Identification and Characterization of the Forkhead Box

Home , Fork head domain, FOXS1, Parasitic worm

IDENTIFICATION AND CHARACTERIZATION OF THE FORKHEAD BOX

FAMILY OF TRANSCRIPTIONAL REGULATORS IN PARASITIC

SCHISTOSOMES

MELISSA M. VARRECCHIA

Submitted in partial fulfillment of the requirements for the degree of

Doctor of philosophy

Department of Biology

CASE WESTERN RESERVE UNIVERSITY

August 2017

CASE WESTERN RESERVE UNIVERSITY

SCHOOL OF GRADUATE STUDIES

We hereby approve the dissertation of

Melissa M. Varrecchia

candidate for the degree of Doctor of Philosophy

Committee Chair

Michael F. Benard

Committee Member

Emmitt R. Jolly

Committee Member

Christopher A. Cullis

Committee Member

Claudia M. Mizutani

Committee Member

Brian M. McDermott

Date of Defense

June 6, 2017

*We also certify that written approval has been obtained

for any proprietary material contained therein.

Dedication

I would like to dedicate this dissertation to my Mom and Dad. Mom, thank you for your

endless love, support and encouragement throughout the years. Dad, I miss you and I

know that you are with me always, cheering me on in spirit.

iii

Table of Contents

Table of Contents………………………………………………………………………...1

List of Tables……………………………………………………………………………..6

List of Figures…………………………………………………………………………....8

Acknowledgements…………………………………………………………………..…11

List of Abbreviations…………………………………………………………………...13

Abstract…………………………………………………………………………………15

Chapter 1: Introduction………………………………………………………………..17

1.1 Schistosomiasis………………………………………………………………17

1.2 Pathogenesis and treatment…………………………………………………..18

1.3 Schistosome life cycle………………………………………………………..20

1.4 Schistosome morphology and development…………………………………21

1.5 Forkhead box transcription factors…………………………………………..23

1.6 Fox family subclasses and development………………………………….….25

1.7 Forkhead box genes in parasites……………………………………………..26

1.8 Thesis aims and significance……………………………………………...... 29

Chapter 2: Schistosome Fox genes: SmFoxA-SmFoxG……………………………...31

2.1 Materials and methods……………………………………………………………..31

2.1.1 Animals and parasites……………………………………………………...31

2.1.2 Bioinformatics……………………………………………………………...31

2.1.3 Cloning and sequencing………………………………………………...... 33

2.1.4 Yeast transformation and modified yeast one-hybrid……………………...34

2.1.5 Absolute quantitative PCR……………………………………………...... 36

2.2 Results……………………………………………………………………………….37

2.2.1 Schistosomes have forkhead genes from several subclasses of the Fox

family of transcription factors …………………………………………………...37

2.2.2 Schistosome forkhead transcripts are developmentally regulated………....45

2.2.3 Schistosome forkhead proteins are transcriptional regulators……………..48

2.3 Supplementary information………………………………………………………..53

2.3.1 Supplementary figures……………………………………………………..53

2.3.2 Supplementary tables………………………………………………………55

Chapter 3: Schistosome Fox genes: SmFoxJ-SmFoxP……………………………….60

3.3 Materials and methods……………………………………………………………..60

3.1.1 Animals and parasites……………………………………………………...60

3.1.2 Bioinformatics…………………………………………………….………..60

3.1.3 Cloning and Sequencing…………………………………………………...61

3.1.4 Yeast Transformation and Modified Yeast One-hybrid…………………...63

3.1.5 Absolute quantitative PCR…………………………………………………64

3.2 Results……………………………………………………………………………….65

3.2.1 Several subclasses of the Fox family of transcriptional regulators were

identified in schistosome worms…………………………………………………65

3.2.2 Developmental regulation of schistosome forkhead transcript

expression………………………………………………………………………..72

3.2.3 Schistosome forkhead proteins regulate transcription……………………..75

3.3 Supplementary Information…………………………………………………….....82

3.3.1 Supplementary figures……………………………………………………..82

3.3.2 Supplementary tables………………………………………………………85

Chapter 4: Discussion and future directions……………………………….…………93

4.1 Discussion…………………………………………………………………………...93

4.2 Future directions…………………………………………………………………..108

4.2.1 Are schistosome Fox genes required for survival at each stage of

developmental expression?...... 108

4.2.2 Where is expression of Fox proteins localized in different developmental

stages of the life cycle?...... 109

4.2.3 What are the upstream regulators and downstream targets

of SmFox genes?...... 109

Appendix: Immunolocalization of anti-Hsf1 to the acetabular glands of infectious schistosomes suggests a non-transcriptional function for this transcriptional activator…………………..……………………………………………………………111

5.1 Abstract…………………………………………………………………………….112

5.2 Author Summary………………………………………………………………….113

5.3 Introduction………………………………………………………………………..114

5.4 Materials and Methods……………………………………………………………117

5.4.1 Animals and parasites…………………………………………………….117

5.4.2 Preparation of schistosomal RNA………………………………………...117

5.4.3 Cloning……………………………………………………………………118

5.4.4 Yeast transformation and modified yeast one-hybrid…………………….118

5.4.5 Electrophoretic mobility shift assay (EMSA)…………………………….119

5.4.6 Comparison of protein sequences………………………………………...120

5.4.7 Quantitative reverse transcriptase polymerase chain

reaction (qRT-PCR)…………………………………………………………….121

5.4.8 Recombinant protein purification………………………………………...122

5.4.9 Custom antibody production……………………………………………...122

5.4.10 Western blotting…………………………………………………………123

5.4.11 Immunohistochemistry………………………………………………….124

5.4.12 Imaging………………………………………………………………….125

5.5 Results……………………………………………………………………………...125

5.5.1 Schistosome Hsf1 is a transcriptional activator…………………………..125

5.5.2 SmHsf1 recognizes the heat shock DNA binding element from the

schistosome HSP70 promoter…………………………………………………..128

5.5.3 SmHSF1 is expressed across schistosome developmental stages……...... 132

5.5.4 A polyclonal antibody detects the SmHsf1 protein………………………133

5.5.5 Antibody raised against SmHSF1 localizes to the acetabular

glands of S. mansoni cercariae………………………………………………….135

5.6 Discussion………………………………………………………………………….137

5.7 Acknowledgements………………………………………………………………..141

5.8 Supplementary Information……………………………………………………...142

Bibliography…………………………………………………………………………...144

List of Tables

Table 2.1 Summary of blastp pairwise alignments of schistosome Fox protein DBDs

(SmFoxA1-SmFoxG) and orthologs from mouse, fly, and roundworm…………………44

Table 2.2. Summary of SmFox yeast one-hybrid results………………………………..52

Supplementary Table 2.1. Databases and gene ID for forkhead homologs used in

phylogenetic analysis…………………………………………………………………….55

Supplementary Table 2.2. Schistosome Forkhead gene ID numbers and oligonucleotide

sequences used for Infusion cloning into the pGBKT7 vector…………………………..57

Supplementary Table 2.3. One-step RT-PCR reaction conditions used for cloning……58

Supplementary Table 2.4. Phusion PCR reaction conditions used for cloning…………59

Supplementary Table 2.5. Oligonucleotides used for absolute quantitative

PCR analysis……………………………………………………………………………..59

Table 3.1. Summary of blastp pairwise alignments of schistosome Fox protein DBDs

(SmFoxJ1-SmFoxP) and orthologs from mouse, fly, and roundworm…………………..71

Table 3.2. Summary of schistosome forkhead yeast one-hybrid results………………...81

Supplementary Table 3.1. Databases and accession numbers for forkhead homologs used in phylogenetic analysis………………………………………………………………….85

Supplementary Table 3.2. Gene ID numbers, plasmid names, and primers used for cloning schistosome forkhead genes……………………………………………………..88

Supplementary Table 3.3 Phusion PCR reaction conditions for cloning………………...90

Supplementary Table 3.4. One-step RT-PCR reaction conditions for cloning………….91

Supplementary Table 3.5. Primer sequences used for absolute quantitative

PCR analysis……………………………………………………………………………..92

Table 4.1. Summary of SmFox yeast one-hybrid results………………………………106

Table S5.8.1. Names and sequences of oligonucleotides used for EMSA……………..142

List of Figures

Figure 1.1. Global distribution of schistosome species infective to man………………..17

Figure 1.2. Life cycle of the schistosome worm, a parasitic trematode…………………21

Figure 1.3. The forkhead DNA binding domain of HNF-3 is similar in

structure to histone H5………………………………………………………………….. 25

Figure 1.4. The insulin signaling pathway is conserved among a variety of organisms...28

Figure 2.1. Yeast expression vector pGBKT7 (Clontech, Mountain View, CA)……….34

Figure 2.2. Schematic of modified yeast one-hybrid……………………………………35

Figure 2.3 Schematic of SmFoxC isoforms……………………………………………...40

Figure 2.4. Phylogenetic analysis of schistosome Fox protein subclasses SmFoxA-

SmFoxG………………………………………………………………………………….43

Figure 2.5. Schistosome forkhead gene expression varies during different stages of development……………………………………………………………………………...47

Figure 2.6. Schistosome forkhead transcription factors differ in ability to drive reporter gene expression in a yeast 1-hybrid analysis…………………………………………….50

Supplementary Figure 2.3.1. Yeast 1-hybrid analysis of SmFoxC isoforms…………….53

Supplementary Figure 2.3.2. X-Alpha-Galactosidase assay plates for yeast-1 hybrid analysis…………………………………………………………………………………...54

Figure 3.1 Schematic of SmFoxK2 isoforms…………………………………………….67

Figure 3.2 Phylogenetic analysis of schistosome Fox protein subclasses SmFoxJ-

SmFoxP…………………………………………………………………………………..70

Figure 3.3. Schistosome forkhead genes are expressed across several stages of the life cycle……………………………………………………………………………………...74

Figures 3.4A and 3.4B. Several schistosome forkhead proteins are transcriptional

activators…………………………………………………………………………………78

Supplementary Figure 3.3.1. Yeast 1-hybrid analysis of SmFoxK2 isoforms…………..82

Supplementary Figure 3.3.2A. X-Alpha-Galactosidase assay plates for yeast-1 hybrid analysis…………………………………………………………………………………...83

Supplementary Figure 3.3.2B. X-Alpha-Galactosidase assay plates for yeast-1 hybrid analysis…………………………………………………………………………………...84

Figure 4.1. Phylogenetic analysis of all schistosome forkhead genes…………………...96

Figure 5.1. SmHsf1 can drive transcription in a modified yeast one-hybrid system…...127

Figure 5.2. SmHsf1 binds the heat shock binding element from the schistosome HSP70 promoter…………………………………………………………..130

Figure 5.3. Phylogram of SmHsf1………………………………………………………131

Figure 5.4. SmHSF1 is expressed across several schistosome life-cycle stages………..132

Figure 5.5. The SmHsf1 antibody recognizes the SmHsf1 protein……………………..134

Figure 5.6. SmHsf1 is localized to the acetabular glands in S. mansoni cercariae……..136

Figure 5.7. Antibody raised against SmHsf1 localizes to the acetabular glands extending the entire length of the S. mansoni cercarial head……………………………………...137

Figure S5.8.1. MBP antibody recognizes the MBP-SmHsf1 fusion protein…………...142

Movie S5.8.1. Anti-SmHsf1 antibody is localized to the cercarial head……….………142

Movie S5.8.2. DAPI staining of the cercarial head…….………………………………142

Movie S5.8.3. Anti-SmHsf1 and DAPI staining in the cercarial head…….……………142

Movie S5.8.4. Rotational view of the cercarial head showing anti-SmHsf1 localization...... 143

Movie S5.8.5. Rotational view of the cercarial head stained with DAPI………………143

Acknowledgements

I am grateful to a number of individuals without whose support the completion of this project and dissertation would not have been possible. First of all, thank you to my advisor, Dr. Emmitt Jolly, who took a chance on a student who was returning to school after several years. You have been an amazing mentor, and though I have been blessed

over the years with great advisors and teachers, I have grown the most as a scientist under your guidance. Thank you for providing an environment that allows students to become independent and encourages discussion and scientific debate. And thank you for always

pushing me to realize my potential and not letting me stay stuck in my head; for pressing

me to always move forward. Navigating this journey would not have been possible

without your continued support. I would also like to thank my thesis committee

members: Dr. Christopher Cullis, Dr. Claudia Mizutani, and Dr. Brian McDermott for

their time, encouraging words, and helpful comments on this project.

Thank you to the past and present members of the Jolly lab. I have been lucky to

be part of a team of individuals who are always there to support one another, to celebrate the accomplishments and empathize during the bumps in the road. Your support over the

years has meant a great deal. I also want to thank Stephanie Chinchen, Alissa Prior, and

Gregory Chang for their work as undergraduates on the cloning of schistosome forkhead

genes. I enjoyed working with each of you and thank you for all of your hard work.

I would like to thank the Department of Biology for its continued support over the years, from the time I was a research assistant, through my transition to a graduate student and through completion of my doctorate. In particular, I would like to extend a

11 special thank you to Julia Brown for your endless support, encouragement and counsel over the years. You have always been there to listen and help and it has been greatly appreciated. I would also like to acknowledge and thank the many friends I have made throughout the years from the department: Deb Harris, and fellow graduate students,

Cory Bickel, Ph.D. and Kathy Krynak, Ph.D. Thank you all for always being there. We have enjoyed many good times and I know all of you will remain lifelong friends. To my friends Nasmah Bastaki, Ph.D. and LaToya Strickland, whom I also met during my time at Case, we met as fellow students, but over the years have become sisters. I love you both and could not ask for better friends. Thank you for being the wonderful people you are. And to all my friends from Hiram, you have been by my side for two decades! Thank you for always making me laugh, for your support over the course of this journey, and for making me a part of your extended families.

Lastly, to my family, I want to express how grateful I am to have you. To my mom, thank you for all your love and support and telling me to never quit. To my sister,

Kristy, thank you for the countless pep talks and for telling me I can succeed in any endeavor. You both have been there for me every step of the way and I love you both.

To my dad, completing this journey has been bittersweet without you here. I love you and miss you every day.

List of Abbreviations

3-Amino-1,2,4-triazole (3-AT)

5-Bromo-4-chloro-3-indolyl-α-D-galactopyranoside (X-α-Gal)

Amino acid (aa)

Base pair (bp)

Caenorhabditis elegans (C. elegans, Ce)

DNA binding domain (DBD)

Drosophila melanogaster (D. melanogaster, Dm) fork head (fkh)

Forkhead Associated Domain (FHA) hepatocyte nuclear factor 3α (HFN-3α)

Kilobase (kb)

Microgram (µg)

Micrometer (µm)

Millimeter (mm)

Millimolar (mM)

Mus musculus (M. musculus. Mm)

Nanogram (ng)

No reverse transcriptase (NoRT)

No template control (NTC)

Polymerase chain reaction (pcr)

Rapid amplification of cDNA ends (RACE)

Saccharomyces cerevisiae (S. cerevisiae, Sc),

Schistosoma haematobium (S. haematobium)

Schistosoma japonicum (S. japonicum)

Schistosoma mansoni (S. mansoni, Sm)

Schistosomula (sla)

SD-histidine (SD-His)

SD-tryptophan (SD-Trp)

Synthetic dextrose (SD)

Identification and Characterization of the Forkhead Box Family of Transcriptional

Regulators in Parasitic Schistosomes

Abstract

MELISSA M. VARRECCHIA

Schistosomiasis is a disease of global scale with more than 240 million people infected and more than 700 million people at risk of infection. Historically, treatment of this disease has been with one primary drug, praziquantel. Due to this, concern for resistance developing in the parasitic worms that cause this disease has risen. The three species of blood flukes responsible for the majority of the schistosomiasis disease burden are Schistosoma mansoni (S. mansoni), S. japonicum, and S. haematobium. These trematodes have a complex life cycle in which they undergo distinct morphological changes during the transitions from free-swimming to invertebrate and vertebrate host stages. The molecular factors and mechanisms which regulate their development during these metamorphoses are widely unknown. A better understanding of the basic biology of these worms and the factors which drive their development will be critical in the process of identifying new treatment targets or developing preventative measures.

Forkhead Box (Fox) proteins, are a family of transcription factors that play key roles in a variety of biological processes including development, metabolism, stress tolerance, and lifespan and have been identified in a number of organisms. The major goal of this thesis is to identify and characterize the complement of forkhead box genes found in the S.

15 mansoni genome. Here, we have identified 15 Fox genes, two with multiple isoforms, which were classified into 11 classes (SmFoxA, SmFoxC, SmFoxD, SmFoxF, SmFoxG,

SmFoxJ, SmFoxK, SmFoxL, SmFoxN, SmFoxO, and SmFoxP) using bioinformatics and a phylogenetic comparison to mouse, fly, nematode, and yeast forkhead proteins.

Additionally, the expression pattern during the sporocyst, cercarial, 4h schistosomula, and adult stages was determined for each gene using absolute quantitative PCR. To test functionality, SmFox-GAL4 DBD fusion proteins were tested in a modified yeast one- hybrid to determine their ability to activate transcription of the reporter genes HIS3 and

MEL1. We determined 12 schistosome Fox proteins are transcriptional activators, though the level of activation varied between proteins and between isoforms of the same protein.

This project lays a foundation for the study of schistosome Fox transcription factors and their potential roles in schistosome development.

Chapter 1. Introduction

1.1 Schistosomiasis

More than 700 million people are at risk of infection in the 78 countries with

endemic populations of schistosomes which infect humans, and of those 240 million

people are infected [1, 2]. There are six species of schistosomes which infect humans,

causing human schistosomiasis, including Schistosoma mansoni (S. mansoni), S.

japonicum, S. haematobium, S. intercalatum, S. mekongi, and S. guineensis. Of these, S.

mansoni, S. japonicum, and S. haematobium account for the greatest number of infections

and have the greatest global distribution (Figure 1.1, [3]). S. mansoni is prevalent in

Africa, the Middle East, South America and the Caribbean. S. haematobium is found

predominantly in Africa and the Middle East and S. japonicum in China, Indonesia and

the Philippines. Its estimated that infections in Africa alone account for >90% of infections [4, 5].

Figure 1.1. Global distribution of schistosome species infective to man. (From Colley

et al, [3, 6]) with permission from Elsevier (see references for licensing information).

Schistosomiasis is a disease of poverty where poor sanitation and exposure to

feces and urine in bodies of water used for drinking, bathing, washing, fishing and play

are the largest contributing factors. These bodies of water are also home to the aquatic

snail intermediate hosts, of the generas Biomphalaria (S. mansoni), Bulinus (S. haematobium), and Oncomelania (S. japonicum) [7]. School-aged children are often the most at risk and have the greatest susceptibility to infection [3].

1.2 Pathogenesis and treatment

There are two forms of schistosomiasis, intestinal and urogenital [8, 9]. The intestinal form is caused by S. mansoni, S. japonicum, S. intercalatum, S. mekongi, and S. guineensis. S. haematobium is the causal agent of urogenital schistosomiasis.

Pathogenesis of this disease is not due to infection with the worms themselves, but rather is due to the immune reactions to eggs that fail to exit the body. These eggs become lodged in the hepatic portal system, liver or bladder tissue and the host’s immune system targets these eggs [9]. The disease can manifest symptoms in both acute and chronic phases. However, it should be noted that most cases are asymptomatic. The acute phase is most often seen in people who are not native to endemic regions, such as travelers [10].

This phase is also known as Katayama syndrome. The initial symptoms can include a rash, known as swimmer’s itch, due to cercarial penetration. Later symptoms, similar to an allergic reaction, are likely due to the presence of worms and deposition of eggs, and include fever, fatigue and cough [10]. Due to the commonality of symptoms, it may not

be readily diagnosed. Diagnosis is often confirmed by presence of eggs in stool or urine

and treatment includes antihelminthics, such as praziquantel.

The chronic phase of the disease occurs due to untreated infection or long-term reinfection. Schistosome worms live several years on average, and females deposit large quantities of eggs daily [7, 11-13]. As the host’s immune system reacts to eggs which have become lodged, granulomas form around the eggs, and eventually the surrounding tissue becomes fibrotic [9]. In intestinal schistosomiasis symptoms include diarrhea, abdominal discomfort and bloody stool. Symptoms of urogenital schistosomiasis include bloody urine, calcification of the urinary tract, and secondary bacterial infections [8, 9].

Additional long-term effects include anemia and malnutrition. Diagnosis of chronic schistosomiasis is also by presence of eggs in the urine or feces [8, 9].

The primary drug used to treat schistosomiasis is praziquantel [14]. Benefits of this drug include efficacy in clearing infection and it is inexpensive. However, there are also drawbacks. These include its limited potency against only the adult worms, and not

to other developmental stages, and its predominance as the primary treatment for

schistosome infection for several decades, with evidence of drug tolerance in the lab and

the field [15-18]. For these reasons, it is critical to have a firmer grasp of the basic

biology of these parasites, particularly during the early stage of infection, in order to

effectively treat all stages of infection, perhaps prevent infection, and to define new

targets for drug treatment.

1.3 Schistosome life cycle

The life cycle of parasitic schistosomes involves several environmental and complex morphological changes (Figure 1.1,(from [19])). The human definitive host encounters the free-living cercarial stage in freshwater ([7, 20]. As the cercariae burrow into the host’s skin, they shed and leave behind their tails, transitioning into the juvenile worm stage, schistosomula. Within 1-2 days schistosomula traverse the skin and enter the hosts circulatory system, and once in the bloodstream, migrate to the lungs within approximately 1-2 weeks post infection. After leaving the lungs, the dioecious worms undergo another migration, and move into the liver, an environment in which they rapidly grow, and form mating pairs. Adult schistosomes are sexually dimorphic. The slender, elongated females reside within the gynecophoral canal, a ventral groove, of the larger, more muscular male. Once paired, adults undergo a final migration to either the mesenteric veins of the intestines or the venous plexus of the bladder, the final destination dependent on species (S. mansoni and S. japonicum, intestinal and S. haematobium, urinary). Females begin laying eggs, hundreds to thousands a day

(depending on species), which traverse to the lumen of the intestines or bladder, where they pass from the host into fresh water. As the eggs encounter fresh water, they hatch releasing miracidia, ciliated free-swimming larvae, that are infective to freshwater snails, the intermediate host. After invading the snail host, miracidia develop into a mother sporocyst which then produces daughter sporocysts. Sporocysts mass produce the next infective larval stage, cercariae, by asexual embryogenic reproduction. Cercariae are then shed from the snail into water, where they are viable and infective for up to two days

[7, 20].

Figure 1.2. Life cycle of the schistosome worm, a parasitic trematode (Reprinted without change from Collins and Newmark in [19]).

1.4 Schistosome morphology and development

During its complex life cycle, parasitic schistosomes undergo several morphological transitions. The molecular mechanisms which regulate these transitions,

most importantly during the time between definitive host invasion and becoming adults,

are widely unknown. Schistosomes undergo embryogenesis at two points, once in the

developing egg during formation of the miracidia, and again during the formation of

cercariae within the sporocyst. Schistosomes are acoelomates, but have a number of

defined organ systems, including a blind gut, nervous, reproductive and excretory

systems.

Development of the ciliated miracidium, occurs inside the egg between the time

the egg is laid by the female and the several days it takes the egg to exit the vertebrate

host and reach water [21]. The sporocyst stage is a point in development when mass

production, by the sporocyst, of the larval cercaria takes place within the snail host.

Cercaria are ~300-400 µm in length, and are equipped for penetration of the vertebrate

host and subsequent development into schistosomula, then adult worms. They have a

muscular head and tail, the latter of which is lost during transformation to the

schistosomula stage after skin penetration. Within the cercarial head are an orthogonal

nervous system with a pair of central ganglia and peripheral nerve cords which run

longitudinally and have transverse connections and a primitive excretory system, the

protonephridia which consists of 5-6 pair of flame cells and ducts [7, 20, 22, 23]. Though gut and reproductive anlagen are also present at this stage, they are nonfunctional until maturation of these organ systems during morphogenesis of the juvenile worm into adults within the vertebrate host [7].

While early schistosomula are phenotypically similar to cercaria with the exception of loss of the tail, extensive changes in phenotype occur during the transition from the schistosomula to adult stage. With the loss of the cercarial tail, schistosomula

are ~150 µm in length, while the adult male is 10-15 mm and the adult female is ~20 mm

[20]. Additionally, schistosome adults are sexually dimorphic, with the males having a robust muscular phenotype and a ventral groove, the gynecophoral canal, in which the slender and elongated female resides. Schistosomes feed on the red blood cells of the vertebrate host and have a blind gut/caecum that extends from the anterior mouth, to a muscular esophagus (schistosomes do not have a pharynx) that then bifurcates around the ventral sucker and reproductive organs, before joining into a single blind sac which extends to the posterior region [7, 20, 24-26]. In adults, the protonephridial system (or excretory system) is extensive and extends throughout the parenchyma [7, 20, 23].

1.5 Forkhead Box transcription factors

Transcription factors are proteins which play a variety of roles in regulation of organismal development and often, development of disease. One such group, the

Forkhead Box (Fox) family, identified by their conserved DNA binding domain (DBD), are a class of transcription factors which regulate target genes involved in a number of diverse biological processes, including development, metabolism, lifespan, and disease

[27-29]. The first member of the family to be identified, the Drosophila gene, fork head

(fkh), was named after the mutant phenotype, in which development of an ectopic head was observed [30]. This was followed by the identification of a second, vertebrate transcription factor, hepatocyte nuclear factor 3α (HFN-3α) in the liver of rats [31]. Both fkh and HFN-3α were determined to share high homology in a novel, conserved DBD, the fork head domain [32]. Since then, a vast number of forkhead genes have been identified in a variety of organisms, including yeast, invertebrates and vertebrates, though they have yet to be found in plants. Due to the number of organisms in which forkhead

genes have been identified, a common nomenclature was developed for naming them.

The common Fox (forkhead box) is used to denote family, followed by a letter (A-S) to

assign a subclass, which is then followed by a number if there is more than one member

of a subclass identified[33]. Both the number, and complement of Fox genes present,

varies by organism. Saccharomyces cerevisiae (S. cerevisiae), Drosophila melanogaster

(D. melanogaster), Caenorhabditis elegans (C. elegans), and the vertebrate, Mus musculus (M. musculus) have 4, 17, 15 and 44 family members, respectively [34-39].

While forkhead proteins are classified as part of the Fox family based on a highly

conserved DBD, they are phylogenetically grouped into subclasses based on some

sequence differences within this conserved region [33, 40, 41]. The 80-110 amino acid

DBD of forkhead proteins has a winged helix structure consisting of three α-helices, 3 β-

sheets, and 2 loops or wings and, for most forkhead proteins, binds DNA as a monomer

(Figure 1.3, from [42]). Though there is little homology outside of the DBD between

family members, some subclasses do have additional shared characteristics [43-45].

These include features such as the Forkhead Associated Domain (FHA) and a coiled-coil

domain, both important in protein-protein interactions [43-45]. These domains, however,

are not restricted to Fox proteins.

Figure 1.3. The forkhead DNA binding domain of HNF-3 is similar in structure to

histone H5 (Reprinted by permission from Macmillan Publishers, Ltd: Nature [42], copyright (1993), http://www.nature.com/nature/index.html.)

1.6 Fox family subclasses and development

Numerous roles for Fox transcription factors in organismal development have

been determined. The FoxA subclass are developmentally early transcription factors and

are commonly referred to as “pioneer” factors for their ability to open condensed

chromatin for additional transcription factors [46, 47]. This group has also been shown to

inhibit gene expression. FoxA homologs in both Drosophila and mice inhibited activity

of downstream targets in developing salivary glands and midbrain, respectively [48, 49].

In C. elegans pha-4 regulates development of the pharynx.

The FoxF subclass regulates differentiation of mesodermal tissues in a variety of

organisms. In C. elegans, Let-381/FoxF, regulates differentiation of coelomocytes,

scavenger cells of mesodermal origin [50]. And in Drosophila, bin/foxf regulates

visceral mesoderm development and formation of the midgut.[51, 52], In sea urchin

FoxF regulates development of the circumesophageal muscle of the foregut [53].

Through its FHA domain, FoxK has been shown to interact with a number of proteins, including SRF, a Mads Box protein, leading repression of smooth muscle α-actin and with Sin3 in myogenic progenitor cells [54, 55]. FoxC homologs are required during pharyngeal, cardiovascular and kidney development, and directly activate the genes

Tbx1, DII4, and Hey2 [56-58]. FoxJ specializes in regulating differentiation of ciliated cells, including lung epithelium in mice and ciliated nodal cells that direct left-right patterning in zebrafish, xenopus, mouse and sea urchin [59-62].

1.7 Forkhead box genes in parasites

Due to their importance in both human and livestock health, understanding the molecular mechanisms underlying the growth and development of parasites is essential.

As regulators of development, metabolism, and lifespan, forkhead box transcription factors, and in particular, FoxO, have been the subject of studies in parasite biology. To date, however, these studies have been limited predominantly to parasitic nematodes

(roundworms) and insects.

In the free-swimming and non-parasitic nematode, C. elegans, the conserved insulin signaling pathway and its downstream target, DAF-16 (FoxO) has been thoroughly described (Figure 1.4) [63-71]. When the insulin receptor is activated by ligand binding in favorable environmental conditions, the transcription factor DAF-16 is negatively regulated via post-translational modifications through the insulin signaling pathway, and the worms continue to develop into adults [63-70]. However, in unfavorable environmental conditions in which insulin signaling is downregulated, larva

enter an alternative larval stage, the dauer stage, in which DAF-16 function is uninhibited, and in turn, can activate target genes in response to environmental stress.

Parasitic nematodes enter an infective third larval stage (iL3) prior to infection of the definitive host [20]. To investigate whether the arrested development of the iL3 stage is regulated similarly to the C. elegans dauer stage by insulin signaling, FoxO homologs from several parasitic nematodes, Strongyloides stercoralis (fktf-1), Ancylostoma caninum (Ac-daf-16), Angiostrongylus cantonensis (Acan-daf-16), and Haemonchus contortus (Hc-daf-16.1 and Hc-daf-16.2) have been identified and described [72-75]. In complementation assays which used a daf2:daf16 C. elegans mutant which does not develop a dauer stage, worms expressing FoxO isoforms from S. stercoralis (FKTF-1b),

A. cantonensis (Acan-DAF-16a and Acan-DAF-16b), and H. contortus (Hc-DAF-16.2), the dauer phenotype was rescued, indicating similar regulation of the parasitic nematode

FoxO homologs through insulin signaling [74-76]. In another study, S. stercoralis larva transformed with mutant fktf-1 transgenes were stunted in growth and failed to survive past the L1 stage due to changes in intestinal cell formation [77]. L3 larva transformed with a dominant-negative fktf-1 transgene failed to undergo arrest to iL3 indicated by discontinued development of the intestine and pharynx [77].

Figure 1.4. The insulin signaling pathway is conserved among a variety of organisms. Reprinted from [71]. See reference for copyright licensing information.

Phylogenetic analyses of Fox genes have also been carried out in the mosquitos

Anopholes gambiae (A. gambiae), a vector for Plasmodium falciparum the causative agent of malaria, and Aedes aegypti (Ae. aegypti), a vector for the yellow and dengue fever viruses [20]. In a phylogenetic analysis of invertebrate Fox genes, 12 forkhead subclasses comprised of 20 genes were identified in the A. gambiae genome [40]. In another study, 18 Fox genes, representing 13 subclasses were identified and classified in

Ae. aegypti [78]. In the same study, 6 forkhead genes were found to be expressed in the fat bodies (important for production of yolk during egg production), of female mosquitos

and individual knockdown of 4 of these genes (FoxL, FoxN1, FoxN2, and FoxO), resulted in a decrease in egg production and downregulation of the vitellogenin gene, Vg

[78]. In another study, knockdown of cfoxo in Culix pipiens (C. pipiens), the West Nile

Virus mosquito vector, resulted in loss of lipid stores and reduced survival of females in diapause [79].

1.8 Aims and significance

As parasitic organisms with a devastating effect on global health, and with only one current and predominant mode of treatment, its crucial to investigate and better understand the basic biology of schistosomes in order to develop new preventative measures and treatments. These flatworms have a complex life cycle spanning free swimming stages and invertebrate and vertebrate hosts. The molecular factors which regulate the morphological transitions these parasites have evolved to adapt and thrive within their changing and starkly diverse environments are just beginning to be identified and defined. The current study was designed to begin to better understand a family of potential regulators of development during these transitions, the Forkhead Box proteins, and to start laying a foundation for the study of this group of transcription factors, in schistosomes. To our knowledge, this is the first comprehensive identification and characterization of Fox genes in a parasitic worm.

The first aim of the study was designed to determine how many and which

subclasses of Fox genes were present. To accomplish this we used bioinformatics,

cloning, sequencing and a phylogenetic analysis of identified genes. Because

schistosomes have several complex developmental stages, we predicted that schistosome

29 forkhead genes, as potential regulators of development in this organism, would have varied levels of expression throughout the life cycle. To test this, the second aim of the study examined the expression level of each schistosome forkhead family member across several stages of development using absolute quantitative PCR. The final aim in the characterization of schistosome forkhead genes was to test the functionality of the identified Fox proteins. As transcription factors, these proteins are expected to be able to activate or repress target gene expression. We used a heterologous yeast system and a one hybrid approach to test the functionality of the identified schistosome forkhead proteins.

Our identification and characterization of schistosome forkhead genes is an important step in beginning to unravel the transcriptional pathways that are involved in regulation of schistosome development throughout their life cycle and contributes to the greater knowledge of the basic biology of this parasitic flatworm.

Chapter 2. Schistosome Fox genes: SmFoxA-SmFoxG

2.1 Materials and methods

2.1.1 Animals and parasites

Snails (Biomphalaria glabrata-NMRI strain) infected with Schistosoma mansoni

(NMRI strain, NR-21962), were obtained from the NIAID Schistosomiasis Resource

Center of the Biomedical Resource Institute (Rockville, MD). The sporocyst stage of the

S. mansoni life cycle was harvested by dissection from infected snails ~5 ½ weeks post

infection. Cercariae were shed, transformed, and schistosomula maintained in culture

with complete RPMI (RPMI, 5% fetal bovine serum, and 1X pen/strep), as previously

described ([80]). Upon collection, samples were stored in TRIzol (Invitrogen, Carlsbad,

CA) or snap-frozen in liquid nitrogen as a pellet and then stored at -80 oC.

2.1.2 Bioinformatics

To identify putative schistosome forkhead proteins, a Blastp analysis was

conducted using the full-length Caenorhabditis elegans (C. elegans) FoxO homolog

(DAF-16, www.wormbase.org, accession number, R13H8.1) protein sequence against the schistosome Genedb protein database (www.genedb.org) [81, 82]. Several putative schistosome forkhead (SmFox) homologs were identified and those genes with an

E-value of < e-5 were selected for cloning and further functional analysis. Additionally, reciprocal blastp analyses were conducted with the NCBI (www.ncbi.nlm.nih.gov) protein database against all available organism protein databases to confirm the presence of a forkhead domain in cloned schistosome forkhead sequences. Due to some differences in putative forkhead nucleotide and protein sequences between the available

schistosome databases (Genedb, SchistoDB (schistodb.net), NCBI, and WormBase

Parasite (parasite.wormbase.org)), cloned forkhead sequences were compared by blastn or blastp against schistosome forkhead gene sequences from each database[81, 83-85].

Additionally, the cloned and sequenced schistosome forkhead gene sequence was aligned

to the S. mansoni genome to define exon boundaries.

In addition to the initial blastp analysis, a tblastn analysis was also conducted

using the Genedb (S. mansoni contigs) and NCBI (S. mansoni whole-genome shotgun

contigs and the transcriptome shotgun assembly) databases with both the C. elegans

DAF-16 full-length and DBD only protein sequences. Again, the E-value cutoff was

The amino acid sequence of the forkhead DNA binding domain (DBD) alone, of

each cloned S. mansoni forkhead homolog (SmFox), was aligned to the full protein

sequences of all forkhead homologs from C. elegans (Ce) (wormbase.org), Drosophila melanogaster (Dm) (flybase.org), Mus musculus (Mm) (Mouse Genome Informatics,

informatics.jax.org) , and Saccharomyces cerevisiae (Sc) (yeastgenome.org) using the multiple sequence alignment tool, ClustalOmega

(http://www.ebi.ac.uk/Tools/msa/clustalo/) with default settings. The phylogram data was downloaded in Newick format and the FigTree program

(http://tree.bio.ed.ac.uk/software/figtree/) was used to generate trees. Additionally, pairwise alignments between each SmFox forkhead protein DBD and the full-length proteins of their orthologs from C. elegans, mouse, and fly were carried out with the blastp tool from the NCBI database. See Supplementary Table 2.1 for databases and accession numbers of forkhead homologs.

2.1.3 Cloning and sequencing

Total RNA was extracted and on-column DNase treated using the Purelink RNA

Mini kit (Life Technologies), according to the manufacturer’s instructions. All RNA

samples were quantitated on a Nanodrop 8000 (Thermo Fisher Scientific, Waltham, MA)

and stored at -80oC until used.

DNA primers (see Supplementary Table 2.2) were obtained from Integrated DNA

Technologies (Coralville, IA) and designed for use with either the Infusion or Infusion

HD cloning kit (Clontech, Mountain View, CA) per manufacturer’s instructions. Briefly,

each oligo contains homology, including a restriction enzyme site, to the multiple cloning

site of the yeast expression vector, pGBKT7 (Clontech, Mountain View, CA), as well as

the gene of interest.

The Superscript III One-Step RT-PCR System with Platinum Taq (Invitrogen,

Carlsbad, CA) was used to amplify SmFoxA2 (Smp_098780), SmFoxC (Smp_158750),

SmFoxD (Smp_054350) and SmFoxF (Smp_076300) and SmFoxG (Smp_150430) from total RNA. SmFoxA2 (Smp_098780) was amplified from adult worm, cercariae, and sporocyst mixed total RNA. The remaining genes were amplified from 4hr schistosomula total RNA. The First Strand Synthesis System for RT-PCR (Invitrogen) was used to generate cDNA from 4hr schistosomula total RNA. This cDNA was then used to amplify

SmFoxA1 (Smp_152170) with Phusion polymerase (NEB, Ipswich, MA). Conditions for all amplification reactions can be found in Supplementary Tables 2.3 and 2.4. Amplicons were then sub cloned into linearized pGBKT7 vector (plasmid names can be found in

Supplementary Table 2.2; See Figure 2.1 for vector map). SmFoxA2 (Smp_098780),

SmFoxC (Smp_158750), SmFoxD (Smp_054350), and SmFoxF (Smp_076300) were directionally cloned into the SalI/NotI restriction sites. SmFoxA1 (Smp_152170) and

SmFoxG (Smp_150430) were cloned into the BamHI/NotI and NdeI/EcoRI sites, respectively. Cloned sequences were analyzed by restriction digest and sequenced

(Eurofins Genomics, Louisville, KY, www.eurofinsgenomics.com) for verification.

Figure 2.1. Yeast expression vector pGBKT7 (Clonetech, Mountain View, CA).

2.1.4 Yeast transformation and modified yeast one-hybrid

Modified yeast-one hybrids [86] were performed by transforming S. cerevisiae

yeast strain AH109 (Clontech, Mountain View, CA) with pGBKT7 plasmids carrying a

cloned schistosome forkhead gene sequence (see Supplementary Table 2.2). These

plasmids generate a schistosome forkhead gene-Gal4 DNA binding domain fusion protein (Figure 2.2). Yeast transformed with pGBKT7 (containing the GAL4 DNA- binding domain alone) or with pEJ780 (pGBKT7 carrying a GAL4 DBD-GAL4 activation domain sequence), served as negative and positive controls, respectively (Figure 2.2).

Positive transformants were selected for on synthetic dextrose-tryptophan (SD-Trp)

media. Single colonies of positive transformants were individually patched onto new

SD-Trp plates. Then, to test for activation of the downstream HIS3 reporter gene, yeast

were streaked on SD-Histidine (SD-His) nutritional drop out media, incubated at 30oC, and monitored for growth of single colonies, indicating a positive result. To increase the stringency of the SD-His assay, the competitive inhibitor 3-Amino-1,2,4-triazole (3-AT,

MP Biomedicals, Solon, OH), was added to the drop out media at either 2.5mM or 5mM concentrations. Additionally, each construct was tested in a screening assay for activation of the MEL1 reporter gene, indicated by the development of blue color. For this assay, several single colonies were patched onto SD-Tryptophan (SD-Trp) plates on which 10 mg/ml 5-Bromo-4-chloro-3-indolyl-α-D-galactopyranoside (X-α-Gal, Clontech,

Mountain View, CA) was spread, according to the manufacturer’s protocol. Yeast were incubated overnight at 30oC.

Figure 2.2. Schematic of modified yeast-one hybrid. A modified yeast one-hybrid is

used to test transcriptional activation of reporter genes by SmFox-Gal4DBD fusion

proteins in transformed yeast. A) Negative control construct used to express Gal4-DBD

only and expression of reporter genes is not turned on. B) Positive control construct used

to express a Gal4-Activatio domain-Gal4-DBD (Gal4 Full) fusion protein that drives

expression of reporter genes. C) Experimental constructs expressing SmFox-Gal4-DBD fusion proteins to test ability to drive expression of downstream reporter genes.

2.1.5 Absolute quantitative PCR

Cercariae and 4h schistosomula total RNA was extracted using the RNA Clean

and Concentrator Kit-5 (Zymo Research, Irvine, CA), according to the manufacturer’s

TRIzol and on-column DNase protocols. Mixed adult worm and uninfected snail total

RNA was obtained from the Schistosomiasis Resource Center (Rockville, MD), and was

also DNase treated and concentrated with the Zymo kit. Sporocyst total RNA was

extracted as described above. The First Strand Synthesis Kit (Invitrogen) with

Superscript II RT and oligo (dT)12-18 was used to generate cDNA from 1µg of total RNA for each stage (sporocyst, cercariae, 4h schistosomula, mixed adult, and uninfected snail),

with the following conditions: 42 oC for 50 minutes, 70 oC for 15 minutes, and RNase H treatment for 20 minutes at 37 oC. The uninfected snail sample is a negative control for

the sporocyst stage.

DNA primers (see Supplementary Table 2.5) were designed based on the cloned

sequences of schistosome forkhead genes using Primer3

(www.biotools.umassmed.edu/bioapps/primer3_www.cgi,[5]) and ordered from IDT

(Coralville, IA). Wherever possible, primer pairs were designed in neighboring exons to

avoid amplification of carryover genomic DNA. Plasmid DNA templates (see

Supplementary Table 2.2) used to generate standard curves for corresponding

schistosome forkhead genes were linearized by restriction digestion with Not1-HF (NEB,

Ipswich, MA), then gel purified with the Wizard SV Gel and PCR Clean-Up System

(Promega, Madison, WI) and quantitated on a Nanodrop 8000 (Thermo Fisher Scientific,

Waltham, MA). For standard curve calculations, the concentration of each plasmid DNA

needed for a desired copy number was based on the mass of each plasmid molecule

(backbone + gene of interest) [87]. Plasmid DNA templates were diluted in a six point,

10-fold serial dilution starting from a copy number of 500,000 for each gene of interest.

Reactions were carried out using Power SYBR Green Master Mix (Life Technologies

Corporation, Grand Island, NY) on a StepOnePlus Real-Time PCR System (Life

Technologies Corporation, Grand Island, NY) with the following conditions: 95oC for 10

minutes, and 40 cycles of 95oC for 15sec and 60oC for 1 minute. For each run, a melt

curve analysis was performed and reactions were then run on a 2% agarose gel for 15

minutes at 50V and 25 minutes at 100V to verify amplicon size. For experimental

reactions, 25ng of cDNA per stage was used, and reactions were run in triplicate.

Standard curve reactions were carried out in triplicate and duplicate no RT and NTC

negative control reactions were run in parallel. Results were analyzed with StepOne

Software v2.3.

2.2 Results

2.2.1 Schistosomes have forkhead genes from several subclasses of the Fox family of transcription factors

Several putative members of the schistosome forkhead box (SmFox) family of

transcription factors, belonging to multiple subclasses, were identified based on a blastp

analysis of the C. elegans FoxO homolog, DAF-16 against the schistosome protein

databases at Genedb and NCBI. The results of the tblastn analyses also conducted with

37 the NCBI and Genedb databases overlapped with those of the blastp analysis and did not identify additional putative schistosome forkhead genes. Among those genes identified were the subclasses SmFoxA, SmFoxC, SmFoxD, SmFoxF, and SmFoxG. Additionally, some subclasses had more than one member present in the schistosome genome.

Subclass SmFoxA has two members, SmFoxA1 (Smp_152170) and SmFoxA2

(Smp_098780). The cloned SmFoxA2 sequence matches the databases 100% and is 1860 base pairs (bp) long, has two exons, spans approximately 5.2 kb, and has not yet been assigned to a chromosome. The amino acid sequence is 619 aa with a forkhead domain of 95aa (aa 371-465). The second member SmFoxA1, was not cloned in its entirety. The predicted sequence differed between databases and primers were designed to amplify both (with a common forward primer and different reverse primers). Despite several pcr runs, no amplicons were produced. A reverse primer in the middle of the gene, downstream of the location of the predicted forkhead domain, was designed with the intent to use 3’RACE (rapid amplification of cDNA ends) to obtain the end of the gene.

A partial clone of 2302 bp, spanning one exon was obtained, however attempts at

3’RACE were unsuccessful. The amino acid sequence is 767 aa and the forkhead domain spans amino acids 407-501. This gene has also not yet been assigned to a chromosome.

The cloned sequence of the gene SmFoxD (Smp_054350) matches that predicted and is a one exon gene that spans ~2 kb on chromosome ZW. The nucleotide sequence is

2025 bp and encodes a forkhead protein of 674 aa with a forkhead domain of 95 aa (aa

205-299).

Once cloned and sequenced, it was discovered that while some sequences matched those predicted by the databases, several had additional exons in their coding sequences. The SmFoxC (Smp_158750) subclass is represented by one gene with three isoforms (Figure 2.3). The databases predicted one isoform with a coding sequence of

2235 bp, however the longest of the isoforms cloned is several hundred base pairs larger, at 2757 bp (SmFoxCa). The SmFoxC gene has been assigned to the ZW chromosome and spans ~19000 kb. The additional isoforms, SmFoxCb and SmFoxCc, are 2173 bp and

1999 bp, respectively. While isoform a has four exons and encodes a protein which is

918 aa with a full forkhead domain (aa 318-412), the other isoforms produce truncated proteins when translated, both with stop codons in the middle of the forkhead domain

(Figure 2.3). SmFoxCb has five exons and translates to a 364 aa protein (the forkhead domain is aa 318-364) and SmFoxCc has four exons that translate to a 387 aa protein (the forkhead domain is aa 318-387).

Figure 2.3. Schematic of SmFoxC isoforms. Green boxes indicate exons of each

isolated isoform. Asterisks on the diagrams of SmFoxCb and SmFoxCc indicate where

translation of the mRNA is truncated by a stop codon. Yellow ovals indicate location of

the forkhead domain DBD (FKH) in the translated protein of each SmFoxC isoform.

Both the cloned sequences of SmFoxF (Smp_076300) and SmFoxG

(Smp_150430) differed from the predicted sequences. SmFoxF was predicted to be four

exons and 2277 bp, however the cloned sequence is several hundred base pairs larger at

2724 bp with four exons, and encodes a forkhead domain (aa 281-375) and a protein of

907 aa. This gene spans ~21.7 kb and hasn’t yet been assigned to a chromosome. The schistosome FoxG homolog, SmFoxG is located on chromosome 1 and spans ~1.7 kb.

Databases predicted and two exon gene of 1515 bp encoding, however the cloned

SmFoxG sequence is 1734 bp, one exon and encodes a 577 aa protein with a conserved forkhead domain (aa 156-250).

In addition to the subclasses listed above, another potential schistosome Fox gene

(Smp_127090) was listed in the multiple blast analyses (blastp and tblastn) conducted through NCBI and Genedb. An attempt to clone this gene was made based on the original predicted sequence (~860 bp), without success. The predicted gene sequence has since been updated, however the databases, Genedb, NCBI, and Wormbase Parasite disagree on the predicted coding sequence. All three databases put the genome locus as

Chromosome 6 and agree on the translational start site of the transcript. NCBI and

Wormbase Parasite differ, however, from Genedb on the stop site of the transcript. The coding sequences from all three databases predict a transcript of ~1530 bp, and overlap with 100% identity over the first 1411 bp. An analysis of the predicted protein sequences using the NCBI blastp tool against all non-redundant protein databases places an incomplete (only 72 aa of ~100 aa) forkhead box domain at the N terminus. This indicates the predicted translational start site of this transcript is likely incorrect, and that this is a partial mRNA sequence. Based on the incomplete and unconfirmed forkhead box sequence, determination of subclass classification is not possible at this time. This gene will need to be followed up on in the future to determine if it does indeed encode a forkhead box protein.

To confirm to which subclasses the cloned schistosome Fox genes belong, a multisequence alignment with the homologous forkhead proteins from mouse, fly, roundworm, and yeast was performed with ClustalOmega. The resulting phylogenetic trees (Figure 2.4 and Summary Figure 4.1) show that schistosome forkhead proteins group with the Fox subclasses predicted by reciprocal blastp analysis. Pairwise alignments of the SmFox protein DBDs with their orthologs from mouse, fly, and C.

41 elegans support the results of the phylogenetic analysis (Table 2.1), as indicated by the high percentage of sequence identity within the compared forkhead domains. Not all subclasses are represented in every organism. For all subclass members, except SmFoxF, the percent identity within the forkhead box domain is similar between schistosome Fox proteins and their orthologs in both vertebrates and invertebrates (Table 2.1). SmFoxF shares the highest percent identity with mouse Foxf1 and Foxf2.

Figure 2.4. Phylogenetic analysis of schistosome Fox protein subclasses SmFoxA-

SmFoxG. The amino acid sequence of the forkhead domain of each schistosome forkhead protein was aligned to full protein sequences of homologs from Mus musculus

(Mm), Drosophila melanogaster (Dm), Caenorhabditis elegans (Ce), and Saccharomyces

43 cerevisiae (Sc) using ClustalOmega (ebi.ac.uk/Tools/msa/clustalo) and drawn from the

Newick output in the FigTree (tree.bio.ed.ac.uk.) program.

S. M. musculus D. melanogaster C. elegans mansoni Ortholog Ortholog Ortholog Ortholog (% Sequence (% Sequence (% Sequence Identity) Identity) Identity) SmFoxA1 Foxa1 fkh PHA-4 (89%) (88%) (82%) Foxa2 (88%) Foxa3 (86%) SmFoxA2 Foxa1 fkh PHA-4 (60%) (55%) (56%) Foxa2 (58%) Foxa3 (58%) SmFoxC Foxc1 croc (76%) (78%) Foxc2 (76%) SmFoxD Foxd1 fd59A UNC-130 (87%) (86%) (78%) Foxd2 (85%) Foxd3 (87%) Foxd4 (84%) SmFoxF Foxf1 bin LET-381 (82%) (64%) (62%) Foxf2 (82%) SmFoxG Foxg1 slp1 FKH-2 (88%) (77%) (80%) slp2 (87%) Table 2.1. Summary of blastp pairwise alignments of schistosome Fox protein

DBDs (SmFoxA1-SmFoxG) and orthologs from mouse, fly, and roundworm. In pairwise alignments using the NCBI blastp tool (www.ncbi.nlm.nih.gov), the forkhead

box DNA binding domain of each schistosome Fox protein was aligned with the full- length sequence of orthologs from Mus musculus, Drosophila melanogaster, and

Caenorhabditis elegans. See Supplementary Table 2.1 for accession numbers for each gene).

2.2.2 Schistosome forkhead transcripts are developmentally regulated

To further characterize the schistosome Fox family of genes, we used absolute quantitative PCR to analyze expression of these genes across several developmental stages of the schistosome life cycle. The stages analyzed for forkhead transcript levels were sporocyst, cercariae, 4h schistosomula and adult stages. An uninfected snail sample was used as a negative control for the sporocyst stage. Copy number of target transcripts was determined by comparison against a standard curve generated from linearized plasmid carrying the corresponding target gene (Supplementary Table 2.2).

The schistosome FoxA homologs, SmFoxA1 and SmFoxA2, differed in the levels of transcript expressed within each stage and between stages in which transcripts were expressed. Both genes were expressed at low levels throughout the stages analyzed, with

SmFoxA1 expressed at the highest levels at just over 3000 copies in the 4h schistosomula stage (Figure 2.5, B). SmFoxA2 was highest in the sporocyst stage and decreased during development until it was off during the 4h schistosomula stage (Figure 2.5, A). Only very low levels of expression were detected during the adult stage. During the sporocyst and cercariae stages, expression levels remained similar for SmFoxA1, but increased during the 4h schistosomula stage (Figure 2.5, B). No expression was detected in the adult stage.

SmFoxC and SmFoxG are also genes expressed at low levels during the stages of

the life cycle which were examined. SmFoxC expression was highest in the sporocyst

stage, with a decline in transcript number during the cercariae stage, before an increase in

expression during the 4h schistosomula stage (Figure 2.5, C). SmFoxG expression was

highest during the sporocyst and 4h schistosomula stages, and low during the cercariae

stage (Figure 2.5, F). No expression was detected in the adult stage.

SmFoxD and SmFoxF are genes which are expressed at mid-levels. SmFoxD expression is similar, and at its highest during the cercariae and 4h schistosomula stages

(Figure 2.5, D). During the sporocyst and adult stages, expression of this gene is low

(Figure 2.5, D). SmFoxF is expressed at similar levels during the sporocyst and cercariae stages, and increases during the 4h schistosomula stage (Figure 2.5, E). Very few transcripts were detected at the adult stage (Figure, 2.5, E).

Figure 2.5. Schistosome forkhead gene expression varies during different stages of development. An absolute quantitative PCR analysis of schistosome forkhead transcript expression was performed on several stages of the schistosome life cycle. A plasmid clone of each gene was used to generate its respective standard curve. Reactions for the

experimental and standard samples were performed in triplicate. Uninfected

Biomphalaria glabrata cDNA was used as a negative control for the sporocyst stage.

Additionally, duplicate No RT and NTC reactions were performed in parallel as negative

controls. Abbreviations: Schistosomula (sla).

2.2.3 Schistosome forkhead proteins are transcriptional regulators

Fox proteins are a family of transcription factors, and have members capable of activating and repressing expression of downstream genes. To test whether schistosome forkhead proteins are transcriptional activators, we used a modified yeast one-hybrid assay, as previously described [86]. Briefly, the yeast strain AH109 was transformed with

yeast expression vectors (Supplementary Table 2.2) carrying a schistosome forkhead

gene and which creates a SmFox(varies)-Gal4 DNA-binding domain (DBD) fusion

protein. In this assay, growth of individual colonies on nutritional drop out media or development of blue color indicate expression of the reporter genes HIS3 and MEL1,

respectively, which are downstream of GAL4 promoters in the yeast genome.

Transformed yeast were streaked on synthetic dextrose -histidine media (SD-His) and allowed to grow over several days. To increase the stringency of this assay, yeast were also grown on SD-His media containing the competitive inhibitor, 3-AT, supplemented at

2.5mM or 5mM concentrations. Additionally, each schistosome forkhead gene was tested in a blue/white screen by growing the transformed yeast on plates supplemented with the chromogenic substrate X-α-Gal.

The results of these assays indicate several schistosome forkhead proteins are transcriptional activators (Figure 2.6, Supplementary Figures 2.3.1 and 2.3.2), though the

strength of their activation of the reporter genes varied. For SmFoxA1 growth of

colonies was observed on the SD-His plates, including those supplemented with 3-AT

(Figure 2.6, A-C). The X-α-Gal assay was also positive (Figure 2.6, D; Supplementary

Figure 2.3.2, A). Interestingly, SmFoxA2 homolog, is not a transcriptional activator, as

indicated by a lack of growth and no development of blue color (Figure 2.6, E-H;

Supplementary Figure 2.3.2, B).

As described previously, SmFoxC has three isoforms, and each of the isoforms

was tested. Yeast transformed with the SmFoxCa construct grew on each SD-His plate,

including those supplemented with 3-AT (Figure 2.6, I-K; Supplementary Figure 2.3.1,

A-C) and were positive on the X-α-Gal assay as well (Figure 2.6, L; Supplementary

Figures 2.3.1, D and 2.3.2, C1). SmFoxC isoforms b and c also tested positive in each

assay (Supplementary Figure 2.3.1, E-H and I-L, respectively; Supplementary Figure

2.3.2, C2 and C3, respectively). SmFoxD is not a transcriptional activator, as indicated by the lack of growth and no development of color in the selection and screening assays, respectively (Figure 2.6, M-P; Supplementary Figure 2.3.2, D). SmFoxF activated transcription of both reporters, as growth was seen on each SD-His plate, including the

SD-His + 2.5mM and SD-His + 5mM plates and development of blue color in the X-α-

Gal assay (Figure 2.6, Q-T; Supplementary Figure 2.3.2, E). Yeast expressing SmFoxG grew only on the SD-His plate, and not on those supplemented with 3-AT (Figure 2.6, U-

W). Results for this gene were negative for the X-α-Gal assay (Figure 2.6, X;

Supplementary Figure 2.3.2, F).

Figure 2.6. Schistosome forkhead transcription factors differ in ability to drive reporter gene expression in a yeast 1-hybrid analysis. The ability of schistosome

forkhead genes to function as transcriptional activators was tested using a heterologous

yeast system. Yeast were transformed with vectors expressing a schistosome forkhead

gene fused to the GAL4 DNA binding domain (DBD). To test expression of reporter

genes, yeast were assayed for growth of single colonies on SD-Histidine nutritional drop-

out media alone (expression of HIS3) or supplemented with the competitive inhibitor, 3-

AT, to increase stringency (first three columns) as well as for development of blue color

(expression of MEL1) in an X-Alpha-Galactosidase assay (X-α-Gal, last column). In each panel in the first 3 columns, the top third of each plate is the experimental yeast expressing a SmFox-GAL4 DBD fusion protein. The bottom left and right thirds of each plate are the negative and positive controls, respectively. Negative control yeast carry an expression vector with the GAL4 DBD alone, and positive control yeast carry an expression vector with a GAL4 DBD and GAL4 activation domain (AD) fusion. For the

X-α-Gal assay yeast were grown on SD-Tryptophan (which selects for cells carrying the pGBKT7 plasmid) plates with 10 mg/ml X-α-Gal. Yeast are expressing the same constructs as those tested on the nutritional drop out media. The rows are as follows: positive control (row 1), negative control (row 2), and experimental (row 3).

Gene SD- SD-Histidine + SD-Histidine X-α-Gal Histidine + (Gene ID) 2.5mM 3-AT 5mM 3-AT SmFoxA1 (Smp_152170) + + + +

SmFoxA2 - - - - (Smp_098780) SmFoxCa + + + + (Smp_158750) SmFoxD - - - - (Smp_054350) SmFoxF + + + + (Smp_076300) SmFoxG + - - - (Smp_150430) Table 2.2. Summary of SmFox yeast one-hybrid results.

2.3 Supplementary information

2.3.1 Supplementary figures

Supplementary Figure 2.3.1. Yeast 1-hybrid analysis of SmFoxC isoforms. Three

isoforms of SmFoxC were cloned individually into the vector pGBKT7 to create

SmFoxC-GAL4 DBD fusions and tested for transcriptional activation of reporter genes in a yeast 1-hybrid assay. Constructs were tested on nutritional dropout media (SD-

Histidine) for growth of single colonies and SD-Tryptophan (selection for plasmid) media with 10 mg/ml X-Alpha-Galactosidase (X-α-Gal) for development of blue color, both indicating expression of downstream reporter genes (HIS3 and MEL1, respectively).

For the SD-His assays, in addition to SD-His alone, SD-His with two different millimolar concentrations of the competitive inhibitor, 3-AT, was used to increase the stringency of the nutritional selection assay. In the results shown in the first three columns, the top

third of plates in the panels are the experimental SmFoxC-GAL4 DBD isoform fusions.

The bottom left and right thirds of these plates are yeast expressing the negative (GAL4

DBD alone) and positive (GAL4 DBD-GAL4 activation domain fusion) control constructs, respectively. The results of the X-α-Gal assay are shown in column three

(same plate is shown for each panel (D, H, and L), but patches from the corresponding

SmFoxC-GAL4 DBD isoform fusion are boxed). The positive control is shown in row 1 and the negative control in row 2.

Supplementary Figure 2.3.2. X-Alpha-Galactosidase assay plates for yeast-1 hybrid analysis. Full image of X-α-Gal plates from Figure 1. Experimental rows are boxed and the panels are as follows: A) SmFoxA1; B) SmFoxA2; C) SmFoxC, Box 1) Isoform a,

Box2) Isoform b, Box3) Isoform c); D) SmFoxD; E) SmFoxF; F) SmFoxG.

The first and second rows on each plate are the positive and negative control patches, respectively.

2.3.2 Supplementary tables

S. mansoni C. elegans D. M. musculus S. cerevisiae melanogaster Gene ID Gene ID Gene ID Gene ID Gene ID SmFoxA1 pha-4 fkh Foxa1 FKH2 Smp_15217 WBGene0000 FBgn0000659 mgi:1347472 S000005012 0 4013

SmFoxA2 lin-31 croc Foxa2 FKH1 Smp_09878 WBGene0000 FBgn0014143 MGI:1347476 S000001393 0 3017

SmFoxC pes-1 fd59A Foxa3 FHL1 Smp_15875 WBGene0000 FBgn0004896 MGI:1347477 S000006308 0 3976

SmFoxD fkh-10 bin Foxb1 HCM1 Smp_05435 WBGene0000 FBgn0045759 MGI:1927549 S000000661 0 1442

SmFoxF fkh-6 slp1 Foxb2 Smp_07630 WBGene0000 FBgn0003430 MGI:1347468 0 1438

SmFoxG unc-130 slp2 Foxc1 Smp_15043 WBGene0000 FBgn0004567 MGI:1347466 0 6853

let-381 fd96Ca Foxc2 WBGene0000 FBgn0004897 MGI:1347481 2601

fkh-2 fd96Cb Foxd1

WBGene0000 FBgn0004898 MGI:1347463 1434

fd3F Foxd2 FBgn0264954 MGI:1347471

fd19B Foxd3 FBgn0031086 MGI:1347473

Foxd4 MGI:1347467

Foxe1 MGI:1353500

Foxe3 MGI:1353569

Foxf1 MGI:1347470

Foxf2 MGI:1347479

Foxg1 MGI:1347464

Foxh1 MGI:1347465

Foxi1 MGI:1096329

Foxi2 MGI:3028075

Foxi3 MGI:3511278

Supplementary Table 2.1. Databases and gene ID numbers for forkhead homologs

used in phylogenetic analysis. Schistosoma mansoni (Sm), Caenorhabditis elegans

(Ce), Drosophila melanogaster (Dm), Mus musculus (Mm), C. elegans (Ce), and

Saccharomyces cerevisiae (Sc). Databases used: C. elegans (wormbase.org), Drosophila melanogaster (flybase.org), Mus musculus (mouse genome informatics, informatics.jax.org), S. cerevisiae (yeastgenome.org)

Gene Plasmid Forward Primer (5’-3’) Reverse Primer (5’-3’) (Gene ID) SmFoxA1 pEJ1700 GAGGCCGAATTCCCGG TGCTAGTTATGCGGCC GGATCCGTATGAATA GCGTGTTGAATCACG (Smp_152170) GTGAACAGTGTATAT ACTATCATAAGGAC TGACAACTAATCAA SmFoxA2 pEJ1701 GAATTCCCGGGGATCC TGCTAGTTAT GCGGCC GTCGACCTATGGAAC GCTTACGTAGTAGTA (Smp_098780) AAAACATAAGTCCTT GTAGAAGGAGATTT CT ACA SmFoxC pEJ1702 GAATTCCCGGGGATCC TGCTAGTTATGCGGCC GTCGACCTATGAATTG GCCTAGGTTAGATTT (Smp_158750) TACAAGATTTCCAAC TCATGATTAATTTTT TACATATGAAGAA TCGCC SmFoxD pEJ1703 GAATTCCCGGGGATCC TGCTAGTTATGC GTCGACCTATGCAAGT GGCCGCTTAATT (Smp_054350) TAAATTGGATAA TGTATGTAGAAC GAATGT AGATTGAATAAA SmFoxF pEJ1704 GAATTCCCGGGGATCC TTATGCTAGTTATGCG GTCGACCTATGCCAG GCCGCTTAACCAAAT (Smp_076300) ATATTGACTCACGTCC AAATATTCACATATA TTAT GTTATGTTTTTGAG SmFoxG pEJ1705 TCAGAGGAGGACCTGC TCGACGGATCCCCGG ATATGATGACTAATCT GAATTCTTAGATTTTT (Smp_150430) AACATTACCTGAAG CCTCCATTTACA

Supplementary Table 2.2. Schistosome Forkhead gene ID numbers and oligonucleotide sequences used for Infusion cloning into the pGBKT7 vector.

Infusion cloning was used to insert sequences into the vector pGBKT7. Restriction sites are underlined.

Gene RT PCR Conditions (Gene ID) SmFoxA2 94 oC 15s (Smp_098780) 50 oC 30s 40 cycles 68 oC 3min 68 oC 5min 1 cycle SmFoxC 94 oC 15s (Smp_158750) 54 oC 30s 40 cycles 68 oC 3min 68 oC 5min 1 cycle SmFoxD 94 oC 15s (Smp_054350) 45 oC 30min 50 oC 30s 40 cycles 94 oC 2min 68 oC 3min 68 o C  5min 1 cycle SmFoxF 94 o C  15s (Smp_076300) 54 o C  30s 40 cycles 68 oC 3min 68 oC 5min 1 cycle SmFoxG 94 oC 15s (Smp_150430) 55 oC 30s 40 cycles 68 oC 3min 68 oC 5min 1 cycle

Supplementary Table 2.3. One-step RT-PCR reaction conditions used for cloning.

Gene PCR Conditions (Gene ID) SmFoxA1 98 oC 30s 1 cycles

(Smp_152170) 98 oC 10s 58.4 oC 20s 40 cycles 72 oC 1min

72 oC 5min 1 cycle Supplementary Table 2.4. Phusion PCR reaction conditions used for cloning.

Gene Forward Primer (5’-3’) Reverse Primer (5’-3’) (Gene ID) SmFoxA2 TAAAGTACCGCGTCC AATTTACGATTACGAC ATCTG GCATTG (Smp_098780) SmFoxA1 ATGACGATGACGGA TTGTCGTTGTTGCCTG GATGG TCTC (Smp_152170) SmFoxC GGGAAAGCAACACT TGGCTTTGTATCATCT AAATGGA CTAGGC (Smp_158750) SmFoxD TGGTTTATTCGATCC CGTGAATAGCTGCGAC AACGAT CATA (Smp_054350)

SmFoxF TTGGAGCTGGTAGA TGTCCACGAAAGAAT CGATCA GGAAA (Smp_076300) SmFoxG TCAACATCGCCACCT TGAAAGCCACTGTTCA ACATC TCAGA (Smp_150430) Supplementary Table 2.5. Oligonucleotides used for absolute quantitative PCR

analysis.

Chapter 3. Schistosome Fox genes: SmFoxJ-SmFoxP

3.1 Materials and methods

3.1.1 Animals and parasites

The NIAID Schistosomiasis Resource Center of the Biomedical Resource

Institute (Rockville, MD) provided snails (Biomphalaria glabrata, NMRI strain) infected

with Schistosoma mansoni (NMRI strain). Cercariae were harvested and mechanically

transformed as previously described[80]. Schistosomula were maintained in vitro in

complete RPMI (RPMI media, 5% FBS and 1X Pen/Strep) at 37 oC. Sporocyst were

dissected from infected snails at ~ 5 ½ weeks post infection. Schistosome material was

stored in TRIzol (Thermo Fisher Scientific, Waltham, MA) or snap frozen in liquid

nitrogen. All samples were stored at -80oC until RNA extraction.

3.1.2 Bioinformatics

A blastp analysis using the full-length Caenorhabditis elegans (C elegans) FoxO homolog, DAF-16 protein sequence (www.wormbase.org, accession number, R13H8.1), against the schistosome Genedb protein database (genedb.org) [81, 82], identified several

putative forkhead homologs with an E-value cutoff of < e-5. A reciprocal blastp analyses of the translated amino acid sequence of the cloned and sequenced putative forkhead homologs against the NCBI protein database (www.ncbi.nlm.nih.gov) confirmed the presence of a forkhead domain and identified forkhead subclasses in other organisms with highest similarity. Cloned schistosome forkhead nucleotide and protein sequences were also compared by pairwise alignment between those found in Genedb,

SchistoDB (schistodb.net), NCBI, and Wormbase Parasite (parasite.wormbase.org) [81,

83-85]. The Genedb, NCBI, and Wormbase Parasite databases were used for alignment of each cloned schistosome gene sequence against the S. mansoni genome to determine location of exons within each gene.

Clustal Omega (www.ebi.ac.uk/Tools/msa/clustalo) was used for a multiple sequence alignment of the forkhead domain protein sequences of cloned S. mansoni forkhead homologs against the full-length protein sequence of forkhead homologs from

Drosophila melanogaster (Dm) (flybase.org), Mus musculus (Mm) (Mouse Genome

Informatics, informatics.jax.org), C. elegans (Ce) (wormbase.org), and Saccharomyces cerevisiae (Sc) (yeastgenome.org) (See Supplementary Table 3.1 for databases and accession numbers for forkhead homologs). Phylograms were drawn using the FigTree program (tree.bio.ed.ac.uk/software/figtree/).

3.1.3 Cloning and sequencing

Total RNA from cercariae, 4h schistosomula and sporocyst stages was extracted using the Purelink RNA Mini kit (Life Technologies), according to the manufacturer’s

TRIzol protocol. Additionally, RNA was on-column DNase treated according to kit

specifications. A Nanodrop 8000 (Thermo Fisher Scientific, Waltham, MA) was used to

quantitate all RNA samples which were then stored at -80 oC.

Stage specific cDNA was generated using the First Strand Synthesis System for

RT-PCR, Superscript II, and oligo (dT). Phusion polymerase (NEB, Ipswich, MA) was

then used in a downstream pcr to amplify target genes (see Supplementary Table 3.3 for

pcr reaction conditions). DNA oligos (Integrated DNA Technologies, Coralville, IA and

Supplementary Table 3.2) were designed to generate amplicons that contain the full

coding sequence for target schistosome forkhead genes and contain homology to the

multiple cloning site of the yeast expression vector pGBKT7 (Clontech, Mountain View,

CA). For the following genes, 4h schistosomula cDNA was used as the template:

SmFoxJ2 (Smp_155010), SmFoxJ3 (Smp_133460), SmFoxK2 (Smp_145650.1 and

145650.2), SmFoxO (Smp_012010), and SmFoxP (Smp_212350). SmFox J1

(Smp_133520) was amplified from cercariae cDNA.

SmFoxL (Smp_133480) was originally amplified from sporocyst cDNA, but the

amplicon contained only the forkhead DNA binding domain and a STOP codon just past

this domain. To isolate the 5’ portion of the gene sequence, 5’ Rapid Amplification of

cDNA ends (RACE) was used. Total RNA from 4h schistosomula was extracted using

the TRIzol protocol of the RNA Clean and Concentrator Kit-5 (Zymo Research, Irvine,

CA) with on-column DNase treatment. The SMARTer PCR cDNA Synthesis kit

(Clontech, Mountain View, CA) was used to generate 5’ RACE ready cDNA, according

to manufacturer’s protocol. The reverse primer, oGC002R (5’-

TGCCATCCTTGACGATTATCACGA), the kit Universal Primer, Phusion polymerase, and 4h schistosomula 5’ RACE ready cDNA were used in a pcr reaction with the

62 following conditions: 1 cycle of 98 oC for 30 seconds, 35 cycles of 98 oC for 10 seconds,

62 oC for 30 seconds and 72 oC for 45 seconds, and 1 cycle of 72 oC for 5 minutes. The amplified product was ligated into the pCR2.1 cloning vector according to the TA

Cloning Kit protocol (Life Technologies, Grand Island, NY) and verified by restriction analysis with EcoR1-HF (NEB, Ipswich, MA) and sequenced. Based on the sequencing analysis, a new forward primer was designed (see Supplementary Table 3.2) and the full

SmFoxL (Smp_133480) was amplified from sporocyst cDNA (see Supplementary Table

3.3 for reaction conditions).

SmFox K1 (Smp_135710) and SmFoxN (Smp_086270) were amplified from 4h schistosomula RNA using the Superscript III One-Step RT-PCR System with Platinum

Taq (Invitrogen, Carlsbad, CA). See Supplementary Tables 3.2 and 3.4 for primer sequences and reaction conditions, respectively.

Once target genes were amplified, they were individually cloned into the multiple cloning site of the linearized yeast expression vector pGBKT7 (Clontech, Mountain

View, CA) using either Infusion or Infusion HD cloning (Clontech, Mountain View, CA).

SmFoxJ2 (Smp_155010), SmFoxJ3 (Smp_133460), SmFoxK1 (Smp_135710), SmFoxK2

(Smp_145650), SmFoxL (Smp_133480), and SmFoxN (Smp_086270) were cloned directionally into the SalI/NotI restriction sites. For SmFoxJ1 (Smp_133520), SmFoxO

(Smp_012010), and SmFoxP (Smp_212350) the BamHI/NotI sites were used. See

Supplementary Table 3.2 for plasmid names. Cloned sequences were verified by restriction digest and sequencing.

3.1.4 Yeast transformation and modified yeast one-hybrid

A modified yeast one-hybrid approach was used, as previously described, to test

transcriptional activity of each schistosome forkhead protein [86]. The experimental

constructs described above, with a pGBKT7 backbone (Figure 2.1, Clontech, Mountain

View, CA) and carrying a cloned schistosome forkhead sequence, were individually

transformed into S. cerevisiae yeast strain AH109 (Clontech, Mountain View, CA).

When expressed, these constructs produce a SmFox-Gal4 DBD fusion protein (See

Figure 2.2). Control yeast were transformed with either the pGBKT7 vector alone (GAL4

DBD only, negative control) or with pEJ780, a pGBKT7 backbone carrying a GAL4 activation domain (positive control). After selection of positive transformants on synthetic dextrose-tryptophan (SD-Trp) plates, several single colonies were individually patched onto new SD-Trp plates. Subsequently, yeast were streaked on SD-Histidine

(SD-His) nutritional drop out media and incubated at 30oC. Activation of reporter gene

HIS3 was indicated by growth of single colonies. Additionally, the competitive inhibitor

3-Amino-1,2,4-triazole (3-AT, MP Biomedicals, Solon, OH), was included at either 2.5 mM or 5 mM concentrations to increase the stringency of the HIS3 reporter assay. Each construct was also tested in a blue/ white screen for the expression of the reporter gene

MEL1. Yeast from SD-Trp patch plate were re-patched onto SD-Trp plates supplemented with 10mg/ml 5-Bromo-4-chloro-3-indolyl-α-D-galactopyranoside (X-α-

Gal, Clontech, Mountain View, CA), according to the manufacturer’s protocol. Yeast were incubated overnight at 30oC. Positive results were indicated by development of blue

color.

3.1.5 Absolute quantitative PCR

Absolute quantitative PCR was performed as described in Section 2.1.5, with the

exception that the starting copy number for SmFoxO was 300,000 copies. Refer to

Supplementary Table 3.2 for a list of genes and plasmid DNA templates.

3.2 Results

3.2.1 Several subclasses of the Fox family of transcriptional regulators were identified in schistosome worms.

The full-length C. elegans DAF-16 protein, a FoxO homolog, was used in a blastp analysis of the schistosome GeneDB database (Genedb.org) in order to identify putative schistosome forkhead box transcription factors. From this analysis, several putative schistosome Fox proteins were identified and cloned for downstream analyses. Within the genes identified, several subclasses are represented, some with more than one representative.

One subclass with multiple members is that of FoxJ. In the schistosome genome there are three members present; SmFoxJ1 (Smp_133520), SmFoxJ2 (Smp_155010), and a more divergent member, SmFoxJ3 (Smp_133460). Based on the original analysis, a

2700 base pair (bp) SmFoxJ1 gene was cloned and sequenced, but was determined to have only a partial forkhead domain after analysis of the sequence. At that time, we had also cloned and sequenced another putative schistosome forkhead gene, Smp_187740

(data not shown), which was ~400 bp in length and also encoded only a partial forkhead domain. After a blastn sequence alignment of the cloned Smp_187740 and Smp_133520 sequences against the schistosome genomic databases, it was determined the genomic locus for both genes was on the ZW chromosome and that Smp_187740 was ~ 5.6 kb upstream of Smp_133520. Based on this finding, we hypothesized that both of these sequences were parts of the same gene. To test this, amplification of a full SmFoxJ1

(Smp_187740/Smp_133520) with the forward primer for Smp_187740 and the reverse primer for the original Smp_133520 sequence (see Supplementary Table 3.2 for primer sequences) was attempted and produced an amplicon of 3162 bp. This new sequence,

SmFoxJ1, has five exons and encodes a 1053 amino acid (aa) protein with a full,

conserved forkhead domain (aa 110-205).

The second FoxJ homolog, SmFoxJ2, was predicted by the schistosome databases

to be ~3500 bp, however we were not able to amplify a product of this size. We decided

to use a 3’ Rapid Amplification of cDNA Ends (RACE) strategy. First, a new reverse

primer was designed from within the middle of the gene to obtain a partial, 1317 bp

amplicon (see Supplementary Table 3.2). This 5’ region of the gene was cloned and

sequenced. Despite multiple attempts to amplify the 3’end, 3’RACE was unsuccessful.

The 1317 bp fragment that was amplified spans three exons and has not yet been assigned

to a chromosome. This portion of the gene encodes a 439 aa partial protein, however a

forkhead domain is present (aa 61-138) at the N terminus.

The third FoxJ homolog, SmFoxJ3 is a more divergent forkhead. The databases predicted a 1194 bp sequence with five exons over an ~18.1 kb genomic region. When translated and analyzed by a reciprocal blastp analysis in the NCBI database, this protein

has homology to the FoxJ subclass as well as rhoptry proteins. The cloned sequence

obtained, however, is 1592 bp, has three exons, and due to a frame shift in the predicted

sequence, no stop codon. Attempts at obtaining the remaining gene sequence by 3’

RACE were unsuccessful. The cloned sequence encodes a 530 aa partial protein with a

forkhead domain (aa 361-443).

Schistosomes have two members of the FoxK subclass, SmFoxK1 (Smp_135710)

and SmFoxK2 (Smp_145650). SmFoxK1 was predicted to have seven exons and be 2364 bp long. The cloned sequence was several hundred base pairs longer at 2928 bp, has seven exons and encodes a 975 aa protein. This FoxK transcription factor has both an

FHA domain (aa 31-82) and a forkhead domain (aa 430-524). SmFoxK1 spans ~43.8 kb

on chromosome 6. For SmFoxK2, the schistosome databases predicted a five exon gene

of ~1400 bp, however two isoforms were cloned for this gene (Figure 3.1). SmFoxK2a is

1509 bp and has four exons encoding a 502 aa protein that has both a forkhead domain

(aa 292-387), as well as a forkhead-associated domain (FHA) at the N terminus (aa 26-

78). The second isoform, SmFoxK2b is 1149 bp, has three exons and encodes a 382 aa

protein with forkhead (aa 172-267) and FHA (aa 26-78) domains. Both isoforms have exons 1, 3 and 4, and have the same forkhead amino acid sequence (See Figure 3.1).

SmFoxK2 spans ~48.2 kb on chromosome ZW.

Figure 3.1. Schematic of SmFoxK2 isoforms. Green boxes indicate exons of each

SmFoxK2 isoform. Yellow ovals indicate the conserved forkhead box DBD (FKH) of the

translated protein of each isoform. The blue circles indicate the forkhead associated

domain (FHA) of each protein isoform.

Schistosomes also have a FoxL subclass, SmFoxL (Smp_133480). This gene has yet to be assigned to a chromosome and spans ~33.4 kb. The sequence predicted in the database is 342 bp, and encodes only the forkhead domain of this protein. This fragment of the gene sequence was amplified, cloned, and confirmed by sequencing. Because the sequence contained a stop codon, 5’RACE was used to obtain the first half of the gene sequence. This strategy enabled an additional 500 bp to be identified and a full coding sequence of 852 bp to cloned. SmFoxL has two exons and encodes a 283 aa protein with a forkhead domain (aa 192-283).

Schistosomes also have FoxN, FoxO, and FoxP subclasses, each represented by a single gene, SmFoxN (Smp_086270), SmFoxO (Smp_012010), and SmFoxP

(Smp_212350), respectively. SmFoxN spans ~10.1 kb on Chromosome 2. Databases

differed on the prediction of a ~2800-2900 bp, 6 exon sequence, however a 3051 bp

sequence with seven exons was cloned which encodes a 1016 aa protein with a forkhead

domain (aa 143-258). SmFoxO spans ~16.6 kb on Chromosome 6. The cloned sequence

of 2652 bp, with three exons matches the database. This sequence encodes an 883 aa

protein with a forkhead domain (aa 201-291). SmFoxP spans ~84.4 kb on Chromosome

7. The predicted gene sequence is 5052 bp with 12 exons. The cloned sequence is 4716

bp, 10 exons, and encodes a 1571aa protein with two conserved domains, the forkhead

domain (aa 993-1072), and a FoxP coiled-coil domain (aa 286-353).

To further characterize the schistosome Fox family of transcription factors a multiple sequence alignment between the forkhead domains of the schistosome forkhead proteins and the full protein sequence of corresponding homologs from yeast, fly, nematodes, and mouse was run in ClustalOmega. The constructed trees (Figure 3.2, and Figure 4.1) show schistosome Fox proteins group with forkhead subclass homologs predicted by reciprocal blastp results using the NCBI databases for all organisms. The exception is SmFoxJ3, which appears to be a more divergent forkhead. This Fox protein doesn’t group with FoxJ homologs, but with the yeast forkhead Fhl1p and the fly forkhead protein fd3F. The pairwise alignments of the remaining SmFox protein DBDs, with the exception of SmFoxN, share higher percent identity with their orthologs than

SmFoxJ3 within the forkhead DBD (Figure 3.1). The conserved percentage of identity

is also similar between these schistosome Fox proteins and their orthologs from both

vertebrates and invertebrates. SmFoxN, like SmFoxJ3, shares a lower sequence identity

with its orthologs from mouse, fly and C. elegans, however it does group with Foxn2 and

Foxn3 from mouse and ches-1 like from Drosophila (Figure 3.2 and Figure 4.1). In

69 general, there is high conservation of amino acid sequence within the forkhead DBD of

SmFox proteins and their orthologs in mouse, fly and C. elegans.

Figure 3.2 Phylogenetic analysis of schistosome Fox protein subclasses SmFoxJ-

SmFoxP. ClustalOmega (ebi.ac.uk/Tools/msa/clustalo) was used to generate a multiple- sequence alignment of schistosome forkhead domain protein sequences against the full proteins of homologs from Mus musculus (Mm), Drosophila melanogaster (Dm),

Caenorhabditis elegans (Ce), and Saccharomyces cerevisiae (Sc). The Newick format alignment was used to draw the tree in FigTree (tree.bio.ed.ac.uk).

S. M. musculus D. melanogaster C. elegans mansoni Ortholog Ortholog Ortholog Ortholog (% Sequence (% Sequence (% Sequence Identity) Identity) Identity) SmFoxJ1 Foxj1 (62%) Foxj2 (54%) Foxj3 (59%) SmFoxJ2 Foxj1 (63%) Foxj2 (77%) Foxj3 (83%) SmFoxJ3 Foxj1 (36%) Foxj2 (32%) Foxj3 (34%) SmFoxK1 Foxk1 foxk (73%) (66%) Foxk2 (71%) SmFoxK2 Foxk1 foxk (75%) (66%) Foxk2 (72%) SmFoxL Foxl1 fd64A (75%) (68%) Foxl2 (61%) SmFoxN Foxn1 jumu (48%) (43%) Foxn2 ches-1 (37%) (38%) Foxn3 (37%)

Foxn4 (45%) SmFoxO Foxo1 foxo DAF-16 (49%) (51%) (52%) Foxo3 (51%) Foxo4 (53%) Foxo6 (50%) SmFoxP Foxp1 foxp FKH-7 (68%) (62%) (64%) Foxp2 (67%) Foxp3 (61%) Foxp4 (68%)

Table 3.1. Summary of blastp pairwise alignments of schistosome Fox protein

DBDs (SmFoxJ1-SmFoxP) and orthologs from mouse, fly, and roundworm. The

DBDs of the schistosome Fox proteins were analyzed in a pairwise alignment using the

NCBI blastp tool ( www.ncbi.nlm.nih.gov) with the full-length proteins of orthologs from

Mus musculus, Drosophila melanogaster, and Caenorhabditis elegans. See

Supplementary Table 3.1 for accession numbers for each gene).

3.2.2 Developmental regulation of schistosome forkhead transcript expression

Expression of schistosome forkhead genes was analyzed in the sporocyst, cercariae, 4h schistosomula, and adult stages of the life cycle by absolute quantitative

PCR. An uninfected snail sample was used as a negative control for the sporocyst stage.

To determine copy number, the expression level of target genes was compared against a

standard curve generated from linearized plasmid carrying the target gene

(Supplementary Table 3.2).

SmFoxJ1 and SmFoxJ2 have similar expression patterns, though the overall level

of expression is different. SmFoxJ1 is expressed at a higher overall level when compared

to SmFoxJ2 (Figure 3.3, A and B, respectively). SmFoxJ1 is expressed at similar levels during development from the sporocyst through the 4h schistosomula stage, with a decrease in expression during the adult stage (Figure 3.3, A). SmFoxJ2 is also expressed at similar levels during the sporocyst, cercariae, and 4h schistosomula stages, with a decrease in expression during the adult stage (Figure 3.3, B). SmFoxJ3 differs in its expression pattern from the other SmFoxJ homologs. Its expression is highest during the

sporocyst stage and decreases during development to the 4h schistosomula stage (Figure

3.3, C). No expression was detected in the adult stage.

The expression profile of SmFoxK1 differs from that of SmFoxK2. SmFoxK1

expression is low during the sporocyst and cercariae stages, and increases during the 4h

schistosomula stage (Figure 3.3, E). Expression during the adult stage is very low.

SmFoxK2 is expressed at low levels, with a decrease in expression from the sporocyst to

cercariae stage, and an increase at the 4h schistosomula stage where it is highest (Figure

3.3, D). Expression in the adult stage is similar to that during the cercariae stage.

SmFoxL increases from the sporocyst to the cercariae stage, before decreasing at

the 4h schistosomula stage and again at the adult stage (Figures 3.3, F). Expression of

SmFoxN increases during development from the sporocyst through the 4h schistosomula

stage, and is decreased at the adult stage (Figure 3.3, G). SmFoxO is a gene which is

74 expressed at overall high levels during development, and increases in expression through development from the sporocyst to 4h schistosomula stage, with no expression detected at the adult stage (Figure 3.3, H). Expression of SmFoxP is low at the sporocyst stage, and increases during development, with highest expression at the 4h schistosomula stage

(Figure 3.3, I). Little expression was detected at the adult stage.

Figure 3.3. Schistosome forkhead genes are expressed across several stages of the life cycle. Total RNA from the sporocyst, cercariae, 4hr schistosomula, and adult stages was used to generate cDNA for an absolute quantitative PCR expression analysis of schistosome forkhead transcripts. A standard curve for each gene was generated using a

plasmid clone of that gene. Experimental and standard curve reactions were run in

triplicate and No-RT and NTC negative controls run in duplicate. cDNA from uninfected snails (Biomphalaria glabrata) was used as an additional negative control for the sporocyst stage. Abbreviations: Schistosomula (sla).

3.2.3 Schistosome forkhead proteins regulate transcription

As a family of transcription factors, Fox proteins activate and repress target gene expression. To determine if schistosome forkhead homologs are transcriptional activators we employed a modified yeast one-hybrid assay and a yeast strain, AH109, with reporter genes (HIS3 and MEL1) downstream of GAL4 promoters, as previously described [86]. Each schistosome forkhead gene was cloned into the yeast expression vector, pGBKT7 which carries the GAL4 DNA Binding Domain (DBD). These constructs create a SmFox-Gal4 DBD fusion protein. Growth of yeast expressing a

SmFox-Gal4 DBD fusion protein on nutritional drop-out media, synthetic dextrose minus histidine (SD-His), indicates expression of the reporter gene HIS3. To increase the stringency of this assay, transformed yeast were also streaked onto SD-His plates supplemented with the competitive inhibitor 3-AT at 2.5mM and 5mM concentrations.

In addition to testing the expression of HIS3, expression of another reporter gene, MEL1, was tested in a blue/white screen on plates supplemented with the chromogenic substrate

X-α-Gal. Development of blue color indicates a positive assay. Several schistosome forkhead proteins tested positive as transcriptional activators, but with varied strength in activation of the reporter genes.

The SmFoxJ proteins all tested positive as transcriptional activators. Yeast

transformed with each homolog were able to grow on SD-His plates (Figure 3.4A, A, E,

and I), however they varied in growth on the plates supplemented with 3-AT. Yeast

transformed with SmFoxJ1 and SmFoxJ2 grew on both the SD-His + 2.5mM and SD +

5mM 3-AT plates (Figure 3.4A, B-C and F-G, respectively). Both were also positive in

the X-α-Gal assay (Figure 3.4A, D and H, respectively; Supplementary Figure 3.3.2A, A

and B, respectively). Yeast transformed with SmFoxJ3 were negative for growth on the

SD-His plates supplemented with 3-AT (Figure 3.4A, J-K), but were positive for

development of blue color (Figure 3.4A, L; Supplementary Figure 3.3.2A, C).

The schistosome FoxK homolog, SmFoxK1 is a transcriptional activator, as

indicated by growth of colonies on all SD-His plates (Figure 3.4A, Q-S) and development

of blue color in the X-α-Gal assay (Figure 3.4A, T; Supplementary Figure 3.3.2A, D).

The second schistosome FoxK homolog, SmFoxK2 has two isoforms. Interestingly,

SmFoxK2a tested positive as an activator and SmFoxK2b did not. Yeast transformed

with SmFoxK2a grew on the SD-His plates, including those supplemented with 3-AT,

though the growth on the SD-His + 5mM 3-AT plates was limited (Figure 3.4A, M-O;

Supplementary Figure 3.3.1, A-C). This isoform was also positive in the X-α-Gal assay

(Figure 3.4A, P; Supplementary Figure 3.3.1, D; Supplementary Figure 3.3.2A, EBox1).

SmFoxK2b was negative in both assays (Supplementary Figure 3.3.1, E-H;

Supplementary Figure 3.3.2A, E Box2).

SmFoxN, SmFoxO, and SmFoxP are all transcriptional activators. SmFoxL is not an activator. SmFoxN tested positive on the SD-His plate and in the X-α-Gal assay

(Figure 3.4B, E and H, respectively; Supplementary Figure 3.3.2B, B). On the SD-His

plates supplemented with 3-AT, no growth was observed of yeast transformed with this

gene (Figure 3.4B, F and G). SmFoxO was positive for growth on all SD-His plates, including those supplemented with 3-AT (Figure 3.4B, I-K). Additionally, blue color was observed in the X-α-Gal assay (Figure 3.4B, L3; Supplementary Figure 3.3.2B, C).

Growth of yeast transformed with SmFoxP was observed on SD-His and SD +2.5mM 3-

AT plates, but not on SD-His+5mM 3-AT (Figure 3.3.2B, M-O). The X-α-Gal assay was also positive (Figure 3.4B, P; Supplementary Figure 3.3.2B, D). Yeast transformed with

SmFoxL were negative for all assays. No growth was observed on any of the SD-His plates (Figure3.4B, A-C) and the X-α-Gal assay was also negative (Figure 3.4B, D;

Supplementary Figure 3.4B, A).

Figure 3.4A

Figure 3.4B

Figures 3.4A and 3.4B. Several schistosome forkhead proteins are transcriptional

activators. A heterologous yeast system was used to test the ability of schistosome

forkhead proteins to activate expression of reporter genes in a yeast 1-hybrid assay.

Schistosome forkhead-GAL4 DNA binding domain (DBD) fusion constructs were

transformed into yeast cells which were then streaked or patched onto plates made with

selective nutritional dropout media (SD-Histidine) or X-Alpha-Galactosidase (X-α-Gal).

Growth of individual colonies (dropout media, first three columns) or the development of blue color (X-α-Gal, last column) indicates expression of reporter genes (HIS3 and

MEL1, respectively) in the assays. The competitive inhibitor 3-AT was added at different

millimolar concentrations to SD-His media to increase the stringency (middle two columns) of the nutritional assay. The yeast in the top third of the SD-His plates (first three columns) were transformed with SmFox-GAL4 DBD constructs. The bottom left and right thirds of the plates are negative and positive control yeast, respectively.

Negative control yeast were transformed with the pGBKT7 vector which contains only

the GAL4 DBD. Positive control yeast were transformed with a full GAL4 fusion

construct containing both a GAL4 DBD and GAL4 activation domain (AD). In the last

column, the same constructs were tested, but yeast were grown on SD-Tryptophan plates

with 10 mg/ml X-α-Gal. The rows are as follows in each of these panels: positive control

(row 1), negative control (row 2), and experimental (row 3).

Gene SD- SD-Histidine + SD-Histidine X-α-Gal Histidine + (Gene ID) 2.5mM 3-AT 5mM 3-AT SmFoxJ1 + + + + (Smp_133520) SmFoxJ2 + + + + (Smp_155010) SmFoxJ3 + - - + (Smp_133460) SmFoxK1 + + + + (Smp_135710) SmFoxK2a + + + + (Smp_145650) SmFoxL - - - - (Smp_133480) SmFoxN + + - + (Smp_086270) SmFoxO + + + + (Smp_012010) SmFoxP + + - + (Smp_212350) Table 3.2. Summary of schistosome forkhead yeast one-hybrid results

3.3 Supplementary information

3.3.1 Supplementary figures

Supplementary Figure 3.3.1. Yeast 1-hybrid analysis of SmFoxK2 isoforms. Two

isoforms of SmFoxK2 were cloned individually into the vector pGBKT7 and tested in a

yeast 1-hybrid assay for activation of downstream reporter genes. Each SmFoxK2-GAL4

DBD isoform fusion was tested for growth of individual colonies (expression of HIS3 reporter gene) on nutritional drop-out media (SD-Histidine alone, or SD-His supplemented with either 2.5mM or 5mM concentrations of the competitive inhibitor, 3-

AT). The inhibitor was used to increase the stringency of the nutritional selection assay.

The results of these assays are shown in the first three columns. For each panel the

SmFoxK2-GAL4 DBD isoform fusion is shown in the top third of the plate. The negative (GAL4 DBD alone) and positive (GAL4 DBD-GAL4 activation domain fusion) controls are shown in the bottom left and bottom right thirds, respectively. In addition to the nutritional assay, each isoform was also tested in an X-Alpha-Galactosidase assay for development of blue color (expression of MEL1 reporter gene). In panels D and H, the

83 same plate is shown, but the corresponding isoform tested is boxed. Positive (row1) and negative (row2) controls are the same constructs as those in the nutritional selection assays.

Supplementary Figure 3.3.2A. X-Alpha-Galactosidase assay plates for yeast-1 hybrid analysis. Image of full plate for X-α-Gal plates from Figure 3.4A. Experimental rows are boxed and the panels are as follows: A) SmFoxJ1; B) SmFoxJ2; C) SmFoxJ3;

D) SmFoxK1; E) SmFoxK2a/b Box1) Isoform a Box2) Isoform b. The first and second rows on each plate are the positive and negative control patches, respectively.

Supplementary Figure 3.3.2B. X-Alpha-Galactosidase assay plates for yeast-1 hybrid analysis. Image of full plate for X-α-Gal plates from Figure 3.4B. Experimental rows are boxed and the panels are as follows: A) SmFoxL; B) SmFoxN; C) SmFoxO; D)

SmFoxP. The first and second rows on each plate are the positive and negative control patches, respectively.

3.3.2 Supplementary tables

S. mansoni C. elegans D. M. musculus S. cerevisiae melanogaster Gene ID Gene ID Gene ID Gene ID Gene ID SmFoxJ1 FKH-10 foxk Foxj1 FKH2 Smp_13352 WBGene00 FBgn0036134 MGI:1347474 S000005012 0 001442

SmFoxJ2 FKH-8 ches-1-like Foxj2 FKH1 Smp_15501 WBGene00 FBgn0029504 MGI:1926805 S000001393 0 001440

SmFoxJ3 FKH-9 jumu Foxj3 FHL1 Smp_13346 WBGene00 FBgn0015396 MGI:2443432 S000006308 0 001441

SmFoxK1 FKH-5 foxo Foxk1 HCM1 Smp_13571 WBGene00 FBgn0038197 MGI:1347488 S000000661 0 001437

SmFoxK2 DAF-16 foxp Foxk2 Smp_14565 WBGene00 FBgn0262477 MGI:1916087 0 000912

SmFoxL FKH-7 fd64A Foxl1 Smp_13348 WBGene00 FBgn0004895 MGI:1347469 0 001439

SmFoxN FKH-3 fd102C Foxl2 Smp_08627 WBGene00 FBgn0039937 MGI:1349428 0 001435

SmFoxO FKH-4 fd3F Foxm1 Smp_01201 WBGene00 FBgn0264954 MGI:1347487 0 001436

SmFoxP fd19B Foxn1 FBgn0031086 MGI:102949

Smp_21235 0

Foxn2 MGI:1347478

Foxn3 MGI:1918625

Foxn4 MGI:2151057

Foxo1 MGI:1890077

Foxo3 MGI:1890081

Foxo4 MGI:1891915

Foxo6 MGI:2676586

Foxp1 MGI:1914004

Foxp2 MGI:2148705

Foxp3 MGI:1891436

Foxp4 MGI:1921373

Foxq1 MGI:1298228

Foxr1

MGI:2685961

Foxr2 MGI:3511682

Foxs1 MGI:95546

Supplementary Table 3.1. Databases and accession numbers for forkhead homologs

used in phylogenetic analysis. Schistosoma mansoni (Sm), Caenorhabditis elegans

(Ce), Drosophila melanogaster (Dm), Mus musculus (Mm), C. elegans (Ce), and

Saccharomyces cerevisiae (Sc). Databases used: C. elegans (wormbase.org), D. melanogaster (flybase.org), M. musculus (MGI, informatics.jax.org), S. cerevisiae

(yeastgenome.org).

Gene Plasmid Forward Primer (5’-3’) Reverse Primer (5’-3’) (Gene ID)

SmFoxJ1 pEJ1706 GAATTCCCGGGGATC TGCTAGTTATGCGGC CGTCGACCTATGTCG CGCTCATTCATTAC (Smp_133520) TTAAATATTTATCCT ACATTCTAACCACA CAGTCTTTTGACTTG TTTTCGGT SmFoxJ2 pEJ1707 GAATTCCCGGGGATC TGCTAGTTATGCGGC CGTCGACCTATGACA CGCGCATACGGAAT (Smp_155010) GACCCAGATAATAGT TAGTCTGTTGATCTG CTGACTGC AATGC SmFoxJ3 pEJ1708 GAATTCCCGGGGATC TGCTAGTTATGCGGC CGTCGACCTATGTTT CGCTCAATATTGAA (Smp_133460) GAATATACAAGTGAT ATTTGATAAATGAT TATTTAGCTGAA CTATTTGATTGATAC AT SmFoxK1 pEJ1709 GAATTCCCGGGGATC TGCTAGTTATGCGGC CGTCGACCTATGCCA CGCCTAGGATTGCA (Smp_135710) GATCGTAGACTTATG TTACATAAAAAGTG ATCGAC GTTGG SmFoxK2 pEJ1710 GAATTCCCGGGGATC TGCTAGTTATGCGGC CGTCGACCTATGGAT CGCTTACAACTGAC (Smp_145650) CGTAACATGCCGACA CTTGATTAACTGGA GTTTATGC ACCAAATTATG SmFoxL pEJ1711 GAATTCCCGGGGATC TGCTAGTTATGCGGC CGTCGACCTATGAAT CGCTTACCTATAATT (Smp_133480) AAAGAAGATTATATT TCCATGTTCAAACA GATGATCATTCTATC TTTCATCT SmFoxN pEJ1712 GAATTCCCGGGGATC TGCTAGTTATGCGG CGTCGACCTATGACC CCGCTTAGATTAGA (Smp_086270)

GTCATAAACAATTCA GTGGCCGG GATTCTGAC CACTTCTTG SmFoxO pEJ1713 GAGGCCGAATTCCCG TGCTAGTTATGCGGC GGGATCCGTATGTCC CGCTCAAAAACTAG (Smp_012010) GCTTCCTATATTCGT AAGTTATTGGGTTA CGTGAT GTACTATTTGA SmFoxP pEJ1714 GAGGCCGAATTCCCG TGCTAGTTATGCGGC GGGATCCGTATGCAA CGCTTAGATTGTTGT (Smp_212350) TCACAATTTCTATCA ATATTTTGTAGGAG TCATCAGCAGCA ACGTAATAA ATTAG Supplementary Table 3.2. Gene ID numbers, plasmid names, and primers used for cloning schistosome forkhead genes. Sequences were cloned by Infusion into the vector pGBKT7. Bases with homology to the vector are in italics and restriction sites are underlined.

Gene PCR Conditions (Gene ID) SmFoxJ1 98 oC30s 1 cycle

(Smp_133520) 98 oC 10s 60.8 oC 20s 15 cycles 72 oC 72s 98 oC 10s 70.3 oC 20s 20 cycles 72 oC 72s 72 oC 5min 1 cycle SmFoxJ2 98 oC 30s 1 cycle

(Smp_155010) 98 oC 10s 58.4 oC 20s 30 cycles 72 oC 1min 72 oC 5min 1 cycle SmFoxJ3 98 oC 30s 1 cycle (Smp_133460) 98 oC 10s 59 oC 20s 35 cycles 72 oC 1min 72 oC 5min 1 cycle SmFoxK2 98 oC 30s 1 cycle (Smp_145650) 98 oC 10s

61 oC 20s 35 cycles 72 oC 40s 72 oC 5min 1 cycle SmFoxL 98 oC 30s 1 cycle (Smp_133480) 98 oC 10s 56 oC 20s 30 cycles 72 oC 15s 72 oC 5min 1 cycle Gene PCR Conditions Gene ID SmFoxO 98 oC 30s 1 cycle (Smp_012010) 98 oC 10s 67.9 oC 20s 30 cycles 72 oC 75s 72 oC 5min 1 cycle SmFoxP 98 oC 30s 1 cycle (Smp_212350) 98 oC 10s 60.5 oC 20s 35 cycles 72 oC 100s 72 oC 5min 1 cycle Supplementary Table 3.3 Phusion PCR reaction conditions for cloning.

Gene RT PCR Conditions (Gene ID) SmFoxK1 45 oC 30min 94 oC 15s (Smp_135710) 94 oC 2min 55 oC 30s 40 cycles 68 o C 3min

68 oC 5min 1 cycle

SmFoxN 45 oC 30min 94 oC 15s (Smp_086270) 94 oC 2min 56 oC 30s 40 cycles 68 o C 3min 68 oC 5min 1 cycle Supplementary Table 3.4. One-step RT-PCR reaction conditions for cloning.

Gene Forward Primer (5’-3’) Reverse Primer (5’-3’) (Gene ID) SmFoxJ1 TGCCACACTTATTTG TTGTTGAGCGAGAGAT CTTGG TGTGA (Smp_133520) SmFoxJ2 CAGGCAAGGGATCT AGTTGTATCGTGTGTG TATTGG GGTGA (Smp_155010) SmFoxJ3 GAATTCACATCGACA GATGGTGATTTCAATG ACCTCA TTGTCA (Smp_133460) SmFoxK2 AAGTTCCTCGTTCAC TCACAGGCTCTTATAC AAGAAGA GACGTT (Smp_145650) SmFoxK1 TTGCACAGCTATCCC TCTGATAAGCCATGGT AGTTG CGAA (Smp_135710) SmFoxL ATTTCCATCGAAACC TTTGCCATCCTTGACGA ACCAT TTA (Smp_133480) SmFoxN TGATGATGAACGAG CTGATTCCCAGCAGTA TGATTCAA ATCG (Smp_086270)

SmFoxO TCCTATCCAGATAAG GACAGGTTGTGACGGA CAAGCAA TTGA (Smp_012010) SmFoxP GGCTGTGGAGCTATT GCGCTCGACTGATTAA CTTGG ATGTC (Smp_212350) Supplementary Table 3.5. Primer sequences used for absolute quantitative PCR

analysis.

Chapter 4. Discussion and future directions

4.1 Discussion

Schistosomes have evolved a complex life cycle which involves several

morphogenic changes. These changes allow this parasite to move between and readily

adapt to several environments, including freshwater, an aquatic snail host, and a vertebrate host. The factors and molecular mechanisms which drive the development of each stage are widely unknown, particularly during the schistosomula stage. One family

of proteins which may play a number of diverse roles in the regulation of development in

schistosomes, the Fox family of transcription factors, have yet to be described in this

system.

As the first step in the characterization of schistosome forkhead genes, I asked how many putative Fox genes were present in the S. mansoni genome and which subclasses they represented, as these vary between organisms [37, 38, 78, 88, 89]. The first draft of the S. mansoni genome, which has since been updated, was published in

2009 [81, 90]. To identify putative schistosome forkhead genes I queried the

schistosome databases, GeneDB (www.genedb.org) and NCBI (www.ncbi.nlm.nih.gov)

using a blastp analysis (E-value

[66, 77, 92, 93]. In addition to the 15 S. mansoni Fox genes successfully cloned, one potential forkhead box gene, Smp_127090, remains to be cloned and verified.

The conserved DBD of Fox proteins is the defining characteristic of forkhead transcription factors [30, 31, 33, 94]. This feature can be used in a phylogenetic analysis to group family members into subclasses [33]. For all SmFox proteins except one,

SmFoxJ3 (Smp_133460), the phylogenetic analysis supported subclass predictions made by reciprocal blastp results against all available organism protein databases at NCBI, and grouped the SmFox proteins into 11 subclasses (Figure 2.4, Figure 3.2, Figure 4.1). This

phylogenetic analysis is further supported by other phylogenetic studies in which

invertebrate forkhead proteins group with those from vertebrates [33, 37, 38, 40, 78, 88,

95, 96]. Additionally, the sequence conservation of > 50% identity demonstrated by a

majority of the SmFox protein DBDs in the pairwise alignments with the full-length

protein sequence of their orthologs in mouse, fly and C. elegans also supports our

phylogenetic analysis (Table 2.1 and Table 3.1). The SmFox genes include one

representative each for the FoxC, FoxD, FoxF, FoxG, FoxL, FoxN, FoxO, and FoxP

subclasses. FoxA and FoxK each have two members, SmFoxA1 and SmFoxA2 and

SmFoxK1 and SmFoxK2, respectively. The FoxJ subclass has three members, SmFoxJ1,

SmFoxJ2 and SmFoxJ3.

For classification of SmFoxJ3, the NCBI blastp analyses against either all

organismal or mouse protein databases showed FoxJ orthologs as the best result.

However, sequence identity of the SmFoxJ3 forkhead DBD with mouse Foxj1, Foxj2 and

Foxj3, is low, at 36%, 32%, and 34%, respectively, when compared to the level of sequence identity in the forkhead DBDs of SmFoxJ1 and SmFoxJ2 against the mouse

FoxJ proteins (Table 3.1). Pairwise alignment of SmFoxJ1 with mouse FoxJ proteins

Foxj1, Foxj2, and Foxj3, shows 62%, 54% and 59% sequence identity within the forkhead DBD, respectively. Similarly, SmFoxJ2, shares 63%, 77%, and 83% identity with Foxj1, Foxj2, and Foxj3 from mouse (Table 3.1). In agreement with this, the

SmFox phylogenetic analysis groups SmFoxJ3 with the Drosophila forkhead fd3F, not with SmFoxJ1 and SmfoxJ2, which are grouped with the mouse FoxJ orthologs (Figure

3.2, Figure 4.1). However, in a study of fd3F by Newton et al, the authors suggest fd3F

is a divergent FoxJ ortholog based on similarities to mammalian FoxJ in its regulation of

target genes expressed in ciliated cells [97]. And, as noted by Newton et al, in the

original Drosophila forkhead phylogenetic analysis by Lee and Frasch, fd3F also did not

group with mouse FoxJ proteins [37, 97]. Based on this and my phylogenetic, NCBI

blastp, and pairwise alignment analyses, I’ve assigned Smp_133460 to the SmFoxJ

subclass as SmFoxJ3.

Figure 4.1. Phylogenetic analysis of all schistosome forkhead genes. A multiple- sequence alignment was generated in ClustalOmega (ebi.ac.uk/Tools/msa/clustalo) using the amino acid sequence of the forkhead domain of all the schistosome forkhead genes and the full protein sequence of forkhead homologs from Mus musculus (Mm),

Drosophila melanogaster (Dm), Caenorhabditis elegans (Ce), and Saccharomyces cerevisiae (Sc). The output format for the alignment was Newick and the FigTree program (tree.bio.ed.ac.uk) was used to draw the tree.

In addition to the conserved forkhead DBD, some classes of Fox proteins have conserved protein-protein interaction domains, such as the Forkhead associated domain

(FHA) or a coiled-coil domain. However, these domains are not exclusive to Fox proteins

[44]. These subclasses include FoxK and FoxP. SmFoxK1 and both isoforms of

SmFoxK2 contain an FHA domain near their N terminus. The FHA domain facilitates phosphorylated protein interactions and FoxK and yeast forkhead proteins are the only

Fox proteins to share this domain [98-100]. Within the FHA domain, SmFoxK1 has 43% and 38% sequence identity to mouse Foxk1 and Foxk2, respectively, and 36% with foxk from fly. SmFoxk2 shares 45% and 37% sequence identity within the mouse Foxk1 and

Foxk2 FHA domain, respectively and 32% with Drosophila foxk. The FoxP subclass also has a conserved N terminal protein-protein interaction domain called the FoxP coiled-coil domain. This domain allows dimerization between members of the FoxP subclasses [45, 101]. SmFoxP too has this conserved domain at its N terminus, and this domain shares 44%, 41%, 41%, 42%, and 29% sequence identity with fly foxp and mouse Foxp1, Foxp2, Fxop4, and Foxp3, coiled-coil domains, respectively.

As potential regulators of schistosome development, the second aim of this study was to determine during which stages of the life cycle each SmFox gene is expressed.

The stages included for analysis were sporocyst, cercaria, schistosomula and adults.

SmFox gene expression varied between stages, and several SmFox genes which may play a role in gut, protonephridial (osmoregulation/excretion) and central nervous system development are expressed during the sporocyst, cercaria, and schistosomula stages

(Figure 2.5, Figure 3.3). In comparison, expression of most SmFox genes was low during the adult stage, if detected at all, though this is consistent with completion of development in the adult stage. It should be noted, however, that transcript copy number for each stage is normalized by total RNA input (1µg total RNA per stage and 25ng of corresponding cDNA per reaction), not on total cell number for each sample. This is due to the infeasibility of determining a cell count for all stages of the S. mansoni life cycle.

Additionally, absolute quantitative PCR was chosen as the quantitation method for transcript levels due to the lack of housekeeping genes with stable transcript levels between schistosome life cycle stages [102]. In circumstances in which copy number can’t be normalized to cell number, tissue mass, or with the use of an endogenous control gene with steady transcript levels in each sample tested, normalization by total RNA input is a viable option [103]. In this study, copy number within each stage could equally be attributed to a large number of cells with low transcript levels or a few cells with high transcript numbers.

The SmFox genes that may play a role in the development of the gut include

SmFoxA1 and SmFoxA2, SmFoxF, SmFoxK1, SmFoxK2, SmFoxL, and SmFoxP. The sporocyst stage is the stage at which the gut anlage forms in developing cercariae and the

early schistosomula stage, just after the cercarial to schistosomula transition, may mark

the timeframe in which the second stage of gut development begins during

morphogenesis in the vertebrate host. The stages in which SmFoxA transcript was

detected was different between SmFoxA1 and SmFoxA2. SmFoxA1 transcripts were

detected in the sporocyst, cercarial and schistosomula stages, though interestingly,

SmFoxA2 was detected only in sporocyst, cercariae, and at very low levels in the adult

stage (Figure 2.5, A and B). SmFoxA2 was not detected in the schistosomula stage and

was highest in the sporocyst stage. FoxA orthologs in fly and C. elegans, fkh and pha-4,

respectively, are expressed in the developing gut. In Drosophila, fkh is expressed in

foregut, midgut and hindgut [104, 105]. pha-4 is expressed in the pharynx of C. elegans

and is required for both early and late pharyngeal development [106-108]. Schistosomes

may us a similar mechanism for gut development, as this organ continues development during two separate life stages.

In addition to a conserved role in gut development, FoxA proteins are also known as “pioneer” factors for their ability to open condensed chromatin [46, 109] This ability is based on the histone-like structure of the conserved forkhead DBD [42, 110]. In a recent study, Roquis et al., examined the chromatin structure of the cercarial, schistosomula and adult stages of S. mansoni and determined that cercarial chromatin contains different histone modifications, than those found in both the schistosomula and adult stages [111]. The authors concluded that similar to embryonic stem cells, these modifications, the bivalent trimethylation of H3K27 (a repressive modification) and

H3K4 (a permissive modification), “poised” transcription in the cercarial stage until larval infection of the vertebrate host [111]. The authors’ conclusion of a “poised”

100

transcriptional state in this stage was supported by the lack of detection of RNA

transcription in cercariae. Interestingly, both SmFoxA1 and SmFoxA2 transcripts were

detected in the cercarial stage, with subsequent upregulation of SmFoxA1, the

transcriptional activator, and downregulation of SmFoxA2, the potential repressor, in the

schistosomula stage (Figure 2.6 A-D and E-H; Figure 2.5, A and B). In contrast to the transcriptional silence of the cercarial stage described above, translation during this stage does occur [112]. However, this leaves an unresolved question in schistosomes. In particular, does SmFoxA1 protein, translated from the cercarial transcripts play a role in facilitating the genomic switch from a paused transcriptional state in cercariae to active gene transcription in the schistosomula stage?

Expression of other potential gut development regulators, SmFoxF, SmFoxK1,

SmFoxK2, SmFoxL, and SmFoxP was also detected during the sporocyst and schistosomula stages (Figure 2.5, E; Figure 3.3, D, E, F, and I). Expression of SmFoxF,

SmFoxK1, SmFoxK2, and SmFoxP was highest in schistosomula. SmFoxL transcript level was highest in cercariae. The Drosophila FoxF ortholog, bin, regulates development of all three types of gut muscle, and in particular the midgut [51]. In bin

mutants gut muscle cells instead become cells of the body wall. Similarly, in mouse,

both Foxf1 and Foxf2 are expressed in early gut [113, 114]. In mice, Foxl1 is expressed

in the gut mesenchyme adjacent to the epithelial layer and null mutants display abnormal

gut epithelia [115]. FoxK is required for normal development of the midgut in

Drosophila [100]. And Foxp is expressed in the muscle of the esophagus in the

developing foregut of mice [116] .

101

Another schistosome organ system which undergoes extensive growth after

morphogenesis of schistosomula into adults is the protonephridial or

excretory/osmoregulatory system. Cercariae and schistosomula have 5-6 pair of ciliated

flame cells adjacent to ciliated tubules [23, 117]. In adults, the protonephridial system is much more extensive. The SmFox genes which may play a role in regulating development of this system include SmFoxC and SmFoxJ1, SmFoxJ2, SmFoxJ3 and

SmFoxN. SmFoxC expression is highest in sporocyst followed by schistosomula, and then at low levels in cercariae (Figure 2.5, C). SmFoxJ1 and SmFoxJ2 have similar expression patterns, in the sporocyst, cercarial, and schistosomula stages, and they are both expressed at similar levels between stages (Figure 3.3, A and B). SmFoxJ3 is also expressed in the sporocyst, cercarial, and schistosomula stages, but the levels decline during development between the sporocyst and schistosomula stages (Figure 3.3, C).

SmFoxN is expressed in the sporocyst, cercariae, schistosomula and adult stages.

Expression increases between the sporocyst and schistosomula stages, and is low in the adult stage (Figure 3.3, C). Vertebrate Foxc is expressed in early kidney and is necessary for maintenance of kidney cells [57, 118]. Drosophila Foxj ortholog, Fd3F, and vertebrate Foxn and Foxj orthologs regulate cilia formation in ciliated cells [97, 119,

120].

Cercariae have an orthogonal nervous system with a pair of central ganglia, and longitudinal nerve cords with transverse connections. The overall patterning of the adult

nervous system is the same as the larval stage [7, 20, 23]. However, in the time between

the cercarial to schistosomula transition and the adult stage, the worms have undergone a

burst of growth (from 150 µm to 10-20mm, depending on sex). During this time of

102

growth and change in phenotype, they have gained extensive musculature (in males in

particular), and fully developed gut, reproductive, and protonephridial systems. In turn,

the adult nervous system becomes more extensive as well, traversing the length of the

body and innervating the newly developed organ systems [20, 121, 122].

The SmFox genes which may play a role in development of the schistosome central nervous system include SmFoxD, SmFoxG, SmFoxJ1, SmFoxJ2, SmFoxJ3. These have not been described in schistosomes, but in other systems they have a role in CNS development. It would be of interest if these function in cercarial development, although it may be technically challenging given our current state of schistosome genetics.

SmFoxD is upregulated in the cercarial and schistosomula stages, and has a low level of expression in sporocyst. The C. elegans FoxD ortholog, unc-130, and vertebrate Foxd direct neuronal fate in chemosensory and gut neurons, respectively [123-125]. SmFoxG is upregulated in both the sporocyst and schistosomula stages (Figure 2.5, F). The

Drosophila FoxG orthologs, slp1/slp2, and vertebrate Foxg1 have also been shown to regulate neuronal cell fate, by inhibiting formation of glial cells [126, 127]. The

Drosophila FoxJ ortholog, Fd3F regulates differentiation of a specialized sensory neuron

[128]. Vertebrate Foxj has been shown to regulate neuronal differentiation in the CNS

[129].

Expression of SmFoxO was detected in the sporocyst, cercarial, and

schistosomula stages in increasing levels (Figure 3.3, H). FoxO transcription factors are

central regulators in the insulin signaling pathway of many organisms, including

vertebrates and invertebrates [69]. Two insulin receptors (IRs) each have been identified

in S. mansoni (SmIR-1 and SmIR-2) and S. japonicum (SjIR-1 and SjIR-2) [130, 131]. In

103

the S. mansoni study, the identification of SmIR-1 and SmIR-2, was the first time two

insulin receptors had been identified in an invertebrate. These receptors were shown to

be expressed in several stages of the life cycle (miracidia, male and female adults,

sporocyst, cercariae, and schistosomula), to be localized to different tissues, and to be

capable of binding human pro-insulin. Based on this information the authors concluded

that these two receptors likely fulfill different roles in schistosome biology [130]. They

also hypothesize that IR-1 may play a role in glucose metabolism, as it is localized to the

tegument, along with the two schistosome glucose transporters SGTP1 and SGTP4 [130].

Another hypothesis they make is, SmIR-2, which is localized throughout the parenchyma of both schistosomula and adults, may play a role in parasite growth [130].

With the identification of two insulin receptors and now, SmFoxO, additional questions are raised. Does SmFoxO function downstream of both receptors? And if so, what are the downstream targets of SmFoxO in each pathway? In 4h schistosomula,

SmFoxO expression is highest, when adaptation to the vertebrate host is taking place. In schistosomula, the function of SmFoxO may be similar to its role in suspended growth in third stage infective larva (iL3) of parasitic nematodes, a stage in which these roundworms arrest until a suitable host is found [72-76, 132]. As schistosomula adapt to and develop within the vertebrate host, despite elongation of the body, growth, in terms of increase in body mass, is suspended until their arrival in the hepatic portal system, several days post infection [7, 133]. This is thought to be due to the need of larva to transit the host vasculature [133]. In Drosophila (d), it’s been demonstrated that activation of dFoxO decreases organ size by restricting cell number, not cell size [134].

104

Similar to its role in fly and parasitic nematodes, does SmFoxO inhibit growth of

schistosomula during the early stages of transition into the vertebrate host?

Interestingly, expression of SmFoxO wasn’t detected in the adult stage, when growth has stopped, though its downregulation in this stage would be consistent with a role as a downstream target of the SmIRs. When insulin receptors are bound by a ligand,

FoxO proteins are post-translationally modified and excluded from the nucleus (Figure

1.4) [135]. Because primary regulation of this transcription factor is by post- transcriptional modifications, high levels of transcript may not be present in the adult stage.

Another potential role for SmFoxO in the early schistosomula stage may be upregulation of the SmIRs in preparation of insulin signaling and glucose metabolism within the vertebrate host. In Drosophila, insulin receptors are a downstream target of dfoxO, in which reduced insulin signaling upregulates dfoxO, which in turn upregulates expression of dIRs [134, 136]. Similarly, in schistosomes, are the SmIRs downstream targets of SmFoxO?

Fox proteins are a family of transcription factors capable of activating and/or repressing the expression of downstream target genes. The third aim of this study was a functional analysis to determine which SmFox genes are transcriptional activators.

Functional analysis of transcription factor regulation using a yeast one-hybrid approach in a heterologous yeast system has been previously described [86, 137]. Fourteen of the

18 SmFox proteins tested are transcriptional activators (Figure 2.6, A-E, I-L, Q-T, U;

Figure 3.4A, A-D, E-H, I and L, Q-T; Figure 3.4B, E and H, I-L, M and P; Table 4.1).

105

The SmFox proteins which are transcriptional activators include, SmFoxA, SmFoxC (all

isoforms), SmFoxF, SmFox J1, SmFoxJ2, SmFoxJ3, SmFoxK1, SmFoxK2a, SmFoxN,

SmFoxO and SmFoxP. Orthologs of each these subclasses have previously been shown

to activate gene expression [51, 56, 134, 138-141]. The SmFox proteins which did not

turn on reporter gene expression and therefore are potential repressors are SmFoxA2,

SmFoxD, SmFoxK2b, and SmFoxL. Orthologs of these forkhead proteins have been

shown to repress transcription in other systems [142, 143].

Interestingly, of the two SmFoxA homologs, only SmFoxA1 functions as a transcriptional activator. FoxA orthologs in other systems have shown both activator and repressor activity. FoxA is a pioneer factor that opens chromatin to facilitate activation of downstream targets [46]. And, Foxa2 was shown to repress both Nkx2.2 and Gli2 during midbrain development of the central nervous system in mice [49]. In other

systems, FoxG is a repressor [126, 144]. However, when tested, SmFoxG was a weak

activator, as it activated transcription of the reporter gene HIS3, but only without the

presence of competitive inhibitor 3-AT. This forkhead protein also tested negative for

expression of MEL1 in the X-α-Gal assay. The isoforms of SmFoxK2 differed in their

ability to activate reporter gene transcription. SmFoxK2a activated transcription and

SmFoxK2b did not. FoxK subclass proteins vary in their ability to activate transcription,

often based on the partner proteins that interact with their FHA domain [139, 145].

106

SmFox X-α-Gal SD-His SD-His + SD-His Subclass 2.5mM 3-AT + 5mM 3-AT

1.) SmFoxA1 + + + + 2.) SmFoxA2 - - - - 3a.) SmFoxCa + + + + 3b.) SmFoxCb + + + + 3c.) SmFoxCc + + + + 4.) SmFoxD - - - - 5.) SmFoxF + + + + 6.) SmFoxG - + - - 7.) SmFoxJ1 + + + + 8.) SmFoxJ2 + + + + 9.) SmFoxJ13 + + - - 10.) SmFoxK1 + + + + 11a.) SmFoxK2a + + + + 11b.) SmFoxK2b - - - - 12.) SmFoxL - - - - 13.) SmFoxN + + + - 14.) SmFoxO + + + + 15.) SmFoxP + + + - Table 4.1. Summary of SmFox yeast one-hybrid results.

Here, I have identified and characterized 15 S. mansoni Fox (SmFox) genes. A phylogenetic analysis grouped these 15 SmFox genes into 11 subclasses (FoxA, FoxC,

FoxD, FoxF, FoxG, FoxJ, FoxK, FoxL, FoxN, FoxO, and FoxP). The SmFoxA and

SmFoxK subclasses each have 2 members represented, SmFoxA1/SmFoxA2, and

SmFoxK1/SmFoxK2. The SmFoxJ subclass has 3 members, SmFoxJ1, SmFoxJ2, and

SmFoxJ3. Multiple isoforms were identified for SmFoxC and SmFoxK2, with 3 and 2 isoforms, respectively. Once the complement of SmFox genes was identified, their

107

expression profile was examined over the sporocyst, cercarial, schistosomula, and adult

stages of the life cycle. Expression over developmental stages varied between genes and

between stages for each gene. Interestingly, most SmFox genes were either not expressed or were expressed at very low levels in the adult stage. Additionally, a functional analysis to test the ability of each SmFox protein to activate reporter gene transcription was conducted. Including all isoforms for SmFoxC and SmFoxK2, 14 SmFox proteins are transcriptional activators, with varying levels of reporter gene activation. The remaining 4 proteins, SmFoxA2, SmFoxD, SmFoxK2b, and SmFoxL are potential repressors.

Schistosomes have an immense impact on global human health. Due to their complex life cycle, which traverses a number of very different environments and the nature of their obligate parasitic relationships with their invertebrate and vertebrate hosts, the study of the basic biology of schistosomes is challenging. However, identifying and defining the factors and molecular mechanisms which drive their development during the morphological changes which occur during each stage of the life cycle will be critical in developing preventative measures and therapeutic treatments. This thesis was designed to lay the foundation for the study of a family of potential developmental regulators, the

Fox family of transcription factors, in schistosomes. In addition to contributing to the greater knowledge of schistosome basic biology, this work is the first comprehensive description of a Fox gene family in a parasitic worm.

108

4.2 Future directions

After the identification and initial characterization of the complement of S. mansoni Fox genes described above, there are several remaining questions about the role these genes play in schistosome development. Some of these questions include: 1) Are schistosome Fox genes required for survival at the stages of development in which they’re expressed? 2) Where is expression of SmFox proteins localized in the different developmental stages of the life cycle? 3) What are the upstream regulators and downstream targets of the SmFox genes?

4.2.1. Are schistosome Fox genes required for survival at each stage of development?

The initial characterization of Forkhead genes in this thesis included an expression analysis in the sporocyst, cercarial, schistosomula and adult stages. As potential regulators of development, an extended expression analysis would be useful in the design of downstream experiments. The additional stages to include would be the egg, miracidia and several additional schistosomula stages (i.e. 24h, 72h, 5day, etc.). In schistosomula this gives a time frame in which to target these genes for RNAi or overexpression. Currently, transfection and RNAi in miracidia, sporocyst, and cercaria are not feasible.

RNAi studies in schistosomes utilizing soaking or electroporation delivery methods have been successful, though with varied levels of knockdown and observation of phenotypes [146-149]. And recently our lab has developed the use of PEI for transfection [150]. I propose the use of PEI mediated RNAi and/or overexpression of

109

dominant negative and wildtype SmFox genes in schistosomula. Schistosomula can be

maintained using in vitro culture conditions or in vivo by injection into mice [146].

Downstream analysis would include analysis of knockdown by quantitative PCR and

examination of changes in phenotype of transfected worms, by microscopy. Analysis

would focus on gut, nervous and protonephridial system morphology [23]. For those grown in vivo, additional analysis would include recovered worm burden, and state of reproductive system, as reproductive development requires host/parasite and male/female interactions [151-153]. A challenge of these experiments will be timing of RNAi or overexpression studies to obtain effective results (i.e. in a targetable stage or duration of time available for application of exogenous DNA/RNA).

4.2.2. Where is expression of Fox proteins localized in the different developmental stages of the life cycle?

Determining localization of expression of SmFox proteins would be informative of function of these transcription factors in schistosome development. I propose the generation of custom antibodies and analysis of localization in the stages in which expression is detected. Whole mount in situ hybridization to define localization of gene transcript may be a viable alternative to custom antibody production. Analysis would include confocal microscopy.

4.2.3. What are the upstream regulators and downstream targets of SmFox genes?

Determining the upstream regulators and downstream targets of SmFox genes will

increase our understanding of the roles they play in schistosome development.

110

Bioinformatics analysis of known regulators and targets of Fox genes from other organisms against the S. mansoni genomic database will be useful in determining which factors have homologs in schistosomes [83, 85]. RNAi/overexpression experiments, quantitative PCR, and heterologous systems (i.e. such as yeast and mammalian cell lines) and SmFox mutant proteins can be used to evaluate function of SmFox proteins and their interactions with upstream regulators and downstream targets. Such systems have been used previously for analysis of schistosome gene function [148, 154-156]. Yeast and mammalian cell lines are required due to lack of available schistosome cell lines and challenges with in vitro culture of parasites.

111

Appendix: Immunolocalization of anti-Hsf1 to the acetabular glands of infectious schistosomes suggests a non-transcriptional function for this transcriptional activator

Kenji Ishida1†, Melissa Varrecchia1†, Giselle M. Knudsen3, Emmitt R. Jolly1, 2*

1Department of Biology, 2Center for Global Health and Diseases, Case Western Reserve

University, Cleveland, Ohio, USA

3Department of Pharmaceutical Chemistry, University of California, San Francisco,

San Francisco, California, USA

†These authors contributed equally to this work

*E-mail: [email protected]

Note: Originally published in PLOS NTD, [137]. Section and figure numbers have been adapted for this dissertation, see [137] for copyright information.

112

5.1 Abstract

Schistosomiasis is a chronically debilitating disease caused by parasitic worms of the genus Schistosoma, and it is a global problem affecting over 240 million people.

Little is known about the regulatory proteins and mechanisms that control schistosome host invasion, gene expression, and development. Schistosome larvae, cercariae, are transiently free-swimming organisms and infectious to man. Cercariae penetrate human host skin directly using proteases that degrade skin connective tissue. These proteases are secreted from anucleate acetabular glands that contain many proteins, including heat shock proteins. Heat shock transcription factors are strongly conserved activators that play crucial roles in the maintenance of cell homeostasis by transcriptionally regulating heat shock protein expression. In this study, we clone and characterize the schistosome

Heat shock factor 1 gene (SmHSF1). We verify its ability to activate transcription using a modified yeast one-hybrid system, and we show that it can bind to the heat shock binding element (HSE) consensus DNA sequence. Our quantitative RT-PCR analysis shows that

SmHSF1 is expressed throughout several life-cycle stages from sporocyst to adult worm.

Most interesting, using immunohistochemistry, a polyclonal antibody raised against an

Hsf1-peptide demonstrates novel localization for this conserved, stress-modulating activator. Our analysis suggests that schistosome Heat shock factor 1 may be localized to the acetabular glands of infective cercariae.

113

5.2 Author Summary

Schistosome parasites are the cause of human schistosomiasis and infect more

than 200 million people worldwide. Schistosome larvae, termed cercariae, are a free-

swimming mobile developmental stage responsible for host infection. These larvae

produce enzymes that degrade human skin allowing them to pass into the human host.

After invasion, they continue evade the immune system and develop into adult worms.

The transition from free-swimming larvae in freshwater to invasion into a warm-blooded saline environment requires that the parasite regulate genes to adapt to these changes.

Heat shock factor 1 is a well-characterized activator of stress and heat response that functions in cellular nuclei. Using immunohistochemistry, we observed non-nuclear localization for anti-Heat shock factor 1 signal in the secretory glands necessary for the invasive function of schistosome larvae. This observation expands the potential mechanistic roles for Heat shock factor 1 and may aid in our understanding of schistosome host invasion and early development.

114

5.3 Introduction

Schistosomiasis affects more than 240 million people worldwide, ranking second after malaria in the World Health Organization listing of neglected tropical diseases. [2,

6, 157-160]. Resistance to praziquantel, the primary therapeutic used for decades to treat schistosome infection has been reported [161] and partial efficacy is observed in some patients [162]. Thus, the development of novel drug strategies and alternative treatment options are pressing issues in schistosome research [163].

Understanding host-parasite interactions can lead to novel therapeutic strategies that can interfere with infection or eliminate established infections. For example, topical application of inhibitors against the proteases of infective cercariae can block skin invasion [164, 165]. We have been exploring heat-shock pathway components as a potential essential pathway in larval schistosomes. In protozoan parasites, heat shock proteins are essential for mediating changes in morphology during stage differentiation that are often concurrent with stress-related transitions from insect to mammalian host, or extracellular to intracellular conditions [166-171]. In human cancers, the heat shock proteins chaperone function mediates oncogenic transformation and blocks apoptosis

[172, 173]. In our Schistosoma mansoni system, heat shock proteins 70 and 89 were identified as abundant components of cercarial secretions used for host invasion [174,

175], suggesting a potential role in host-parasite interactions as well.

We have focused on characterizing Heat shock factor 1 in S. mansoni as a route to better understanding the role of heat shock pathway activation in infective larvae.

Schistosome infections occur when the skin of a potential mammalian host is exposed to schistosome larvae in freshwater. The larvae penetrate the skin and begin development

115 into adult worms. Identification of suitable targets via drug screening approaches are ongoing, but challenges remain to translate the results of these screens into useful anti- schistosomal drugs [176-180]. Therefore, a more thorough understanding of basic schistosome biology and schistosome infection strategies is necessary.

Schistosomes require both molluscan and mammalian hosts for parasite development. The free-swimming and infectious schistosome larvae, cercariae, penetrate human skin with the aid of proteolytic enzymes [175, 181-183]. During penetration, cercariae lose their tails, while the cercarial head continues to develop, transforming into the next developmental stage, the schistosomula. After invasion, schistosomula immediately begin host immune system evasion strategies, elongate, and develop into male and female adults. Worms pair in the liver, then travel to the veins of the bladder or small intestine, where they produce eggs, the pathologic agent in schistosomiasis. Once the eggs are excreted and reach fresh water, the eggs hatch into transient and free- swimming miracidia, which invade a molluscan host, develop into mother and daughter sporocysts, and mass produce infectious cercariae [181], completing the life-cycle.

The transformation from infectious cercariae to schistosomula involves not only a morphological change, but also includes a change in temperature (from the temperature of the external water to that of the host body (37°C)) and osmolarity (from relatively hypotonic freshwater to a saline environment in the bloodstream of the human host).

Before transforming into schistosomula, cercariae must first breach the host skin barrier.

Cercariae penetrate human skin by releasing the contents of two sets of acetabular glands

(preacetabular and postacetabular). These glands produce many substances, including the proteolytic enzyme cercarial elastase (which breaks down host skin) and mucins (which

116

enable adhesion to the host skin) [165, 173, 183-187]. In addition, these glands contain a

conglomerate of other proteins such as the heat shock proteins (HSPs) Heat shock protein

70 (Hsp70), Heat shock protein 90 (Hsp90), and Heat shock protein 60 (Hsp60) [174,

175, 182]. After the acetabular glands release their contents, they atrophy to make space for gut and other organ development [188]. Since schistosomula effectively survive the

transformation from cercariae, we reasoned that a heat shock response system could be

involved in schistosome invasion, as well as adaptation to and survival in a warm-

blooded human host.

The heat shock response pathway is a highly conserved and adaptive response

system that has evolved to reduce stress-induced cellular damage (for review, see [189-

191]). When cells are stressed by elevated temperature or by other cellular insults, HSPs such as Hsp70 bind unfolded proteins to prevent protein aggregation [192] and to maintain cellular integrity and organismal viability. A major regulator of the heat shock pathway is Heat shock factor 1 (Hsf1), a transcriptional activator that is critical for positive regulation of HSP transcript levels such as those of HSP70 [191, 193]. Under non-stress conditions, HSPs are thought to interact with Hsf1 and sequester its

transcriptional activity [194, 195]. Under heat stress conditions, HSPs release Hsf1,

allowing it to activate the transcription of HSP70 and other genes encoding HSPs.

Recently, the view that heat shock factors (HSFs) function solely to regulate the

heat shock pathway has been changing [196]. Mounting evidence suggests that HSFs

have complex roles in development. In Drosophila, the HSF gene functions in oogenesis

and larval development [197], and in mice, mutations in the HSF gene result in

developmental defects, infertility, retarded growth and lethality [198]. Similarly, HSF

117

promotes an extended lifespan in Caenorhabditis elegans [199, 200], and is involved in the regulation of apoptosis in cancer cell lines [201, 202].

Parasitic schistosomes have a gene encoding Hsf1 [203, 204] that responds to heat

stress [205, 206]. A role for Hsf1 in the transformation from free-swimming cercariae to

skin schistosomula has not been described. We reasoned that this transformation involves

a heat shock response. To begin to address this question, we verified the existence of an

HSF1 homolog in the infective stage of schistosomes, tested its ability to activate

transcription, assessed its expression profile across different schistosome developmental

stages, and examined its capacity to bind DNA. We report here the identification of an

antibody, raised against a sequence from SmHSF, which specifically labels the acetabular

glands of invasive cercariae, an observation which may have potential implications for

novel functions of SmHsf1 in schistosome host invasion and development.

5.4 Materials and Methods

5.4.1 Animals and parasites

Infected Biomphalaria glabrata snails (strain NMRI, NR-21962) were obtained

from the Biomedical Research Institute (BRI, Rockville, MD). Schistosoma mansoni

cercariae were shed from B. glabrata snails as previously described [207]. Sporocyst

stage parasites were dissected from these snails.

5.4.2 Preparation of schistosomal RNA

Sporocyst, cercaria, and 4-hour schistosomulum, S. mansoni were each suspended in TRIzol reagent (Invitrogen, Carlsbad, CA) and homogenized by Dounce homogenization. As per manufacturer’s instructions for the PureLink RNA Mini kit

(Invitrogen), the samples were then centrifuged, and a phenol-chloroform extraction was

118

performed on the supernatant, followed by DNAse I treatment. The eluted RNA was

quantitated on a ND-8000 spectrophotometer (Thermo Scientific, Waltham MA). Adult

stage and uninfected B. glabrata snail RNA was obtained from the BRI.

5.4.3 Cloning

Reverse transcriptase polymerase chain reaction (RT-PCR) was performed using

mixed schistosome RNA (from sporocyst, cercaria, schistosomulum, and adult stages)

and Superscript III/Platinum Taq RT-PCR kit (Invitrogen) with forward primer oKI001

(5’- CATATGATGTATGGTTTCACATCTGGACCTCCTGTA-3’) and reverse primer oKI002 (5’- GAATTCTCATTCCAATTCTTCCTCACAAAAATCAGG-3’) (Integrated

DNA Technologies, Coralville, IA) for the schistosome gene Smp_068270

(www.genedb.org) and with cycling conditions: single cycle of (45°C for 30 min, 95°C

for 2 min) and 25 cycles of (94°C for 30 sec, 50.4°C for 30 sec, 72°C for 2.5 min) with a

final extension at 72°C 10 min. The RT-PCR product was subcloned into the SmaI restriction site of the pGBKT7 vector (Clontech) to make plasmid pKI003, and sequenced (Elim Biopharmaceuticals, Hayward, CA) for verification.

5.4.4 Yeast transformation and modified yeast one-hybrid

Saccharomyces cerevisiae yeast strain AH109 was transformed for a modified yeast one-hybrid experiment (with pKI003 in this study) as previously described [208,

209]. Yeast cells were plated on synthetic dextrose medium lacking tryptophan (SD-Trp).

Transformed colonies were patched onto SD-Trp plates overlaid with 1000 μg 5-bromo-

4-chloro-3-indolyl-α-D-galactopyranoside (X-α-Gal) and incubated at 30°C for 1 day.

The yeast cells were used for a serial dilution growth test, for which the cells were grown to saturation in SD-Trp medium, diluted to a 600 nm absorbance (A600) value of 0.85 (“1”

119

in the dilution series), serially diluted from 1 to 10-5, and grown on synthetic dextrose

medium lacking histidine or adenine (SD-His or SD-Ade) plates at 30°C for 3 and 4 days, respectively.

5.4.5 Electrophoretic mobility shift assay (EMSA)

Biotin-labeled and non-labeled oligonucleotide probes containing DNA binding sequences were designed and obtained from Integrated DNA Technologies. The double- stranded, biotin-labeled oligonucleotide oKI068(ds)(5’-Biotin- ttagaagccgccgagagatct[aGAAagTTCtaGTAc]agatctacggaagactctcct-3’) contains the genomic DNA sequence 112 base pairs upstream of the translation start site (-112) for

Smp_106930, the schistosome HSP70 homolog; the brackets indicate the heat shock binding element (HSE), which closely resembles the HSE consensus sequence, a repeating inverted pentameric sequence (nGAAnnTTCnGAAn) [196, 198, 210, 211].

Unlabeled oligonucleotides used for competition experiments include: oKI032 (5’- ttagaagccgccgagagatct[aGAAagTTCtaGTAc]agatctacggaagactctcct-3’) and oKI033

(reverse complement of oKI032), which match the sequence of oKI068(ds); oKI030 (5’- ttagaagccgccgagagatct[cGAAtTTCgaCTAg]agatctacggaagactctcct-3’) and oKI031

(reverse complement of oKI030), which contain the genomic sequence 239 base pairs upstream of the translation start site of SmHSP70 (-239); oKI034 (5’- ttagaagccgccgagagatct[cGAAtTTCg]agatctacggaagactctcct-3’) and oKI035 (reverse complement of oKI034), which contain a shortened binding sequence from -239; oKI036

(5'-ttagaagccgccgagagatct[aCTTagTTCtaGTAc]agatctacggaagactctcct-3') and oKI037

(reverse complement of oKI036), which contain three mutated nucleotides in the first pentameric repeat from -112; double-stranded oligonucleotide oAT012(ds)(5’-

120

gctgaaggat[CTAAAAATAG]gcggatcggc-3’), which contains a DNA binding sequence

for the putative schistosome myocyte enhancer factor 2 [208]; and oKI073 (5’-

gatcgtcat[aGAAagTTCtaGAAc]gatc-3’) and oKI074 (reverse complement of oKI073),

which contain the HSE consensus sequence [211]. To make the oligonucleotide probes

double-stranded, matched single-stranded oligonucleotides were incubated at 100°C for 2

minutes, after which the temperature was reduced by 1°C each minute, ending when the

temperature reached 30°C. The oligonucleotide names and sequences are summarized in

Table S1.

Biotin-labeled DNA was detected using the LightShift chemiluminescent EMSA

kit (Thermo Scientific) according to the manufacturer’s guidelines. Briefly, 3.5 μg each

of purified maltose binding protein (MBP) and MBP-SmHsf1 fusion protein was incubated with 100 fmol of the biotin-labeled oligonucleotide probes either alone or together with 25 pmol of non-labeled oligonucleotide probes in binding buffer, glycerol,

MgCl2, poly-dIdC (nonspecific DNA competitor), and NP-40 detergent for 30 minutes.

The protein-DNA complexes were run on a 5% native polyacrylamide gel in 0.5× TBE at

200 V for 1 hour, transferred to a nylon membrane in 0.5× TBE at 350 mA for 1 hour, and crosslinked on a CL-1000 Ultraviolet Crosslinker (CVP) at an energy setting of 120 mJ/cm2. After crosslinking, the membrane was blocked, incubated with a stabilized

streptavidin-horseradish peroxidase conjugate, washed, incubated with luminol/enhancer

and stable peroxide solution, and visualized on a CCD camera (Fotodyne, Hartland, WI).

5.4.6 Comparison of protein sequences

Hsf1 protein sequences from Schistosoma mansoni (GeneDB, Smp_068270.2),

Schistosoma japonicum (GeneDB, Sjp_0064040), Caenorhabditis elegans (GenBank:

121

AAS72410.1), Saccharomyces cerevisiae (Saccharomyces genome database, strain

S288C: YGL073W), Drosophila melanogaster (NCBI RefSeq: NP_476575.1), Xenopus

laevis (NCBI RefSeq: NP_001090266.1), Mus musculus (GenBank: AAH94064.1), and

Homo sapiens (NCBI RefSeq: NP_005517.1), along with the protein sequence

corresponding to the conserved domain of Hsf1 (NCBI conserved domains,

Cdd:smart00415) [163, 164, 212], were aligned using ClustalW2

(http://www.ebi.ac.uk/Tools/msa/clustalw2/) [161, 162] using the default parameters.

TreeViewX software was used to generate a phylogram.

5.4.7 Quantitative reverse transcriptase polymerase chain reaction (qRT-PCR)

Primers specific to Smp_068270.2 (forward primer oKI040: 5’-

TGGTAATGACGAGTGTGACGTA-3’, reverse primer oKI042: 5’-

TCAACATTAAGGCCTACAGGAAA-3’) were designed using the Primer3 web applet

[213, 214]. One microgram each of sporocyst, cercaria, 4-hour schistosomulum, and adult stage RNA was subjected to a reverse transcriptase reaction with oligo dT (Promega), and

50 ng of the resulting cDNA was used for a relative ΔΔCT quantitative PCR using SYBR

Green PCR Master Mix (Applied Biosystems) and primers oEJ548 (5’-

AGTTATGCGGTGTGGGTCAT-3’) and oEJ549 (5’-TGCTCGAGTCAAAGGCCTAC-

3’) with cytochrome c oxidase subunit 2 (TC7399, TIGR database) as the reference gene. qRT-PCR products are intron-spanning. All experiments were done in triplicate. A two- tailed t-tested was applied to ΔCT values as the statistical test to determine significant

differences in transcript expression levels relative to the cercaria stage.

122

5.4.8 Recombinant protein purification

Smp_068270.2 was subcloned into pMAL-c5X (NEB) at NdeI and EcoRI by ligation using T4 DNA ligase (NEB, Ipswitch, MA) to make plasmid pKI058, and transformed into BL21(DE3) chemically competent E. coli bacterial cells (Invitrogen).

BL21(DE3) cells carrying either plasmid pKI058 or empty vector pMAL-c5X were induced with isopropyl β-D-1-thiogalactopyranoside (IPTG, Sigma-Aldrich, Saint Louis,

MO) to a concentration of 0.4 mM at 37°C for 6 hours, and cell pellets were frozen overnight. Cells were lysed by pulse sonication (Sonifier 250, Branson, Danbury, CT) in a phosphate lysis buffer (50 mM potassium phosphate at pH 8.0, 200 mM NaCl) containing 10 mM phenylmethylsulfonyl fluoride (PMSF) and 100 μL Halt Protease

Inhibitor Cocktail (Thermo Scientific). The lysate was cleared by centrifugation at 10,000

× g for 30 minutes at 4°C (Sorvall), and the cleared supernatant was incubated with amylose resin beads (NEB) at 4°C overnight with gentle rocking. Purified protein (MBP and MBP-SmHsf1, respectively, from pMAL-c5X and pKI058) was eluted from the amylose beads (50 mM potassium phosphate at pH 8.0, 200 mM NaCl, 10 mM maltose), dialyzed against 3 changes of protein storage buffer (20 mM HEPES pH 7.9, 100 mM

KCl, 0.1 mM EDTA, 1 mM DTT, 50% glycerol) Slide-a-lyzer, Thermo Scientific) and concentrated with 30k and 50k MWCO Amicon columns (Millipore, Billerica, MA). The proteins were quantified using the Bradford reagent (Bio-Rad, Hercules, CA) and an ND-

8000 spectrophotometer (Thermo Scientific).

5.4.9 Custom antibody production

A polyclonal antibody raised in New Zealand white rabbits against the peptide with sequence Cys-KYKKEPIRKQHKI from Smp_068270 (SmHsf1) was designed and

123 purchased (Pacific Immunology, Ramona, CA). The peptide sequence used for antibody production was Blasted against the NCBI schistosome protein database to prevent production of an antibody cross-reactive with other schistosome proteins. IgG was purified from the pre-immune serum using Melon Gel IgG Spin Purification Kit (Thermo

Scientific).

5.4.10 Western blotting

To detect SmHsf1 protein, 1 μg purified MBP, 1 μg and 7 μg MBP-SmHsf1 fusion, and approximately 5 μg of cercarial protein extract were resolved on a 5% polyacrylamide gel and transferred to nitrocellulose membranes in ice-cold Towbin transfer solution (25 mM tris, 192 mM glycine, 20% methanol) at 400 mA for 2 hours.

Following the transfer, the membranes were blocked in 5% milk dissolved in phosphate buffered saline, 0.1% Tween-20 (PBSTw) on an orbital shaker at room temperature for 1 hour. Purified IgG from pre-immune serum or immune serum was added to a concentration of 0.5 µg/mL, and the membranes were gently rocked at 4°C overnight.

The membranes were washed in PBSTw on an orbital shaker for 5, 10, and 15 minutes, after which an HRP-linked goat anti-rabbit secondary antibody (GE Healthcare) was added at a dilution of 1:2500 in 1% milk/PBSTw, followed by orbital shaking at room temperature for 1 hour and washing in PBSTw. Amersham ECL Western blotting detection reagent (GE Healthcare) was added (2 mL per nitrocellulose membrane) and incubated at room temperature for 1 minute before the membranes were exposed to autoradiography film.

124

5.4.11 Immunohistochemistry

A protocol adapted from Collins et al. (2011) was used to prepare samples for

immunohistochemistry [25]. Briefly, cercariae were fixed for 20 minutes at room

temperature in a 4% paraformaldehyde/PBSTw (PBS/ 0.1% Tween-20) solution, washed

in PBSTw, then dehydrated in a methanol/PBSTw series and stored in 100% methanol at

-20°C until use. Prior to use, cercariae were rehydrated, digested for 10 minutes at room

temperature in permeabilization solution (1× PBSTw, 0.1% SDS, and proteinase K (1

µg/mL)), and washed in PBSTw (all subsequent washes were carried out with nutation at

room temperature). Cercariae were re-fixed for 10 minutes at room temperature in a 4%

paraformaldehyde/PBSTw solution, and washed in PBSTw. Samples were incubated with

rocking in block solution (PBSTw, 5% horse serum (Jackson ImmunoResearch

Laboratories, West Grove, PA), 0.05% Tween-20, and 0.3% Triton X-100) for 2hrs at RT or overnight at 4°C. Samples were incubated with a polyclonal primary rabbit anti-

SmHsf1 antibody (described above) in block solution at a concentration of 0.6 µg/mL or

2.5 μg/mL, overnight at 4°C and washed >2hrs at room temperature. Samples were then incubated with an Alexa 647 donkey anti-rabbit antibody (Jackson ImmunoResearch

Laboratories) at a concentration of 1:400 or 1:800 in block solution, overnight at 4°C.

Samples were washed in PBSTw (>2hrs), at room temperature with the second wash containing DAPI (1 µg/mL). After washing, samples were mounted in Slow Fade Gold

(Invitrogen, Grand Island, NY). Pre-immune serum IgG (5 µg/mL), and no primary controls were run in parallel with experimental samples. For the no primary controls, samples were incubated in block solution alone during the primary incubation step.

125

5.4.12 Imaging

All samples were mounted in Slow Fade Gold mounting media. Samples were

imaged on a Zeiss LSM 510 META confocal microscope (Carl Zeiss, Germany) (Plan-

Apochromat 63×/1.2 W objective). The Alexa 647 fluorophore was excited with a 633

nm laser and the DAPI with a 405 nm laser. Images were processed using Zeiss LSM

Image Browser (Carl Zeiss) or ImageJ.

5.5 Results

5.5.1 Schistosome Hsf1 is a transcriptional activator.

Hsf1 proteins function as activators of transcription. To test whether the Hsf1

protein from schistosomes (Smp_068270.2) is able to activate transcription, we

performed a modified yeast one-hybrid analysis as previously described [208, 209].

Briefly, we made an N-terminal fusion of the DNA binding domain of the yeast

Galactose 4 protein (Gal4DBD) with SmHSF1 to make the fusion protein Gal4DBD-

SmHsf1. Gal4DBD can bind DNA, but it cannot activate transcription because its

transactivation domain has been removed. The Gal4DBD-SmHsf1 fusion protein was expressed in a yeast strain that is auxotrophic for histidine and adenine (see Materials and

Methods). Genes for alpha galactosidase (encoded by MEL1), histidine metabolism

(encoded by HIS3), and adenine metabolism (encoded by ADE2), are regulated by promoter elements dependent on Gal4 binding and activation; these genes were used as reporters.

Expression of the Gal4DBD-SmHsf1 protein in yeast cells resulted in the induction of the MEL1 reporter gene, which was visualized by blue-colored yeast cells on

SD-Trp/X-α-Gal plates (Figure 5.1A). To test whether SmHsf1 could also induce HIS3

126

and ADE2 reporter gene expression, yeast cells were selected for growth and viability by

a serial dilution assay on synthetic medium lacking the respective nutritional marker (SD-

His, SD-Ade). Yeast not expressing the selectable markers cannot survive. We found that

yeast cells expressing Gal4DBD-SmHsf1 protein were viable and conferred histidine and adenine prototrophy to these cells (Figure 5.1B, 5.1C). Yeast cells expressing only the

Gal4DBD were unable to induce activity from any reporter: they showed no blue color on

SD-Trp/X-α-Gal plates and were not viable on SD-His and SD-Ade plates, while the positive control yeast cells expressing the full length Gal4 activator (Gal4Full) showed blue color on SD-Trp/X-α-Gal plates and were viable on SD-His and SD-Ade plates

(Figure 5.1) These data demonstrate that SmHsf functions as a transcriptional activator.

127

Figure 5.1. SmHsf1 can drive transcription in a modified yeast one-hybrid system.

Yeast cells expressing SmHsf1 fused to the Gal4 DNA binding domain (Gal4DBD-

SmHsf1) were patched (A) or serially diluted (B and C, from 1 to 10-5) on different

selective media to test the ability of SmHsf1 to activate transcription. The positive control yeast express a complete GAL4 gene (Gal4Full) and the negative control yeast express the GAL4 DNA binding domain alone (Gal4DBD). (A) Blue color on SD-Trp with X-α-

128

Gal indicates expression of the MEL1 reporter gene. (B and C) Growth on the SD-His and SD-Ade plates indicates expression of the HIS3 and ADE2 reporter genes, respectively, and are essential for cell viability.

5.5.2 SmHsf1 recognizes the heat shock DNA binding element from the schistosome

HSP70 promoter.

Heat shock factors recognize promoter sequences that regulate several heat shock response genes (such as HSP70) by binding to heat shock factor DNA binding elements

(HSEs) consisting of repeating inverted pentameric sequences: nGAAnnTTCnnGAAn

[196, 210]. We tested whether SmHsf1 can bind to the HSE located 112 base pairs from the translation start site of the SmHSP70 gene using an electrophoretic mobility shift assay (EMSA) (Figure 5.2). Recombinant, purified MBP-SmHsf1 fusion protein was incubated with a double-stranded DNA (dsDNA) oligonucleotide probe, oKI068(ds), containing the HSE from the SmHSP70 promoter (Figure 5.2, lane 3). The dsDNA oligonucleotide sequence was labeled with biotin for chemiluminescent EMSA detection

(see Materials and Methods). Unlabeled dsDNA oligonucleotide probes were used for competition experiments and matched the following: 1] an HSE sequence found at -239 base pairs from the SmHSP70 translation start site (DNA oligonucleotide pair oKI030/031), 2] an HSE sequence found at -112 base pairs from the SmHSP70 translation start site (DNA oligonucleotide pairs oKI032/033), 3] an HSE sequence found at -239 base pairs from the SmHSP70 translation start site lacking the third pentameric repeat (DNA oligonucleotide pair oKI034/035), 4] an HSE sequence found at -112 base pairs from the SmHSP70 translation start site with three base pairs of the first pentameric repeat mutated (DNA oligonucleotide pair oKI036/037), 5] a negative control sequence

129

reported to bind the putative schistosome Myocyte enhancer factor 2 (dsDNA

oligonucleotide oAT012(ds)) [208]; and the HSE consensus sequence (DNA

oligonucleotide pair oKI073/074) (Figure 5.2, lanes 4-9) [211]. Consistent with previous

findings [203, 211], we found that MBP-SmHsf1 binds the HSE from the schistosome

HSP70 promoter. Our competition experiments show that MBP-SmHsf1 also recognizes the consensus HSE with great affinity (Figure 5.2, lane 9). The HSE consensus sequence is found in the promoter region of Drosophila HSP70 [160, 215].

130

Figure 5.2. SmHsf1 binds the heat shock binding element from the schistosome

HSP70 promoter.

Recombinant SmHsf1 cloned as a fusion protein with maltose binding protein (MBP-

SmHsf1), or maltose binding protein (MBP) alone, was incubated with the double- stranded biotin-labeled oligonucleotide oKI068(ds) containing the heat shock binding element sequence from the schistosome HSP70 promoter. Unlabeled competitor

131

oligonucleotide probes were added at a 250-fold molar excess relative to oKI068(ds) in lanes 4-9. Labeled DNA was detected by chemiluminescence. Oligonucleotide sequences for the probes are shown in Table S5.8.1.

This led us to compare the protein sequence of the conserved domain (which

contains the DNA binding domain) of SmHsf1 to that of Hsf1 from other species using

ClustalW2 (Figure 5.3). Our analysis showed the expected result that Hsf1 from

Schistosoma mansoni and the related species, Schistosoma japonicum, cluster together.

However, these flatworm Hsf1 sequences appear to cluster more closely to sequences

from Drosophila than to those from other organisms, including the roundworm C.

elegans.

132

Figure 5.3. Phylogram of SmHsf1.

Protein sequences of the Hsf1 conserved domain from various species were aligned using

ClustalW2, and the phylogram was generated using TreeViewX software. The following settings were used for the protein alignment: Protein Weight Matrix (Gonnet); Gap open

(10); Gap extension (0.20), Gap distances (5); No end gaps allowed; Single iteration;

Clustering (NJ).

5.5.3 SmHSF1 is expressed across schistosome developmental stages.

To determine the expression level of SmHSF1 during schistosome development, we used quantitative reverse transcriptase PCR (qRT-PCR) to assess SmHSF1 transcript levels from sporocyst, cercaria, 4-hour schistosomula, and adult stages. Relative to the cercaria stage, SmHSF1 was expressed 2.3, 1.8, and 1.4-fold in sporocyst, 4-hour schistosomula, and adult stages, respectively (Figure 4, p < 0.05). Thus, for all schistosome developmental stages analyzed, SmHSF1 is expressed. Values of ΔCT were used for a two-tailed t-test to determine significant differences in expression levels.

Figure 5.4. SmHSF1 is expressed across several schistosome life-cycle stages.

133

qRT-PCR of SmHSF1 transcript was performed on sporocyst, cercaria, 4-hour

schistosomula, and adult stages with 3 replicates. Cytochrome c oxidase was used as the

reference gene and cercaria as the reference stage. The ΔΔCT method was used to analyze

the qRT-PCR data.

5.5.4 A polyclonal antibody detects the SmHsf1 protein.

A custom polyclonal antibody was designed against peptide sequence (Cys-

KYKKEPIRKQHKI) that is common to the known splice variants of the SmHsf1 protein.

Prior to antibody production, the peptide sequence was compared to known schistosome

protein sequences by BLASTP search and no statistically significant alignment to other

proteins was identified. To test whether the antibody recognizes SmHsf1, we expressed

and purified SmHsf1 as a fusion protein to the maltose binding protein (MBP-SmHsf1) to increase solubility and to aid in purification. We performed a Western blot on the recombinant MBP-SmHsf1 and cercarial protein extract separated by SDS-PAGE, using both pre-immune serum and the purified polyclonal anti- SmHsf1 antibody. (Figure 5.5).

The antibody detected bands at approximately 130, 110, and 70 kDa for the recombinant

MBP-SmHsf1 fusion protein (Figure 5.5, lanes 2 and 3), all of which were sequence confirmed to contain Hsf1 protein by LC-MS/MS. In cercarial extract, bands were observed at approximately 110, 65, and 50 kDa for the cercarial protein extract, (Figure

5.5, lane 4), and no non-specific reactivity was observed to the extract using IgG from pre-immune serum (Figure 5.5, lane 5). In the context of highly abundant background proteins in a complex lysate, it was not possible to detect Hsf1 peptides in the 110, 65, and 50 kDa bands from cercarial extract.

134

The expected molecular weight of SmHsf1 is approximately 73 kDa in molecular

weight, which when fused to 42 kDa MBP should result in an approximately 115 kDa

MBP-SmHsf1 fusion protein. Since Hsf1 can be highly post-translationally modified

[216], we assessed whether treatment with alkaline phosphatase or deglycosidase could

collapse the higher molecular weight bands at 130 and 110 kDa, but observed no band

shift. Analysis of MBP signal in these recombinant protein bands by Western blot (Figure

S5.8.1) demonstrated a similar band pattern to the anti-SmHsf1 blot. Treatment of recombinant MBP-SmHsf1 with Factor Xa protease produced the desired cleavage result by liberating the 42 kDa MBP; however, after cleavage SmHsf1 is not detected using the antibody against Hsf1, suggesting the Hsf1 protein is not very stable (data not shown).

Figure 5.5. The SmHsf1 antibody recognizes the SmHsf1 protein

Purified IgG from SmHsf1-immunized rabbit bleeds (lanes 1-4) or pre-immune serum

(lane 5) were used in a Western blot to test for reactivity against bacterially expressed recombinant proteins and cercarial extract (lane 1), 1 µg MBP negative control (lane 2), 1

135

µg MBP- SmHsf1 fusion protein (lane 3), 7 µg MBP- SmHsf1 fusion protein (lanes 4 &

5), 7 µg cercarial extract.

5.5.5 Antibody raised against SmHSF1 localizes to the acetabular glands of S.

mansoni cercariae.

We used indirect immunohistochemistry to determine the location of SmHsf1

expression in fixed cercariae (Figure 5.6 and 5.77; Movie S5.8.1-S5.8.5). We predicted

that SmHsf1 should produce punctate staining to nuclei throughout the cercariae. We reasoned this because as a transcription factor, Hsf1 is usually localized to the nucleus to induce activation of HSPs [191, 193]. To our surprise, we observed targeted SmHsf1 localization to the cercarial acetabular glands, which run the length of, and comprise a large percentage of, the cercarial head (Figures 5.6I, 5.6K and 5.7; Movie S5.8.1 and

S5.8.4). Cercarial acetabular glands are composed of three pairs of postacetabular and two pairs of preacetabular glands, whose secretions are thought to be involved in host invasion [185, 217, 218]. These anucleated glands are unicellular, have large fundi located anterior and posterior to the acetabulum (i.e., pre and post), and have ducts composed of long cellular processes that extend anteriorly to the tip of the oral sucker

[22, 217]. Both sets of glands are filled with secretory granules whose contents are thought to be involved in attachment to, and subsequent penetration of, the definitive host. The postacetabular glands contain secretory granules of mucigen, and the preacetabular gland granules contain proteinases [183, 185, 218, 219]. Labeling with the

SmHsf1 antibody occurred along the length of the glands, rather than being restricted to the fundus as might be expected of a transcription factor (Figures 5.6I and 5.7; Movie

S5.8.1 and S5.8.4). Our data show that SmHsf1 is primarily localized to the

136

postacetabular glands. Additionally, SmHsf1 localization and DAPI staining seem to be

mutually exclusive (Movie S5.8.3). The no primary and pre-immune controls did not

show labeling (Figure 5.6, panels A and E, respectively).

Figure 5.6. SmHsf1 is localized to the acetabular glands in S. mansoni cercariae. (A-

L) Single, representative confocal sections of cercariae. A custom, rabbit polyclonal

primary antibody against S. mansoni Heat shock factor 1 protein (SmHsf1) and a donkey anti-rabbit Alexa 647 secondary antibody were used to detect SmHsf1 in cercariae. (A-D)

No primary negative control. The anterior region (mouth) is located near the bottom of

the panels. (E-H) Pre-immune serum IgG negative control. The anterior region is located

to the left. (I-L) Anti-SmHsf1. In panel I, SmHsf1 is localized to the acetabular glands

(red) which traverse the entire head of the cercariae from the posterior (left) to anterior

137

(bottom right). Panels B, F, and J are stained with DAPI. Panels C, G, and K are merged

Alexa 647 and DAPI images. Panels D, H, and L are Differential Interference Contrast

(DIC) images for each treatment.

Figure 5.7. Antibody raised against SmHsf1 localizes to the acetabular glands

extending the entire length of the S. mansoni cercarial head. Immune staining, as in

Figure 6, was used to localize anti-SmHsf1 signal (red) to acetabular glands of the S. mansoni cercariae. The anterior (mouth) is to the bottom left of the image. The image is a maximum confocal projection, and the magnification is with a 63×/1.2 W objective.

5.6 Discussion

Hsf1 proteins are highly conserved and well-characterized transcriptional

activators. Hsf1 in schistosomes has been previously described [203, 211, 220]. We

expand the initial observations on SmHsf1, and we increase our knowledge of this

138

protein. Hsf1 functions as a transcriptional activator of HSPs in other systems. We cloned

the SmHSF1 gene and assessed whether SmHsf1 functions as an activator in a

heterologous yeast reporter system. Our results confirm that SmHsf1 is a positive

regulator of transcription (Figure 5.1). Using qRT-PCR, we show that SmHSF1 transcript is expressed in all stages tested, but that the level of SmHSF1 is relatively high in sporocysts and relatively low in cercariae. Our findings of transcript levels of SmHSF1

support the idea that a larger pool of heat shock proteins is required to maintain cell

homeostasis in sporocysts because of their elevated protein levels for the mass production

of cercariae [221]. Alternatively, this may reflect the general lower transcript levels

observed in cercariae, or priming of cercarial transcripts by production of some cercarial

transcripts in sporocysts.

The transcript levels of the Hsf1 target, SmHSP70, do not change in response to

salt or temperature increases in cercariae as expected of a stress response gene [205]. It

was speculated that the lack of increase in HSP70 transcript levels in cercariae prior to

the loss of the cercarial tail during transformation is due to tail-dependent inhibitory

signals that terminate the transcription of HSP70 [205]. In support of these observations,

we found that the HSP activator, SmHsf1 protein, is primarily localized to the cercarial

acetabular glands, which are unicellular and lack nuclei [22, 217]. We also found that the

SmHsf1 staining does co-localize with the DAPI nuclear stain elsewhere in the cercariae.

Thus, it appears that in the absence of nuclear localization, cercarial SmHsf1 would be

unable to induce the transcription of new HSPs, including HSP70, despite expectations

for this transformation to be a high stress condition. Furthermore, localization of anti-

SmHsf1 signal to cercarial acetabular glands is suggestive of alternative function for this

139 transcription factor. This motivates our further research into the specificity of this novel immunolocalization..

The schistosome acetabular glands are long, unicellular structures that produce, store, and release a variety of substances such as mucins and elastases/proteinases to assist in adhesion and invasion of human skin [217]. Curiously, SmHsf1 has not been detected in cercarial secretions [174, 175], suggesting that SmHsf1 protein may be bound directly or indirectly to the acetabular cell membrane. At the time of host invasion, the acetabular glands are no longer nucleated [22, 217], raising the possibility of an alternative function for SmHsf1 beyond a transcriptional role in cercariae and newly transformed schistosomula. SmHsf1 may be required for the production of chaperone proteins during the development of the glands in early embryonic cercariae in the molluscan host. After fragmentation of the gland nucleus, SmHsf1 could be released into the cytoplasm, where it can interact with membrane-associated proteins (SmHsf1 has no known transmembrane domains), facilitating SmHsf1 to remain bound to the glands during the secretion of other gland contents. A non-nuclear Hsf1 is also observed in non- small cell lung cancer line cells, in which Hsf1 associates with and disables the anti- apoptotic membrane-bound Ralbp1 protein [201, 202]. One scenario is that SmHsf1 functions to block a related anti-apoptotic factor, allowing apoptosis of the glands to occur. Indeed, in 5-day old schistosomula, the acetabular glands are disintegrated [188], and our immunohistochemical analysis using the anti-SmHsf1 antibody shows no acetabular SmHsf1 localization in 5-day old schistosomula (data not shown). SmHsf1 could be involved in the degradation of acetabular glands in schistosomula, allowing space for the development of organs such as the gut. Additional investigation is required

140

to reveal the mechanism by which SmHsf1 remains in the glands, and whether it

contributes to the controlled disintegration of the glands, will be of significant interest. In

addition, our data suggest that the anti-SmHsf1 antibody is primarily localized to the postacetabular glands in cercariae, although we do not exclude the preacetabular glands.

It is not clear why there appears to be a preference for the postacetabular glands, responsible for the deposition of cercarial mucins and for providing an adhesive substrate for the parasite to remain attached to host skin [185, 217].

Hsf1 and HSPs could play even broader roles in schistosome developmental regulation. Hsp70 was identified as being responsible for mediating the association and dissociation of the 26S proteasome in mouse embryonic fibroblasts [170]. The 26S

proteasome is a conserved set of proteins that function in protein turnover and protein

recycling, cell cycle progression through degradation of cyclins, and modulation of cell

death [166-169, 171]. A major component of the 26S proteasome, the 20S proteasome is

reported to bind tightly to Hsp90 in schistosomes, and it has different forms of reactive

subunits in cercariae relative to newly transformed schistosomula [172], again connecting

the heat shock pathway to cellular development. Examination of the role of SmHsf1 and

HSPs during and after the invasion of human skin not only represents the study of a

potentially novel developmental regulatory mechanism, but it can also help to identify

key proteins necessary for parasite invasion and development that can be used as

therapeutic targets to decrease schistosomula viability in the host. Alternatively,

inhibiting the heat shock pathway in cercariae may have unpredictable effects on the

ability of schistosomes to infect their host. The heat shock system used by schistosome

cercariae during host invasion may also apply to other parasites that undergo

141 environmental transitions, such as Ancylostoma duodenale (hookworm), which transition from soil to host, or Toxoplasma gondii, which transition from extracellular to intracellular during muscle and brain invasion.

Our data demonstrate that the antibody raised against a peptide in SmHsf1 can recognize SmHsf1, but we cannot rule out the possibility that it does not interact with another cercarial protein, and that another protein is responsible for this unique localization to the acetabular glands. Given that our data support previous evidence that the SmHsf1 protein is extremely insoluble and unstable [203], we were unable to statistically identify the protein in cercariae using mass spectrometry. However, if

SmHsf1 is not responsible for this novel acetabular localization and it is another protein, this observation provides a cellular marker and an excellent impetus to begin to explore molecular factors in acetabular regulatory mechanisms as well as an opportunity to further explore host-parasite interactions and parasite development. Understanding the mechanisms for schistosome invasion and development can promote the discovery of novel treatments to combat parasitic infections.

5.7 Acknowledgements

Infected snails and adult RNA were provided to E. Jolly by the BRI via the NIAID

Schistosomiasis resource center under NIH-NIAID contract No. HHSN27220100000051:

Schistosoma mansoni, Strain NMRI-exposed Biomphalaria glabrata, Strain NMRI, NR-

21962. We also thank Ronald Blanton and Blanton Tolbert for helpful discussions, and

Anida Karahodza and Shuang Liang for critical review of the manuscript.

142

5.8 Supplementary Information

Figure S5.8.1. MBP antibody recognizes the MBP-SmHsf1 fusion protein

An antibody against MBP-fused with HRP (Abcam, ab49923) was used in a Western blot

to probe for MBP in recombinant proteins prepared from E. coli. (lane 1) 5 µg MBP

positive control (lane 2) 5 µg intact MBP-SmHsf1 fusion protein (lane 3) 5 µg recombinant MBP-SmHsf1 cleaved with Factor Xa. Signal was detected by chemiluminescence (Pierce ECL western blotting substrate, 32209).

Table S5.8.1. Names and sequences of oligonucleotides used for EMSA.

Movie S5.8.1. Anti-SmHsf1 antibody is localized to the cercarial head.

Z-stack images of an S. mansoni cercarial head showing anti-SmHsf1 localization. The

anterior end the cercarial head is toward the bottom right.

Movie S5.8.2. DAPI staining of the cercarial head.

Z-stack images of an S. mansoni cercarial head stained with DAPI. The anterior end of

the cercarial head is toward the bottom right.

Movie S5.8.3. Anti-SmHsf1 and DAPI staining in the cercarial head.

143

Merged z-stack images of an S. mansoni cercarial head showing anti-SmHsf1 localization

and DAPI staining. The anterior end of the cercarial head is toward the bottom right.

Movie S5.8.4. Rotational view of the cercarial head showing anti-SmHsf1

localization.

Maximum projection images are shown. The anterior end of the cercarial head is toward

the bottom.

Movie S5.8.5. Rotational view of the cercarial head stained with DAPI.

Maximum projection images are shown. The anterior end of the cercarial head is toward the bottom.

144

Bibliography

1. WHO. Schistosomiasis. Available from: www.who.int. 2. Steinmann, P., et al., Schistosomiasis and water resources development: systematic review, meta-analysis, and estimates of people at risk. Lancet Infect Dis, 2006. 6(7): p. 411-25. 3. Colley, D.G., et al., Human schistosomiasis. The Lancet, 2014. 383(9936): p. 2253-2264. Regarding Figure 1.1: Reprinted from The Lancet, 368(9541), Gryseels et al, Human schistosomiasis, p. 1106-18, 2006, with permission from Elsevier. Reprinted in this dissertation from Colley, et al, 2014, with permission from Elsevier. 4. (WHO), W.H.O., Schistosomiasis and soil-transmitted helminthiases: number of people treated in 2015, in Weekly Epidemiological record. 2016, World Health Organization. p. 585-600. 5. Tchuem Tchuente, L.A., et al., Moving from control to elimination of schistosomiasis in sub-Saharan Africa: time to change and adapt strategies. Infect Dis Poverty, 2017. 6(1): p. 42. 6. Gryseels, B., et al., Human schistosomiasis. Lancet, 2006. 368(9541): p. 1106-18. 7. Basch, P., Schistosomes: Development, reproduction, and host relations. 1991, New York: Oxford University Press. 8. Colley, D.G., et al., Human schistosomiasis. Lancet, 2014. 383(9936): p. 2253-64. 9. Burke, M.L., et al., Immunopathogenesis of human schistosomiasis. Parasite Immunol, 2009. 31(4): p. 163-76. 10. Ross, A.G., et al., Katayama syndrome. Lancet Infect Dis, 2007. 7(3): p. 218-24. 11. Goddard, M.J. and P. Jordan, On the longevity of Schistosoma mansoni in man on St. Lucia, West Indies. Trans R Soc Trop Med Hyg, 1980. 74(2): p. 185-91. 12. Harris, A.R., R.J. Russell, and A.D. Charters, A review of schistosomiasis in immigrants in Western Australia, demonstrating the unusual longevity of Schistosoma mansoni. Trans R Soc Trop Med Hyg, 1984. 78(3): p. 385-8. 13. VieiraPaulo, et al., Latent Schistosomiasis in Portuguese Soldiers. Military Medicine, 2007. 172(2): p. 144-146. 14. Zwang, J. and P.L. Olliaro, Clinical efficacy and tolerability of praziquantel for intestinal and urinary schistosomiasis-a meta-analysis of comparative and non- comparative clinical trials. PLoS Negl Trop Dis, 2014. 8(11): p. e3286. 15. Fallon, P.G., Schistosome resistance to praziquantel. Drug Resist Updat, 1998. 1(4): p. 236-41. 16. Danso-Appiah, A. and S.J. De Vlas, Interpreting low praziquantel cure rates of Schistosoma mansoni infections in Senegal. Trends Parasitol, 2002. 18(3): p. 125- 9. 17. Bergquist, R., J. Utzinger, and J. Keiser, Controlling schistosomiasis with praziquantel: How much longer without a viable alternative? Infect Dis Poverty, 2017. 6(1): p. 74. 18. Mutapi, F., et al., Human schistosomiasis in the post mass drug administration era. Lancet Infect Dis, 2017. 17(2): p. e42-e48.

145

19. Collins, J.J., 3rd and P.A. Newmark, It's no fluke: the planarian as a model for understanding schistosomes. PLoS Pathog, 2013. 9(7): p. e1003396. Licensing for Figure 1.2 provided under CC BY (https://creativecommons.org/licenses/by/4.0/). 20. Jr., L.R.a.J.J., Foundations of Parasitology. 8 ed. 2009, New York. 21. Jurberg, A.D., et al., The embryonic development of Schistosoma mansoni eggs: proposal for a new staging system. Dev Genes Evol, 2009. 219(5): p. 219-34. 22. Dorsey, C.H., et al., Ultrastructure of the Schistosoma mansoni cercaria. Micron, 2002. 33(3): p. 279-323. 23. Collins, J.J., III, et al., An Atlas for Schistosoma mansoni Organs and Life-Cycle Stages Using Cell Type-Specific Markers and Confocal Microscopy. PLOS Neglected Tropical Diseases, 2011. 5(3): p. e1009. 24. Lawrence, J.D., The ingestion of red blood cells by Schistosoma mansoni. J Parasitol, 1973. 59(1): p. 60-3. 25. Collins, J.J., 3rd, et al., An atlas for Schistosoma mansoni organs and life-cycle stages using cell type-specific markers and confocal microscopy. PLoS Negl Trop Dis, 2011. 5(3): p. e1009. 26. Skelly, P.J., et al., Schistosome feeding and regurgitation. PLoS Pathog, 2014. 10(8): p. e1004246. 27. Carlsson, P. and M. Mahlapuu, Forkhead transcription factors: key players in development and metabolism. Dev Biol, 2002. 250(1): p. 1-23. 28. Hannenhalli, S. and K.H. Kaestner, The evolution of Fox genes and their role in development and disease. Nat Rev Genet, 2009. 10(4): p. 233-40. 29. Golson, M.L. and K.H. Kaestner, Fox transcription factors: from development to disease. Development, 2016. 143(24): p. 4558-4570. 30. Weigel, D., et al., The homeotic gene fork head encodes a nuclear protein and is expressed in the terminal regions of the Drosophila embryo. Cell, 1989. 57(4): p. 645-58. 31. Lai, E., et al., HNF-3A, a hepatocyte-enriched transcription factor of novel structure is regulated transcriptionally. Genes Dev, 1990. 4(8): p. 1427-36. 32. Weigel, D. and H. Jackle, The fork head domain: a novel DNA binding motif of eukaryotic transcription factors? Cell, 1990. 63(3): p. 455-6. 33. Kaestner, K.H., W. Knochel, and D.E. Martinez, Unified nomenclature for the winged helix/forkhead transcription factors. Genes Dev, 2000. 14(2): p. 142-6. 34. Zhu, G., et al., A dosage-dependent suppressor of a temperature-sensitive calmodulin mutant encodes a protein related to the fork head family of DNA- binding proteins. Mol Cell Biol, 1993. 13(3): p. 1779-87. 35. Hermann-Le Denmat, S., et al., Suppression of yeast RNA polymerase III mutations by FHL1, a gene coding for a fork head protein involved in rRNA processing. Mol Cell Biol, 1994. 14(5): p. 2905-13. 36. Zhu, G., et al., Two yeast forkhead genes regulate the cell cycle and pseudohyphal growth. Nature, 2000. 406(6791): p. 90-4. 37. Lee, H.H. and M. Frasch, Survey of forkhead domain encoding genes in the Drosophila genome: Classification and embryonic expression patterns. Dev Dyn, 2004. 229(2): p. 357-66. 38. Hope, I.A., et al., The forkhead gene family of Caenorhabditis elegans. Gene, 2003. 304: p. 43-55.

146

39. Jackson, B.C., et al., Update of human and mouse forkhead box (FOX) gene families. Hum Genomics, 2010. 4(5): p. 345-52. 40. Mazet, F., et al., Phylogenetic relationships of the Fox (Forkhead) gene family in the Bilateria. Gene, 2003. 316: p. 79-89. 41. Wang, M., et al., Evolutionary selection pressure of forkhead domain and functional divergence. Gene, 2009. 432(1-2): p. 19-25. 42. Clark, K.L., et al., Co-crystal structure of the HNF-3/fork head DNA-recognition motif resembles histone H5. Nature, 1993. 364(6436): p. 412-20. 43. Durocher, D. and S.P. Jackson, The FHA domain. FEBS Lett, 2002. 513(1): p. 58- 66. 44. Hofmann, K. and P. Bucher, The FHA domain: a putative nuclear signalling domain found in protein kinases and transcription factors. Trends Biochem Sci, 1995. 20(9): p. 347-9. 45. Wang, B., et al., Multiple domains define the expression and regulatory properties of Foxp1 forkhead transcriptional repressors. J Biol Chem, 2003. 278(27): p. 24259-68. 46. Cirillo, L.A., et al., Opening of compacted chromatin by early developmental transcription factors HNF3 (FoxA) and GATA-4. Mol Cell, 2002. 9(2): p. 279-89. 47. Kaestner, K.H., The FoxA factors in organogenesis and differentiation. Curr Opin Genet Dev, 2010. 20(5): p. 527-32. 48. Haberman, A.S., D.D. Isaac, and D.J. Andrew, Specification of cell fates within the salivary gland primordium. Dev Biol, 2003. 258(2): p. 443-53. 49. Mavromatakis, Y.E., et al., Foxa1 and Foxa2 positively and negatively regulate Shh signalling to specify ventral midbrain progenitor identity. Mech Dev, 2011. 128(1-2): p. 90-103. 50. Amin, N.M., H. Shi, and J. Liu, The FoxF/FoxC factor LET-381 directly regulates both cell fate specification and cell differentiation in C. elegans mesoderm development. Development, 2010. 137(9): p. 1451-60. 51. Zaffran, S., et al., biniou (FoxF), a central component in a regulatory network controlling visceral mesoderm development and midgut morphogenesis in Drosophila. Genes Dev, 2001. 15(21): p. 2900-15. 52. Perez Sanchez, C., et al., DmFoxF, a novel Drosophila fork head factor expressed in visceral mesoderm. Mech Dev, 2002. 111(1-2): p. 163-6. 53. Andrikou, C., et al., Myogenesis in the sea urchin embryo: the molecular fingerprint of the myoblast precursors. Evodevo, 2013. 4(1): p. 33. 54. Freddie, C.T., et al., Functional interactions between the Forkhead transcription factor FOXK1 and the MADS-box protein SRF. Nucleic Acids Res, 2007. 35(15): p. 5203-12. 55. Shi, X. and D.J. Garry, Sin3 interacts with Foxk1 and regulates myogenic progenitors. Mol Cell Biochem, 2012. 366(1-2): p. 251-8. 56. Hayashi, H. and T. Kume, Foxc transcription factors directly regulate Dll4 and Hey2 expression by interacting with the VEGF-Notch signaling pathways in endothelial cells. PLoS One, 2008. 3(6): p. e2401. 57. Kume, T., K. Deng, and B.L. Hogan, Murine forkhead/winged helix genes Foxc1 (Mf1) and Foxc2 (Mfh1) are required for the early organogenesis of the kidney and urinary tract. Development, 2000. 127(7): p. 1387-95.

147

58. Yamagishi, H., et al., Tbx1 is regulated by tissue-specific forkhead proteins through a common Sonic hedgehog-responsive enhancer. Genes Dev, 2003. 17(2): p. 269-81. 59. Gomperts, B.N., X. Gong-Cooper, and B.P. Hackett, Foxj1 regulates basal body anchoring to the cytoskeleton of ciliated pulmonary epithelial cells. J Cell Sci, 2004. 117(Pt 8): p. 1329-37. 60. Zhang, M., et al., Foxj1 regulates asymmetric gene expression during left-right axis patterning in mice. Biochem Biophys Res Commun, 2004. 324(4): p. 1413- 20. 61. Stubbs, J.L., et al., The forkhead protein Foxj1 specifies node-like cilia in Xenopus and zebrafish embryos. Nat Genet, 2008. 40(12): p. 1454-60. 62. Tisler, M., et al., Cilia are required for asymmetric nodal induction in the sea urchin embryo. BMC Dev Biol, 2016. 16(1): p. 28. 63. Lin, K., et al., daf-16: An HNF-3/forkhead family member that can function to double the life-span of Caenorhabditis elegans. Science, 1997. 278(5341): p. 1319-22. 64. Ogg, S., et al., The Fork head transcription factor DAF-16 transduces insulin-like metabolic and longevity signals in C. elegans. Nature, 1997. 389(6654): p. 994-9. 65. Paradis, S. and G. Ruvkun, Caenorhabditis elegans Akt/PKB transduces insulin receptor-like signals from AGE-1 PI3 kinase to the DAF-16 transcription factor. Genes Dev, 1998. 12(16): p. 2488-98. 66. Lee, R.Y., J. Hench, and G. Ruvkun, Regulation of C. elegans DAF-16 and its human ortholog FKHRL1 by the daf-2 insulin-like signaling pathway. Curr Biol, 2001. 11(24): p. 1950-7. 67. Lin, K., et al., Regulation of the Caenorhabditis elegans longevity protein DAF- 16 by insulin/IGF-1 and germline signaling. Nat Genet, 2001. 28(2): p. 139-45. 68. Lee, S.S., et al., DAF-16 target genes that control C. elegans life-span and metabolism. Science, 2003. 300(5619): p. 644-7. 69. Mukhopadhyay, A., S.W. Oh, and H.A. Tissenbaum, Worming pathways to and from DAF-16/FOXO. Exp Gerontol, 2006. 41(10): p. 928-34. 70. Li, J., et al., The 14-3-3 protein FTT-2 regulates DAF-16 in Caenorhabditis elegans. Dev Biol, 2007. 301(1): p. 82-91. 71. Martins, R., G.J. Lithgow, and W. Link, Long live FOXO: unraveling the role of FOXO proteins in aging and longevity. Aging Cell, 2016. 15(2): p. 196-207. Licensing for Figure 1.4 provided under CC BY (https://creativecommons.org/licenses/by/4.0/). 72. Massey, H.C., Jr., et al., Structure and developmental expression of Strongyloides stercoralis fktf-1, a proposed ortholog of daf-16 in Caenorhabditis elegans. Int J Parasitol, 2003. 33(13): p. 1537-44. 73. Gao, X., D. Frank, and J.M. Hawdon, Molecular cloning and DNA binding characterization of DAF-16 orthologs from Ancylostoma hookworms. Int J Parasitol, 2009. 39(4): p. 407-15. 74. Hu, M., et al., Structural and functional characterisation of the fork head transcription factor-encoding gene, Hc-daf-16, from the parasitic nematode Haemonchus contortus (Strongylida). Int J Parasitol, 2010. 40(4): p. 405-15.

148

75. Yan, B., et al., Structural and functional characterisation of FOXO/Acan-DAF-16 from the parasitic nematode Angiostrongylus cantonensis. Acta Trop, 2016. 164: p. 125-136. 76. Massey, H.C., Jr., et al., The fork head transcription factor FKTF-1b from Strongyloides stercoralis restores DAF-16 developmental function to mutant Caenorhabditis elegans. Int J Parasitol, 2006. 36(3): p. 347-52. 77. Castelletto, M.L., H.C. Massey, Jr., and J.B. Lok, Morphogenesis of Strongyloides stercoralis infective larvae requires the DAF-16 ortholog FKTF-1. PLoS Pathog, 2009. 5(4): p. e1000370. 78. Hansen, I.A., et al., Forkhead transcription factors regulate mosquito reproduction. Insect Biochem Mol Biol, 2007. 37(9): p. 985-97. 79. Sim, C. and D.L. Denlinger, Insulin signaling and FOXO regulate the overwintering diapause of the mosquito Culex pipiens. Proc Natl Acad Sci U S A, 2008. 105(18): p. 6777-81. 80. Milligan, J.N. and E.R. Jolly, Cercarial Transformation and in vitro Cultivation of Schistosoma mansoni Schistosomules. 2011(54): p. e3191. 81. Berriman, M., et al., The genome of the blood fluke Schistosoma mansoni. Nature, 2009. 460(7253): p. 352-8. 82. Haas, B.J., et al., Schistosoma mansoni genome: closing in on a final gene set. Exp Parasitol, 2007. 117(3): p. 225-8. 83. Howe, K.L., et al., WormBase ParaSite - a comprehensive resource for helminth genomics. Mol Biochem Parasitol, 2016. 84. Zerlotini, A., et al., SchistoDB: a Schistosoma mansoni genome resource. Nucleic Acids Res, 2009. 37(Database issue): p. D579-82. 85. Howe, K.L., et al., WormBase 2016: expanding to enable helminth genomic research. Nucleic Acids Res, 2016. 44(D1): p. D774-80. 86. Milligan, J.N. and E.R. Jolly, Identification and Characterization of a Mef2 Transcriptional Activator in Schistosome Parasites. PLOS Neglected Tropical Diseases, 2012. 6(1): p. e1443. 87. Biosystems, A., Creating Standard Curves with Genomic DNA or Plasmid DNA Templates for Use in Quantitative PCR. 2003: p. 1-9. 88. Tu, Q., et al., Sea urchin Forkhead gene family: phylogeny and embryonic expression. Dev Biol, 2006. 300(1): p. 49-62. 89. Song, J., et al., Genome-wide identification and characterization of Fox genes in the silkworm, Bombyx mori. Funct Integr Genomics, 2015. 15(5): p. 511-22. 90. Protasio, A.V., et al., A systematically improved high quality genome and transcriptome of the human blood fluke Schistosoma mansoni. PLoS Negl Trop Dis, 2012. 6(1): p. e1455. 91. Zerlotini, A., et al., SchistoDB: an updated genome resource for the three key schistosomes of humans. Nucleic Acids Res, 2013. 41(Database issue): p. D728- 31. 92. Ye, H., et al., Hepatocyte nuclear factor 3/fork head homolog 11 is expressed in proliferating epithelial and mesenchymal cells of embryonic and adult tissues. Mol Cell Biol, 1997. 17(3): p. 1626-41.

149

93. Perez-Sanchez, C., et al., FHX.L and FHX.S, two isoforms of the human fork-head factor FHX (FOXJ2) with differential activity. J Mol Biol, 2000. 301(4): p. 795- 806. 94. Lai, E., et al., Hepatocyte nuclear factor 3 alpha belongs to a gene family in mammals that is homologous to the Drosophila homeotic gene fork head. Genes Dev, 1991. 5(3): p. 416-27. 95. Adell, T. and W.E. Muller, Isolation and characterization of five Fox (Forkhead) genes from the sponge Suberites domuncula. Gene, 2004. 334: p. 35-46. 96. Leveugle, M., et al., Phylogenetic analysis of Ciona intestinalis gene superfamilies supports the hypothesis of successive gene expansions. J Mol Evol, 2004. 58(2): p. 168-81. 97. Newton, F.G., et al., Forkhead transcription factor Fd3F cooperates with Rfx to regulate a gene expression program for mechanosensory cilia specialization. Dev Cell, 2012. 22(6): p. 1221-33. 98. Li, J., et al., The FHA domain mediates phosphoprotein interactions. J Cell Sci, 2000. 113 Pt 23: p. 4143-9. 99. Pohl, B.S. and W. Knochel, Isolation and developmental expression of Xenopus FoxJ1 and FoxK1. Dev Genes Evol, 2004. 214(4): p. 200-5. 100. Casas-Tinto, S., et al., FoxK mediates TGF-beta signalling during midgut differentiation in flies. J Cell Biol, 2008. 183(6): p. 1049-60. 101. Shu, W., et al., Characterization of a new subfamily of winged-helix/forkhead (Fox) genes that are expressed in the lung and act as transcriptional repressors. J Biol Chem, 2001. 276(29): p. 27488-97. 102. Liu, S., et al., Genome-wide identification and characterization of a panel of house-keeping genes in Schistosoma japonicum. Mol Biochem Parasitol, 2012. 182(1-2): p. 75-82. 103. Bustin, S.A., Absolute quantification of mRNA using real-time reverse transcription polymerase chain reaction assays. J Mol Endocrinol, 2000. 25(2): p. 169-93. 104. Jurgens, G. and D. Weigel, Terminal versus segmental development in the Drosophila embryo: the role of the homeotic gene fork head. Roux Arch Dev Biol, 1988. 197(6): p. 345-354. 105. Weigel, D., et al., Primordium specific requirement of the homeotic gene fork head in the developing gut of the Drosophila embryo. Roux Arch Dev Biol, 1989. 198(4): p. 201-210. 106. Horner, M.A., et al., pha-4, an HNF-3 homolog, specifies pharyngeal organ identity in Caenorhabditis elegans. Genes Dev, 1998. 12(13): p. 1947-52. 107. Kalb, J.M., et al., pha-4 is Ce-fkh-1, a fork head/HNF-3alpha,beta,gamma homolog that functions in organogenesis of the C. elegans pharynx. Development, 1998. 125(12): p. 2171-80. 108. Gaudet, J. and S.E. Mango, Regulation of organogenesis by the Caenorhabditis elegans FoxA protein PHA-4. Science, 2002. 295(5556): p. 821-5. 109. Lalmansingh, A.S., et al., Multiple modes of chromatin remodeling by Forkhead box proteins. Biochim Biophys Acta, 2012. 1819(7): p. 707-15.

150

110. Zaret, K.S., et al., Nuclear mobility and mitotic chromosome binding: similarities between pioneer transcription factor FoxA and linker histone H1. Cold Spring Harb Symp Quant Biol, 2010. 75: p. 219-26. 111. Roquis, D., et al., The Epigenome of Schistosoma mansoni Provides Insight about How Cercariae Poise Transcription until Infection. PLoS Negl Trop Dis, 2015. 9(8): p. e0003853. 112. Atkinson, K.H. and B.G. Atkinson, Protein synthesis in vivo by Schistosoma mansoni cercariae. Mol Biochem Parasitol, 1981. 4(3-4): p. 205-16. 113. Mahlapuu, M., et al., The forkhead transcription factor Foxf1 is required for differentiation of extra-embryonic and lateral plate mesoderm. Development, 2001. 128(2): p. 155-66. 114. Aitola, M., et al., Forkhead transcription factor FoxF2 is expressed in mesodermal tissues involved in epithelio-mesenchymal interactions. Dev Dyn, 2000. 218(1): p. 136-49. 115. Kaestner, K.H., et al., The mesenchymal winged helix transcription factor Fkh6 is required for the control of gastrointestinal proliferation and differentiation. Genes Dev, 1997. 11(12): p. 1583-95. 116. Shu, W., et al., Foxp2 and Foxp1 cooperatively regulate lung and esophagus development. Development, 2007. 134(10): p. 1991-2000. 117. Wilson, R.A. and L.A. Webster, Protonephridia. Biol Rev Camb Philos Soc, 1974. 49(2): p. 127-60. 118. Motojima, M., T. Kume, and T. Matsusaka, Foxc1 and Foxc2 are necessary to maintain glomerular podocytes. Exp Cell Res, 2017. 352(2): p. 265-272. 119. Campbell, E.P., I.K. Quigley, and C. Kintner, Foxn4 promotes gene expression required for the formation of multiple motile cilia. Development, 2016. 143(24): p. 4654-4664. 120. You, Y., et al., Role of f-box factor foxj1 in differentiation of ciliated airway epithelial cells. Am J Physiol Lung Cell Mol Physiol, 2004. 286(4): p. L650-7. 121. El-Shehabi, F., et al., A novel G protein-coupled receptor of Schistosoma mansoni (SmGPR-3) is activated by dopamine and is widely expressed in the nervous system. PLoS Negl Trop Dis, 2012. 6(2): p. e1523. 122. Ribeiro, P. and N. Patocka, Neurotransmitter transporters in schistosomes: structure, function and prospects for drug discovery. Parasitol Int, 2013. 62(6): p. 629-38. 123. Sarafi-Reinach, T.R. and P. Sengupta, The forkhead domain gene unc-130 generates chemosensory neuron diversity in C. elegans. Genes Dev, 2000. 14(19): p. 2472-85. 124. Mundell, N.A., et al., Enteric nervous system specific deletion of Foxd3 disrupts glial cell differentiation and activates compensatory enteric progenitors. Dev Biol, 2012. 363(2): p. 373-87. 125. Sherman, J.H., et al., Foxd4 is essential for establishing neural cell fate and for neuronal differentiation. Genesis, 2017. 126. Mondal, S., et al., Sloppy paired 1/2 regulate glial cell fates by inhibiting Gcm function. Glia, 2007. 55(3): p. 282-93. 127. Brancaccio, M., et al., Emx2 and Foxg1 inhibit gliogenesis and promote neuronogenesis. Stem Cells, 2010. 28(7): p. 1206-18.

151

128. Cachero, S., et al., The gene regulatory cascade linking proneural specification with differentiation in Drosophila sensory neurons. PLoS Biol, 2011. 9(1): p. e1000568. 129. Jacquet, B.V., et al., FoxJ1-dependent gene expression is required for differentiation of radial glia into ependymal cells and a subset of astrocytes in the postnatal brain. Development, 2009. 136(23): p. 4021-31. 130. Khayath, N., et al., Diversification of the insulin receptor family in the helminth parasite Schistosoma mansoni. Febs j, 2007. 274(3): p. 659-76. 131. You, H., et al., Cloning and characterisation of Schistosoma japonicum insulin receptors. PLoS One, 2010. 5(3): p. e9868. 132. Gelmedin, V., et al., Transgenic C. elegans dauer larvae expressing hookworm phospho null DAF-16/FoxO exit dauer. PLoS One, 2011. 6(10): p. e25996. 133. Crabtree, J.E. and R.A. Wilson, Schistosoma mansoni: a scanning electron microscope study of the developing schistosomulum. Parasitology, 1980. 81(Pt 3): p. 553-64. 134. Puig, O., et al., Control of cell number by Drosophila FOXO: downstream and feedback regulation of the insulin receptor pathway. Genes Dev, 2003. 17(16): p. 2006-20. 135. Barthel, A., D. Schmoll, and T.G. Unterman, FoxO proteins in insulin action and metabolism. Trends Endocrinol Metab, 2005. 16(4): p. 183-9. 136. Puig, O. and R. Tjian, Transcriptional feedback control of insulin receptor by dFOXO/FOXO1. Genes Dev, 2005. 19(20): p. 2435-46. 137. Ishida, K., et al., Immunolocalization of Anti-Hsf1 to the Acetabular Glands of Infectious Schistosomes Suggests a Non-Transcriptional Function for This Transcriptional Activator. PLOS Neglected Tropical Diseases, 2014. 8(7): p. e3051. Licensing provided under CC BY (https://creativecommons.org/licenses/by/4.0/). 138. Yu, X., et al., Foxj1 transcription factors are master regulators of the motile ciliogenic program. Nat Genet, 2008. 40(12): p. 1445-53. 139. Ji, Z., et al., The forkhead transcription factor FOXK2 promotes AP-1-mediated transcriptional regulation. Mol Cell Biol, 2012. 32(2): p. 385-98. 140. Yu, J., et al., CHES-1-like, the ortholog of a non-obstructive azoospermia- associated gene, blocks germline stem cell differentiation by upregulating Dpp expression in Drosophila testis. Oncotarget, 2016. 7(27): p. 42303-42313. 141. Sin, C., H. Li, and D.A. Crawford, Transcriptional regulation by FOXP1, FOXP2, and FOXP4 dimerization. J Mol Neurosci, 2015. 55(2): p. 437-48. 142. Klein, S.L., et al., Conserved structural domains in FoxD4L1, a neural forkhead box transcription factor, are required to repress or activate target genes. PLoS One, 2013. 8(4): p. e61845. 143. Nakada, C., et al., Transcriptional repressor foxl1 regulates central nervous system development by suppressing shh expression in zebra fish. Mol Cell Biol, 2006. 26(19): p. 7246-57. 144. Obendorf, M., et al., FoxG1, a member of the forkhead family, is a corepressor of the androgen receptor. J Steroid Biochem Mol Biol, 2007. 104(3-5): p. 195-207.

152

145. Shi, X., et al., Foxk1 promotes cell proliferation and represses myogenic differentiation by regulating Foxo4 and Mef2. J Cell Sci, 2012. 125(Pt 22): p. 5329-37. 146. Correnti, J.M., P.J. Brindley, and E.J. Pearce, Long-term suppression of cathepsin B levels by RNA interference retards schistosome growth. Mol Biochem Parasitol, 2005. 143(2): p. 209-15. 147. Krautz-Peterson, G., et al., Optimizing gene suppression in schistosomes using RNA interference. Mol Biochem Parasitol, 2007. 153(2): p. 194-202. 148. Krautz-Peterson, G., et al., Suppressing glucose transporter gene expression in schistosomes impairs parasite feeding and decreases survival in the mammalian host. PLoS Pathog, 2010. 6(6): p. e1000932. 149. Liu, Q., et al., Function of Nanos1 gene in the development of reproductive organs of Schistosoma japonicum. Parasitol Res, 2017. 116(5): p. 1505-1513. 150. Liang, S., M. Knight, and E.R. Jolly, Polyethyleneimine mediated DNA transfection in schistosome parasites and regulation of the WNT signaling pathway by a dominant-negative SmMef2. PLoS Negl Trop Dis, 2013. 7(7): p. e2332. 151. Popiel, I. and P.F. Basch, Reproductive development of female Schistosoma mansoni (Digenea: Schistosomatidae) following bisexual pairing of worms and worm segments. J Exp Zool, 1984. 232(1): p. 141-50. 152. Blank, R.B., et al., The common gamma chain cytokines interleukin (IL)-2 and IL- 7 indirectly modulate blood fluke development via effects on CD4+ T cells. J Infect Dis, 2006. 194(11): p. 1609-16. 153. Osman, A., et al., Schistosoma mansoni TGF-beta receptor II: role in host ligand- induced regulation of a schistosome target gene. PLoS Pathog, 2006. 2(6): p. e54. 154. Beall, M.J. and E.J. Pearce, Human transforming growth factor-beta activates a receptor serine/threonine kinase from the intravascular parasite Schistosoma mansoni. J Biol Chem, 2001. 276(34): p. 31613-9. 155. Carlo, J.M., et al., Identification and characterization of an R-Smad ortholog (SmSmad1B) from Schistosoma mansoni. Febs j, 2007. 274(16): p. 4075-93. 156. Wu, W., et al., Identification and characterization of a nuclear receptor subfamily I member in the Platyhelminth Schistosoma mansoni (SmNR1). Febs j, 2007. 274(2): p. 390-405. 157. Chitsulo, L., et al., The global status of schistosomiasis and its control. Acta Trop, 2000. 77(1): p. 41-51. 158. Chitsulo, L., P. Loverde, and D. Engels, Schistosomiasis. Nat Rev Microbiol, 2004. 2(1): p. 12-3. 159. King, C.H., Parasites and poverty: the case of schistosomiasis. Acta Trop, 2010. 113(2): p. 95-104. 160. Engels, D., et al., The global epidemiological situation of schistosomiasis and new approaches to control and research. Acta Trop, 2002. 82(2): p. 139-46. 161. Melman, S.D., et al., Reduced susceptibility to praziquantel among naturally occurring Kenyan isolates of Schistosoma mansoni. PLoS Negl Trop Dis, 2009. 3(8): p. e504.

153

162. Blanton, R.E., et al., Schistosoma mansoni population structure and persistence after praziquantel treatment in two villages of Bahia, Brazil. Int J Parasitol, 2011. 41(10): p. 1093-9. 163. Prichard, R.K., et al., A research agenda for helminth diseases of humans: intervention for control and elimination. PLoS Negl Trop Dis, 2012. 6(4): p. e1549. 164. Cohen, F.E., et al., Arresting tissue invasion of a parasite by protease inhibitors chosen with the aid of computer modeling. Biochemistry, 1991. 30(47): p. 11221- 9. 165. Lim, K.C., et al., Blockage of skin invasion by schistosome cercariae by serine protease inhibitors. Am J Trop Med Hyg, 1999. 60(3): p. 487-92. 166. Acharya, P., R. Kumar, and U. Tatu, Chaperoning a cellular upheaval in malaria: heat shock proteins in Plasmodium falciparum. Mol Biochem Parasitol, 2007. 153(2): p. 85-94. 167. Echeverria, P.C., et al., Toxoplasma gondii Hsp90 is a potential drug target whose expression and subcellular localization are developmentally regulated. J Mol Biol, 2005. 350(4): p. 723-34. 168. Graefe, S.E., et al., Inhibition of HSP90 in Trypanosoma cruzi induces a stress response but no stage differentiation. Eukaryot Cell, 2002. 1(6): p. 936-43. 169. Hammarton, T.C., J.C. Mottram, and C. Doerig, The cell cycle of parasitic protozoa: potential for chemotherapeutic exploitation. Prog Cell Cycle Res, 2003. 5: p. 91-101. 170. Shonhai, A., Plasmodial heat shock proteins: targets for chemotherapy. FEMS Immunol Med Microbiol, 2010. 58(1): p. 61-74. 171. Wiesgigl, M. and J. Clos, The heat shock protein 90 of Leishmania donovani. Med Microbiol Immunol, 2001. 190(1-2): p. 27-31. 172. Jolly, C. and R.I. Morimoto, Role of the heat shock response and molecular chaperones in oncogenesis and cell death. J Natl Cancer Inst, 2000. 92(19): p. 1564-72. 173. Whitesell, L. and S.L. Lindquist, HSP90 and the chaperoning of cancer. Nat Rev Cancer, 2005. 5(10): p. 761-72. 174. Curwen, R.S., et al., Identification of novel proteases and immunomodulators in the secretions of schistosome cercariae that facilitate host entry. Mol Cell Proteomics, 2006. 5(5): p. 835-44. 175. Knudsen, G.M., et al., Proteomic analysis of Schistosoma mansoni cercarial secretions. Mol Cell Proteomics, 2005. 4(12): p. 1862-75. 176. Abdulla, M.H., et al., Drug discovery for schistosomiasis: hit and lead compounds identified in a library of known drugs by medium-throughput phenotypic screening. PLoS Negl Trop Dis, 2009. 3(7): p. e478. 177. Caffrey, C.R., et al., A comparative chemogenomics strategy to predict potential drug targets in the metazoan pathogen, Schistosoma mansoni. PLoS One, 2009. 4(2): p. e4413. 178. Mansour, N.R. and Q.D. Bickle, Comparison of microscopy and Alamar blue reduction in a larval based assay for schistosome drug screening. PLoS Negl Trop Dis, 2010. 4(8): p. e795.

154

179. Paveley, R.A., et al., Whole organism high-content screening by label-free, image-based Bayesian classification for parasitic diseases. PLoS Negl Trop Dis, 2012. 6(7): p. e1762. 180. Peak, E., I.W. Chalmers, and K.F. Hoffmann, Development and validation of a quantitative, high-throughput, fluorescent-based bioassay to detect schistosoma viability. PLoS Negl Trop Dis, 2010. 4(7): p. e759. 181. Basch, P.F., Schistosomes : development, reproduction, and host relations. 1991, New York: Oxford University Press. vii, 248 p. 182. Hansell, E., et al., Proteomic analysis of skin invasion by blood fluke larvae. PLoS Negl Trop Dis, 2008. 2(7): p. e262. 183. McKerrow, J.H. and J. Salter, Invasion of skin by Schistosoma cercariae. Trends Parasitol, 2002. 18(5): p. 193-5. 184. Fishelson, Z., et al., Schistosoma mansoni: cell-specific expression and secretion of a serine protease during development of cercariae. Exp Parasitol, 1992. 75(1): p. 87-98. 185. Stirewalt, M.A. and M. Walters, Schistosoma mansoni: histochemical analysis of the postacetabular gland secretion of cercariae. Exp Parasitol, 1973. 33(1): p. 56- 72. 186. Curwen, R.S. and R.A. Wilson, Invasion of skin by schistosome cercariae: some neglected facts. Trends Parasitol, 2003. 19(2): p. 63-6; discussion 66-8. 187. Whitfield, P.J., et al., Invasion by schistosome cercariae: studies with human skin explants. Trends Parasitol, 2003. 19(8): p. 339-40. 188. Stirewalt, M.A., Cercaria vs. schistosomule (Schistosoma mansoni): absence of the pericercarial envelope in vivo and the early physiological and histological metamorphosis of the parasite. Exp Parasitol, 1963. 13: p. 395-406. 189. Richter, K., M. Haslbeck, and J. Buchner, The heat shock response: life on the verge of death. Mol Cell, 2010. 40(2): p. 253-66. 190. Schlesinger, M.J., Heat shock proteins: the search for functions. J Cell Biol, 1986. 103(2): p. 321-5. 191. Shamovsky, I. and E. Nudler, New insights into the mechanism of heat shock response activation. Cell Mol Life Sci, 2008. 65(6): p. 855-61. 192. Sharma, S.K., P. Christen, and P. Goloubinoff, Disaggregating chaperones: an unfolding story. Curr Protein Pept Sci, 2009. 10(5): p. 432-46. 193. Anckar, J. and L. Sistonen, Regulation of HSF1 function in the heat stress response: implications in aging and disease. Annu Rev Biochem, 2011. 80: p. 1089-115. 194. Guo, Y., et al., Evidence for a mechanism of repression of heat shock factor 1 transcriptional activity by a multichaperone complex. J Biol Chem, 2001. 276(49): p. 45791-9. 195. Shi, Y., D.D. Mosser, and R.I. Morimoto, Molecular chaperones as HSF1- specific transcriptional repressors. Genes Dev, 1998. 12(5): p. 654-66. 196. Akerfelt, M., R.I. Morimoto, and L. Sistonen, Heat shock factors: integrators of cell stress, development and lifespan. Nat Rev Mol Cell Biol, 2010. 11(8): p. 545- 55. 197. Jedlicka, P., M.A. Mortin, and C. Wu, Multiple functions of Drosophila heat shock transcription factor in vivo. EMBO J, 1997. 16(9): p. 2452-62.

155

198. Xiao, X., et al., HSF1 is required for extra-embryonic development, postnatal growth and protection during inflammatory responses in mice. EMBO J, 1999. 18(21): p. 5943-52. 199. Hsu, A.L., C.T. Murphy, and C. Kenyon, Regulation of aging and age-related disease by DAF-16 and heat-shock factor. Science, 2003. 300(5622): p. 1142-5. 200. Morley, J.F. and R.I. Morimoto, Regulation of longevity in Caenorhabditis elegans by heat shock factor and molecular chaperones. Mol Biol Cell, 2004. 15(2): p. 657-64. 201. Hu, Y. and N.F. Mivechi, HSF-1 interacts with Ral-binding protein 1 in a stress- responsive, multiprotein complex with HSP90 in vivo. J Biol Chem, 2003. 278(19): p. 17299-306. 202. Singhal, S.S., et al., Hsf-1 and POB1 induce drug sensitivity and apoptosis by inhibiting Ralbp1. J Biol Chem, 2008. 283(28): p. 19714-29. 203. Lantner, F., et al., Different forms of the mRNA encoding the heat-shock transcription factor are expressed during the life cycle of the parasitic helminth Schistosoma mansoni. Eur J Biochem, 1998. 253(2): p. 390-8. 204. Neumann, S., et al., Cloning and sequencing of an hsp70 gene of Schistosoma mansoni. Mol Biochem Parasitol, 1992. 56(2): p. 357-60. 205. Neumann, S., et al., Regulation of HSP70 gene expression during the life cycle of the parasitic helminth Schistosoma mansoni. Eur J Biochem, 1993. 212(2): p. 589-96. 206. Levy-Holtzman, R. and I. Schechter, Activity of the promoter of the hsp70 gene of the parasitic helminth Schistosoma mansoni in the mammalian CHO cell-line. Biochim Biophys Acta, 1995. 1263(1): p. 96-8. 207. Milligan, J.N. and E.R. Jolly, Cercarial transformation and in vitro cultivation of Schistosoma mansoni schistosomules. J Vis Exp, 2011(54). 208. Milligan, J.N. and E.R. Jolly, Identification and characterization of a Mef2 transcriptional activator in schistosome parasites. PLoS Negl Trop Dis, 2012. 6(1): p. e1443. 209. Titz, B., et al., Transcriptional activators in yeast. Nucleic Acids Res, 2006. 34(3): p. 955-67. 210. Amin, J., J. Ananthan, and R. Voellmy, Key features of heat shock regulatory elements. Mol Cell Biol, 1988. 8(9): p. 3761-9. 211. Levy-Holtzman, R., J. Clos, and I. Schechter, Differences in DNA sequence recognition by the heat-shock factors of Drosophila melanogaster and the parasitic helminth Schistosoma mansoni. Biochim Biophys Acta, 1995. 1264(1): p. 134-40. 212. Marchler-Bauer, A., et al., CDD: specific functional annotation with the Conserved Domain Database. Nucleic Acids Res, 2009. 37(Database issue): p. D205-10. 213. Untergasser, A., et al., Primer3--new capabilities and interfaces. Nucleic Acids Res, 2012. 40(15): p. e115. 214. Koressaar, T. and M. Remm, Enhancements and modifications of primer design program Primer3. Bioinformatics, 2007. 23(10): p. 1289-91. 215. Xiao, H. and J.T. Lis, Germline transformation used to define key features of heat-shock response elements. Science, 1988. 239(4844): p. 1139-42.

156

216. Guettouche, T., et al., Analysis of phosphorylation of human heat shock factor 1 in cells experiencing a stress. BMC Biochem, 2005. 6: p. 4. 217. Dorsey, C.H. and M.A. Stirewalt, Schistosoma mansoni: fine structure of cercarial acetabular glands. Exp Parasitol, 1971. 30(2): p. 199-214. 218. Stirewalt, M.A. and B.E. Austin, Collection of secreted protease from the preacetabular glands of cercariae of Schistosoma mansoni. J Parasitol, 1973. 59(4): p. 741-3. 219. McKerrow, J.H., et al., Purification and characterization of an elastinolytic proteinase secreted by cercariae of Schistosoma mansoni. J Biol Chem, 1985. 260(6): p. 3703-7. 220. Ram, D., et al., Stage-specific alternative splicing of the heat-shock transcription factor during the life-cycle of Schistosoma mansoni. Parasitology, 2004. 129(Pt 5): p. 587-96. 221. Jolly, E.R., et al., Gene expression patterns during adaptation of a helminth parasite to different environmental niches. Genome Biol, 2007. 8(4): p. R65.

157