DOCSLIB.ORG

Structure/Function Relationships Underlying Regulation of FOXO Transcription Factors

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Structure/Function Relationships Underlying Regulation of FOXO Transcription Factors Oncogene (2008) 27, 2263–2275 & 2008 Nature Publishing Group All rights reserved 0950-9232/08 $30.00 www.nature.com/onc REVIEW Structure/function relationships underlying regulation of FOXO transcription factors T Obsil1,2 and V Obsilova2 1Department of Physical and Macromolecular Chemistry, Faculty of Science, Charles University, Prague, Czech Republic and 2Institute of Physiology, Academy of Sciences of the Czech Republic, Prague, Czech Republic The FOXO subgroup of forkhead transcription factors their forkhead DBD and constitute a discrete family plays a central role in cell-cycle control,differentiation, within the ‘winged helix protein’ superfamily that occurs metabolism control,stress response and apoptosis. There- in both eukaryote and prokaryote genomes (Clark et al., fore,the function of these important molecules is tightly 1993; Gajiwala and Burley, 2000). controlled by a wide range of protein–protein interactions Among the forkhead box family of transcription and posttranslational modifications including phospho- factors (a group of more than 100 proteins identified so rylation,acetylation and ubiquitination. The mechanisms far), the ‘O’ subgroup consists of four members by which these processes regulate FOXO activity are (FOXO1, FOXO3, FOXO4 and FOXO6). The FOXO mostly elusive. This review focuses on recent advances in proteins were initially identified in humans at chromo- structural studies of forkhead transcription factors and somal rearrangements in certain tumors (Galili et al., the insights they provide into the mechanism of DNA 1993; Davis et al., 1994; Parry et al., 1994; Borkhardt recognition. On the basis of these data,we discuss et al., 1997; Hillion et al., 1997; Anderson et al., 1998). structural aspects of protein–protein interactions and They are the vertebrate orthologs ofthe Caenorhabditis posttranslational modifications that target the forkhead elegans DAF-16 transcription factor and constitute key domain and the nuclear localization signal of FOXO components ofa highly conserved signaling pathway proteins. that connects growth and stress signals to transcrip- Oncogene (2008) 27, 2263–2275; doi:10.1038/onc.2008.20 tional control (Lin et al., 1997; Ogg et al., 1997). Molecules ofFOXO proteins consist offourdomains: a Keywords: FOXO; forkhead transcription factors; highly conserved forkhead DBD, a nuclear localization 14-3-3 protein; phosphorylation; acetylation; signal (NLS) located just downstream ofDBD, a ubiquitination nuclear export sequence (NES) and a C-terminal transactivation domain (Figure 1). FOXO1, FOXO3 and FOXO6 proteins have similar length ofapproxi- mately 650 amino-acid residues, whereas FOXO4 Introduction sequence is shorter and contains about 500 amino-acid residues. Analysis ofmultiple sequence alignment shows The forkhead box (FOX) transcription factors contain that several regions ofFOXO proteins are highly approximately 110-amino-acid-long winged helix DNA- conserved (Figure 2). The regions showing the highest binding domain (DBD) known as the forkhead domain sequence conservation include the N-terminal region (Weigel and Jackle, 1990; Kaestner et al., 2000; Mazet surrounding first AKT/protein kinase B (PKB) phos- et al., 2003). The FOX proteins display large functional phorylation site, the forkhead DBD, the region contain- diversity and play a wide range ofroles in development, ing NLS and the part ofthe C-terminal transactivation proliferation, differentiation, stress resistance, apoptosis domain. and control ofmetabolism (recently reviewed by Transcriptional activity ofFOXO proteins is regu- Carlsson and Mahlapuu, 2002; Lehmann et al., 2003; lated through insulin–phosphatidylinositol 3-kinase– Greer and Brunet, 2005; and van der Horst and AKT/PKB signaling pathway. Phosphorylation by Burgering, 2007). Their name is derived from the AKT/PKB creates two binding sites for the 14-3-3 Drosophila melanogaster forkhead gene, the first identi- proteins and induces phosphorylation ofadditional sites fied FOX transcription factor, which is important for by casein kinase-1 (CK1) and dual-specificity tyrosine- the correct formation of the anterior and posterior gut regulated kinase-1A. The AKT/PKB-mediated phos- ofthe embryo (Weigel et al., 1989). All FOX proteins phorylation ofFOXO induces binding of14-3-3 show high degree ofamino-acid sequence identity in proteins, and the resulting complex is then translocated to the cytosol where the bound 14-3-3 protein prevents reentry ofFOXO into the nucleus likely by interfering Correspondence: Professor T Obsil, Department of Physical and Macromolecular Chemistry, Faculty ofScience, Charles University; with the function of their NLS (Brunet et al., 1999; 12843 Prague, Czech Republic. Brownawell et al., 2001; Cahill et al., 2001; Zhao E-mail: [email protected] et al., 2004; Obsilova et al., 2005). In addition to Structure/function relationships in FOXO proteins T Obsil and V Obsilova 2264 Figure 1 Schematic representation ofprimary structure ofFOXO proteins. All FOXO proteins have the same domain organization and contain forkhead DNA-binding domain (DBD), nuclear localization signal (NLS), nuclear export sequence (NES) and transactivation domain (TA). Only the AKT/protein kinase B (PKB) phosphorylation sites are shown. Figure 2 Sequence alignment and posttranslational modifications ofFOXO subgroup members. Residues that are conserved at least in three sequences are shaded in gray. Residue color coding: brown, AKT/protein kinase B (PKB)/serum- and glucocorticoid-inducible kinase (SGK) phosphorylation sites; red, non-AKT/PKB phosphorylation sites; and green, acetylation sites. Symbol ( + ) denotes monoubiquitination sites. Regions ofnuclear localization signal (NLS) and nuclear export sequence (NES) motifsare labeled by yellow boxes. Question marks indicate unknown acetylating enzymes. Symbol (#) denotes oxidative stress-induced phosphorylation events (Brunet et al., 2004). Symbol (*) denotes sites phosphorylated by mitogen-activated kinases ERK and p38 (Asada et al., 2007). CBP, cyclic-AMP responsive element binding (CREB)-binding protein; cGK1, cyclic GMP-dependent kinase-1; DIRK1, dual-specificity tyrosine-regulated kinase-1A; JNK, c-JUN N-terminal kinase. AKT/PKB-mediated phosphorylation, the function of FOXO molecule (Figure 2). The precise mechanisms by FOXO proteins is also controlled by other types of which posttranslational modifications regulate FOXO posttranslational modifications including non-AKT/ functions are mostly elusive, but in many cases they PKB-mediated phosphorylation, acetylation and ubi- seem to affect DNA-binding potential of FOXO quitination. Sites ofthese posttranslational modifica- proteins, function of their NLS and NES, or interac- tions are often located within the conserved regions of tions ofFOXO with other proteins. Oncogene Structure/function relationships in FOXO proteins T Obsil and V Obsilova 2265 This review focuses on recent advances in structural However, different classes of forkhead proteins recog- studies of forkhead transcription factors and the insights nize diverse DNA sequences adjacent to the core they provide into the mechanism ofDNA recognition. sequence through still not fully understood mechanism. On the basis ofthese data, we discuss structural aspects To date, six structures offorkheaddomains bound to ofprotein–protein interactions and posttranslational DNA have been solved: FoxA3ÀDNA (Clark et al., modifications that target the forkhead domain and the 1993), FoxD3ÀDNA (Jin and Liao, 1999), FOXP2À NLS ofFOXO proteins. DNA (Stroud et al., 2006), NFATÀFOXP2ÀDNA (Wu et al., 2006), FOXK1aÀDNA (Tsai et al., 2006) and FOXO3aÀDNA (Tsai et al., 2007). Structure of FoxA3ÀDNA complex provided first details about Structure of forkhead DNA-binding domain interactions between forkhead DBD and the core sequence, showing that the helix H3 represents the main Structural studies offorkheadproteins began with the DNA recognition site (Clark et al., 1993). The forkhead solution ofco-crystal structure ofthe DBD ofa FoxA3 domain ofFoxA3 binds to the DNA duplex as a (HNF-3g) DNA complex (Clark et al., 1993). FoxA3 is À monomer with the helix H3 docked into the major a liver-specific transcription factor that plays important groove roughly perpendicular to the DNA axis provid- roles in cell differentiation and tissue-specific gene ing extensive interactions with the core sequence. expression (Lai et al., 1993). Its structure showed that Residues that are involved in these interactions the forkhead/winged helix motif is a compact structure (Asn165 and His169) are highly conserved among all containing about 110 amino-acid residues that fold forkhead proteins (Figure 3c). Contacts between fork- into three a-helices (H1, H2 and H3), three b-strands head domain and DNA involve direct hydrogen bonds (S1, S2 and S3) and two wing-like loops (W1 and W2) between side chains and bases, water-mediated side (Figure 3). Topologically, the arrangement ofthe chainÀbase interactions and van der Waals contacts domain is H1ÀS1ÀH2ÀH3ÀS2ÀW1ÀS3ÀW2. The with both the bases and the backbone ofDNA (Figures strand S1, inserted between helices H1 and H2, interacts 5a and 6a). Other regions ofFoxA3 DBD that make with strands S2 and S3 to form a three-stranded, important interactions with DNA, in addition to twisted, antiparallel b-sheet. While the N-terminal part recognition helix H3, are both wings W1 and W2 ofthe domain is formed by a cluster ofthree a-helices, flanking the helix H3. Mainly the wing W2 was shown to the C-terminal halfconsists of
Load more

Recommended publications
  • The Title of the Dissertation
    UNIVERSITY OF CALIFORNIA SAN DIEGO Novel network-based integrated analyses of multi-omics data reveal new insights into CD8+ T cell differentiation and mouse embryogenesis A dissertation submitted in partial satisfaction of the requirements for the degree Doctor of Philosophy in Bioinformatics and Systems Biology by Kai Zhang Committee in charge: Professor Wei Wang, Chair Professor Pavel Arkadjevich Pevzner, Co-Chair Professor Vineet Bafna Professor Cornelis Murre Professor Bing Ren 2018 Copyright Kai Zhang, 2018 All rights reserved. The dissertation of Kai Zhang is approved, and it is accept- able in quality and form for publication on microfilm and electronically: Co-Chair Chair University of California San Diego 2018 iii EPIGRAPH The only true wisdom is in knowing you know nothing. —Socrates iv TABLE OF CONTENTS Signature Page ....................................... iii Epigraph ........................................... iv Table of Contents ...................................... v List of Figures ........................................ viii List of Tables ........................................ ix Acknowledgements ..................................... x Vita ............................................. xi Abstract of the Dissertation ................................. xii Chapter 1 General introduction ............................ 1 1.1 The applications of graph theory in bioinformatics ......... 1 1.2 Leveraging graphs to conduct integrated analyses .......... 4 1.3 References .............................. 6 Chapter 2 Systematic
    [Show full text]
  • A Role for Histone Modification in the Mechanism of Action of Antidepressant and Stimulant Drugs: a Dissertation
    University of Massachusetts Medical School eScholarship@UMMS GSBS Dissertations and Theses Graduate School of Biomedical Sciences 2007-12-28 A Role for Histone Modification in the Mechanism of Action of Antidepressant and Stimulant Drugs: a Dissertation Frederick Albert Schroeder University of Massachusetts Medical School Let us know how access to this document benefits ou.y Follow this and additional works at: https://escholarship.umassmed.edu/gsbs_diss Part of the Amino Acids, Peptides, and Proteins Commons, Cells Commons, Enzymes and Coenzymes Commons, Genetic Phenomena Commons, Mental Disorders Commons, Nervous System Commons, and the Therapeutics Commons Repository Citation Schroeder FA. (2007). A Role for Histone Modification in the Mechanism of Action of Antidepressant and Stimulant Drugs: a Dissertation. GSBS Dissertations and Theses. https://doi.org/10.13028/7bk0-a687. Retrieved from https://escholarship.umassmed.edu/gsbs_diss/370 This material is brought to you by eScholarship@UMMS. It has been accepted for inclusion in GSBS Dissertations and Theses by an authorized administrator of eScholarship@UMMS. For more information, please contact [email protected]. A Dissertation Presented by Frederick Albert Schroeder Submitted to the Faculty of the University of Massachusetts Graduate School of Biomedical Sciences Worcester, Massachusetts, USA in partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY December 28, 2007 Program in Neuroscience A Role for Histone Modification in the Mechanism of Action of Antidepressant and Stimulant Drugs A Dissertation Presented By Frederick Albert Schroeder Approved as to style and content by: _____________________________________ Alonzo Ross, Ph.D., Chair of Committee _____________________________________ Pradeep Bhide, Ph.D., Member of Committee _____________________________________ Craig L.
    [Show full text]
  • The DNA Methylation of FOXO3 and TP53 As a Blood Biomarker of Late
    Yuan et al. J Transl Med (2020) 18:467 https://doi.org/10.1186/s12967-020-02643-y Journal of Translational Medicine RESEARCH Open Access The DNA methylation of FOXO3 and TP53 as a blood biomarker of late-onset asthma Lin Yuan1,2,3, Leyuan Wang2, Xizi Du2, Ling Qin1,3, Ming Yang4, Kai Zhou2, Mengping Wu2, Yu Yang2, Zhiyuan Zheng1,3, Yang Xiang2, Xiangping Qu2, Huijun Liu2, Xiaoqun Qin2 and Chi Liu1,2,5* Abstract Background: Late-onset asthma (LOA) is beginning to account for an increasing proportion of asthma patients, which is often underdiagnosed in the elderly. Studies on the possible relations between aging-related genes and LOA contribute to the diagnosis and treatment of LOA. Forkhead Box O3 (FOXO3) and TP53 are two classic aging-related genes. DNA methylation varies greatly with age which may play an important role in the pathogenesis of LOA. We supposed that the diferentially methylated sites of FOXO3 and TP53 associated with clinical phenotypes of LOA may be useful biomarkers for the early screening of LOA. Methods: The mRNA expression and DNA methylation of FOXO3 and TP53 in peripheral blood of 43 LOA patients (15 mild LOA, 15 moderate LOA and 13 severe LOA) and 60 healthy controls (HCs) were determined. The association of methylated sites with age was assessed by Cox regression to control the potential confounders. Then, the correlation between diferentially methylated sites (DMSs; p-value < 0.05) and clinical lung function in LOA patients was evalu- ated. Next, candidate DMSs combining with age were evaluated to predict LOA by receiver operating characteristic (ROC) analysis and principal components analysis (PCA).
    [Show full text]
  • FOX) Proteins in Osteosarcoma Wentao Zhang1*, Ning Duan1*, Tao Song1, Zhong Li1, Caiguo Zhang2, Xun Chen1
    Journal of Cancer 2017, Vol. 8 1619 Ivyspring International Publisher Journal of Cancer 2017; 8(9): 1619-1628. doi: 10.7150/jca.18778 Review The Emerging Roles of Forkhead Box (FOX) Proteins in Osteosarcoma Wentao Zhang1*, Ning Duan1*, Tao Song1, Zhong Li1, Caiguo Zhang2, Xun Chen1 1. Department of Orthopaedics, Xi'an Hong-Hui Hospital affiliated to medical college of Xi'an Jiaotong University, Xi'an, Shaanxi, China, 710054; 2. Department of Dermatology, University of Colorado Anschutz Medical Campus, Aurora, CO, USA. * These authors contributed equally to this work. Corresponding authors: [email protected]; [email protected] © Ivyspring International Publisher. This is an open access article distributed under the terms of the Creative Commons Attribution (CC BY-NC) license (https://creativecommons.org/licenses/by-nc/4.0/). See http://ivyspring.com/terms for full terms and conditions. Received: 2016.12.15; Accepted: 2017.02.27; Published: 2017.06.03 Abstract Osteosarcoma is the most common bone cancer primarily occurring in children and young adults. Over the past few years, the deregulation of a superfamily transcription factors, known as forkhead box (FOX) proteins, has been demonstrated to contribute to the pathogenesis of osteosarcoma. Molecular mechanism studies have demonstrated that FOX family proteins participate in a variety of signaling pathways and that their expression can be regulated by multiple factors. The dysfunction of FOX genes can alter osteosarcoma cell differentiation, metastasis and progression. In this review, we summarized the evidence that FOX genes play direct or indirect roles in the development and progression of osteosarcoma, and evaluated the emerging role of FOX proteins as targets for therapeutic intervention.
    [Show full text]
  • The Genetic Network of Forkhead Gene Family in Development of Brown Planthoppers
    biology Article The Genetic Network of Forkhead Gene Family in Development of Brown Planthoppers Hai-Yan Lin 1,2, Cheng-Qi Zhu 1,2, Hou-Hong Zhang 2, Zhi-Cheng Shen 2, Chuan-Xi Zhang 2,3 and Yu-Xuan Ye 1,2,* 1 The Rural Development Academy, Zhejiang University, Hangzhou 310058, China; [email protected] (H.-Y.L.); [email protected] (C.-Q.Z.) 2 Institute of Insect Sciences, Zhejiang University, Hangzhou 310058, China; [email protected] (H.-H.Z.); [email protected] (Z.-C.S.); [email protected] (C.-X.Z.) 3 State Key Laboratory for Managing Biotic and Chemical Threats to the Quality and Safety of Agro-Products, Institute of Plant Virology, Ningbo University, Ningbo 315211, China * Correspondence: [email protected] Simple Summary: Forkhead (Fox) genes encode a family of transcription factors defined by a ‘winged helix’ DNA-binding domain and play important roles in regulating the expression of genes involved in cell growth, proliferation, differentiation and longevity. However, we still lack a comprehensive understanding of the Fox gene family in animals. Here, we take an integrated study, which combines genomics, transcriptomics and phenomics, to construct the Fox gene genetic network in the brown planthopper, Nilaparvata lugens, a major rice pest. We show that FoxG, FoxQ, FoxA, FoxN1, FoxN2 and their potential target genes are indispensable for embryogenesis; FoxC, FoxJ1 and FoxP have complementary effects on late embryogenesis; FoxA, FoxNl and FoxQ are pleiotropism and also essential for nymph molting; FoxT belongs to a novel insect-specific Fox subfamily; and FoxL2 and FoxO are involved in the development of eggshells and wings, respectively.
    [Show full text]
  • The E–Id Protein Axis Modulates the Activities of the PI3K–AKT–Mtorc1
    Downloaded from genesdev.cshlp.org on October 6, 2021 - Published by Cold Spring Harbor Laboratory Press The E–Id protein axis modulates the activities of the PI3K–AKT–mTORC1– Hif1a and c-myc/p19Arf pathways to suppress innate variant TFH cell development, thymocyte expansion, and lymphomagenesis Masaki Miyazaki,1,8 Kazuko Miyazaki,1,8 Shuwen Chen,1 Vivek Chandra,1 Keisuke Wagatsuma,2 Yasutoshi Agata,2 Hans-Reimer Rodewald,3 Rintaro Saito,4 Aaron N. Chang,5 Nissi Varki,6 Hiroshi Kawamoto,7 and Cornelis Murre1 1Department of Molecular Biology, University of California at San Diego, La Jolla, California 92093, USA; 2Department of Biochemistry and Molecular Biology, Shiga University of Medical School, Shiga 520-2192, Japan; 3Division of Cellular Immunology, German Cancer Research Center, D-69120 Heidelberg, Germany; 4Department of Medicine, University of California at San Diego, La Jolla, California 92093, USA; 5Center for Computational Biology, Institute for Genomic Medicine, University of California at San Diego, La Jolla, California 92093, USA; 6Department of Pathology, University of California at San Diego, La Jolla, California 92093, USA; 7Department of Immunology, Institute for Frontier Medical Sciences, Kyoto University, Kyoto 606-8507, Japan It is now well established that the E and Id protein axis regulates multiple steps in lymphocyte development. However, it remains unknown how E and Id proteins mechanistically enforce and maintain the naı¨ve T-cell fate. Here we show that Id2 and Id3 suppressed the development and expansion of innate variant follicular helper T (TFH) cells. Innate variant TFH cells required major histocompatibility complex (MHC) class I-like signaling and were associated with germinal center B cells.
    [Show full text]
  • Supplemental Table 1. Complete Gene Lists and GO Terms from Figure 3C
    Supplemental Table 1. Complete gene lists and GO terms from Figure 3C. Path 1 Genes: RP11-34P13.15, RP4-758J18.10, VWA1, CHD5, AZIN2, FOXO6, RP11-403I13.8, ARHGAP30, RGS4, LRRN2, RASSF5, SERTAD4, GJC2, RHOU, REEP1, FOXI3, SH3RF3, COL4A4, ZDHHC23, FGFR3, PPP2R2C, CTD-2031P19.4, RNF182, GRM4, PRR15, DGKI, CHMP4C, CALB1, SPAG1, KLF4, ENG, RET, GDF10, ADAMTS14, SPOCK2, MBL1P, ADAM8, LRP4-AS1, CARNS1, DGAT2, CRYAB, AP000783.1, OPCML, PLEKHG6, GDF3, EMP1, RASSF9, FAM101A, STON2, GREM1, ACTC1, CORO2B, FURIN, WFIKKN1, BAIAP3, TMC5, HS3ST4, ZFHX3, NLRP1, RASD1, CACNG4, EMILIN2, L3MBTL4, KLHL14, HMSD, RP11-849I19.1, SALL3, GADD45B, KANK3, CTC- 526N19.1, ZNF888, MMP9, BMP7, PIK3IP1, MCHR1, SYTL5, CAMK2N1, PINK1, ID3, PTPRU, MANEAL, MCOLN3, LRRC8C, NTNG1, KCNC4, RP11, 430C7.5, C1orf95, ID2-AS1, ID2, GDF7, KCNG3, RGPD8, PSD4, CCDC74B, BMPR2, KAT2B, LINC00693, ZNF654, FILIP1L, SH3TC1, CPEB2, NPFFR2, TRPC3, RP11-752L20.3, FAM198B, TLL1, CDH9, PDZD2, CHSY3, GALNT10, FOXQ1, ATXN1, ID4, COL11A2, CNR1, GTF2IP4, FZD1, PAX5, RP11-35N6.1, UNC5B, NKX1-2, FAM196A, EBF3, PRRG4, LRP4, SYT7, PLBD1, GRASP, ALX1, HIP1R, LPAR6, SLITRK6, C16orf89, RP11-491F9.1, MMP2, B3GNT9, NXPH3, TNRC6C-AS1, LDLRAD4, NOL4, SMAD7, HCN2, PDE4A, KANK2, SAMD1, EXOC3L2, IL11, EMILIN3, KCNB1, DOK5, EEF1A2, A4GALT, ADGRG2, ELF4, ABCD1 Term Count % PValue Genes regulation of pathway-restricted GDF3, SMAD7, GDF7, BMPR2, GDF10, GREM1, BMP7, LDLRAD4, SMAD protein phosphorylation 9 6.34 1.31E-08 ENG pathway-restricted SMAD protein GDF3, SMAD7, GDF7, BMPR2, GDF10, GREM1, BMP7, LDLRAD4, phosphorylation
    [Show full text]
  • Anti-Carcinogenic Glucosinolates in Cruciferous Vegetables and Their Antagonistic Effects on Prevention of Cancers
    molecules Review Anti-Carcinogenic Glucosinolates in Cruciferous Vegetables and Their Antagonistic Effects on Prevention of Cancers Prabhakaran Soundararajan and Jung Sun Kim * Genomics Division, Department of Agricultural Bio-Resources, National Institute of Agricultural Sciences, Rural Development Administration, Wansan-gu, Jeonju 54874, Korea; [email protected] * Correspondence: [email protected] Academic Editor: Gautam Sethi Received: 15 October 2018; Accepted: 13 November 2018; Published: 15 November 2018 Abstract: Glucosinolates (GSL) are naturally occurring β-D-thioglucosides found across the cruciferous vegetables. Core structure formation and side-chain modifications lead to the synthesis of more than 200 types of GSLs in Brassicaceae. Isothiocyanates (ITCs) are chemoprotectives produced as the hydrolyzed product of GSLs by enzyme myrosinase. Benzyl isothiocyanate (BITC), phenethyl isothiocyanate (PEITC) and sulforaphane ([1-isothioyanato-4-(methyl-sulfinyl) butane], SFN) are potential ITCs with efficient therapeutic properties. Beneficial role of BITC, PEITC and SFN was widely studied against various cancers such as breast, brain, blood, bone, colon, gastric, liver, lung, oral, pancreatic, prostate and so forth. Nuclear factor-erythroid 2-related factor-2 (Nrf2) is a key transcription factor limits the tumor progression. Induction of ARE (antioxidant responsive element) and ROS (reactive oxygen species) mediated pathway by Nrf2 controls the activity of nuclear factor-kappaB (NF-κB). NF-κB has a double edged role in the immune system. NF-κB induced during inflammatory is essential for an acute immune process. Meanwhile, hyper activation of NF-κB transcription factors was witnessed in the tumor cells. Antagonistic activity of BITC, PEITC and SFN against cancer was related with the direct/indirect interaction with Nrf2 and NF-κB protein.
    [Show full text]
  • A Flexible Microfluidic System for Single-Cell Transcriptome Profiling
    www.nature.com/scientificreports OPEN A fexible microfuidic system for single‑cell transcriptome profling elucidates phased transcriptional regulators of cell cycle Karen Davey1,7, Daniel Wong2,7, Filip Konopacki2, Eugene Kwa1, Tony Ly3, Heike Fiegler2 & Christopher R. Sibley 1,4,5,6* Single cell transcriptome profling has emerged as a breakthrough technology for the high‑resolution understanding of complex cellular systems. Here we report a fexible, cost‑efective and user‑ friendly droplet‑based microfuidics system, called the Nadia Instrument, that can allow 3′ mRNA capture of ~ 50,000 single cells or individual nuclei in a single run. The precise pressure‑based system demonstrates highly reproducible droplet size, low doublet rates and high mRNA capture efciencies that compare favorably in the feld. Moreover, when combined with the Nadia Innovate, the system can be transformed into an adaptable setup that enables use of diferent bufers and barcoded bead confgurations to facilitate diverse applications. Finally, by 3′ mRNA profling asynchronous human and mouse cells at diferent phases of the cell cycle, we demonstrate the system’s ability to readily distinguish distinct cell populations and infer underlying transcriptional regulatory networks. Notably this provided supportive evidence for multiple transcription factors that had little or no known link to the cell cycle (e.g. DRAP1, ZKSCAN1 and CEBPZ). In summary, the Nadia platform represents a promising and fexible technology for future transcriptomic studies, and other related applications, at cell resolution. Single cell transcriptome profling has recently emerged as a breakthrough technology for understanding how cellular heterogeneity contributes to complex biological systems. Indeed, cultured cells, microorganisms, biopsies, blood and other tissues can be rapidly profled for quantifcation of gene expression at cell resolution.
    [Show full text]
  • Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K
    www.nature.com/scientificreports OPEN Genome-wide DNA methylation analysis of KRAS mutant cell lines Ben Yi Tew1,5, Joel K. Durand2,5, Kirsten L. Bryant2, Tikvah K. Hayes2, Sen Peng3, Nhan L. Tran4, Gerald C. Gooden1, David N. Buckley1, Channing J. Der2, Albert S. Baldwin2 ✉ & Bodour Salhia1 ✉ Oncogenic RAS mutations are associated with DNA methylation changes that alter gene expression to drive cancer. Recent studies suggest that DNA methylation changes may be stochastic in nature, while other groups propose distinct signaling pathways responsible for aberrant methylation. Better understanding of DNA methylation events associated with oncogenic KRAS expression could enhance therapeutic approaches. Here we analyzed the basal CpG methylation of 11 KRAS-mutant and dependent pancreatic cancer cell lines and observed strikingly similar methylation patterns. KRAS knockdown resulted in unique methylation changes with limited overlap between each cell line. In KRAS-mutant Pa16C pancreatic cancer cells, while KRAS knockdown resulted in over 8,000 diferentially methylated (DM) CpGs, treatment with the ERK1/2-selective inhibitor SCH772984 showed less than 40 DM CpGs, suggesting that ERK is not a broadly active driver of KRAS-associated DNA methylation. KRAS G12V overexpression in an isogenic lung model reveals >50,600 DM CpGs compared to non-transformed controls. In lung and pancreatic cells, gene ontology analyses of DM promoters show an enrichment for genes involved in diferentiation and development. Taken all together, KRAS-mediated DNA methylation are stochastic and independent of canonical downstream efector signaling. These epigenetically altered genes associated with KRAS expression could represent potential therapeutic targets in KRAS-driven cancer. Activating KRAS mutations can be found in nearly 25 percent of all cancers1.
    [Show full text]
  • Identification and Characterization of the Forkhead Box
    IDENTIFICATION AND CHARACTERIZATION OF THE FORKHEAD BOX FAMILY OF TRANSCRIPTIONAL REGULATORS IN PARASITIC SCHISTOSOMES by MELISSA M. VARRECCHIA Submitted in partial fulfillment of the requirements for the degree of Doctor of philosophy Department of Biology CASE WESTERN RESERVE UNIVERSITY August 2017 CASE WESTERN RESERVE UNIVERSITY SCHOOL OF GRADUATE STUDIES We hereby approve the dissertation of Melissa M. Varrecchia candidate for the degree of Doctor of Philosophy Committee Chair Michael F. Benard Committee Member Emmitt R. Jolly Committee Member Christopher A. Cullis Committee Member Claudia M. Mizutani Committee Member Brian M. McDermott Date of Defense June 6, 2017 *We also certify that written approval has been obtained for any proprietary material contained therein. ii Dedication I would like to dedicate this dissertation to my Mom and Dad. Mom, thank you for your endless love, support and encouragement throughout the years. Dad, I miss you and I know that you are with me always, cheering me on in spirit. iii Table of Contents Table of Contents………………………………………………………………………...1 List of Tables……………………………………………………………………………..6 List of Figures…………………………………………………………………………....8 Acknowledgements…………………………………………………………………..…11 List of Abbreviations…………………………………………………………………...13 Abstract…………………………………………………………………………………15 Chapter 1: Introduction………………………………………………………………..17 1.1 Schistosomiasis………………………………………………………………17 1.2 Pathogenesis and treatment…………………………………………………..18 1.3 Schistosome life cycle………………………………………………………..20 1.4 Schistosome morphology
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]