDNA similarity matrix based on similarity coefﬁ cient of ampliﬁ ed bands for the selected Polygonaceae taxa species Po. equisetiforme Pe .lapathofolia Pe. salicifolia Pe. lanigera R. dentatus R. pictus E.spinosa Po. equisetiforme 1 Pe. lapathofolia 0.4 1 Pe. salicifolia 0.2 0.25 1 Pe. lanigera 0.2 0.25 1 1 R. dentatus 0.4 0.2 0.25 0.25 1 R. pictus 0.2 0.25 0.333 0.333 0.25 1 E. spinosa 0.5 0.25 0.333 0.333 0.667 0.333 1

Fig. 4. Cluster analysis dendrogram of the 5s-rDNA PCR based on the genetic similarity between the selected Polygonaceae taxa. Fig. 3. Gel-electrophoresis of 5S rDNA PCR amplifi ed bands. M: DNA ladder (100 bp- 3000 bp Axygen); Lans: 1. Po. equisetiforme; 2. Pe. lapathifolia; 3. Pe. salicifolia; Abd El-Twab, M. H.; Mekawy, A. M. and El-Katatny, M. S. 4. Pe. lanigera, 5. R. dentatus; 6. R. pictus and 7. E. spinosa 2008. Karyomorphological studies of species of Chrysan- themum senso lato in Egypt. Chromo. Bot. 3: 41-47. Abd El-Twab, M. H. and Zahran, F. A. 2008. Extracting total 100 bp and 80bp) and (400 bp, 120 bp and 100 bp) genomic DNA of Chrysanthemum sensu lato by CTAB respectively. However, Pe. lanigera, Pe. salicifolia, R. and SDS without both liquid nitrogen and phenol. Chrom. pictus and E. spinosa, produced 11.1% of two amplifi ed Bot. 3: 83-88. Al-Helai, A. A. 1996. Studies on germination of Rumex bands (450 bp and 100 bp), (475 bp and 100 bp) and (120 dentatus L. seeds. Journ. Arid Environ. 33: 39-47. bp and 100 bp) respectively. Al-Turki, T. A., Filfi lan, S. A. and Mehmood, S. F. 2000. A A dendrogram based on the genetic similarity of the 5S cytological study of fl owering plants from Saudi Arabia. Willdenowia 30: 339-358. rDNA was created (Fig. 4). Accordingly, the seven species Baltisberger, M. and Widmer, A. 2006. Chromosome numbers were divided into three main groups: group-1 has Po. of plant species from the Canary Islands. Bot. Helv., 116: equisetiforme as an out-group; group-2 Pe. lapathifolia; 9-30. Pe. salicifolia and Pe. lanigera; group-3 R. dentatus, R. Bir, S. S. and Sidhu, M. 1979. Cytological observations in weed fi ora of orchards of Paticla district, Punjab. Recent pictus and E. spinosa. According to cluster analysis which Res. Pl. Sci. (New Delhi). 7: 261-271. using the data matrix of the 5S rDNA molecular marker; Bir, S. S. and Sidhu, M. 1980. Cyto-palynological studies on the two main groups in the representative dendrogram weed fl ora of cultivable lands of Patiala district (Punjab). Journ. Palynol. 16: 85-105. might support the basic classifi cation on the generic level Boulos, L. 1999. Flora of Egypt. Cairo University. Vol. 1: 21-36. in subfamily Polygonoideae in Egypt, since Polygonum Bouwmeester, H. J. and Karssen, C. M. 1993. Annual changes was separated in an outer group, while Rumex and Emex in dormancy and germination in seeds of Sisymbrium were closely related and clustered with Persicaria species. offi cinale (L) Scop. New Phytologist 124: 179-191. Burke, J. M., Sanchez, A., Kron K. and Luckow, M. 2010. Placing the woody tropical genera of Polygonaceae: A ACKNOWLEDGEMENTS. We would like to present a great thank hypothesis of character evolution and phylogeny. Am. for Dr. Mohey Eldin K. Mohamed for his effort in the beginning of our Journ. Bot. 97: 1377-1390. work. We would like also to express our great appreciation to Dr. Magda Chaudhary, S. A. 1999. Flora of Kingdom Saudi Arabia. Mohamed Mehani for her cooperation and support. National Agriculture and Water Reasearch Center. Riyadh. Vol. 1: 304-320. LITERATURE CITED Chen, Q. F. 1999. A study of resources of Fagopyrum Abd El-Twab, M. H. and Kondo, K. 2002. Physical mapping (Polygonaceae) native to China. Bot. Journ. Linn. Soc. of 5S rDNA in chromosomes of Dendranthema by 130: 53-64. fl uorescence in situ hybridization. Chrom. Sci. 6: 13-16. Daniels, R. E., McDonnel, E. J. and Raybould, A. F. 1998. The 22 ABD EL-TWAB ET AL

current status of Rumex rupestris Le Gall (Polygonaceae) Michael, T. S., Bein, S. P. and Heriel, P. M. 1998. Dormancy in England and Wales, and threats to it survival and and germination, chapter 5. University of Natal, Durban, genetic diversity. Watsonia 22 : 33-30. South Africa; Petawawa Research Forest, Natural Davis, R. J. and Bowmer, R.G. 1966. Chromosome number in Resources Canada, Ontario, Canada. Volume 1: 149-176. Clytonia. Brittonia 18: 37-38. Mohamed, M. K. 1997. Chromosome counts in some fl owering Davis, P. H. 1967. Flora of Turkey. Edinburgh University plants from Egypt. Egypt. Journ. Bot. 37(2): 129-156. Press. Vol. 2, 265-294. Oyebanji, O. B., Nweke, O., Odebunmi, O., Galadima, N. B., Decraene, L. R. and Akeroyd, J. R. 1988. Generic limits in Idris, M. S., Nnodi, U. N., Afolabi, A. S. and Ogbadu, G. H. Polygonum and related genera (Polygonaceae) on the 2009. Simple, effective and economical explant-surface basis of fl oral characters. Bot. Journ. Linn. Soc. 98: 321- sterialization protocol for cowpea, rice and sorghum 371. seeds. African Journ. Biotech. 8: 5395-5399. Decraene, L. R.; Hong, S. P. and Smets, E. 2000. Systematic Probatova. 2005. Chromosome numbers of some dicotyledons signifi cance of fruit morphology and anatomy in tribes of the fl ora of the Amur Region. Bot. Žurn. (Moscow and Persicarieae and Polygoneae (Polygonaceae). Bot. Journ. Leningrad) 90: 779-792. Linn. Soc. 134: 301-337. Probatova, N. S. and Sokolovskaya, A. P. 1989. Chromosome Dempsey, R. E., Gornall, R. J. and Bailey, J. P. 1994. numbers in vascular plants from Primorye Territory, the Contributions to a cytological catalogue of the British and Amur region, Sakhalin, Kamchatka and the Kuril Islands. Irish fl ora, 4. Watsonia 20: 63-66. Bot. Žurn. (Moscow & Leningrad) 74: 120-123. Fiorini, G. and Raffaelli, M. 1996. Mediterranean chromosome Putievsky, E.; Weiss, P. W. and Marshall, D. R. 1980. Interspecifi c number reports 6 (705-715). Fl. Medit. 6: 278-288. hybridization between Emex australis and Emex spinosa. Hedberg, I. and Hedberg, O. 1995. The genus Colpodium Austral. Journ. Bot. 28: 323-328. (Gramineae) in Africa. Nord. J. Bot. 14: 601-607. Pye, A. and Andersson, L. 2009. Time of emergence of Rumex Hedberg, O. 1997. The genus Koenigia L. emend. Hedberg crispus L. as affected by dispersal time, soil cover and (Polygonaceae). Bot. Journ. Linn. Soc., 124: 295-330. mechanical disturbance. Acta Agric. Scandinavica, B 59: Hong, D. Y. 1990. Plant cytotaxonomy. Science Press, Beijing. 500-505. Hizume, M. 1993. Chromosome localization of 5s rDNA Queiros, M. 1983. Números cromossómicos para a Flora genes in Vicia faba and Crepis capillaries. Cytologia 58: Portugesa, 64-85. Bol. Soc. Brot. 56: 79-98. 417-421. Queiros, M. 1991. Números chromossómicos para a Flora Hu, Y. P., Xie, X. L., Wen, Q., Zhao, X. D., Wang, L. and Li, Portuguesa. 104-105. Bol. Soc. Brot., sér. 2, 64: 135-142. Y. 2007. Studies on karyotype of fve polulations of Rheum Raven, P. H. 1975. The bases of angiosperm phylogeny: tanguticum. Acta Bot. Yunnan. 29: 429-433. cytology. Ann. Missouri. Bot. Gard., 62: 724-764. Huziwara, Y. 1962. Karyotype analysis in some genera of Roberts, E. H. and Totterdell, S. 1981. Seed dormancy in Compositae VIII. Further studies on chromosomes of Rumex species in response to environmental factors. Aster. Amer. Journ. Bot. 49: 116-119. Plant, Cell and Environment 4: 97-106. Imai, H. T., Maruyama, T., Gojobori, T., Inoue, Y. and Crozier, Runemark, H. 1996. Mediterranean chromosome number R. H. 1986. Theoretical bases for karyotype evolution. 1. reports 6 (590-678). Fl. Medit. 6: 223-243. The minimum-interaction hypothesis. Am. Nat. 128:900- Simmonds, N. W. 1945. Biological fora of the British Isles. J. 920. Ecol., 33: 117-120. Imai, Y., Soda, M., Inoue H. et al. 2001. An unfolded putative Stebbins, G. L. 1971. Chromosome evolution in higher plants. transmembrane polypeptide, which can lead to Edward Arnold, London. endoplasmic reticulum stress, is a substrate of Parkin. Täckholm, V. 1974. Student Flora of Egypt. Cairo University. Cell 105 (7): 891-902. Ed. 2, 58-68. Kondo, K. Tanaka, R., Ge, S.; Hong, D. and Nakata, M. 1992. Talei, D., Saad, M. S., Yusop, M. K. and Valdiani, A. 2011. Cytologenetic studies on wild Crysanthemum senso lato Effect of different surface sterializers on seed germination in China. IV. Karyomorphological characteristics of three and contamination of Andrographis paniculata. American- species of Ajania. Jpn. Journ. Bot. 67: 324-329. Eurasian Journ. Agric. and Environ. Sci., 10 (4): 639-643. Lewis, W.H. 1970. Extreme instability of chromosome number Tanaka, R. 1959. On the speciation of karyotype in diploid and in Clytonia virginica. Taxon 19: 180-182. tetraploid species of Chrysanthemum boreale (2n=18). Levan A., Fredga K., and Sandberg, A. A. 1964. Nomenclature Journal of Science, Hiroshima University, Series B, for centromeric position on chromosomes. Hereditas 52: Division 2, 9: 1-16. 201-220. Vogt, R. and Aparicio, A. 1999. Chromosome numbers of Lifante, D. Z., Luque, T. and Bárbara, C. S. 1992. Chromosome plants collected during Iter Mediterranean IV in Cyprus. numbers of plants collected during Iter Mediterraneum II Bocconea 11: 117-169. in Israel. Bocconea 3: 229-250. Wolf, S. J. and McNeill, J. 1987. Cytotaxonomic studies on Long, E. O. and David, I. B. 1980. Repeated genes in Eukaryotes. Polygonum section Polygonum in Eastern Canada and Annual Rev. Biochem. 49: 727-764. adjacent United States. Canad. J. Bot. 65: 647-652. Martins, C. and Wasko, A. P. 2004. Organization and evolution Watanabe, K. 1977. The control of diploid-like meiosis in of 5S ribosomal DNA in fi sh genome. In: Williams CR polyploid taxa of Chrysanthemum (Compositae). Japanese (ed) focus on genome research Nova Science Publishers, Journ. Genet. 52: 124-131. Hauppauge, pp. 335-363. Xinmin, T., Lui, R., Tian, B. and Lui, J. 2009. Karyological Mao, Z. M., Yang, G. and Wang, C. G. 1983 Studies on chro- studies of Parapteropyrum and Atraphaxis (Polygonaceae). mosome number and anatomy of young branches of Institute of molecular ecology, Lanzhou University, Calligonum of Xinjiang in relation to the evolution of Lanzhou 7300000, Gansu, P. R. China. Vol. 62, 4: 261- some species of the genus. Acta Phytotax. Sin., 21: 44-48. 266 Meikle, R. D. 1985. Flora of Cyprus. In Meikle R. D. ed. Yilmaz, D. D. and Ahmet, A. 2007. Physiological effects of Bentham-Moxon Trust, Royal Botanic Gardens, Kew, different environmental conditions on the seed germination UK 2: 1398-1414. of Rumex scutatus L. (Polygonaceae). Erciyes Üniversitesi Metzger, J. D. 1992. Phsiological basis of achene dormancy in Fen Bilimleri Enstitüsü Dergisi 23 (1-2) 24-29. Polygonum convolvulus L. (Polygonaceae). Am. Journ. Zohary, M. 1981. Flora Palaestina. Jerusalem Academic Press. Bot. 79: 882-886. (Text) Vol. 1: 51-68.