J. Biochem. 129, 139-146 (2001) Isolation, Characterization, and Expression Analysis of Zebrafish Large Mafs1 Miwako Kajihara, Shimako Kawauchi,* Makoto Kobayashi,* Hajime Ogino,•õ,•ö Satoru Takahashi,*,2 and Kunio Yasuda•õ Institute of Basic Medical Sciences, University of Tsukuba. 1-1-1, Tennodai, Tsukuba 305-8575;•õGraduate School of Biological Sciences, Nara Institute of Science and Technology (NAIST) , 8916-5 Takayama, Ihoma 630-0101; and Department of Biology University of Virginia, Charlottesville, VA 22903, USA Received August 24, 2000: accepted November 6, 2000 Large Maf proteins, which are members of the basic leucine zipper (b-Zip) superfamily, are involved in the determination and control of cellular differentiation. The expression patterns of various vertebrate large Maf mRNAs were described previously. Here, we report the cloning of a novel zebrafish large Maf cDNA, SMaf1 (Somite Maf1), and other zebrafish large Mafs, the N-terminus domains of which possess transactivational activ ity, We also analyzed the expression patterns of SMaf1 and SMaf2 (Somite Maf2)/Krml2 as well as MafB/Val and c-Maf during zebrafish embryogenesis. In particular, the robust expression of the novel SMaf1 mRNA, which overlapped that of MyoD, in somitic cells during somitogenesis was noteworthy. In addition, the expression patterns of SMaf2 and MafB in the blood-forming regions, and those of c-Maf and MafB in the lens cells showed spatial redundancy, although the temporal appearance of these genes at these sites dif fered. These data indicate that SMafs may play important roles in somitogenesis, and that Maf proteins may have overlapping and yet specific functions as to the determina tion and differentiation of cell lineages. Key words: basic-leucine zipper (b-Zip), large Mafs, Maf recognition elements (MARE), somite, transcription factor. The Maf protein family members are transcription factors establishment of neuronal cells (11), and regulates the ex that contain a basic-leucine zipper (b-Zip) motif which is pression of the rhodopsin gene in the retina (12). Kawauchi homologous to that of the v-Maf oncoprotein. The latter was et al. (1999) reported that c-oaf knock-out mice exhibit isolated as the transforming component of the avian mus severe defects in the lens fiber cells (13). In the chicken, L culoaponeurotic fibrosarcoma virus, AS42 (1, 2). Maf family - Maf takes part in the differentiation of the lens and in proteins are divided into two subgroups, large Maf and duces the expression of crystallin in chick embryos (6). The small Maf proteins. The large Maf proteins, c-Maf(3), MafB MafB member has been identified as the affected gene in (4), Nrl (5), and L-Maf (6), contain an acidic domain in the mice carrying the kreisler (kr) mutation (14), and the gene N-terminus of each factor that acts as the transcriptional product is required for segmentation of the hindbrain activating moiety By contrast, the small Maf proteins, because it controls Hoxb-3 expression (15). Furthermore, MafK, MafF (7), and MafG (8), lack such an acidic domain. MafB down-regulates the expression of the transferrin re Several experiments have demonstrated that the large ceptor and inhibits erythroid differentiation in myelomono Mafs are key factors involved in cellular differentiation. cytic cells (16). These results indicate that the large Maf The c-Maf member activates the transcription of L7 gene proteins play indispensable regulatory roles in the cellular expression in developing Purkinje cells (9), and controls the differentiation and morphogenesis of several distinct devel tissue-specific expression of interleukin-4 (IL-4) in CD4+ T opmental lineages. helper 2 cells (10). Nrl contributes to the maturation and It has been reported that Mafs form either homodimers or heterodimers with other Maf, Jun, Fos (17, 18), or other b-Zip-type transcription factors. The DNA target sites of 1 This work was supported in part by a Grant-in-Aid from the Minis- Maf homodimers and heterodimers have been defined as a try of Education, Science, Sports and Culture, the Japanese Society 13 by palindromic sequence TRE (TPA-responsive ele for Promotion of Sciences (RFTF), Core Research for Evolutional ment)-type Maf recognition element (T-MARE) (TGCT Sciences and Technology (CREST and the Program for Promotion GACTCAGCA), or a 14 by palindromic sequence CRE of Basic Research Activities for Innovative Biosciences (PRO- BRAIN) (CAMP-responsive element)-type MARE (C-MARE) (TGCT .2 To whom correspondence should be addressed Phone: +81-298-53- GACGTCAGCA) (17). The chicken L-Maf was shown to 7516, Fax; + 81-298-53-6965, E-mail: [email protected] bind to the core site (TGCTGAC, -108 to -102 within the Abbreviations: Hpf, hours post-fertilization, MARE, Maf recognition ƒ¿ CE2 sequence (CTCCGCATTTCTGCTGACCAC, -119 to -99) elements; SMaf, somite Maf. , which was identified as the lens-specific enhancer GenBank accession numbers SMaf1, AB006324, SMaf2, AB022286: element in the avian ƒ¿A-crystallin promoter (19, 20). The MafB, AB006322: and c-Maf, AB006323. murine MafB recognizes hoxb-3 r5 enhancer sequences ? 2001 by The Japanese Biochemical Society (TGTCATC TAAGTCAGCAGTTAC and CCAAATTTGCA- Vol. 129, No. 1, 2001 139 140 M. Kajihara et al. GACACCTACATTCTTGGC) (15); the mouse IL-4 promoter using DMRIE-C Reagent (GIBCO). The CEF cells (2.2-mm (CTCATTTTCCCTTCCTTTCAGCAACTTTAACTC) (10) is dish) were co-transfected with test effector plasmid (30ng), associated with c-Maf, and Nrl binds to the rhodopsin pro reporter plasmid (300ng), and pEFX control plasmid (100 moter (TGCTGATTCAGCA) (21). Hence, the large Maf fac ng) containing a ƒÀ-galactosidase gene for normalization of tors are vital in various cell differentiation processes transfection efficiency. The cultured cells were harvested at because they regulate target gene expression through 48 h post-transfection and then analyzed for luciferase ac MARES. tivity. Our goal is to understand the function of different mem Electrophoretic Gel Mobility Shift Assay (EMSA)-The bers of the large Maf family during embryogenesis. Here, intact Maf and truncated •¢Maf proteins were synthesized we describe the isolation of a novel large Maf transcription with a TNT coupled reticulocyte lysate or TNT coupled factor, in addition to the previously reported MafB/Val , wheat germ extract in vitro transcription/translation sys- SMaf2/Krml2, and c-Maf factors, from zebrafish (22, 23). At tem (Promega), respectively, using the pEFX-SMaf1, pEFX- the protein level, SMaf1 is related to the L-Maf-type of SMaf2, pEFX-•¢SMaf1, and pEFX-•¢SMaf2 constructs. large Maf protein. Both SMaf1 and SMaf2 showed tran ƒ¿ CE2 (5•L-GATCCCATTTCTGCTGACCACGTTGCCTTCA) scriptional activation activity, and the mRNAs were detect- (20), corresponding to the chicken ƒ¿A-crystallin enhancer ed in the paraxial mesodermal cells after somite boundary (-114 to -90), was labeled with [32P-ƒ¿]dATP using Klenow formation. Analysis of the mRNA expression profiles of four DNA-polymerase. Five microliters of in vitro translated zebrafish large Mafs showed spatial overlapping in the proteins was mixed with 0.5ng of a radiolabeled oligonucle expression of each factor. Our investigation of zebrafish otide in a reaction mixture containing 10mM HEPES large Mats indicated that SMafs may play important roles KOH (pH 7.9), 50mM KCl, 0.1mM EDTA, and 50ƒÊg/ml of in somitogenesis, and that each Maf transcription factor poly(dI-dC), and then analyzed on a 4% polyacrylamide gel may perform both overlapping and specific functions dur in 0.25/ TAE [10mM Tris-HCl (pH 8.0), 10mM acetate, ing embryogenesis in the vertebrate. 0.25mM EDTA]. The gels were dried and exposed to X-ray films for 12 h. For competition assays, the EMSA reaction METERIALS AND METHODS mixture was first incubated with a radiolabeled probe at 25•Ž for 10 min. For competition assays, unlabeled ƒ¿CE2 Zebrafish Embryos-Breeding fish were maintaained at or mutated ƒ¿CE2 (mtƒ¿CE2, 5•L-GATCCCATTTCTCAGGAC 28.5•Ž with a 14 h light 10 h dark cycle. Embryos were col CACGTTGCCTTCA) was added to the reaction mixture. lected by natural spawning and staged according to the Whole Mount In Situ Hybridization•\Digoxigenin-11-uri method of Kimmel et al. (24). din-5•L-triphosphate (DIG-11-UTP)-labeled RNA probes cDNA Cloning and Sequencing of the Zebrafish Large were synthesized using standard methods (Roche). For Mafs-ƒÉgt10 and ƒÉZAP zebrafish cDNA libraries (kindly zebrafish embryos, the probes corresponding to the b-Zip provided by Drs. H. Okamoto and B. Appel, respectively) coding region plus 3•LUTR region [MafB (+709 to +1620 were prepared from 18-23 hpf (hours post-fertilization) and bp), c-Maf (+622 to +1015 bp), and SMaf2 (+718 to +1439 15-19 hpf zebrafish embryos. We screened approximately bp),I, 5•LUTR plus acidic region [SMaf1 (-263 to +410)], and 4.8•~106 and 3.2•~107 plaques from the respective librar full-length cDNA (MyoD) were used. For sectioned mouse ies wider low stringency conditions (25% formamide, 42•Ž) embryos, the marine MafB probe, containing the ORF with a probe containing the b-Zip domain of Xenopus MafB region (+52 to +755 bp), was used. Embryo fixation, pre (provided by S. Ishibashi). A total of 180 clones was isolated treatment and whole-mount in situ hybridization for zebra- on the first screening. After three further rounds of purifi fish were performed as described previously (25) except for cation, the remaining 32 clones were subcloned into pBlue slight modification of the hybridization mixture (5•~ SSC, -script SK+ (Stratagene) and sequenced. In an additional 50 ƒÊg/ml of heparin, 5 mg/ml of yeast tRNA, 0.1% Tween- experiment, total RNA, which was prepared from 18hpf 20, 50% formamide) and the blocking solution (1% DIG zebrafish embryos using ISOGEN (Nippongene), was ana Blocking Reagent, 0.2, Tween20, 1•~ PBS). Post-stained lyzed by RT-PCR (reverse transcriptase-polymerase chain zebrafish embryos were sectioned at a thickness of 50 or 10 reaction) using previously described degenerate sense and µm.