bioRxiv preprint doi: https://doi.org/10.1101/2020.01.13.904144; this version posted January 13, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

1 Complete genome and phylogenetic analysis of

2 type 15 in Southern Xinjiang dairy cow 3 Jianjun Hu1*, Wanqi Zhang1, Surinder Singh Chauhan2*, Changqing Shi1, Yumeng Song2,

4 Zhitao Qiu1, Yubing Zhao1, Zhehong Wang1, Long Cheng2, Yingyu Zhang1

5 1 College of Animal Science, Tarim University, Alar, Xinjiang, China

6 2 Faculty of Veterinary and Agricultural Sciences, Dookie campus, The University of

7 Melbourne, Victoria, Australia

8 *Corresponding author

9 Jianjun Hu, E-mail: [email protected]

10 Surinder Singh Chauhan , E-mail: [email protected]

11 12 Abstract

13 In this study, the complete genome sequence of bovine papillomavirus（BPV）type 15 (BPV

14 Aks-02), a novel putative BPV type from a skin sample of a cow in southern Xinjiang, China

15 was determined by collecting cutaneous neoplastic lesion, followed by DNA extraction and

16 amplicon sequencing. The complete genome consisted of 7189 base pairs (G+C content of

17 42.50%) that encoded five early (E8, E7, E1, E2, E4) and two late (L1 and L2) genes. The E7

18 protein contained a consensus CX2CX29CX2C zinc-binding domain and an LxCxE motif. The

19 nucleotide sequence of the L1 open reading frame (ORF) was related mostly (99%) to the L1

20 ORF of putative type BAPV-3 reference strain from GenBank. Phylogenetic analysis and

21 sequence similarities based on the L1 ORF suggest that BPV type (BPV Aks-02) clustered

22 with members of genus Xipapillomavirus as BPV15, and closely related to Xipapillomavirus

23 1.

24 Introduction bioRxiv preprint doi: https://doi.org/10.1101/2020.01.13.904144; this version posted January 13, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

25 Papillomaviruses (PVs) are a crescent diverse group of whose genomes comprise

26 small non-enveloped and circular double-stranded DNA [1-2]. The PVs have been

27 reported worldwide to cause infection in a large variety of amniote species [2]. In cattle,

28 bovine papilloma, also known as wart, is the most common skin tumor caused by bovine

29 papillomavirus [3]. The BPV types and putative new PV (BAPV1 to 10) have been found by

30 broad-spectrum detection in different places of the animals’ body, even in healthy skin [4-5].

31 Several studies have reported that BPV viral types have limited relationship to clinical status,

32 type of herd, and age of animals [6-7]. This indicates that traditional clinical diagnostic

33 techniques may not be effective methods to determine BPV types.

34 Recently, culture-independent molecular techniques are used to detect the PV without virus

35 culture system [8]. Based on the sequence similarity of the highly conserved ORF L1 of

36 papillomaviruses (PVs), the BPV types have been characterized and classified into five

37 genera, namely Deltapapillomavirus, , Xipapillomavirus,

38 Dyoxipapillomavirus and Dyokappapapillomavirus [9-10]. So far, 23 genotypes have been

39 reported [11-12]. The BPVs 1, 2, 13, and 14 are classified in Deltapapillomavirus genus;

40 BPVs 5 and 8 are grouped in Epsilonpapillomavirus genus; Xipapillomavirus genus

41 comprised the BPVs 3, 4, 6, 9, 10, 11, 12, 15, 17, 20, and 23; BPV 7 is classed as a member

42 of Dyoxipapillomavirus genus, Dyokappapapillomavirus genus includes BPVs 16 and 18.

43 Other new BPV 19 and BPV 21 still have undefined genera [11-15]

44 In 2014, we observed a case of warty lesion from a dairy cow in Southern Xinjiang, China.

45 Although the genomes of BPV 15 were submitted to the GenBank database, the complete

46 genome sequence of BPV 15 has not yet been characterized. Therefore, the aim of this study bioRxiv preprint doi: https://doi.org/10.1101/2020.01.13.904144; this version posted January 13, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

47 was to conduct a complete genome and phylogenetic analysis of BPV type 15 in Southern

48 Xinjiang dairy cow.

49 Material and Methods

50 Sample collection

51 In 2014, 11 warty lesion samples were collected from a dairy farm in southern Xinjiang,

52 China. All samples were studied by L1 gene and phylogenetic analysis, but for the purpose of

53 this publication, we focused on reporting the novel BPV 15 which was isolated from the

54 warty lesion sample collected from one of the infected cows. The lesion was dark grey, 0.5-1

55 cm in diameter and located on the neck region below jaw. The sample was suspended in a 50%

56 glycerol phosphate buffer and stored at -20 °C. The sample was named as Aks-02.

57 DNA extraction

58 The frozen warty lesion specimens were homogenized. Total genomic DNA was extracted

59 from warty lesions specimens using TIANamp Genomic DNA Kit (TIANGEN BIOTECH,

60 Beijing, China) according to the manufacture’s protocol. The extracted DNAs were dissolved

61 in 50 μl TE buffer and stored at -20 °C until used.

62 PCR assay

63 Papillomaviral DNA was initially analyzed by PCR using the degenerate primers

64 FAP59(forward: 5′ -TAACWGTIGGICAYCCWTATT-3′ ) and FAP64 (reverse: 5′

65 -CCWATATCWVHCATITCICCATC -3′) [16]. The expected length was approximately 480

66 bp.

67 To further characterize the complete genome sequences of the BPV Aks-02, amplification bioRxiv preprint doi: https://doi.org/10.1101/2020.01.13.904144; this version posted January 13, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

68 primers and sequencing primers were designed by DNAStar version 5.0 software according to

69 available genomes in GenBank under the following accession number: AY300819,

70 HQ612180. The primers set for amplification of the complete BAPV3 genome were

71 BAPV-3_F (forward: 5′ -CAGTGACACCTATTCCAAGAGGTT-3′ and BAPV-3_R2

72 (reverse: 5′- GCATGGACCCTAAACAAGTGCAAC -3′). Details of the sequencing primers

73 are shown in S1 Table. Both amplification and sequencing primers were synthesized by

74 Sangon Biotech (Shanghai, China). The amplification of viral DNA by PCR was carried out

75 base on the manufacturer’s recommendations of the LA PCR Kit (TaKaRa Biomedical

76 Technology Beijing, China). Briefly, in a total volume of 20 μl: 2x LA Buffer 2.0 μl, dNTP

77 （2.5 mM）0.5 μl; Primer BAPV-3_F（10 mM）0.4 μl; Primer BAPV-3_ R2（10 mM）0.4

78 μl; template DNA 1.0 μl; LATaq enzyme（ 5 U/μl） 0.4 μl; ddH2O 15.3 μl, which was

79 homogeneously mixed and short spun. The expected length was approximately 7200 bp.

80 The PCR was performed in a thermocycler (TECHNE, TC-1500, UK) with the following

81 cycling profile: an initial denaturation of 10 min at 94 °C, followed by 32 cycles of 30 s at

82 95 °C, 45 s at 56 °C and 80 s at 72 °C; and a final extension step of 10 min at 72 °C. 5 μl of

83 PCR products were loaded on 1.5% agarose gel in Tris-acetate EDTA buffer at constant

84 voltage (90V) for approximately 45 min, and visualized under UV light.

85 Sequencing and sequence analysis

86 All products were purified using AxyPrep DNA Gel Extraction kits (Axygen Biotechnology,

87 Hangzhou, China) according to the manufacturer’s instruction. The PCR amplifications of the

88 complete genomes were sequenced bi-directionally by amplification prime and multiply

89 sequencing primers using the Applied Biosystems 3730XL DNA Analyzer (Applied bioRxiv preprint doi: https://doi.org/10.1101/2020.01.13.904144; this version posted January 13, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

90 Biosystems, USA). The data of sequencing were assembled using DNAStar version 5.0

91 software, and submitted to Blastn search. The characteristics of the complete sequence of the

92 PV, including predictions of putative ORF, molecular weight, motifs, and regulatory

93 sequences were predicted using DNAStar version 5.0 software.

94 Phylogenetic analysis

95 The complete genome sequences of L1 gene of 22 genotypes (BPV 1 to 22) from GenBank,

96 the partial gene sequences of L1 gene of 10 putative BPV types (BAPV 1 to 10) from

97 GenBank, were imported and aligned using Clustal W in DNAStar version 5.0 software.

98 Phylogenetic trees were constructed from the alignment of L1 sequences using

99 Neighbor-joining method in MEGA 6.0 software.

100 Gene sequence accession number

101 The complete sequence of the novel PV was deposited in the GenBank database with the

102 accession number KM983393.1. The GenBank accession numbers of these different genotype

103 sequences used in sequence analysis and phylogenetic analysis were shown in S2 Table.

104 Results and Discussion

105 PCR, sequencing and sequence alignments

106 In this study, papillomaviral DNA from the sample of warty lesion was successfully amplified

107 by the PCR with the degenerate primers (FAP59/FAP64). The expected length of PCR

108 product was approximately 480 bp. The negative control with Millipore water for PCR

109 amplification resulted in no amplified product. Based on conserved region within the L1 ORF

110 of different genera of PVs, BPVs are divided into different genotypes. Ten putative BPV bioRxiv preprint doi: https://doi.org/10.1101/2020.01.13.904144; this version posted January 13, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

111 types (BAPV 1 to 10) with the partial ORF L1 nucleotide sequence were also used for

112 sequence alignments [17-18]. Interestingly, the ORF L1 nucleotide sequence of the BPV

113 Aks-02 was more than 99% identity with BAPV-3 (AY300819). The result revealed that BPV

114 Aks-02 and BAPV-3 were most closely related to each other, according to difference between

115 2% and 10% based on L1 nucleotide sequence [1, 11]. Except for BAPV-3, present identity

116 between the ORF L1 nucleotide sequences of the BPV Aks-02 and BPV 3, -4, -6, -9, -10 were

117 74.6%, 72.9%, 72.2%, 75.2% and 71.8%, respectively. Nucleotide sequence similarity of L1

118 gene sequence of BPV was shown in S3 Table.

119 Based on the results of sequence alignments analysis of L1 gene, the complete genome

120 sequences of the identified BPVAks-02 was successfully amplified and sequenced with 17

121 sequencing primers, resulting in amplicons with approximately 7189 bp size (S1 Fig). The

122 complete genomes of different BPV genotypes consisted of different ORFs and contained at

123 least four common ORFs, there are E1, E2, L1 and L2 ORF [9, 19]. According to E1, E2, E7,

124 L1 and L2 nucleotide sequence alignment between BPV Aks-02 and related BPV, those of

125 BPV Aks-02 shared more than 62.2% similarity with five ORFs of Xipapillomavirus1

126 respectively. Similarly, similarities between the complete genomes of BPV Aks-02 and those

127 of Xipapillomavirus1 were a maximum of 67.5-72.3% identity within five different genera

128 (Table 1). Therefore, our results suggested that the BPV Aks-02 should be classified in

129 Xipapillomavirus1.

130 Table 1. Nucleotide sequence similarity (%) between BPV Aks-02 and related BPV. Xipapillomaviru Delta- s Epsilon- Dyoxi- Dyokappa- papilloma Xi Xi- Xi- papillomavir papillomavir papillomavir virus papillomav papillomav papillomav us us us irus -1 irus -2 irus -3 Complet 12.4-12. 67.5-72.3 61.0 57.3 43.0-43.0 43.1 43.5-43.7 bioRxiv preprint doi: https://doi.org/10.1101/2020.01.13.904144; this version posted January 13, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

e genomes E1 41.0-41.8 74.5-77.8 65.7 66.9 39.8-42.1 43.5 42.1-42.2

E2 14.2-18.0 69.3-72.1 61.1 62.6 14.9-17.0 25.9 28.8-30.5

E7 4.0-8.3 65.7-72.6 12.6 13.5 4.6-6.9 7.3 9.1-21.3

L1 55.1-57.2 71.5-99.5 68.1 68.7 55.4-59.3 52.9-60.6 56.2-57.0

L2 2.7-9.9 62.2-69.3 63.6 48.2 7.8-8.0 7.8 7.8-9.8

131

132 Phylogenetic analysis

133 The phylogenetic tree of L1 ORF sequence was constructed with 32 BPVs using

134 Neighbor-joining method in MEGA 6.0 software. According to the International Committee

135 on Taxonomy of Viruses (ICTV) new Papillomavirus taxonomy proposal, the

136 Xipapillomavirus genus includes three papillomavirus species: Xipapillomavirus1 (BPV3, 4, 6,

137 9, 10, 11, 15 and 23), Xipapillomavirus2 (BPV12), Xipapillomavirus3 (RtPV2), respectively

138 [11, 14, 15]. As evident from the phylogenetic tree, the BPV Aks-02 was more closely related

139 to BAPV3-AY300819 of the species Xipapillomavirus1, classified in the Xipapillomavirus

140 genus (Fig 1). Therefore, the phylogenetic analysis indicated that the BPV Aks-02 appeared

141 in the same cluster as BAPV3 within the genus Xipapillomavirus1. Additionally, the new

142 putative BPV types BAPV 1 to 10 were classified in different genera in the family

143 . However, other two new BPV types, namely, BPV 19 and BPV 21 are still

144 unclassified genus, which requires further research [11, 14, 15]. bioRxiv preprint doi: https://doi.org/10.1101/2020.01.13.904144; this version posted January 13, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

A

Y

4

2

6 q q 5 e e s 5 s . . q 6 4 7 e 9 _ 9 s 3 ( . 9 B 7 B 4 1 0 A 9 5 P 3 3 U P V 0 q 9 K V 2 1 - e C 1 0 _ 5 q s 2 . N e - 8 - U A V s K 6 . ) 7 K P Y U . 2 - 2 s 1 B 1 3 1 9 5 e V 6 0 8 1 1 q 7 P 2 V 0 9 0 B 8 0 P 0 3 _ eq 1 B .s 9 C C 6) 9 _ 5 N V ( N P . - - A B B s 7 (B 2 _ P A e V 2 1 5 V q 5 P P 26 _ V B 4 A V AY k P s _ A - B Y4 02 3 2 ) eq 6 .s . .s 5 e s _5) 55 q e PV _ q A (B _(B A 551 PV 426 _9 AY BP ). V6- se AJ6 q 202 PV_7).seq 08 426553_(BA .seq AY Dyoxipapillomavirus

BPV3-A J620207.seq 1.seq BPV16-KU51939

).seq PV_10 556(BA AY426 BPV22 q -KY705 ).se q 374.s V_1 e eq BAP .s 7_( 0 081 5 Y30 6 A 1 3 3 B -A BPV 9 18- V KU5 P 193 B q 93. q e seq e s .s . 1 7 5 0 q Dyokappapapillomavirus 6 5 e 3 s 1 . 3 4 7 3 5 1 B B A 8 - A 5 0 - 1 1 0 BPV2-KM X 4 V 1 55051.s - eq P V 4 B P V B B P PV

B 1 3- B JQ P 7 V 98 1 17 B - 1. P X se V 0 q 2 Xipapillomavirus 1 3 4 4

- 6

A K

B . Y s

B P

P e

3 2

A P q

0 V 7

0 Y V

8 6

8 5

4

1 3

-

D -

8 4

2 A

_ 6 3 Q

( J .

B 5 6 s 0

A 5 2 e Deltapapillomavirus 9

P 0 0 q

8

V ( 2

9 B

_ 0

1

2 A 6

) 3

. P .

s s .

e s V e q e q

_ q 4

)

. s

e Epsilonpapillq omavirus 145 0.05 146 147 Fig 1. Phylogenetic tree based on the papillomavirus L1 gene.

148 The phylogenetic tree was inferred using the neighbor-joining method based on an L1 nucleotide

149 sequence alignment of 31 BPVs and BPV Aks-02 (the BPV Aks-02 is indicted with a black

150 diamond). The tree was divided into the previously determined genera Xipapillomavirus,

151 Epsilonpapillomavirus, Deltapapillomavirus, Dyokappapapillomavirus, Dyoxipapillomavirus, and

152 unassigned PV genus (BPV19, BPV21)

153 The complete BPV 15 genome structure

154 The complete genome structure of the BPV Aks-02 was predicted to contain 7189 bp with a

155 GC content of 42.5% and consist of five early (E8, E7, E1, E2, E4) and two late (L1 and L2) bioRxiv preprint doi: https://doi.org/10.1101/2020.01.13.904144; this version posted January 13, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

156 ORFs. The long control region (LCR) located between the early and late ORFs of the circular

157 virus. The E4 ORF was embedded within E2. E7 and E1, E1 and E2, were partial overlapping.

158 The BPV Aks-02 was lack of characteristic E6 ORF [1]. The predicted ORFs and

159 characteristics of genomes structure are shown in Fig 2 and Table 2.

160 161 474 602 2871 4085 4099 5673 5684 7189 808 1110 E8 E2 L2 L1 162 E7 163 1100 2929 3391 3819 E1 E4 164

1000 165 1 2000 3000 4000 5000 6000 7000 473 166 LCR

167 Fig 2. Complete genome structure analysis of the BPV Aks-02. The boxes represent the early

168 (E) and the late (L) ORFs. The long control regions (LCR) encompassing nucleotides 1-473

169 ▲, E1 binding sites (E1BS); ●, Polyadenylation signals; ▼, Nuclear factor binding sites

170 (NF-1); ◆, TATA box of the viral promoters; △, E2 binding sites (E2BS). 171

172 Table 2. Main features of the proposed BPV genome.

Position Length (nt) Length (aa) Molecular mass (KDa) Isolectric Point

LCR 1-473 473 - - -

E8 474-602 129 42 4858.97 Daltons 5.411

E7 808-1,110 303 100 11140.66 3.938

E1 1,100-2,929 1830 609 69496.13 6.556

E2 2,871-4,085 1215 404 45699.32 9.723

E4 3,391-3,819 429 142 16301.39 5.938

L2 4,099-5,673 1506 501 57205.94 7.786

L1 5,684-7,189 1575 524 57317.08 4.759

173

174 The long control region bioRxiv preprint doi: https://doi.org/10.1101/2020.01.13.904144; this version posted January 13, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

175 LCR known as the non-coding region (NCR) or up-stream regulatory region (URR), was

176 located at nt 1 to 473 between the stop-codon of L1 and the start-codon of E8 in the BPV

177 Aks-02. Many sites were found in the early region of complete genome. Most PVs possess

178 some of the transcription factor binding sites (TFBS) in the LCR, such as E2BS, E1BS, NF-1

179 [20-23]. LCR of the BPV Aks-02 contained one E1BS (AACAAT at nt 28-31), two canonical

180 E2BS (ACCGN4CGGT at nt 322-333, nt 410-421), one non-canonical E2BS (ACC-N6-GGT

181 at nt 395-406), respectively. E2BS are essential for activating or repressing the transcription

182 of viral genome [24]. One modified E1BS (TAACAA at nt 366-371) was presented in the

183 LCR. It also contained only one polyadenylation (polyA) sites (AATAAA at nt 81-86) and

184 two TATA boxes (TATAAAA at nt 261-267, nt 425-431) in the LCR. Nuclear factor binding

185 sites NF-1 (TTGGCA at nt 113-118) were also located in the LCR.

186 BPV 15 early region

187 The early region of the BPV Aks-02 includes 5 ORFs, such as E8 (128 bp), E7 (302 bp), E1

188 (1829 bp), E2 (1214 bp) and E4 (428 bp). The early region mainly encodes the non-structural

189 viral proteins for initiation of virus replication [2, 14]. The BPV Aks-02 genome included a

190 putative E8 gene in the early region [1] [24]. An important element of E8 protein was

191 presented to be the conserved C-terminal amino acids LXGWD and repeated sequences

192 TGTCAACTGT (nt 568-577). The BPV Aks-02 E8 ORF shared 65.1% identity of nucleotide

193 sequence with BPV3 E8 ORF (AF486184.1) [11].

194 The pRbBD found in the E7 protein of most PVs members play an important role in

195 interfering with host cell cycle and the immortalization and transformation of the host cell [11,

196 14, 25]. The BPV Aks-02 E7 ORF encoded a 100 aa protein and contained a conserved bioRxiv preprint doi: https://doi.org/10.1101/2020.01.13.904144; this version posted January 13, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

197 retinoblastoma tumor-suppressor protein-binding domain (pRbBD: LXCXE). Furthermore, one

198 consensus zinc-binding domain (ZnBD: CX2CX29CX2C) was located in the C-terminal region.

199 The CXXC motifs were separated by 29 aa residues.

200 The E1 and E2 of the early region in all PV are necessary for genome transcription and

201 replication [14]. The E1 ORF coded about 609 aa as the largest protein of BVP 15. The

202 conserved ATP-binding site of ATP-dependent helicase (GX4GKS) is located in C-terminal

203 region of E1. There were two modified E1BS (TAACAA) at 1357-1362, nt 1540-1545 in the

204 E1 ORF. Additionally, the E1 ORF contains a cyclin interaction RXL motif (the native

205 KRRLL recruitment motif), which is essential for the initiation of papillomavirus replication

206 and could be a potential target for developing therapeutic agents or vaccine development [14,

207 20]. There was a lack of a leucine-zipper domain (LX6LX6LX6LX6L) in the E2 protein of the

208 BPV Aks-02 [26]. The Putative E4 ORF showed a start codon and nested within the E2 ORF,

209 which is 71.8% similar to BPV 3 (AF486184.1).

210 BPV 15 late region

211 The BPV viral capsid is mainly consisted of the major L1 and minor L2 late proteins [11].

212 The late region of the BPV Aks-02 was predicated to contain major capsid protein L1 and

213 minor capsid protein L2. There were two E1BS (AACAAT at nt 5439-5444, nt 6917-6922)

214 and one modified E1BS (TAACAA at nt 5438-5443) in the late region. For the late viral

215 mRNA transcription, polyadenylation signals PolyA (AATAAA) were identified at nt

216 7040-7045 of the L1. In addition, Polyadenylation signals PolyA (ATTAAA instead of

217 AATAAA) was founded at nt 4093-4098 between the stop-codon of the E2 and the

218 start-codon of L2 ORF. There were one canonical E2BS (ACC-N6-GGT at nt 7126-7137) in bioRxiv preprint doi: https://doi.org/10.1101/2020.01.13.904144; this version posted January 13, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

219 the L1 gene and one non-canonical E2BS (ACC-N7-GGT at nt4308-4320) in the L2 gene.

220 Nuclear factor binding sites (NF-1: TTGGCA at nt 5278-5283) were also found in the L2

221 ORF. The L1 protein was presented a high proportion of positively charged residues (K or R)

222 in the C-terminal end.

223 Conclusion

224 In this study, we detected the BPV genotype from a neck wart of dairy cow and present the

225 complete genome sequences and genome characterization of BPV 15. Based on these genetic

226 features, it is suggested that BPV 15 classified viral type in the Xipapillomavirus genus, well

227 aligns in Xipapillomavirus genus 1 branch. These data may contribute to the understanding of

228 the classification, genomic evolution and epidemiology of BPV.

229 Supporting information 230 S1 Table. Sequencing primers.

Sequencing primers Position Sequence (5′→3′)

BAPV-3_R4 1-530nt CAGTGGTAAGGCGCCAAAGC

BAPV-3_R6 487-1013nt CGGTCGTACCGATATCGGTG

BAPV-3_R7 901-1489nt CGTGGTATTGCAGGACTTAG

BAPV-3_R8 1430-2076nt AGACTAACAACAGCCCTCGT

BAPV-3_R10 2019-2753nt GTGGAAGCTGCAGCATAATCC

BAPV-3_F10 2685-3331nt GCATCATCATGAAAGTTCACAT

BAPV-3_F8 3278-3884nt AGTCTTGCTAACCCATGTCCA

BAPV-3_F7 3835-4370nt CTATAACTGTTGGCCTGACT

BAPV-3_F6 4265-4627nt CATGATCTGATGCTGAAGTC

BAPV-3_F4 4568-4971nt AGGTCTACTTAACCTTATTA

BAPV-3_F3 4921-5511nt CAATGTCAGGATATGCTGGTTG bioRxiv preprint doi: https://doi.org/10.1101/2020.01.13.904144; this version posted January 13, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

231 BAPV-3_F 5461-5920nt CAGTGACACCTATTCCAAGAGGTT 232 BAPV-3_P2 5833-6188nt CCWATATCWVHCATITCICCATC 233 234 BAPV-3_P1 5954-6259nt TAACWGTIGGICAYCCWTATT 235 GCATGGACCCTAAACAAGTGCAA 236 BAPV-3_R2 6220-6752nt C 237 238 BAPV-3_F5 6553-7047nt CGGTGCAGACCGTTTGGTGC 239 S2 Table. 240 BAPV-3_R3 6930-7189nt TTGACACCACTCGAGGAACA Reference 241 strains. 242 All reference strains in this study were downloaded from GenBank 243 (http://www.ncbi.nlm.nih.gov/), as shown in Table with the respective GenBank accession 244 numbers. 245 Table BPV reference strains from GenBank Scientific genus accession number Abbreviation BPV1 Deltapapillomavirus X02346 BPV2 Deltapapillomavirus KM455051.1 BPV3 Xipapillomavirus AF486184.1 BPV4 Xipapillomavirus X05817.1 BPV5 Epsilonpapillomavirus AF457465 BPV6 Xipapillomavirus AJ620208.1 BPV7 Dyoxipapillomavirus NC_007612 BPV8 Epsilonpapillomavirus DQ098913 BPV9 Xipapillomavirus AB331650 BPV10 Xipapillomavirus AB331651 BPV11 Xipapillomavirus AB543507 BPV12 Xipapillomavirus NC_028126.1 BPV13 Deltapapillomavirus JQ798171 BPV14 Deltapapillomavirus KP276343 BPV15 Xipapillomavirus KM983393.1 BPV16 Dyokappapapillomavirus KU519391 BPV17 Xipapillomavirus NC_030797.1 BPV18 Dyokappapapillomavirus KU519393.1 BPV19 undefined KU519394.1 BPV20 Xipapillomavirus KU519395.1 BPV21 undefined KU519396.1 BPV22 Dyokappapapillomavirus KY705374 BAPV 1 Xipapillomavirus AY300817 BAPV 2 Epsilonpapillomavirus AY300818 BAPV 3 Xipapillomavirus AY300819，HQ612180 BAPV 4 Epsilonpapillomavirus AY426550 BAPV 5 Dyokappapapillomavirus AY426551 bioRxiv preprint doi: https://doi.org/10.1101/2020.01.13.904144; this version posted January 13, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

BAPV 6 Dyokappapapillomavirus AY426552 BAPV 7 Dyokappapapillomavirus AY426553 BAPV 8 Xipapillomavirus AY426554 BAPV 9 Xipapillomavirus AY426555 BAPV 10 Xipapillomavirus AY426556 246 247 S3 Table. Homology analysis of L gene sequence of BPV 248 249 S1Fig. PCR amplification fragment 250 A PCR amplification fragment was obtained and the results of the 1.5% agarose gel 251 electrophoresis showed that the fragment size was 7189 bp.

252 253 Fig PCR amplification for the BPV Aks-02 complete genome

254 1：nt6120-6035；M：DL2000 DNA marker；control：Negative control

255

256 Acknowledgments

257 We thank National Nature Science Foundation of China for financial support.

258 References 259 1. de Villiers EM, Fauquet C, Broker TR, Bernard HU, Hausen HZ. Classification of

260 papillomaviruses. Virology. 2004 Jun 20;324(1):17-27. doi:10.1016/j.virol.2004.03.033.

261 PMID:15183049.

262 2. Rector A, Van Ranst M. Animal papillomaviruses.Virology. 2013 Oct; 445(1-2):213-223.

263 doi:10.1016/j.virol.2013.05.007. PMID:23711385.

264 3. Bocaneti F, Altamura G, Corteggio A, Velescu E, Roperto F, Borzacchiello G. Bovine

265 papillomavirus: new insights into an old disease. Transbound Emerg Dis. 2016 Feb;

266 63(1):14-23. doi: 10.1111/tbed.12222. PMID: 24661978. bioRxiv preprint doi: https://doi.org/10.1101/2020.01.13.904144; this version posted January 13, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

267 4. Corteggio A, Altamura G, Roperto F, Borzacchiello G. Bovine papillomavirus E5 and E7

268 oncoproteins in naturally occurring tumors: are two better than one? Infect Agents Cancer.

269 2013 Jan 9;8(1):1. doi:10.1186/1750-9378-8-1. PMID: 23302179.

270 5. Ogawa T, Tomita Y, Okada M, Shinozaki K, Kubonoya H, Kaiho I, et al. Broad-spectrum

271 detection of papillomaviruses in bovine teat papillomas and healthy teat skin. J Gen Virol.

272 2004 Aug; 85(Pt8):2191-7. doi:10.1099/vir.0.80086-0. PMID: 15269358.

273 6. Dagalp SB, Dogan F, Farzani TA, Salar S, Bsatan A. The genetic diversity of bovine

274 papillomaviruses (BPV) from different papillomatosis cases in dairy cows in Turkey. Arch

275 Virol. 2017 Jun; 162 (6):1507-1518. doi:10.1007/s00705-017-3258-8. PMID: 28190198.

276 7. Santos EU, Silva MA, Pontes NE, Coutinho LC, Paiva SS, Castro RS,et al. Detection of

277 different bovine papillomavirus types and co-infection in bloodstream of cattle.

278 Transbound Emerg Dis. 2016 Feb; 63(1):e103-8. doi: 10.1111/tbed.12237. PMID:

279 24889887.

280 8. Ling Y, Zhang XD, Qi GL, Yang SX, Li JJ; Shen Q, et al. viral metagenomics reveals

281 significant viruses in the genital tract of apparently healthy dairy cows. Archives of

282 Virology. 2019 Apr; 164(4):1059-1067. doi:10.1007/s00705-019-04158-4. PMID:

283 30783771.

284 9. Bernard HU, Burk RD, Chen Z, Doorslaer KV, Hausen HZ, Villiers EMD. Classification

285 of papillomaviruses (PVs) based on 189 PV types and proposal of taxonomic amendments.

286 Virology. 2010 May; 401(1):70-79. doi:10.1016/j.virol. 2010.02.002. PMID: 20206957.

287 10. Daudt C, da Silva FRC, Streck AF, Weber MN, Mayer FQ, Cibulski SP, et al. how many

288 papillomavirus species can go undetected in papilloma lesions? Sci Rep. 2016 Nov 3;

289 6:36480. doi: 10.1038/srep36480. PMID: 27808255.

290 11. Daudt C, Da Silva FRC, Lunardi M, Alves CBDT, Weber MN, Cibulski SP,et al.

291 Papillomaviruses in ruminants: an update. Transbound Emerg Dis. 2018 Oct;

292 65(5):1381-1395. doi:10.1111/tbed.12868. PMID: 29603890. bioRxiv preprint doi: https://doi.org/10.1101/2020.01.13.904144; this version posted January 13, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

293 12. Roperto S, Russo V, Corrado F, Munday JS, De Falco F, Roperto F. Detection of bovine

294 deltapapillomavirus DNA in peripheral blood of healthy sheep (Ovis aries). Transbound

295 Emerg Dis. 2018 Jun; 65(3):758-764. doi: 10.1111/tbed.12800. PMID: 29330926.

296 13. Bauermann FV, Joshi LR, Mohr KA, Kutish GF, Meier P, Chase C, et al. A novel bovine

297 papillomavirus type in the genus Dyokappapapillomavirus. Arch Virol. 2017 Oct;

298 162(10):3225-3228. doi: 10.1007/s00705-017-3443-9. PMID: 28616671.

299 14. da Silva FR, Cibulski SP, Daudt C, Weber MN, Guimarães LL, Streck AF, et al. Novel

300 bovine papillomavirus type discovered by rolling-circle amplification coupled with

301 next-generation sequencing. PLOS ONE. 2016 Sep 8; 11(9):e0162345. doi:

302 10.1371/journal.pone.0162345. PMID: 27606703.

303 15. Crespo SEI, Lunardi M, Otonel RAA, Headley SA, Alfieri AF, Alfieri AA. Genetic

304 characterization of a putative new type of bovine papillomavirus in the xipapillomavirus 1

305 species in a Brazilian dairy herd. Virus Genes. 2019 Oct; 55(5):682-687.

306 doi:10.1007/s11262-019-01694-8. PMID: 31377921.

307 16. Forslund O, Antonsson A, Nordin P, Stenquist B, Hansson BG. A broad range of human

308 papillomavirus types detected with a general PCR method suitable for analysis of

309 cutaneous tumours and normal skin. J Gen Virol. 1999 Sep; 80(Pt9):2437-2443. doi:

310 10.1099/0022-1317-80-9-2437. PMID: 10501499.

311 17. Lunardi M, de Camargo Tozato C, Alfieri AF, de Alcântara BK, Vilas-Boas LA, Otonel

312 RA, et al. Genetic diversity of bovine papillomavirus types, including two putative new

313 types, in teat warts from dairy cattle herds. Arch Virol. 2016 Jun; 161(6):1569-1577.

314 doi:10.1007/s00705-016-2820-0. PMID: 26997614.

315 18. Claus MP, Lunardi M, Alfieri AF, Ferracin LM, Fungaro MHP, Alfieri AA. Identification

316 of unreported putative new bovine papillomaviruse types in Brazilian cattle herds. Vet

317 Microbiol. 2008 Dec; 132(3-4):396-401. doi:10.1016/j.vetmic.2008.05.026. PMID:

318 18617336.

319 19. Munday JS. Bovine and human papillomaviruses a comparative review. Vet Pathol. 2014

320 Nov; 51(6):1063-1075. doi:10.1177/0300985814537837. PMID: 24981715. bioRxiv preprint doi: https://doi.org/10.1101/2020.01.13.904144; this version posted January 13, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

321 20. Ma T, Zou N, Lin BY, Chow LT, Harper J W. Interaction between cyclin-dependent

322 kinases and human papillomavirus replication-initiation protein E1 is required for efficient

323 viral replication. Proc Natl Acad Sci USA. 1999 Jan 19;96(2):382-7. doi:

324 10.1073/pnas.96.2.382. PMID: 9892642.

325 21 Zhu W, Dong J, Shimizu E, Hatama S, Kadota K, Goto Y, et al. Characterization of novel

326 bovine papillomavirus type 12 (BPV-12) causing epithelial papilloma. Arch Virol. 2012

327 Jan; 157(1):85-91. doi:10.1007/s00705-011-1140-7. PMID: 22033594.

328 22. García-Vallvé S; Iglesias-Rozas JR; Alonso A; Bravo IG. Different papillomaviruses

329 have different repertoires of transcription factor binding sites: convergence and divergence

330 in the upstream regulatory region. BMC Evol Biol. 2006 Mar 9; 6:20.

331 doi:10.1186/1471-2148-6-20. PMID: 16526953.

332 23. Hubert WG. Variant upstream regulatory region sequences differentially regulate human

333 papillomavirus type 16 DNA replication throughout the viral life cycle. J Virol. 2005 May;

334 79(10):5914-22. doi:10.1128/JVI.79.10.5914-5922.2005. PMID: 15857977.

335 24. Truchado DA, Williams RAJ, Benítez L. Natural history of avian papillomaviruses. Virus

336 Res. 2018 Jul 2; 252:58-67. doi:10.1016/j.virusres.2018.05.014. PMID: 29778701.

337 25. Ogawa T, Tomita Y, Okada M, Shirasawa H. Complete genome and phylogenetic

338 position of bovine papillomavirus type 7. J Gen Virol. 2007 Jul: 88(Pt7):1934-1938.

339 doi:10.1099/vir.0.82794-0. PMID: 17554025.

340 26. Hatama S, Nobumoto K, Kanno T. Genomic and phylogenetic analysis of two novel

341 bovine papillomaviruses, BPV-9 and BPV-10. J Gen Virol. 2008 Jan; 89(Pt1):158-163.

342 doi:10.1099/vir.0.83334-0. PMID: 18089739.