IDENTIFICATION of FUSARIUM OXYSPORUM F. Sp. OPUNTIARUM on NEW HOSTS of the CACTACEAE and EUPHORBIACEAE FAMILIES

Journal of Plant Pathology (2017), 99 (2), 347-354 Edizioni ETS Pisa, 2017 347

IDENTIFICATION OF FUSARIUM OXYSPORUM f. sp. OPUNTIARUM ON NEW HOSTS OF THE CACTACEAE AND EUPHORBIACEAE FAMILIES

D. Bertetti, G. Ortu, M.L. Gullino and A. Garibaldi

Centre of Competence for the Innovation in the Agro-Environmental Sector (AGROINNOVA), University of Turin, Largo Braccini 2, 10095 Grugliasco, Italy.

SUMMARY was more than 4 billion dollars in 2014 (USDA, 2015); in Canada, the import and export value of ornamental plant Fusarium oxysporum has recently been detected in com- products was about 418 and 312 million Canadian dollars, mercial nurseries in the Liguria region (northern Italy) on respectively, in 2013 (Statistical Overview of the Canadian new succulent plants belonging to the Cactaceae family Ornamental Industry, 2013); in Europe, the importing of (Astrophytum myriostigma, Cereus marginatus var. cristata, live plants and floriculture products reached more than C. peruvianus monstruosus and C. peruvianus florida) and 1,500 million euros in 2014 (European Commission, Ag- to the Euphorbiaceae family (Euphorbia mammillaris). The riculture and rural development, 2015). pathogen has been identified, for all the new hosts, from The ornamental industry in Italy is important in the morphological characteristics observed in vitro. The iden- agricultural sector because of its favourable climatic con- tifications have been confirmed by means of internal tran- ditions and specific economic situations that positively in- scribed spacer (ITS) analysis and/or by translation elonga- fluence the economic returns, with a production of about tion factor 1α (TEF) analysis. The aim of this work was 2,670 million euros in 2011 (Schimmenti et al., 2013). In to identify the forma specialis of the F. oxysporum isolates 2013, the production of ornamental and flowering plants obtained from new succulent plants. This has been investi- represented 5.4% of the total production in the agricul- gated by means of phylogenetic analysis based on the TEF tural sector in Italy (INEA, 2014). In 2010, a total of 4,271 gene and intergenic spacer (IGS), carried out on single- farms producing ornamental and flowering plants were spore isolates, together with pathogenicity assays. The located in the Liguria region, over an area of about 2,672 results of this research led to include four new succulent hectares (ISTAT, 2010). Various new genera and species hosts from Cactaceae as additional hosts to F. oxysporum are exploited in this region, because of their commercial f. sp. opuntiarum. This forma specialis has been identified importance. A particular fragment of the ornamental in- for the first time on a new host Euphorbia( mammillaris) dustry is that of succulent plants, which currently show a not belonging to the Cactaceae family. good market potential. The diversity of the crops and varieties, the effects of Keywords: ornamentals, succulent plants, soil-borne globalisation and of the intensive productions all lead pathogens, Fusarium wilt. to a multiplication of the number of potential pests and diseases that are able to infect new hosts. More than 120 different formae speciales of F. oxysporum have been described (Armstrong and Armstrong, 1981; O’Donnell and Cigelnik, 1999; Baayen et al., 2000; O’Donnell et al., 2009; Leslie, 2012). The detection and identification of formae speciales, which are classically based on pathogenicity as- INTRODUCTION says (Recorbet et al., 2003), are at present supported by molecular diagnostic tools (Lievens et al., 2012). Several The ornamental industry is economically important markers have been developed, on the basis of DNA se- throughout the world, and it also represents an interesting quences, in order to identify different formae speciales growth opportunity for developing countries. In industri- (Baayen et al., 2000; Groenewald et al., 2006). Genomic alized countries ornamental plants are purchased through- regions, such as the intergenic spacer region (IGS) or the out the year by a significant portion of the population, and translation elongation factor 1α (TEF), are useful but not moving the production of ornamental plants to develop- enough for correct identification (O’Donnell et al., 2009). ing countries would provide a remarkable source of in- Over the last few years, Fusarium rot or wilt symptoms come: in the USA, the wholesale value of floriculture crops have appeared on five new succulent hosts grown as pot- ted plants in commercial nurseries located in the Imperia Corresponding author: D. Bertetti Fax: + 39.011.6709307 province (Liguria region, northern Italy). The new hosts E-mail: [email protected] were succulent plants belonging to the Cactaceae family, 348 Fusarium oxysporum f. sp. opuntiarum on succulent plants Journal of Plant Pathology (2017), 99 (2), 347-354 that is, Astrophytum myriostigma (Garibaldi et al., 2015b), MATERIALS AND METHODS Cereus peruvianus monstruosus (Garibaldi et al., 2011), C. peruvianus florida (Garibaldi et al., 2015a) and C. mar- Fungal isolates. The F. oxysporum isolates were ob- ginatus var. cristata (Garibaldi et al., 2014) as well as to tained from diseased plants grown in nurseries located in the Euphorbiaceae family, that is, Euphorbia mammillaris Bordighera, Vallecrosia and Ventimiglia (Imperia prov- (Garibaldi et al., 2015c). Fusarium oxysporum has been ince, Liguria region) (Table 1). The isolates were obtained isolated and identified as the causal agent of the diseases by taking small pieces from the margin of symptomatic on all the host plants by means of morphological and mo- internal tissues and placing them on potato dextrose agar lecular methods. (PDA) and/or Komada Fusarium selective medium (Ko- The aim of this work was to investigate the forma specia- mada, 1975). To obtain pure isolates, colonies were sub- lis of the isolates of F. oxysporum obtained from succulent cultured on PDA. About 10 isolates were obtained from plants. each host; among these, two strains isolated from different plants were chosen for this study. Furthermore, two F. oxysporum f. sp. opuntiarum strains obtained from different collections were used as reference isolates: one strain isolated from Echinocactus grusonii (Polizzi and Vitale, 2004), gently provided by Prof. G.C. Polizzi (University of Table 1. The Fusarium oxysporum isolates used in this study. Catania, Italy), and the CBS 743.79 from the CBS-KNAW Strain* Host plant Place: city, Fungal Biodiversity Centre (The Netherlands). To ob- province, state tain the single-spore isolates used in this work (Table 1), DB13GIU05-22M Cereus marginatus Ventimiglia, a fungal suspension of each isolate was prepared in Po- Imperia, Italy tato Dextrose Broth (PDB), shaking cultures (90 rpm) at DB13GIU06-26M Cereus marginatus Ventimiglia, Imperia, Italy 25°C for 10 days. Then, each suspension was diluted to −8 DB210211-18M Cereus peruvianus monstruosus Bordighera, 1 × 10 CFU/ml. A drop from more diluted concentra- Imperia, Italy tions was spread on Komada selective medium. Single ger- DB220211-21M Cereus peruvianus monstruosus Bordighera, minated microconidia were selected by using an optical Imperia, Italy DB14OTT05-M1 Astrophytum myriostigma Vallecrosia, microscope. Imperia, Italy DB14OTT07-M1 Astrophytum myriostigma Vallecrosia, Pathogenicity assays. The isolates listed in Table 2 were Imperia, Italy DB14NOV08-M1 Cereus peruvianus florida Vallecrosia, artificially inoculated on Schlumbergera truncata plants (3 Imperia, Italy plants for each isolate), which are notoriously susceptible DB14NOV09-M1 Cereus peruvianus florida Vallecrosia, to F. oxysporum f. sp. opuntiarum (Lops et al., 2013). S. Imperia, Italy truncata healthy plants used for artificial inoculation were DB14OTT16-M1 Euphorbia mammillaris Vallecrosia, Imperia, Italy raised in a nursery and inoculated by wounding the stems DB14OTT17-M1 Euphorbia mammillaris Vallecrosia, (3 lesions/plant) with a sterilized needle contaminated Imperia, Italy with spores and mycelium taken from pure PDA cultures * In addition, two Fusarium oxysporum f. sp. opuntiarum strains were of the isolates (Talgø and Stensvand, 2013). Control plants used as reference isolates: Polizzi-31M (isolated from Echinocactus gru- were wounded with sterilized needles without any inocu- sonii, gently provided by Prof. Polizzi, University of Catania, Italy) and CBS 743.79 (isolated from Zygocactus truncatus and provided by the CBS- lum. All the plants were maintained under greenhouse KNAW Fungal Biodiversity Centre, The Netherlands). conditions, at mean daily temperatures ranging from 23 to 25°C and at mean daily RH ranging from 50 to 56%.

Table 2. Pathogenicity test carried out on Schlumbergera truncata plants artificially inoculated with Fusarium oxysporum isolates obtained from succulent plants.

Fusarium oxysporum tested isolates Susceptibility of Schlumbergera truncata Controls R* DB13GIU05-22M (from Cereus marginatus) HS DB13GIU06-26M (from Cereus marginatus) HS DB210211-18M (from Cereus peruvianus monstruosus) HS DB220211-21M (from Cereus peruvianus monstruosus) HS DB14OTT07-M1 (from Astrophytum myriostigma) HS DB14NOV09-M1 (from Cereus peruvianus florida) HS DB14OTT16-M1 (from Euphorbia mammillaris) HS Fusarium oxysporum f. sp. opuntiarum Polizzi-31M (from Echinocactus grusonii) HS Fusarium oxysporum f. sp. opuntiarum CBS 743.79 (from Zygocactus truncatus) HS *R = Resistant (disease index 0-5); PR = Partially Resistant (disease index 6-20); MS = Moderately Susceptible (disease index 21-50); S = Susceptible (disease index 51-75); HS = Highly Susceptible (disease index 76-100). Journal of Plant Pathology (2017), 99 (2), 347-354 Bertetti et al. 349

Furthermore, two F. oxysporum f. sp. opuntiarum refer- Table 3. Susceptibility of succulent species artificially inocu- ence isolates (Table 3) were inoculated on each new host lated with Fusarium oxysporum f. sp. opuntiarum isolates. and on S. truncata for comparison purposes. Three plants were inoculated with each isolate (3 wounds/plant), ac- Fusarium oxysporum f. sp. opuntiarum tested isolates cording to the method described by Talgø and Stensvand Tested species (2013). The control plants were wounded with sterilized Controls Polizzi-31M CBS 743.79 needles without any inoculum. All the plants were kept Astrophytum myriostigma R* HS HS Cereus marginatus R MS MS in a greenhouse, at the same environmental conditions Cereus peruvianus monstruosus R MS S described above. Cereus peruvianus florida R HS HS After the first symptoms of rot appeared around the Euphorbia mammillaris R MS MS needles on the inoculated plants, the severity of Fu- *R = Resistant (disease index 0-5); PR = Partially Resistant (disease sarium rot was evaluated every 4-7 days by measuring index 6–20); MS = Moderately Susceptible (disease index 21-50); S = Sus- the size of the rotted area. Totally rotted plants were ceptible (disease index 51-75); HS = Highly Susceptible (disease index 76- 100). removed at the end of each evaluation. The severity of Fusarium rot was assessed using a 0 to 100 scale, where 0 indicates the absence of rot; 25: rot diameter of 0 to Table 4. Primers used to amplify polygalacturonase genes. 5 mm; 50: rot diameter of > 5 to 10 mm; 75: rot diameter Gene Primer Nucleotide Sequences (5’→3’) Source of > 10 to 20 mm; 100: rot diameter of more than 20 mm. EF-1α Ef1 ATGGGTAAGGAAGACAAGAC O’Donnell et The disease index was then calculated using the follow- Ef2 GGAAGTACCAGTGATCATGTT al., 1998 ing formula: (0n0 + 25n1 + 50n2 + 75n3 + 100n4)/The total IGS CNS1 CCAGAGTGCCGATACCGATT Appel and Gordon, 1995 number of plants scored, where n0 is the number of rot- CNL12 GCTTAGYGAACAKGGAGTG ting areas that scored 0; n1 is the number of rotting areas that scored 25; … n4 is the number of rotting areas that scored 100. Finally, each tested species was classified in of denaturation at 94°C for 1 min, annealing at 58°C for 5 susceptibility classes: R = Resistant (disease index 0-5); 1 min, extension at 72°C for 1 min and final extension at PR = Partially Resistant (disease index 6-20); MS = Mod- 72°C for 7 min. For the IGS amplification, a PCR reac- erately Susceptible (disease index 21-50); S = Susceptible tion was performed in a 50 μl reaction mixture contain- (disease index 51-75); HS = Highly Susceptible (disease ing: 30 ng of gDNA, 5 μl of 10 μM stock (final concentra- index 76-100) (Tables 2 and 3). tion 1 μM) of primers CNL12 and CNS1, 3 units of Taq DNA polymerase (Qiagen), 5 μl of PCR buffer 10×, 5 μl DNA extraction. DNA extraction was carried out us- of dNTPs stock (final concentration 0.25 mM) and 10 μl ing an E.Z.N.A. Fungal DNA Mini Kit (Omega Bio-Tek), of 5× Q solution to amplify the G-C rich regions. A nega- according to the manufacturer’s instructions. Fresh my- tive control (no template DNA) was included in all the ex- celium was obtained for each isolate listed in Table 1 in periments. Amplifications were checked by electrophoresis 50 ml of a liquid PDB culture incubated at 25°C. The cul- on 1% agarose gel (Agarose D-1 LOW EEO, Eppendorf). tures were filtered after 6 days and 50 μg of mycelium was After purification with a QIAquick PCR Purification Kit transferred to a 2 ml tube containing 400 μl of lysis buffer (Qiagen), the PCR products were measured using a Nan- and two tungsten beads (Qiagen Stainless Steel Beads, oDrop spectrophotometer and were then sent to Macro- 5 mm). Homogenization was performed using Qiagen Tis- gen for sequencing (http://www.macrogen.com/eng/). TEF sueLyser for 4 min with 30 repetitions per minute, and the was sequenced in both directions, while the two internal obtained lysate was used for DNA extraction. The DNA primers CNS and CRU were also used for the IGS region. concentration was measured using a NanoDrop spectro- The sequences were deposited at GenBank and the acces- photometer, and the extracted DNA was stored at −20°C sion numbers are listed in Table 5. until further use. Alignment and phylogenetic analysis. Similarity PCR amplification. Translation elongation factor 1α searches (NCBI BLASTN, default parameters) were (TEF) and intergenic spacer (IGS) regions were used for performed for all the obtained sequences before a phy- the phylogenetic analysis. TEF was amplified with the logenetic analysis was performed. The sequences were EF1/EF2 primers (Table 4) using a T100 Thermal Cycler then considered for CLUSTALW multiple sequence (Bio-Rad) in a 20 μl reaction mixture containing: 10 ng of alignments using MEGA6 software set to the default gDNA, 1 μl of 10 μM stock (final concentration 0.5 μM) parameters. The sequences were corrected manually for of each primer, 1 unit of Taq DNA polymerase (Qiagen), each alignment in order to delete any external trimmer 2 μl of PCR buffer 10×, 1 μl of dNTPs stock (final con- regions and discard any incomplete sequences. Phylo- centration 0.25 mM) and 0.8 μl of MgCl2 (final concentra- genetic trees were constructed in MEGA6 (Tamura et tion 1 mM). Amplification was carried out with an initial al., 2013) using the Neighbor joining method with 1,000 denaturing step at 94°C for 5 min, followed by 35 cycles bootstrap repeats and the pairwise deletion option. The 350 Fusarium oxysporum f. sp. opuntiarum on succulent plants Journal of Plant Pathology (2017), 99 (2), 347-354

Fig. 1. Phylogenetic tree of Fusarium oxysporum isolates from Cactaceae and Euphorbiaceae based on EF-1α gene sequences. The values at the nodes are the bootstrap value based 1000 replicates. ▲ Sequences obtained from reference strains; ■ Sequences obtained from GenBank; ♦ Sequences obtained from the strains studied in this work. evolutionary distances were computed using the Tajima- RESULTS AND DISCUSSION Nei method, and are in the units of the number of base substitutions per site. Two different reference strains Pathogenicity assays. After the artificial inoculation on were used in this cluster: F. oxysporum f. sp. opuntiarum Schlumbergera truncata, all the isolates listed in Table 2 de- CBS 743.79 and a strain isolated from barrel cactus veloped necrosis around the wounds, only on the inoculat- (Echinocactus grusonii) in Italy (Polizzi and Vitale, 2004). ed stems. The necrosis then became extended as far as the Sequences derived from different F. oxysporum formae stems that rotted, whereas the controls remained healthy. speciales obtained from the GenBank database were in- F. oxysporum was consistently re-isolated from symptom- cluded in each analysis. atic plants for all the new hosts. S. truncata showed high Journal of Plant Pathology (2017), 99 (2), 347-354 Bertetti et al. 351 susceptibility to all the tested isolates, including the F. oxy- Table 5. Accession numbers of the EF-1α and IGS sequences sporum f. sp. opuntiarum reference isolates (Table 2). obtained from Fusarium oxysporum and deposited in Gen- Furthermore, all the artificially inoculated succulent Bank. hosts were also susceptible to various degrees to the F. oxysporum f. sp. opuntiarum isolates, as reported in Table 3. Accession numbers in Isolates GenBank EF-1α IGS Molecular phylogenetic analysis of the region. EF-1α DB13GIU05-22M KU575888 KU575870 Amplification of the EF-1α gene resulted in 750 bp frag- DB13GIU06-26M KU575889 KU575871 ments of DNA. After multi-alignment with other formae DB210211-18M KU575886 KU575872 speciales present in GenBank, the obtained sequences were DB220211-21M KU575887 KU575873 used for the phylogenetic analyses. The results of the anal- DB14OTT05-M1 KU575882 KU575876 yses showed that the isolates obtained from Astrophytum DB14OTT07-M1 KT183483 KU575877 DB14NOV08-M1 KU575885 KU575878 myriostigma, Cereus peruvianus monstruosus, C. peruvianus DB14NOV09-M1 KT183484 KU575879 florida, C. marginatus var. cristata and Euphorbia mammil- DB14OTT16-M1 KT183485 KU575880 laris were grouped with all F. oxysporum f. sp. opuntiarum DB14OTT17-M1 KU575883 KU575881 Fusarium oxysporum f. sp. opuntiarum KU575890 KU575868 used for the analysis, with a 99% bootstrap value (Fig. 1). Polizzi-31M The sequences used for the phylogenetic analysis were de- Fusarium oxysporum f. sp. opuntiarum KU575891 KU575869 posited at GenBank (Table 5). CBS 743.79

Molecular phylogenetic analysis of the IGS region. A 1994 bp sequence was obtained for each isolate, and the se- (Petrone et al., 2007) and Hylocereus undatus in Argen- quences used for the phylogenetic analysis were deposited tina (Wright et al., 2007). F. oxysporum on Cactaceae has at GenBank (Table 5). As observed for the EF 1-α analysis, been identified as belonging to f. sp. opuntiarum: on Zy- all the isolates in the analysis based on the IGS sequences gocactus and Rhipsalidopsis in Germany (Gerlach, 1972), also grouped together within the F. oxysporum f. sp. opun- on Opuntia ficus-indica in Brazil (Souza de et al., 2010), on tiarum clade with a high bootstrap value (100) (Fig. 2). A Echinocactus grusonii (Polizzi and Vitale, 2004) and Sch- reference sequence (GenBank Accession No. FJ985530.1) lumbergera truncata in Italy (Lops et al., 2013). Moreover, deposited by O’Donnell et al. in 2009 was added for this on new succulent hosts belonging to Crassulaceae family phylogenetic tree. (Crassula ovata, Echeveria agavoides and E. tolimanensis), Phylogenetic analysis permitted to include the new F. two new formae speciales, named f. sp. crassulae (Ortu et oxysporum isolates from succulents in f. sp. opuntiarum, al., 2013) and f. sp. echeveriae (Ortu et al., 2015; Garib- according to the results of the pathogenicity assays. These aldi et al., 2015d), respectively, have been recently identi- results showed that all the new isolates were pathogenic fied. Up to the present, F. oxysporum f. sp. opuntiarum has on Schlumbergera truncata, and when inoculated, provided only been identified on Cactaceae, and it has never been the same effect as that caused by the tested F. opuntiarum detected on hosts belonging to other families: this forma reference strains (Table 2). Furthermore, F. opuntiarum specialis is reported on Euphorbia mammillaris, Euphorbia- reference strains also caused disease on all the artificially ceae family, for the first time. Some strains of F. oxysporum inoculated new succulent hosts (Table 3). isolated from diseased wild Euphorbia spp. in European In the phylogenetic tree based on the IGS sequenc- countries have been shown to be virulent when artificially es all the isolates studied in this work clustered in the inoculated for biological control of leafy spurge (Euphorbia same group with the reference sequences proposed by esula) (Caesar, 1996). F. oxysporum was also isolated from O’Donnell et al. in 2009, while the other reference strains affected poinsettias (Euphorbia pulcherrima) (Orlikowski were separated in a closer group. BLAST analysis on Fu- et al., 2007). Nevertheless, the forma specialis was never sarium ID (http://isolate.fusariumdb.org/) showed a ho- investigated in any of these cases. Usually, formae speciales mology between our isolates and the NRRL29274 strain of F. oxysporum are assigned on the basis of their ability to isolated from Cereus and deposited in the database, while infect a specific host. However, the acquisition of pathoge- the others reference strains showed a homology with the nicity genes by horizontal transfer is common on F. oxys- strain NRRL29112 isolated from Cactus. This separation porum species complex (Van der Does and Rep, 2007). In suggests a possible differentiation within the f. sp. opun- addition, F. oxysporum genome is about 70% larger com- tiarum of F. oxysporum depending on the plant host. This pared to F. verticilloides and has larger intergenic regions, aspect requires further studies. with the possibility of rearranging its genome by the high Fusarium oxysporum has been identified as the causal presence of transposable element sequences. The common agent of stem and root rot on different hosts belonging presence of different transposable elements (Daboussi and to the Cactaceae family: Echinocactus grusonii in Eng- Capy, 2003) suggests the ability to rearrange the genome land (Hazelgrove, 1979), Zygocactus truncatus in the USA in response to the selection pressure, as well as to the in- (Moorman and Klemmer, 1980), Schlumbergera truncata tensive cultivation of host crop plants. 352 Fusarium oxysporum f. sp. opuntiarum on succulent plants Journal of Plant Pathology (2017), 99 (2), 347-354

Fig. 2. Phylogenetic tree of Fusarium oxysporum isolates from Cactaceae and Euphorbiaceae based on the IGS sequences. The values at the nodes are the bootstrap value based 1000 replicates. ▲ Sequences obtained from reference strains; ■ Sequences obtained from GenBank; ♦ Sequences obtained from the strains studied in this work.

Because a large number of succulent species and culti- ACKNOWLEDGEMENTS vars are grown in the same farms, there is the risk of spread of F. oxysporum f. sp. opuntiarum among the susceptible This project has been funded by the European Union hosts listed above. In these farms of intense floriculture, Horizon 2020 research and innovation programme under strategies to avoid the diffusion of F. oxysporum f. sp. opun- grant agreement No. 634179 “Effective Management of tiarum are particularly recommended, especially in the case Pests and Harmful Alien Species - Integrated Solutions” of rooted cuttings production. Finally, there is the neces- (EMPHASIS). The authors thank Prof. Giancarlo Polizzi, sity to test the susceptibility to this pathogen in the most University of Catania, for kindly providing one fungal diffused succulent plants in the Italian market, especially strain used in this work. Cactaceae and Euphorbiaceae, to provide growers with a list of resistant and/or tolerant species and cultivars. Journal of Plant Pathology (2017), 99 (2), 347-354 Bertetti et al. 353

REFERENCES INEA, 2014. L’agricoltura italiana conta 2014, Ministero delle Politiche Agricole Alimentari e Forestali, Roma. Appel D.J., Gordon T.R., 1995. Intraspecific variation within ISTAT, 2010. In: L’Agricoltura in Liguria. Rapporto sui dati populations of Fusarium oxysporum based on RFLP analysis provvisori del 6° Censimento generale dell’Agricoltura in of the intergenic spacer region of the rDNA. Experimental Liguria. 2011. Regione Liguria, Collana Convergenze & Di- Mycology 19: 120-128. vergenze, 15. Armstrong G.M., Armstrong J.K., 1981. Formae speciales and Komada H., 1975. Development of a selective medium for quan- races of Fusarium oxysporum causing wilt diseases. In: Nel- titative isolation of Fusarium oxysporum from natural soils. son P.E., Toussoun T.A., Cook R.J. (eds). Fusarium: Diseases, Review of Plant Protection Research 8: 114-125. Biology and Taxonomy, pp. 391-399. The Pennsylvania State Leslie J.F., 2012. Genetics and Fusarium oxysporum. In: Gullino University Press, University Park, USA. M.L., Katan J., Garibaldi A. (eds). Fusarium Wilts of Green- Baayen R.P., O’Donnell K., Bonants P.J.M., Cigelnik E., Kroon house Vegetable and Ornamental Crops, pp. 39-47. APS L.P.N.M., Roebroeck J.A., Waalwijk C., 2000. Gene gene- Press, St. Paul, MN, USA. alogies and AFLP analysis in the Fusarium oxysporum com- Lievens B., Hanssen I.M., Rep M., 2012. Recent developments plex identify monophyletic and non-monophyletic formae in the detection and identification of formae speciales and speciales causing wilt and rot disease. Phytopathology 90: races of Fusarium oxysporum: from pathogenicity testing to 891-900. molecular diagnostics. In: Gullino M.L., Katan J., Garibaldi Caesar A.J., 1996. Identity, pathogenicity, and comparative A. (eds). Fusarium Wilts of Greenhouse Vegetable and Or- virulence of Fusarium spp. related to stand declines of leafy namental Crops, pp. 47-55. APS Press, St. Paul, MN, USA. spurge (Euphorbia esula) in the Northern Plains. Plant Dis- Lops F., Cibelli F., Raimondo M.L., Carlucci A., 2013. First ease 80: 395-1398. report of stem wilt and root rot of Schlumbergera truncata Daboussi M.J., Capy P., 2003. Transposable elements in filamen- caused by Fusarium oxysporum f. sp. opuntiarum in southern tous fungi. Annual Review of Microbiology 57: 275-299. Italy. Plant Disease 97: 846. European Commission, Agriculture and Rural Development, Moorman G.W., Klemmer R.A., 1980. Fusarium oxysporum 2015. http://ec.europa.eu/agriculture/fruit-and-vegetables/ causes basal stem rot of Zygocactus truncatus. Plant Disease product-reports/flowers/statistics-2015_en.pdf 64: 1118-1119. Garibaldi A., Pensa P., Bertetti D., Poli A., Gullino M.L., 2011. O’Donnell K., Kistler H.C., Cigelnik E., Ploetz R.C., 1998. First report of basal stem rot of Apple Cactus (Cereus peru- Multiple evolutionary origins of the fungus causing Panama vianus monstruosus) caused by Fusarium oxysporum in Italy. disease of banana: concordant evidence from nuclear and Plant Disease 95: 877. mitochondrial gene genealogies. Proceedings of the National Garibaldi A., Pensa P., Bertetti D., Ortu G., Gullino M.L., Academy of Sciences of the United States of America 95: 2044- 2014. First report of dry and soft rot of Cereus marginatus 2049. var. cristata caused by Fusarium oxysporum in Italy. Plant O’Donnell K., Cigelnik E., 1999. A DNA sequence-based phy- Disease 98: 1441. logenetic structure for the Fusarium oxysporum complex. Garibaldi A., Bertetti D., Pensa P., Ortu G., Gullino M.L., Phytoparasitica 27: 69-70. 2015a. First Report of Fusarium oxysporum on Cereus peru- O’Donnell K., Gueidan C., Sink S., Johnston P.R., Crous P.W., vianus florida in Italy. Journal of Plant Pathology 97: S70. Glenn A., Riley R., Zitomer N.C., Colyer P., Waalwijk C., Garibaldi A., Bertetti D., Pensa P., Ortu G., Gullino M.L., van der Lee T., Moretti A., Kang S., Kim H.S., Geiser D.M., 2015b. First Report of Fusarium oxysporum causing wilt on Juba J.H., Baayen R.P., Cromey M.G., Bithell S., Sutton Astrophytum myriostigma in Italy. Plant Disease 100: 215. D.A., Skovgaard K.R., Kistler P., Elliott H.C., Davis M., Garibaldi A., Bertetti D., Pensa P., Ortu G., Gullino M.L., Sarver M.B.A.J., 2009. A two locus DNA sequence database 2015c. First Report of Fusarium oxysporum causing wilt on for typing plant and human pathogens within the Fusarium Euphorbia mammillaris var. variegata in Italy. Journal of Plant oxysporum species complex. Fungal Genetics and Biology 46: Pathology 97: S68. 936-948. Garibaldi A., Bertetti D., Pensa P., Ortu G., Gullino M.L., Orlikowski L.B., Skrzypczak C., Valiuskaite A., Sroczyn´ski M., 2015d. First report of Fusarium oxysporum f. sp. echeveriae 2007. Fusarium rot - new disease of poinsettia in Poland. causing wilt on Echeveria tolimanensis in Italy. Plant Disease Progress in Plant Protection 47: 212-215. 99: 1448. Ortu G., Bertetti D., Gullino M.L., Garibaldi A., 2013. A new Gerlach W., 1972. Fusarium rot and other fungal diseases of forma specialis of Fusarium oxysporum on Crassula ovata. horticulturally important cacti in Germany. Phytopatholo- Journal of Plant Pathology 95: 33-39. gische Zeitschrift 74: 197-217. Ortu G., Bertetti D., Gullino M.L., Garibaldi A., 2015. Fusari- Groenewald S., Van Den Berg N., Marasas W.F.O., Viljoen A., um oxysporum f. sp. echeveriae, a novel forma specialis caus- 2006. The application of high throughput AFLPs in assess- ing crown and stem rot of Echeveria agavoides. Phytopatho- ing genetic diversity in Fusarium oxysporum f. sp. cubense. logia Mediterranea 54: 64-75. Mycological Research 110: 297-305. Petrone M.E., Lori G., Wright E.R., Rivera M.C., 2007. First Hazelgrove A.J., 1979. A dry rot disease of Echinocactus grusonii report of stem and root rot of Schlumbergera truncata caused caused by Fusarium oxysporum Schlect. National Cactus and by Fusarium oxysporum in Argentina. Journal of Plant Pathol- Succulent Journal 34: 37-39. ogy 89: S70. 354 Fusarium oxysporum f. sp. opuntiarum on succulent plants Journal of Plant Pathology (2017), 99 (2), 347-354

Polizzi G., Vitale A., 2004. First report of basal stem rot of 2013. http://www.agr.gc.ca/ golden barrel cactus caused by Fusarium oxysporum f. sp. Tamura K., Stecher G., Peterson D., Filipski A., Kumar S., 2013. opuntiarum in Italy. Plant Disease 88: 85. MEGA6: Molecular Evolutionary Genetics Analysis version Recorbet G., Steinberg C., Olivain C., Edel V., Trouvelot S., 6.0. Molecular Biology and Evolution 30: 2725-2729. Dumas-Gaudot E., Gianinazzi S., Alabouvette C., 2003. Talgø V., Stensvand A., 2013. A simple and effective inoculation Wanted: pathogenesis-related marker molecules for Fusari- method for Phytophthora and fungal species on woody um oxysporum. New Phytologist 159: 73-92. plants. OEPP/EPPO Bulletin 43: 276-279. Schimmenti E., Galati A., Borsellino V., Ievoli C., Lupi C., Ti- USDA, 2015. Floriculture Crops, 06-04-2015. http://usda. nervia S., 2013. Behaviour of consumers of conventional and mannlib.cornell.edu/MannUsda/viewDocumentInfo. organic flowers and ornamental plants in Italy. Horticultural do?documentID = 1072 Science 40: 162-171. Van der Does H.C., Rep M., 2007. Virulence Genes and the Souza de A.E.F., Nascimento L.C., Araújo E., Lopes E.B., Sou- Evolution of Host Specificity in Plant-Pathogenic Fungi. to F.M., 2010. Occurrence and identification of the etiologic Molecular Plant-Microbe Interactions 20: 1175-1182. agents of plant diseases in cactus (Opuntia ficus-indica Mill.) Wright E.R., Rivera M.C., Ghirlanda A., Lori G.A., 2007. Basal in the semi-arid region of Paraiba. Biotemas 23: 11-20. rot of Hylocereus undatus caused by Fusarium oxysporum in Statistical Overview of the Canadian Ornamental Industry, Buenos Aires, Argentina. Plant Disease 91: 323.

Received May 25, 2016 Accepted February 4, 2017