DOCSLIB.ORG

Isolation, Characterization, and Expression Analysis of Zebrafish Large Mafs1

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Isolation, Characterization, and Expression Analysis of Zebrafish Large Mafs1 J. Biochem. 129, 139-146 (2001) Isolation, Characterization, and Expression Analysis of Zebrafish Large Mafs1 Miwako Kajihara, Shimako Kawauchi,* Makoto Kobayashi,* Hajime Ogino,•õ,•ö Satoru Takahashi,*,2 and Kunio Yasuda•õ Institute of Basic Medical Sciences, University of Tsukuba. 1-1-1, Tennodai, Tsukuba 305-8575;•õGraduate School of Biological Sciences, Nara Institute of Science and Technology (NAIST) , 8916-5 Takayama, Ihoma 630-0101; and Department of Biology University of Virginia, Charlottesville, VA 22903, USA Received August 24, 2000: accepted November 6, 2000 Large Maf proteins, which are members of the basic leucine zipper (b-Zip) superfamily, are involved in the determination and control of cellular differentiation. The expression patterns of various vertebrate large Maf mRNAs were described previously. Here, we report the cloning of a novel zebrafish large Maf cDNA, SMaf1 (Somite Maf1), and other zebrafish large Mafs, the N-terminus domains of which possess transactivational activ ity, We also analyzed the expression patterns of SMaf1 and SMaf2 (Somite Maf2)/Krml2 as well as MafB/Val and c-Maf during zebrafish embryogenesis. In particular, the robust expression of the novel SMaf1 mRNA, which overlapped that of MyoD, in somitic cells during somitogenesis was noteworthy. In addition, the expression patterns of SMaf2 and MafB in the blood-forming regions, and those of c-Maf and MafB in the lens cells showed spatial redundancy, although the temporal appearance of these genes at these sites dif fered. These data indicate that SMafs may play important roles in somitogenesis, and that Maf proteins may have overlapping and yet specific functions as to the determina tion and differentiation of cell lineages. Key words: basic-leucine zipper (b-Zip), large Mafs, Maf recognition elements (MARE), somite, transcription factor. The Maf protein family members are transcription factors establishment of neuronal cells (11), and regulates the ex that contain a basic-leucine zipper (b-Zip) motif which is pression of the rhodopsin gene in the retina (12). Kawauchi homologous to that of the v-Maf oncoprotein. The latter was et al. (1999) reported that c-oaf knock-out mice exhibit isolated as the transforming component of the avian mus severe defects in the lens fiber cells (13). In the chicken, L culoaponeurotic fibrosarcoma virus, AS42 (1, 2). Maf family - Maf takes part in the differentiation of the lens and in proteins are divided into two subgroups, large Maf and duces the expression of crystallin in chick embryos (6). The small Maf proteins. The large Maf proteins, c-Maf(3), MafB MafB member has been identified as the affected gene in (4), Nrl (5), and L-Maf (6), contain an acidic domain in the mice carrying the kreisler (kr) mutation (14), and the gene N-terminus of each factor that acts as the transcriptional product is required for segmentation of the hindbrain activating moiety By contrast, the small Maf proteins, because it controls Hoxb-3 expression (15). Furthermore, MafK, MafF (7), and MafG (8), lack such an acidic domain. MafB down-regulates the expression of the transferrin re Several experiments have demonstrated that the large ceptor and inhibits erythroid differentiation in myelomono Mafs are key factors involved in cellular differentiation. cytic cells (16). These results indicate that the large Maf The c-Maf member activates the transcription of L7 gene proteins play indispensable regulatory roles in the cellular expression in developing Purkinje cells (9), and controls the differentiation and morphogenesis of several distinct devel tissue-specific expression of interleukin-4 (IL-4) in CD4+ T opmental lineages. helper 2 cells (10). Nrl contributes to the maturation and It has been reported that Mafs form either homodimers or heterodimers with other Maf, Jun, Fos (17, 18), or other b-Zip-type transcription factors. The DNA target sites of 1 This work was supported in part by a Grant-in-Aid from the Minis- Maf homodimers and heterodimers have been defined as a try of Education, Science, Sports and Culture, the Japanese Society 13 by palindromic sequence TRE (TPA-responsive ele for Promotion of Sciences (RFTF), Core Research for Evolutional ment)-type Maf recognition element (T-MARE) (TGCT Sciences and Technology (CREST and the Program for Promotion GACTCAGCA), or a 14 by palindromic sequence CRE of Basic Research Activities for Innovative Biosciences (PRO- BRAIN) (CAMP-responsive element)-type MARE (C-MARE) (TGCT .2 To whom correspondence should be addressed Phone: +81-298-53- GACGTCAGCA) (17). The chicken L-Maf was shown to 7516, Fax; + 81-298-53-6965, E-mail: [email protected] bind to the core site (TGCTGAC, -108 to -102 within the Abbreviations: Hpf, hours post-fertilization, MARE, Maf recognition ƒ¿ CE2 sequence (CTCCGCATTTCTGCTGACCAC, -119 to -99) elements; SMaf, somite Maf. , which was identified as the lens-specific enhancer GenBank accession numbers SMaf1, AB006324, SMaf2, AB022286: element in the avian ƒ¿A-crystallin promoter (19, 20). The MafB, AB006322: and c-Maf, AB006323. murine MafB recognizes hoxb-3 r5 enhancer sequences ? 2001 by The Japanese Biochemical Society (TGTCATC TAAGTCAGCAGTTAC and CCAAATTTGCA- Vol. 129, No. 1, 2001 139 140 M. Kajihara et al. GACACCTACATTCTTGGC) (15); the mouse IL-4 promoter using DMRIE-C Reagent (GIBCO). The CEF cells (2.2-mm (CTCATTTTCCCTTCCTTTCAGCAACTTTAACTC) (10) is dish) were co-transfected with test effector plasmid (30ng), associated with c-Maf, and Nrl binds to the rhodopsin pro reporter plasmid (300ng), and pEFX control plasmid (100 moter (TGCTGATTCAGCA) (21). Hence, the large Maf fac ng) containing a ƒÀ-galactosidase gene for normalization of tors are vital in various cell differentiation processes transfection efficiency. The cultured cells were harvested at because they regulate target gene expression through 48 h post-transfection and then analyzed for luciferase ac MARES. tivity. Our goal is to understand the function of different mem Electrophoretic Gel Mobility Shift Assay (EMSA)-The bers of the large Maf family during embryogenesis. Here, intact Maf and truncated •¢Maf proteins were synthesized we describe the isolation of a novel large Maf transcription with a TNT coupled reticulocyte lysate or TNT coupled factor, in addition to the previously reported MafB/Val , wheat germ extract in vitro transcription/translation sys- SMaf2/Krml2, and c-Maf factors, from zebrafish (22, 23). At tem (Promega), respectively, using the pEFX-SMaf1, pEFX- the protein level, SMaf1 is related to the L-Maf-type of SMaf2, pEFX-•¢SMaf1, and pEFX-•¢SMaf2 constructs. large Maf protein. Both SMaf1 and SMaf2 showed tran ƒ¿ CE2 (5•L-GATCCCATTTCTGCTGACCACGTTGCCTTCA) scriptional activation activity, and the mRNAs were detect- (20), corresponding to the chicken ƒ¿A-crystallin enhancer ed in the paraxial mesodermal cells after somite boundary (-114 to -90), was labeled with [32P-ƒ¿]dATP using Klenow formation. Analysis of the mRNA expression profiles of four DNA-polymerase. Five microliters of in vitro translated zebrafish large Mafs showed spatial overlapping in the proteins was mixed with 0.5ng of a radiolabeled oligonucle expression of each factor. Our investigation of zebrafish otide in a reaction mixture containing 10mM HEPES large Mats indicated that SMafs may play important roles KOH (pH 7.9), 50mM KCl, 0.1mM EDTA, and 50ƒÊg/ml of in somitogenesis, and that each Maf transcription factor poly(dI-dC), and then analyzed on a 4% polyacrylamide gel may perform both overlapping and specific functions dur in 0.25/ TAE [10mM Tris-HCl (pH 8.0), 10mM acetate, ing embryogenesis in the vertebrate. 0.25mM EDTA]. The gels were dried and exposed to X-ray films for 12 h. For competition assays, the EMSA reaction METERIALS AND METHODS mixture was first incubated with a radiolabeled probe at 25•Ž for 10 min. For competition assays, unlabeled ƒ¿CE2 Zebrafish Embryos-Breeding fish were maintaained at or mutated ƒ¿CE2 (mtƒ¿CE2, 5•L-GATCCCATTTCTCAGGAC 28.5•Ž with a 14 h light 10 h dark cycle. Embryos were col CACGTTGCCTTCA) was added to the reaction mixture. lected by natural spawning and staged according to the Whole Mount In Situ Hybridization•\Digoxigenin-11-uri method of Kimmel et al. (24). din-5•L-triphosphate (DIG-11-UTP)-labeled RNA probes cDNA Cloning and Sequencing of the Zebrafish Large were synthesized using standard methods (Roche). For Mafs-ƒÉgt10 and ƒÉZAP zebrafish cDNA libraries (kindly zebrafish embryos, the probes corresponding to the b-Zip provided by Drs. H. Okamoto and B. Appel, respectively) coding region plus 3•LUTR region [MafB (+709 to +1620 were prepared from 18-23 hpf (hours post-fertilization) and bp), c-Maf (+622 to +1015 bp), and SMaf2 (+718 to +1439 15-19 hpf zebrafish embryos. We screened approximately bp),I, 5•LUTR plus acidic region [SMaf1 (-263 to +410)], and 4.8•~106 and 3.2•~107 plaques from the respective librar full-length cDNA (MyoD) were used. For sectioned mouse ies wider low stringency conditions (25% formamide, 42•Ž) embryos, the marine MafB probe, containing the ORF with a probe containing the b-Zip domain of Xenopus MafB region (+52 to +755 bp), was used. Embryo fixation, pre (provided by S. Ishibashi). A total of 180 clones was isolated treatment and whole-mount in situ hybridization for zebra- on the first screening. After three further rounds of purifi fish were performed as described previously (25) except for cation, the remaining 32 clones were subcloned into pBlue slight modification of the hybridization mixture (5•~ SSC, -script SK+ (Stratagene) and sequenced. In an additional 50 ƒÊg/ml of heparin, 5 mg/ml of yeast tRNA, 0.1% Tween- experiment, total RNA, which was prepared from 18hpf 20, 50% formamide) and the blocking solution (1% DIG zebrafish embryos using ISOGEN (Nippongene), was ana Blocking Reagent, 0.2, Tween20, 1•~ PBS). Post-stained lyzed by RT-PCR (reverse transcriptase-polymerase chain zebrafish embryos were sectioned at a thickness of 50 or 10 reaction) using previously described degenerate sense and µm.
Load more

Recommended publications
  • Single Cell Transcriptomics Reveal Temporal Dynamics of Critical Regulators of Germ Cell Fate During Mouse Sex Determination
    bioRxiv preprint doi: https://doi.org/10.1101/747279; this version posted November 2, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 1 Single cell transcriptomics reveal temporal dynamics of critical regulators of germ 2 cell fate during mouse sex determination 3 Authors: Chloé Mayère1,2, Yasmine Neirijnck1,3, Pauline Sararols1, Chris M Rands1, 4 Isabelle Stévant1,2, Françoise Kühne1, Anne-Amandine Chassot3, Marie-Christine 5 Chaboissier3, Emmanouil T. Dermitzakis1,2, Serge Nef1,2,*. 6 Affiliations: 7 1Department of Genetic Medicine and Development, University of Geneva, 1211 Geneva, 8 Switzerland; 9 2iGE3, Institute of Genetics and Genomics of Geneva, University of Geneva, 1211 10 Geneva, Switzerland; 11 3Université Côte d'Azur, CNRS, Inserm, iBV, France; 12 Lead Contact: 13 *Corresponding Author: Serge Nef, 1 rue Michel-Servet CH-1211 Genève 4, 14 [email protected]. + 41 (0)22 379 51 93 15 Running Title: Single cell transcriptomics of germ cells 1 bioRxiv preprint doi: https://doi.org/10.1101/747279; this version posted November 2, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 16 Abbreviations; 17 AGC: Adrenal Germ Cell 18 GC: Germ cell 19 OGC: Ovarian Germ Cell 20 TGC: Testicular Germ Cell 21 scRNA-seq: Single-cell RNA-Sequencing 22 DEG: Differentially Expressed Gene 23 24 25 Keywords: 26 Single-cell RNA-Sequencing (scRNA-seq), sex determination, ovary, testis, gonocytes, 27 oocytes, prospermatogonia, meiosis, gene regulatory network, germ cells, development, 28 RNA splicing 29 2 bioRxiv preprint doi: https://doi.org/10.1101/747279; this version posted November 2, 2020.
    [Show full text]
  • Multifactorial Erβ and NOTCH1 Control of Squamous Differentiation and Cancer
    Multifactorial ERβ and NOTCH1 control of squamous differentiation and cancer Yang Sui Brooks, … , Karine Lefort, G. Paolo Dotto J Clin Invest. 2014;124(5):2260-2276. https://doi.org/10.1172/JCI72718. Research Article Oncology Downmodulation or loss-of-function mutations of the gene encoding NOTCH1 are associated with dysfunctional squamous cell differentiation and development of squamous cell carcinoma (SCC) in skin and internal organs. While NOTCH1 receptor activation has been well characterized, little is known about how NOTCH1 gene transcription is regulated. Using bioinformatics and functional screening approaches, we identified several regulators of the NOTCH1 gene in keratinocytes, with the transcription factors DLX5 and EGR3 and estrogen receptor β (ERβ) directly controlling its expression in differentiation. DLX5 and ERG3 are required for RNA polymerase II (PolII) recruitment to the NOTCH1 locus, while ERβ controls NOTCH1 transcription through RNA PolII pause release. Expression of several identified NOTCH1 regulators, including ERβ, is frequently compromised in skin, head and neck, and lung SCCs and SCC-derived cell lines. Furthermore, a keratinocyte ERβ–dependent program of gene expression is subverted in SCCs from various body sites, and there are consistent differences in mutation and gene-expression signatures of head and neck and lung SCCs in female versus male patients. Experimentally increased ERβ expression or treatment with ERβ agonists inhibited proliferation of SCC cells and promoted NOTCH1 expression and squamous differentiation both in vitro and in mouse xenotransplants. Our data identify a link between transcriptional control of NOTCH1 expression and the estrogen response in keratinocytes, with implications for differentiation therapy of squamous cancer. Find the latest version: https://jci.me/72718/pdf Research article Multifactorial ERβ and NOTCH1 control of squamous differentiation and cancer Yang Sui Brooks,1,2 Paola Ostano,3 Seung-Hee Jo,1,2 Jun Dai,1,2 Spiro Getsios,4 Piotr Dziunycz,5 Günther F.L.
    [Show full text]
  • The Role of Dlx3 in Gene Regulation in the Mouse Placenta
    The role of Dlx3 in gene regulation in the mouse placenta by Li Han This thesis/dissertation document has been electronically approved by the following individuals: Roberson,Mark Stephen (Chairperson) Wolfner,Mariana Federica (Minor Member) Cohen,Paula (Field Appointed Minor Member) Weiss,Robert S. (Field Appointed Minor Member) THE ROLE OF DLX3 IN GENE REGULATION IN THE MOUSE PLACENTA A Dissertation Presented to the Faculty of the Graduate School of Cornell University In Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy by Li Han August 2010 © 2010 Li Han THE ROLE OF DLX3 IN GENE REGULATION IN THE MOUSE PLACENTA Li Han, Ph. D. Cornell University 2010 Distal-less 3 (Dlx3) is a homeodomain containing transcription factor that is required for the normal development of the mouse placenta. Moreover in human trophoblasts, DLX3 appears to be a necessary transcriptional regulator of the glycoprotein hormone α subunit gene, a protein subunit of placental-derived chorionic gonadotropin. The aim of my studies described here was to determine the role of Dlx3 in gene regulation within the placenta. My studies initially sought to determine if Dlx3 could interact physically with other transcriptional regulators in placental trophoblast cells and how these protein- protein interactions might influence Dlx3-dependent gene expression. Yeast two- hybrid screens provide evidence that mothers against decapentaplegic homolog 6 (SMAD6) was a binding partner for DLX3. SMAD6 was found to be expressed and nuclear localized in placental trophoblasts and interacted directly with DLX3. Structure-function analysis revealed that this interaction occurred within a DLX3 domain that overlapped the homeobox, a key domain necessary for DLX3 DNA binding.
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]
  • FARE2021WINNERS Sorted by Institute
    FARE2021WINNERS Sorted By Institute Swati Shah Postdoctoral Fellow CC Radiology/Imaging/PET and Neuroimaging Characterization of CNS involvement in Ebola-Infected Macaques using Magnetic Resonance Imaging, 18F-FDG PET and Immunohistology The Ebola (EBOV) virus outbreak in Western Africa resulted in residual neurologic abnormalities in survivors. Many case studies detected EBOV in the CSF, suggesting that the neurologic sequelae in survivors is related to viral presence. In the periphery, EBOV infects endothelial cells and triggers a “cytokine stormâ€. However, it is unclear whether a similar process occurs in the brain, with secondary neuroinflammation, neuronal loss and blood-brain barrier (BBB) compromise, eventually leading to lasting neurological damage. We have used in vivo imaging and post-necropsy immunostaining to elucidate the CNS pathophysiology in Rhesus macaques infected with EBOV (Makona). Whole brain MRI with T1 relaxometry (pre- and post-contrast) and FDG-PET were performed to monitor the progression of disease in two cohorts of EBOV infected macaques from baseline to terminal endpoint (day 5-6). Post-necropsy, multiplex fluorescence immunohistochemical (MF-IHC) staining for various cellular markers in the thalamus and brainstem was performed. Serial blood and CSF samples were collected to assess disease progression. The linear mixed effect model was used for statistical analysis. Post-infection, we first detected EBOV in the serum (day 3) and CSF (day 4) with dramatic increases until euthanasia. The standard uptake values of FDG-PET relative to whole brain uptake (SUVr) in the midbrain, pons, and thalamus increased significantly over time (p<0.01) and positively correlated with blood viremia (p≤0.01).
    [Show full text]
  • Chronodentistry: the Role & Potential of Molecular Clocks in Oral Medicine
    Janjić and Agis BMC Oral Health (2019) 19:32 https://doi.org/10.1186/s12903-019-0720-x REVIEW Open Access Chronodentistry: the role & potential of molecular clocks in oral medicine Klara Janjić1,2 and Hermann Agis1,2* Abstract Molecular clocks help organisms to adapt important physiological functions to periodically changing conditions in the environment. These include the adaption of the 24 h sleep-wake rhythm to changes of day and night. The circadian clock is known to act as a key regulator in processes of health and disease in different organs. The knowledge on the circadian clock led to the development of chronopharmacology and chronotherapy. These fields aim to investigate how efficiency of medication and therapies can be improved based on circadian clock mechanisms. In this review we aim to highlight the role of the circadian clock in oral tissues and its potential in the different fields of dentistry including oral and maxillofacial surgery, restorative dentistry, endodontics, periodontics and orthodontics to trigger the evolving field of chronodentistry. Keywords: Circadian clock, Molecular clock, Dentistry, Chronopharmacology, Oral surgery, Conservative dentistry, Endodontology, Periodontology Background the circadian clock governs synchronization of various As part of evolution, the adaption to environmental physiological processes as an output to the environmen- changes contributes fundamentally to prevail in natural tal changes. The inputs are transmitted to the central selection. Hence this ability is an important feature of a circadian clock in the brain [4] that controls healthy organism. Teeth play a major role in satisfying cell-autonomous peripheral circadian clocks in different the basic human need of food uptake.
    [Show full text]
  • Genetic Network During Neural Crest Induction: from Cell Specification to Cell Survival
    Seminars in Cell & Developmental Biology 16 (2005) 647–654 Review Genetic network during neural crest induction: From cell specification to cell survival a a a,b,c, Ben Steventon , Carlos Carmona-Fontaine , Roberto Mayor ∗ a Department of Anatomy and Developmental Biology, University College London, Gower Street, London WC1E 6BT, UK b Millennium Nucleus in Developmental Biology, Universidad de Chile, Chile c Fundaci´on Ciencia Para la Vida, Chile Available online 5 August 2005 Abstract The concerted action of extracellular signals such as BMP, Wnt, FGF, RA and Notch activate a genetic program required to transform a na¨ıve ectodermal cell into a neural crest cell. In this review we will analyze the extracellular signals and the network of transcription factors that are required for this transformation. We will propose the division of this complex network of factors in two main steps: an initial cell specification step followed by a maintenance or cell survival step. © 2005 Elsevier Ltd. All rights reserved. Keywords: Neural crest; Genetic cascade; Cell survival; Wnt; FGF; BMP; Retinoic acid Contents 1. Introduction ........................................................................................................ 647 2. Extracellular Cell Signalling during neural crest induction............................................................... 648 3. Early genetic network involved in Cell Specification of the neural crest ................................................... 649 4. Specific neural crest genes involved in Cell Survival ...................................................................
    [Show full text]
  • The Role of Epigenomics in Osteoporosis and Osteoporotic Vertebral Fracture
    International Journal of Molecular Sciences Review The Role of Epigenomics in Osteoporosis and Osteoporotic Vertebral Fracture Kyoung-Tae Kim 1,2 , Young-Seok Lee 1,3 and Inbo Han 4,* 1 Department of Neurosurgery, School of Medicine, Kyungpook National University, Daegu 41944, Korea; [email protected] (K.-T.K.); [email protected] (Y.-S.L.) 2 Department of Neurosurgery, Kyungpook National University Hospital, Daegu 41944, Korea 3 Department of Neurosurgery, Kyungpook National University Chilgok Hospital, Daegu 41944, Korea 4 Department of Neurosurgery, CHA University School of medicine, CHA Bundang Medical Center, Seongnam-si, Gyeonggi-do 13496, Korea * Correspondence: [email protected]; Tel.: +82-31-780-1924; Fax: +82-31-780-5269 Received: 6 November 2020; Accepted: 8 December 2020; Published: 11 December 2020 Abstract: Osteoporosis is a complex multifactorial condition of the musculoskeletal system. Osteoporosis and osteoporotic vertebral fracture (OVF) are associated with high medical costs and can lead to poor quality of life. Genetic factors are important in determining bone mass and structure, as well as any predisposition for bone degradation and OVF. However, genetic factors are not enough to explain osteoporosis development and OVF occurrence. Epigenetics describes a mechanism for controlling gene expression and cellular processes without altering DNA sequences. The main mechanisms in epigenetics are DNA methylation, histone modifications, and non-coding RNAs (ncRNAs). Recently, alterations in epigenetic mechanisms and their activity have been associated with osteoporosis and OVF. Here, we review emerging evidence that epigenetics contributes to the machinery that can alter DNA structure, gene expression, and cellular differentiation during physiological and pathological bone remodeling.
    [Show full text]
  • DLX Genes: Roles in Development and Cancer
    cancers Review DLX Genes: Roles in Development and Cancer Yinfei Tan 1,* and Joseph R. Testa 1,2,* 1 Genomics Facility, Fox Chase Cancer Center, Philadelphia, PA 19111, USA 2 Cancer Signaling and Epigenetics Program, Fox Chase Cancer Center, Philadelphia, PA 19111, USA * Correspondence: [email protected] (Y.T.); [email protected] (J.R.T.) Simple Summary: DLX homeobox family genes encode transcription factors that have indispensable roles in embryonic and postnatal development. These genes are critically linked to the morphogene- sis of craniofacial structures, branchial arches, forebrain, and sensory organs. DLX genes are also involved in postnatal homeostasis, particularly hematopoiesis and, when dysregulated, oncogen- esis. DLX1/2, DLX3/4, and DLX5/6 exist as bigenes on different chromosomes, sharing intergenic enhancers between gene pairs, which allows orchestrated spatiotemporal expression. Genomic alterations of human DLX gene enhancers or coding sequences result in congenital disorders such as split-hand/foot malformation. Aberrant postnatal expression of DLX genes is associated with hematological malignancies, including leukemias and lymphomas. In several mouse models of T-cell lymphoma, Dlx5 has been shown to act as an oncogene by cooperating with activated Akt, Notch1/3, and/or Wnt to drive tumor formation. In humans, DLX5 is aberrantly expressed in lung and ovarian carcinomas and holds promise as a therapeutic target. Abstract: Homeobox genes control body patterning and cell-fate decisions during development. The homeobox genes consist of many families, only some of which have been investigated regarding a possible role in tumorigenesis. Dysregulation of HOX family genes have been widely implicated in cancer etiology.
    [Show full text]
  • Genomic Structure and Functional Control of the Dlx3-7 Bigene Cluster
    Genomic structure and functional control of the Dlx3-7 bigene cluster Kenta Sumiyama*, Steven Q. Irvine*, David W. Stock†, Kenneth M. Weiss‡, Kazuhiko Kawasaki‡, Nobuyoshi Shimizu§, Cooduvalli S. Shashikant¶, Webb Millerʈ, and Frank H. Ruddle*,** *Department of Molecular, Cellular, and Developmental Biology, Yale University, New Haven, CT 06511; †Department of Biology, University of Colorado, Boulder, CO 80309; Departments of ‡Anthropology, ¶Dairy and Animal Science, and ʈComputer Science, Pennsylvania State University, University Park, PA 16802; and §Department of Molecular Biology, Keio University School of Medicine, Tokyo 160, Japan Contributed by Frank H. Ruddle, November, 1, 2001 The Dlx genes are involved in early vertebrate morphogenesis, Dlx3 is expressed in the first and second visceral arches and notably of the head. The six Dlx genes of mammals are arranged fronto-nasal ectoderm at E9.5 (9). Later in development, Dlx3 is in three convergently transcribed bigene clusters. In this study, we also expressed in the external respiratory epithelium of the nares, examine the regulation of the Dlx3-7 cluster of the mouse. We in whisker follicles, taste bud primordia, dental and mammary obtained and sequenced human and mouse P1 clones covering the gland epithelia, apical ectodermal ridge (AER) of limb buds, entire Dlx3-7 cluster. Comparative analysis of the human and genital primordia, and in several additional sites of epithelial- mouse sequences revealed several highly conserved noncoding mesenchymal interaction (8, 9). By the end of embryonic devel- regions within 30 kb of the Dlx3-7-coding regions. These conserved opment, Dlx3 is down-regulated, except in the skin, where it is elements were located both 5؅ of the coding exons of each gene transcribed in stratified epidermis and in the matrix cells of the and in the intergenic region 3؅ of the exons, suggesting that some hair follicles (10).
    [Show full text]
  • Dlx1 and Dlx2 Function Is Necessary for Terminal Differentiation And
    Research article 311 Dlx1 and Dlx2 function is necessary for terminal differentiation and survival of late-born retinal ganglion cells in the developing mouse retina Jimmy de Melo1, Guoyan Du2,3, Mario Fonseca2,3, Leigh-Anne Gillespie3, William J. Turk3, John L. R. Rubenstein4 and David D. Eisenstat1,2,3,5,* 1Department of Human Anatomy and Cell Science, University of Manitoba, Winnipeg, Manitoba, R3E 3J7, Canada 2Department of Pediatrics and Child Health, University of Manitoba, Winnipeg, Manitoba, R3A 1S1, Canada 3Manitoba Institute of Cell Biology, Cancer Care Manitoba, Winnipeg, Manitoba, R3E 0V9, Canada 4Department of Psychiatry, University of California, San Francisco, CA 94143, USA 5Department of Ophthalmology, University of Manitoba, Winnipeg, Manitoba, R3E 0V9, Canada *Author for correspondence (e-mail: [email protected]) Accepted 3 November 2004 Development 132, 311-322 Published by The Company of Biologists 2005 doi:10.1242/dev.01560 Summary Dlx homeobox genes, the vertebrate homologs of Distal- Ectopic expression of Crx, the cone and rod photoreceptor less, play important roles in the development of the homeobox gene, in the GCL and neuroblastic layers of the vertebrate forebrain, craniofacial structures and limbs. mutants may signify altered cell fate of uncommitted RGC Members of the Dlx gene family are also expressed in progenitors. However, amacrine and horizontal cell retinal ganglion cells (RGC), amacrine and horizontal cells differentiation is relatively unaffected in the Dlx1/2 null of the developing and postnatal retina. Expression begins retina. Herein, we propose a model whereby early-born at embryonic day 12.5 and is maintained until late RGCs are Dlx1 and Dlx2 independent, but Dlx function is embryogenesis for Dlx1, while Dlx2 expression extends to necessary for terminal differentiation of late-born RGC adulthood.
    [Show full text]
  • Placental Failure in Mice Lacking the Homeobox Gene Dlx3
    Proc. Natl. Acad. Sci. USA Vol. 96, pp. 162–167, January 1999 Developmental Biology Placental failure in mice lacking the homeobox gene Dlx3 MARIA I. MORASSO*†,ALEXANDER GRINBERG‡,GERTRAUD ROBINSON§,THOMAS D. SARGENT*, AND KATHLEEN A. MAHON¶ *Laboratory of Molecular Genetics, ‡Laboratory of Mammalian Genes and Development, National Institute of Child Health and Human Development, §Laboratory of Genetics and Physiology, National Institute of Diabetes, Digestive and Kidney Diseases, National Institutes of Health, Bethesda, MD 20892; and ¶Department of Cell Biology, Baylor College of Medicine, Houston, TX 77030 Communicated by Igor B. Dawid, National Institute of Child Health and Human Development, Bethesda, MD, November 16, 1998 (received for review September 23, 1998) ABSTRACT Dlx3 is a homeodomain transcription factor helix–turn–helix family have been detected in trophoblastic and a member of the vertebrate Distal-less family. Targeted tissues by day 6.5. In Ets2 mutant embryos, both migration and deletion of the mouse Dlx3 gene results in embryonic death differentiation of trophoblast cells are defective, resulting in between day 9.5 and day 10 because of placental defects that embryonic death before day 8.5 of gestation (9). For both alter the development of the labyrinthine layer. In situ hy- Mash-2 and Ets2 mutants, the defects were rescued by tet- bridization reveals that the Dlx3 gene is initially expressed in raploid cell aggregation experiments, reinforcing the conclu- ectoplacental cone cells and chorionic plate, and later in the sion that there is an essential role for these genes during labyrinthine trophoblast of the chorioallantoic placenta, extraembryonic tissue development (7, 9).
    [Show full text]