Molecular Cloning and Characterization of a Human PAX-7 Cdna Expressed in Normal and Neoplastic Myocytes
Total Page：16
File Type：pdf, Size：1020Kb
4574-4582 Nucleic Acids Research, 1994, Vol. 22, No. 22 .:/ 1994 Oxford University Press Molecular cloning and characterization of a human PAX-7 cDNA expressed in normal and neoplastic myocytes Beat W.Schafer*, Thomas Czerny1, Michele Bernasconi, Michele Genini and Meinrad Busslinger1 University of Zurich, Department of Pediatrics, Division of Clinical Chemistry, Steinwiesstrasse 75, 8032 Zurich, Switzerland and 'Research Institute of Molecular Pathology, Dr. Bohr-Gasse 7, 1030 Vienna, Austria Received August 25, 1994; Revised and Accepted October 11, 1994 EMBL accession no. Z35141 ABSTRACT The myogenic basic helix-loop-helix proteins are MRF4 (myf6) of the myogenic basic helix-loop-helix (bHLH) essential components of the regulatory network con- protein family (for review, see ref. 1,2). Recent gene targeting trolling vertebrate myogenesis. However, determined experiments in mice demonstrated that mice lacking either both myoblasts appear in the limb buds which do not initially myoD and myf5, or myogenin alone display severe skeletal express any member of this transcription factor family. muscle deficiencies (3-5) which underscores the importance of In a search for potential novel regulators of myogene- this family of transcription factors for myogenesis. In addition, sis, a human PAX-7 cDNA was isolated from primary these experiments placed myoD and myf5 upstream of myogenin myoblasts. Analysis of the DNA-binding properties of in a possible transcriptional hierarchy (6). The myogenic bHLH the Pax-7 paired domain revealed that it binds DNA in factors have furthermore the potential to convert several non- a sequence-specific manner indistinguishable from that muscle cell types to the muscle phenotype upon ectopic expression of the paralogous Pax-3 protein. Each of the two (7). However, expression of these factors does not necessarily proteins also binds to palindromic homeodomain- lead to the activation of the myogenic program in all cells as has binding sites by cooperative dimerization. Both Pax-3 been shown for the cell lines HeLa or HepG2 (7,8). In these and Pax-7, which are known to partially overlap in their cells, the expression of muscle specific genes can, however, be expression during development, can also efficiently induced by cell fusion with myoblasts. In addition, there is form heterodimers on these sites and stimulate reporter substantial evidence for the existence ofcommitted myogenic cells gene transcription in transient transfection experiments in limb buds of vertebrate embryos that do not express any of which, in the case of Pax-7, is dependent on the the myogenic bHLH regulators (9,10). Such observations led to transactivation function encoded by the C-terminal a search for additional regulators involved in the establishment sequences. Thus, the formation of heterodimers might of the myogenic lineage and muscle specific gene expression. have important consequences for target gene recog- Indeed, a family of four gene products called myocyte enhancer nition and regulation during development. PAX-7 was factor 2 (MEF2) (11) has been described that contain the MADS found to be weakly expressed in normal human domain (12) and that are able to bind an A/T rich DNA motif myoblasts, while PAX-3 could not be detected in these found in several muscle specific genes. cells at all. However, transcripts for either PAX-3 and/or Homeodomain proteins which represent another important PAX-7 were expressed at elevated levels in tumorigenic family of transcription factors are known to play key roles in rhabdomyosarcoma cell lines. Hence, overexpression the establishment of body axes and the regulation of of these PAX genes may be involved in the genesis of developmental programs. So far little is known about homeobox myogenic tumors. containing genes expressed during myogenesis. One gene, called MHox, has been reported to bind to an essential site in the INTRODUCTION enhancer of the muscle creatine kinase gene (13). The expression pattern of MHox suggests, that the gene product may be involved Myogenesis is a multistep process during which pluripotent stem in the specification of somites (14). In addition, two members cells are committed to the myogenic lineage and subsequently of the Pax gene family, Pax-3 and Pax-7, comprising both a are induced to express many muscle specific genes. Expression paired domain as well as a paired-type homeodomain, are of these genes is, in part, regulated by a cis-regulatory DNA motif expressed in the dermomyotomal part of the somites, from which called the E box (CANNTG), which can be bound by the muscle cells derive in the developing mouse embryo (15,16). transcription factors myoD (myf3), myogenin (myf4), myf5 and Both genes are also transcribed in the dorsal region of the neural *To whom correspondence should be addressed Nucleic Acids Research, 1994, Vol. 22, No. 22 4575 tube as well as in specific brain regions. In somites, transcripts this reaction was used as template for a polymerase chain reaction begin to accumulate between day 8.5 (Pax-3) and day 9 (Pax-7). (PCR) with the degenerated primers HoxF and HoxG. PCR was Later, during somite maturation, Pax-3 expression becomes performed for 30 cycles at 94°C for 1 min, 50°C for 1 min and confined to the ventrolateral part of the dermomyotome (17). 72°C for 90 s. PCR products of the correct size were subcloned Whereas the expression of Pax-3 and Pax-7 is overlapping in into the EcoRI/BamHI site of pBluescript SK+ and sequenced the somitic region, only Pax-3 expression persists in prospective using the T7 sequencing kit (Pharmacia) according to the myoblasts migrating from the somitic dermomyotome into the supplier's instruction. For rapid amplification of cDNA 5' ends limb buds (18). Notochord transplantation experiments indicated (5' RACE; 35), RNA was reverse transcribed with random that signals from the notochord determine the expression pattern hexamers as described above. A polyA tail was added with of Pax-3 and Pax-7 in somites and alter the subsequent terminal transferase and two subsequent rounds of amplification differentiation of cell types, including muscle cells, arising from carried out, using an annealing temperature of 58°C and primers the somitic mesoderm (17,19) These experiments suggest that M3-lREV/M3-lREVI as sequence specific primers. A single Pax genes might play an important role in the development of band of -900 bp was obtained, gel purified (Geneclean, BiolO1) limb muscles. and subcloned into the BamHIIHindlI sites of pBluescript SK+. The Pax genes constitute a family of nine genes in the The 3' RACE was performed with cDNA obtained by reverse mammalian genome (for review see ref. 20,21) They have been transcription with the oligonucleotide RACEtot (35) . In order subdivided into six classes based on sequence homology (22). to enhance the yield of PCR products, 5 mM MeHgOH and 30 Recent evidence suggests that Pax proteins can act as transcription mM 3-mercaptoethanol were added to the reaction. After factors, since specific DNA binding as well as transactivation amplification with gene specific primers M3-lFOR/M3-lFORI, has been shown for a number of Pax proteins (reviewed in 23). a number of bands were obtained, gel purified and subcloned Three products of Pax genes have been associated with mouse as described above. Sequencing identified B2-5 as the longest developmental mutants, namely Pax-l with undulated (24), Pax-3 cDNA clone (681 bp). The longest 5' and 3' RACE products with Splotch (25) and Pax-6 with Small eye (26). Furthermore, (E1-9 and B2-5) were combined taking advantage of a common mutations in the human PAX-3 and PAX-6 genes cause StuI site in primer M3-1FORI yielding cDNA clone D8 which Waardenburg's syndrome (27-29) and aniridia (30,31), was sequenced on both strands. To verify the sequence of the respectively. In addition, the PAX-3 gene has been shown to be cloned cDNA, overlapping RT-PCR products covering the entire altered by a specific translocation, t(2; 13)(q35;q14), in alveolar open reading frame were generated and directly sequenced. We rhabdomyosarcoma, leading to a chimeric gene product between found a discrepancy at two positions (position 1046 C to T and PAX-3 and a novel member of the fork head family of position 1310 G to A) between the direct sequencing and the transcription factors (32). Together these data suggest that Pax cDNA clone D8. In Figure 1, the bases determined by direct genes are important regulators of developmental processes. sequencing are shown, assuming that clone D8 contains two base To study the role of PAX-7 in the establishment of the exchanges due to Taq polymerase errors. PCR cloning of the myogenic lineage, we have isolated and characterized a human murine Pax-3 cDNA has been described (36). PAX-7 cDNA. Here we show that PAX-7 is expressed at low levels in primary human myoblasts and at elevated levels in cell Oligonucleotides lines derived from rhabdomyosarcomas. Analysis of the DNA Oligonucleotides and their sequences are as follows: HoxF, CA- binding and transactivation properties of the PAX-7 protein CGAATTCCG(A/C)CG(A/C)(G/A)(C/G)(C/T)CG(C/G)ACC- demonstrated that PAX-7 is a sequence-specific transcription (G/A)C(C/G)TT(C/T)AC; HoxG, CGTGGATCC(G/C)CG- factor expressed during human myogenesis. (G/C)CGGTT(C/A)(T/C)(C/A)GAACCA; M3-1FOR, GGC- CGAGCAGCTGGAGGAG; M3- iFORI, CACGAATTCC- MATERIALS AND METHODS TGGAGAAGGCCTTTGAGAGG; M3-lREV,GACCTGC- ACACGCGCCTCT; M3-lREVI, CGTGGATCCCCATTG- Cell lines and primary cultures ATGAAGACCCCTC. All oligonucleotides used for EMSA were Human rhabdomyosarcoma cell lines A673 and RD were previously described (36,37) except for the H2A-17C oligo- obtained from American Type Culture Collection (Rockville, nucleotide (TGTGACGCAGCGGTGCGTGACGACTT). MD), and the cell lines RhI, Rhl8 and Rh3O were a generous gift of Dr P.Houghton.