Chromosome Botany (2012) 7: 17-22 © Copyright 2012 by the International Society of Chromosome Botany Karymorphological and molecular studies on seven species in Polygonoideae (Polygonaceae) in Egypt Magdy Hussein Abd El-Twab1, Ahmed M. Abdel-Hamid and Hagar Ata A. Mohamed Department of Botany and Microbiology, Faculty of Science, Minia University 61519, El-Minia City, Egypt 1Author for correspondence: ([email protected]) Received January 22, 2012; accepted February 29, 2012 ABSTRACT. Seven species in four genera of the Polygonoideae (Polygonaceae) in Egypt were subjected to karyomorphological and molecular studies in order to identify their chromosomal characteristics and investigate their phylogenetical relationships by the conventional staining method and the 5S rDNA PCR. Seed germination after treatment with low temperature stratifi cation and acidifi cation by concentrated H2SO4 was studied. Three rates of germination were obtained in response to the cold stratifi cation and acidifi cation: 1) High in Polygonum equisetiforme, Persicaria lanigera, Pe. lapathifolia and Pe. salicifolia; 2) low in Rumex dentatus; 3) no effect in R. pictus and Emex spinosa. Variation in the chromosome complements number, length and structure were detected for Po. equisetiforme (2n=58; new count); Pe. lanigera (2n=40; new count); Pe. lapathifolia (2n=22); Pe. salicifolia (2n=60); Emex spinosa (2n=18; a new count); Rumex dentatus (2n=40); and R. pictus (2n=18; a new count). Eighteen polymorphic bands of 5S rDNA were used to determine the similarities among the taxa with the similarity coeffi cient ranging between 0.2 and 0.67. KEYWORDS: Acidifi cation, Chromosomes, 5S rDNA, Polygonaceae, Stratifi cation. The Polygonaceae is cosmopolitic to temperate regions have been widely used to elucidate generic relationships (Täckholm 1974; Boulos 1999). The family is taxonomi- and circumscriptions (Stebbins 1971; Raven 1975; Hong cally divided into two subfamilies, Polygonoideae and 1990). Many karyological studies were performed in the Eriogonoideae. The subfamily Polygonoideae includes Polygonaceae species such as: Polygonum (Simmonds fi ve tribes: Calligoneae (Calligonum and Petroxygonum 1945), Fagopyrum (Chen 1999), Koenigia (Hedberg group), Fagopyreae (Fallopia group), Persicarieae 1997) Rumex (Baltisberger and Widmer 2006) and Rheum (Persicaria group), Polygoneae (Polygonum and (Hu et al. 2007). Atraphaxis group), and Rumiceae (Rumex and Emex In addition to karyological studies, molecular markers group) (Burke et al. 2010). There are 46 genera with 1100 provide a powerful tool in identifi cation and phylogenetic species in the world (Boulos 1999). In Egypt, the family is studies. In higher eukaryotes, the 5S ribosomal DNA (5S represented by 28 species belonging to seven genera, if rDNA) represents multiple copies of highly conserved Persicaria is considered as a section within Polygonum 120 base pairs coding sequences, separated from each (Davis 1967; Täckholm 1974; Zohary 1981; Meikle other by variable non-transcribed spacers (Long and 1985), or eight genera after they were separated into two David 1980). The 5S rDNA is considered a suitable genera (Boulos 1999; Chaudhary 1999). candidate for PCR-based genetic studies. It is highly The seed in stage is the most important stage in the life conserved even among distantly related species and cycle for survival of higher plants. In the Polygonaceae, consequently, it is possible to amplify the 5S rDNA the plants suffer from seed dormancy by unknown reasons repeats by PCR, even in the presence of poor DNA quality (Metzger 1992) and consequently they are diffi cult to and quantity due to their tandem nature and small size germinate in the laboratory. In conditions of natural (Martins and Wakso 2004). environment, those seeds germinate by seasonal fl uctuation The present study is conducted in order to: 1) study the of temperature (Roberts and Totterdell 1981; Pye and chromosome characteristics of seven species belonging to Andersson 2009) but light appeared to be not critical for four genera of the Polygonoideae (Polygonaceae) in germination (Bouwmeester and Karssen 1992). Dormancy Egypt; 2) compare their 5S rDNA PCR profi les; 3) and germination are natural mechanisms, by which the investigate the genetical relationship between Polygonum seed is often well equipped to survive extended periods of and Persicaria. unfavorable conditions, and the embryo is protected by one or several layers of tissues, which play an important MATERIALS AND METHODS part in the regulation of dormancy and germination Plant materials Polygonum equisetiforme Sibth., Persi- (Michael et al. 1998). caria lanigera (R. Br.), P. lapathifolia (L.) Delarbre, Pe. Karyological studies are considered of great importance salicifolia (Brouss. & Willd.) Assenov., Rumex denatus L., for taxonomical and evolutionary studies of plants and R. pictus Foessk and Emex spinosa (L.) Campd. (Table 1) 18 ABD EL-TWAB ET AL Table 1. Rate and duration of seed germination of the control and H2SO4 treated seeds of the selected Polygonaceae taxa Rate of seed germination Duration of seed Taxa germination Control (without acid) Conc. H2SO4 Po. equisetiforme 80% 0% 15 days E. spinosa 0% 60% 10 days R. dentatus 60% 98% 5 to 7 days R. pictus 0% 98% 5 to 7 days Pe. lanigera 60% 0% 15 days Pe. lapathifolia 85% 0% 30 to 35 days Pe. salicifolia 70% 0% 15 to 22 days were studied. Their plants at fl owering and fruiting stages ground tissue (500 mg) was transferred into 1.5 ml were collected in various regions in Egypt such as eppendorf tube and 650 μl of pre-warmed lyses buffer of Mediterranean, Eastern Desert and Nile Islands. 2% CTAB solution was added. Tubes were then incubated at 65 °C for about 1 - 1.5 h with gentle shaking every 10 Stoppage of seed dormancy The collected seeds were min. After centrifugation at 12,000 rpm for 10 min, the subjected to two different treatments; acidifi cation and supernatant was transferred into another tube, washed by low-temperature stratifi cation simultaneously. Seeds were a double volume of chloroform: isoamyl alcohol (24:1) fi rstly sterilized by soaking in diluted NaOCl at non- mixture with gentle vortexing for 10 min. washing was inhibitory concentration for 5 min (Oyebanji et al. 2009; repeated until the supernatant became completely clear. Talei et al. 2011), washed by sterilized distilled H2O, The supernatant was transferred to another tube and an treated by concentrated H2SO4 for 15 min and then washed equal volume of absolute ethanol was added and left on by running tap H2O for 30 min. Control seeds were planted ice for at least one hour to precipitate DNA strands. without treatment. Mature H2SO4-treated seeds were Suspension was then spun down to precipitate DNA in the planted in Petri dishes under different ranges of low form of pellet on the tube wall. Pellets were washed with temperatures; 2 °C for 20 h, 10 °C for 4 h and 25 °C for 24 70% ethanol and left to evaporate the excess of alcohol, h (Metzger 1992). eluted in 100 μl of either Tris-EDTA (TE) buffer or distilled water. Chromosomal preparation Seedlings ca 1 cm long were collected in the early morning, treated with 0.002 M Amplifi cation of 5S rDNA Amplifi cation of 5S rRNA 8-hydroxyquinoline for 4 h at 4 °C (Kondo et al. 1992; was conducted as described by Hizume (1993) and Abd Abd El-Twab et al. 2008), fi xed in freshly prepared acetic- El-Twab and Kondo (2002). Two primers were used: ethanol (1:3) at room temperature overnight, and then (forward) 5’- CGGTGCATTAATGCTGGTAT - 3’ and preserved in 70% ethanol. Preserved seedlings were (reverse) 5’- CCATCAGAACTCCGCAGTTA - 3’. The washed briefl y with distilled water and then hydrolyzed in PCR reaction mixture (20 μl) consisted of PCR-master a mixture of 1 N HCl-glacial acetic acid (2:1) at 60 °C for mix beads (Taq-polymerase, dNTPs, Tris-HCl (pH=9), 30-60 sec, followed by aceto-orcein squash technique. MgCl2 and KCl), 2μl of template DNA, 1.5 μl of each Root tips were subjected to 0.2% aceto-orcein solution for primer and free nuclease H2O. PCR was performed using 5:10 min, and then mounted on slides. Slides were Hybaid Thermal Cycler according to the following dehydrated and fi xed by quick freezing and fi nally program: one cycle for initial denaturation at 94 °C for 5 examined. Examination of slides was done by Zeiss min, 30 cycles of 94 °C for 45 sec, 56 °C for 45 sec and 72 microscope and photographs were taken by a microscope- °C for 45 sec. A fi nal extension step was performed for computer digital camera “Ulead explorer”. Some karyotype one cycle at 72 °C for 10 min. The PCR-products were criteria were measured from 2 to 3 chromosome always kept at 4 °C. The 5S rDNA amplifi cation products complements, which were the mean of total chromosome were separated onto 1.5% Agarose Gel, stained by 0.5 μg/ length (μm), chromosome form following Levan et al. ml Ethidium Bromide and visualized by UV light. (1964) and total form percent (TF %) following Huziwara Analysis was determined by variation in band numbers (1962). The TF % was used to evaluate the karyotype and sizes of 5S rDNA. Sizes of the amplifi ed bands were symmetry/asymmetry and the karyotypic relationship determined using DNA ladder (100 bp - 3000 bp Axygen). among species Calculation of the similarity matrix (Jaccard) and cluster analysis were done by PAST computer statistical Plant genomic DNA extraction Genomic DNA was program, that was used for hierarchical clustering analysis extracted by the CTAB method according to Abd El-Twab based on outweighed pair group method with arithmetic and Zahran (2008). Young fresh or sterilized dried leaves mean to generate a dendrogram and to describe were ground with liquid nitrogen to fi ne powder. The relationships among genotypes. KARYOMORPHOLOGICAL AND MOLECULAR STUDIES OF POLYGONACEAE IN EGYPT 19 RESULTS AND DISCUSSION with those of Metzger (1992) where treatment of seeds The effect of concentrated sulfuric acid and low temperature with concentrated sulfuric acid coupled with low treatments on the germination rates and durations of the temperature induced the germination of Polygonum and seven chosen Polygonoideae taxa is shown in Table 1.