DOCSLIB.ORG

Identification and Tracking Activity of Fungus from the Antarctic Pole on Antagonistic of Aquatic Pathogenic Bacteria

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Identification and Tracking Activity of Fungus from the Antarctic Pole on Antagonistic of Aquatic Pathogenic Bacteria INTERNATIONAL JOURNAL OF AGRICULTURE & BIOLOGY ISSN Print: 1560–8530; ISSN Online: 1814–9596 19F–079/2019/22–6–1311–1319 DOI: 10.17957/IJAB/15.1203 http://www.fspublishers.org Full Length Article Identification and Tracking Activity of Fungus from the Antarctic Pole on Antagonistic of Aquatic Pathogenic Bacteria Chuner Cai1,2,3, Haobing Yu1, Huibin Zhao2, Xiaoyu Liu1*, Binghua Jiao1 and Bo Chen4 1Department of Biochemistry and Molecular Biology, College of Basic Medicine, Naval Medical University, Shanghai, 200433, China 2College of Marine Ecology and Environment, Shanghai Ocean University, Shanghai, 201306, China 3Co-Innovation Center of Jiangsu Marine Bio-industry Technology, Lianyungang, Jiangsu, 222005, China 4Polar Research Institute of China, Shanghai, 200136, China *For correspondence: [email protected] Abstract To seek the lead compound with the activity of antagonistic aquatic pathogenic bacteria in Antarctica fungi, the work identified species of a previously collected fungus with high sensitivity to Aeromonas hydrophila ATCC7966 and Streptococcus agalactiae. Potential active compounds were separated from fermentation broth by activity tracking and identified in structure by spectrum. The results showed that this fungus had common characteristics as Basidiomycota in morphology. According to 18S rDNA and internal transcribed space (ITS) DNA sequencing, this fungus was identified as Bjerkandera adusta in family Meruliaceae. Two active compounds viz., veratric acid and erythro-1-(3, 5-dichlone-4- methoxyphenyl)-1, 2-propylene glycol were identified by nuclear magnetic resonance spectrum and mass spectrum. Veratric acid was separated for the first time from any fungus, while erythro-1-(3, 5-dichlone-4-methoxyphenyl)-1, 2-propylene glycol was once reported in Bjerkandera. In addition, 3-chlone-4-methoxybenzoi acid and 4-chlone-2-methoxybenzoic acid were identified by GC-MS. In the non-active compounds, the metabolic intermediate, veratraldehyde was identified with spectrum. The results concluded that there were various antibacterial active compounds in the extractum of fermentation liquor, which provides reference for developing new preventive drug against aquatic pathological bacteria. © 2019 Friends Science Publishers Keywords: Antarctica fungus; Purification; Secondary metabolites; Structural identification Introduction bauer paper strip method (Esser and Elefson. 1970). A fungus with strong antibacterial activity was screened. This China supplies one-third of global fish production, in which fungus was highly sensitive to A. hydrophila ATCC7966 aquiculture yield occupies the half of global gross and S. agalactiae. During 10-day’s fermentation, pH curve production (Cao et al., 2015). However, sustainable tended to increase after decreased, while the curve of sugar development is often affected by fish diseases spreading residual tended to decrease (Zhao et al., 2018). It was caused by aquatic pathogenic bacteria such as Streptococcus initially speculated that lots of alkaline secondary agalactiae and Aeromonas hydrophila. Both of them result metabolites had generated. The strain was roughly inferred in fish death (Money and Dobson, 2004), especially for A. to belong to Bjerkandera based on 18S rDNA. The work hydrophila, which is the main reason for furunculosis and further identified this strain via morphological fish hemorrhagic diseases after infection (Cutuli et al., characteristics of every growth stages, more detailed 2015). At present, the use of antibiotic is the main method to molecular identification and characteristic compound even. withstand these pathogens. Antarctic fungi might be the Furthermore, potential active compounds were separated by most diverse species in Antarctic fungi (Bridge and activity tracking from fermentation broth to identify Spooner, 2012), which have more than 1,000 species structures by spectrum and GC-MS. identified (Bridge et al., 2008). Antarctica microbes present antimicrobial activity with their secondary Material and Methods metabolites, such as terpenoids, phenols and nitrides, which might become new drug sources (Giudice et al., 2007). Morphology Identification of Strain B-7 In early study, the fermentation products of 23 polar fungi were extracted to detect antibacterial activity by kirby- Antarctic fungi were from Polar Research Institute of To cite this paper: Cai, C., H. Yu, H. Zhao, X. Liu, B. Jiao and B. Chen, 201x. Identification and tracking activity of fungus from the Antarctic pole on antagonistic of aquatic pathogenic bacteria. Intl. J. Agric. Biol., 22: 1311–1319 Cai et al. / Intl. J. Agric. Biol., Vol. 22, No. 6, 2019 China, while A. hydrophila ATCC7966 and S. agalactiae activity tracking. Moreover, other components were also were from National Aquatic Pathogen Database of Shanghai separated or analyzed by liquid chromatography mass Ocean University and preserved under -80°C in 60% spectrometry technology (GC-MS) for identification (Fig. 1) glycerol. Potato Dextrose Broth (PDB), Mueller-Hinton to understand the overall components in fungus B-7 Agar, nutrient broth and Glucose Peptone Yeast medium fermented extractum. The sample for GC-MS analysis was were all prepared according to Zhao’s method (Zhao et al., pretreated by 4% vitriol-methyl alcohol heating reflux 2018). Potato Dextrose Agar slant medium was prepared as esterification method (Pang et al., 2013) with loading follows: mix 6 g PDB and 4 g agar and dissolved in 200 mL quantity of 1 μL. HP-5 capillary column (30 m × 0.25 mm) distilled water to make slant medium in tube. Fungus strain was used. For heating procedure, keep at 50°C for 1 min B-7 was preserved in Potato Dextrose Agar slant medium. and then rise the temperature to 200°C by 25°C min-1 and to In resuscitation, some thalluses was scraped and placed in 5 230°C by 3°C min-1. Finally, keep at 230°C for 18 min. The mL PDB medium for 2-day excitation. The fungus was split ratio was 50:1. The flow rates of nitrogen, hydrogen activated at 24°C and 180 rpm in incubator for shaking and air were 30, 450 and 40 mL min-1, respectively. culture. After confirming the increase of bacterium concentration by microscopic examination, fungus strain B- Steps for Separation of Fermentation Broth 7 was inoculated on Potato Dextrose Agar slant with sterilized bamboo stick for static culture at 37°C. After Rough extractum was dissolved with dichloromethane in hypha overgrowed on the slant, clear it with sterilized 1:1 (g mL-1) and mixed with silica gel in 1:1 (m:m) followed distilled water and then transfer to a 75 mL PDB medium as by grinding and blowing dry. The sample was loaded on seed solution. All the hypha was cultured by shaking at preequilibrated silica gel column [9 cm (d) × 6 cm (h)] and 28°C and 180 rpm. After the seed solution was cultured to eluted with different liquors (mixture of petroleum ether and an appropriate density, shake evenly and pour it to 500 mL ethyl acetate at ratio of 50:1, 30:1, 15:1, 8:1 or 3:1, ethyl Glucose Peptone Yeast medium for fermentation at 20°C acetate and methyl alcohol). Every part of eluent was with continuous oscillation frequency of 180 rpm. After detected by thin-layer chromatography and concentrated, fermentation for 10 days, every bottle of fermentation liquor followed by detection of antibacterial activity of two was filtered with four layers of gauze. Butyl acetate were pathological bacteria. used to extract the filter liquor in 1:1 (v:v) twice and dried by rotary evaporation. Purification of Components Molecular Identification of Strain B-7 Eluted components (the eluent petroleum ether: ethyl acetate=3:1, No. 1-6) dissolved in methyl alcohol were 18S rDNA and ITS DNA from genomic DNA of strain B-7 conducted by thin-layer chromatography. The developing were amplified by PCR using primers as follows. 18S rDNA solvents were as follows: pure petroleum ether, petroleum amplification primer: NS1: ether and ethyl acetate with ratio of 50:1, 40:1, 30:1, 20:1, 5’GTAGTCATATGCTTGTCTC3’; NS6: 10:1, 5:1, 4:1, 3:1, 2:1, and 1:1. The components were 5’GCATCACAGACCTGTTATTGCCTC3’. ITS DNA detected with 254 nm ultraviolet and dyed with vanillin. amplification primer: ITS1: 5’ Component No. 1-6 was taken for liquid chromatogram TCCGTAGGTGAACCTGCGG 3’, ITS4: 5’ with chromatographic column, YMC. 20–100% methyl TCCTCCGCTTATTGATATGC 3’. PCR products were alcohol was used for 1h linear elution. Components 1-6 was identified by electrophoresis and purified by the SanPrep separated by chromatography on ODS column using eluent column DNA gel recovery kit to sequence by Applied of methyl alcohol solution in different concentrations (45, Biosystems 3730XL sequencer. The sequencing results were 55, 65, 75, 85 and 100%) followed by antibacterial activity analyzed. For each sample, 100 most similar sequences detection. from genbank were obtained according to their matching After thin-layer chromatography detection, the eluted degree and score, followed by comparison using DNAMAN components (tube 1–8 with 45% methyl alcohol, No. 1-6-1) software. After comparison, the Maximum likelihood was separated by silica gel using eluent of petroleum ether, phylogenetic tree was built with MEGA6.06 (Tamura et al., dichloromethane, ethyl acetate and methyl alcohol in ratio 2013) in Kimura 2 - parameter model. of 5:5:1:1. The separated components were loaded on ODS- HG-5 [5 μm, 10 mm (i.d.) × 25 cm] column for HPLC Overall Flow of Separating Fermented Extractum detection using methyl alcohol as mobile phase. The eluted component (No. 1-6-1-2) was dissolved with deuterated Fungus strain B-7 was fermented, and a total of 80L chloroform for 1H, 13C and DEPT spectrum. fermentation liquor was extracted with butyl acetate twice. After comparative thin-layer chromatography detection The bacteriostatic activity of two pathological bacteria was with developing solvents of petroleum ether and acetone in detected with paper strip for rough extractum (Zhao et al., ratio of 3:1, petroleum ether and ethyl acetate in ratio of 3:1, 2018). Active components were particularly separated by and dichloromethane and methyl alcohol in ratio of 9:1, the 1312 Antarctic Fungus Anti-aquatic Pathogenic Bacteria / Intl.
Load more

Recommended publications
  • Why Mushrooms Have Evolved to Be So Promiscuous: Insights from Evolutionary and Ecological Patterns
    fungal biology reviews 29 (2015) 167e178 journal homepage: www.elsevier.com/locate/fbr Review Why mushrooms have evolved to be so promiscuous: Insights from evolutionary and ecological patterns Timothy Y. JAMES* Department of Ecology and Evolutionary Biology, University of Michigan, Ann Arbor, MI 48109, USA article info abstract Article history: Agaricomycetes, the mushrooms, are considered to have a promiscuous mating system, Received 27 May 2015 because most populations have a large number of mating types. This diversity of mating Received in revised form types ensures a high outcrossing efficiency, the probability of encountering a compatible 17 October 2015 mate when mating at random, because nearly every homokaryotic genotype is compatible Accepted 23 October 2015 with every other. Here I summarize the data from mating type surveys and genetic analysis of mating type loci and ask what evolutionary and ecological factors have promoted pro- Keywords: miscuity. Outcrossing efficiency is equally high in both bipolar and tetrapolar species Genomic conflict with a median value of 0.967 in Agaricomycetes. The sessile nature of the homokaryotic Homeodomain mycelium coupled with frequent long distance dispersal could account for selection favor- Outbreeding potential ing a high outcrossing efficiency as opportunities for choosing mates may be minimal. Pheromone receptor Consistent with a role of mating type in mediating cytoplasmic-nuclear genomic conflict, Agaricomycetes have evolved away from a haploid yeast phase towards hyphal fusions that display reciprocal nuclear migration after mating rather than cytoplasmic fusion. Importantly, the evolution of this mating behavior is precisely timed with the onset of diversification of mating type alleles at the pheromone/receptor mating type loci that are known to control reciprocal nuclear migration during mating.
    [Show full text]
  • Cabalodontia (Meruliaceae), a Novel Genus for Five Fungi Previously Placed in Phlebia
    Polish Botanical Journal 49(1): 1–3, 2004 CABALODONTIA (MERULIACEAE), A NOVEL GENUS FOR FIVE FUNGI PREVIOUSLY PLACED IN PHLEBIA MARCIN PIĄTEK Abstract: The new genus Cabalodontia M. Piątek with the type Odontia queletii Bourdot & Galzin is described, and new com- binations C. bresadolae (Parmasto) M. Piątek, C. cretacea (Romell ex Bourdot & Galzin) M. Piątek, C. livida (Burt) M. Piątek, C. queletii (Bourdot & Galzin) M. Piątek and C. subcretacea (Litsch.) M. Piątek are proposed. The new genus belongs to Meruliaceae P. Karst. and is closely related to Phlebia Fr. Key words: Cabalodontia, Phlebia, Steccherinum, Irpex, Meruliaceae, new genus, corticoid fungi, taxonomy Marcin Piątek, Department of Mycology, W. Szafer Institute of Botany, Polish Academy of Sciences, Lubicz 46, 31-512 Kraków, Poland; e-mail: [email protected] The generic placement of Odontia queletii Bourdot genera should be accepted as subgenera or sections & Galzin has been much debated, and the spe- within Irpex. In addition to Flavodon, Flaviporus cies has had a very unstable taxonomic position. and Junghuhnia, Kotiranta and Saarenoksa (2002) Christiansen (1960) combined it into Phlebia Fr. as transferred to Irpex species of Steccherinum that Phlebia queletii (Bourdot & Galzin) M. P. Christ., possess a dimitic hyphal system, including Parmasto (1968) transferred the species to the genus Hydnum ochraceum Pers., the generitype of Stec- Metulodontia Parmasto as Metulodontia queletii cherinum (Maas Geesteranus 1974). Irpex is now (Bourdot & Galzin) Parmasto, and fi nally Hal- defi ned as a genus possessing a dimitic hyphal lenberg and Hjortstam (1988) reallocated Odontia system, with simple septate or clamped generative queletii to Steccherinum Gray as Steccherinum hyphae, relatively small spores, large encrusted queletii (Bourdot & Galzin) Hallenb.
    [Show full text]
  • Gymnosperms) of New York State
    QK 129 . C667 1992 Pinophyta (Gymnosperms) of New York State Edward A. Cope The L. H. Bailey Hortorium Cornell University Contributions to a Flora of New York State IX Richard S. Mitchell, Editor 1992 Bulletin No. 483 New York State Museum The University of the State of New York THE STATE EDUCATION DEPARTMENT Albany, New York 12230 V A ThL U: ESTHER T. SVIERTZ LIBRARY THI-: ?‘HW YORK BOTANICAL GARDEN THE LuESTHER T. MERTZ LIBRARY THE NEW YORK BOTANICAL GARDEN Pinophyta (Gymnosperms) of New York State Edward A. Cope The L. H. Bailey Hortorium Cornell University Contributions to a Flora of New York State IX Richard S. Mitchell, Editor 1992 Bulletin No. 483 New York State Museum The University of the State of New York THE STATE EDUC ATION DEPARTMENT Albany, New York 12230 THE UNIVERSITY OF THE STATE OF NEW YORK Regents of The University Martin C. Barell, Chancellor, B.A., I.A., LL.B. Muttontown R. Carlos Carballada, Vice Chancellor, B.S. Rochester Willard A. Genrich, LL.B. Buffalo Emlyn I. Griffith. A.B.. J.D. Rome Jorge L. Batista, B.A.. J.D. Bronx Laura Bradley Chodos, B.A., M.A. Vischer Ferry Louise P. Matteoni, B.A., M.A., Ph.D. Bayside J. Edward Meyer, B.A., LL.B. Chappaqua FloydS. Linton, A.B., M.A., M.P.A. Miller Place Mimi Levin Lif.ber, B.A., M.A. Manhattan Shirley C. Brown, B.A., M.A., Ph.D. Albany Norma Gluck, B.A., M.S.W. Manhattan Adelaide L. Sanford, B.A., M.A., P.D.
    [Show full text]
  • Supplement of Ice Nucleation by Fungal Spores from the Classes Agaricomycetes, Ustilagi- Nomycetes, and Eurotiomycetes, And
    Supplement of Atmos. Chem. Phys., 14, 8611–8630, 2014 http://www.atmos-chem-phys.net/14/8611/2014/ doi:10.5194/acp-14-8611-2014-supplement © Author(s) 2014. CC Attribution 3.0 License. Supplement of Ice nucleation by fungal spores from the classes Agaricomycetes, Ustilagi- nomycetes, and Eurotiomycetes, and the effect on the atmospheric trans- port of these spores D. I. Haga et al. Correspondence to: A. K. Bertram ([email protected]) and S. M. Burrows ([email protected]) 15 Table S1. List of the fungal spores studied here and previous studies that have identified these spores in the atmosphere.1 Species studied Studies that have identified this species in the Studies that have identified this genus in the atmosphere atmosphere Agaricus bisporus Morales et al. (2006) Calderon et al. (1995); De Antoni Zoppas et al. (2006); Mallo et al. (2011); Oliveira et al. (2009) Amanita muscaria Li (2005) Magyar et al. (2009) Boletus zelleri - Calderon et al. (1995); Magyar et al. (2009) Lepista nuda - - Trichaptum abietinum - - Ustilago nuda Calderon et al. (1995); Magyar et al. (2009) De Antoni Zoppas et al. (2006); Herrero et al. Ustilago nigra - (2006); Hirst (1953); Morales et al. (2006); Ustilago avenae Gregory (1952) Oliveira et al. (2005); Pady and Kelly (1954); Sabariego et al. (2000); Waisel et al. (2008); Garcia et al. (2012) Aspergillus brasiliensis - Abu-Dieyeh et al. (2010); Adhikari et al. Aspergillus niger Abu-Dieyeh et al. (2010); Grishkan et al. (2012); Li (2004); Chakraborty et al. (2003); Crawford (2005); Mishra and Srivastava (1971, 1972); Nayar et al. (2009); De Antoni Zoppas et al.
    [Show full text]
  • The Use of Algae and Fungi for Removal of Pharmaceuticals by Bioremediation and Biosorption Processes: a Review
    Review The Use of Algae and Fungi for Removal of Pharmaceuticals by Bioremediation and Biosorption Processes: A Review Andreia Silva, Cristina Delerue-Matos, Sónia A. Figueiredo and Olga M. Freitas * REQUIMTE/LAQV, Instituto Superior de Engenharia do Porto, Rua Dr. António Bernardino de Almeida 431, 4200-072 Porto, Portugal * Correspondence: [email protected] Received: 3 July 2019; Accepted: 25 July 2019; Published: 27 July 2019 Abstract: The occurrence and fate of pharmaceuticals in the aquatic environment is recognized as one of the emerging issues in environmental chemistry. Conventional wastewater treatment plants (WWTPs) are not designed to remove pharmaceuticals (and their metabolites) from domestic wastewaters. The treatability of pharmaceutical compounds in WWTPs varies considerably depending on the type of compound since their biodegradability can differ significantly. As a consequence, they may reach the aquatic environment, directly or by leaching of the sludge produced by these facilities. Currently, the technologies under research for the removal of pharmaceuticals, namely membrane technologies and advanced oxidation processes, have high operation costs related to energy and chemical consumption. When chemical reactions are involved, other aspects to consider include the formation of harmful reaction by-products and the management of the toxic sludge produced. Research is needed in order to develop economic and sustainable treatment processes, such as bioremediation and biosorption. The use of low-cost materials, such as biological matrices (e.g., algae and fungi), has advantages such as low capital investment, easy operation, low operation costs, and the non-formation of degradation by-products. An extensive review of existing research on this subject is presented.
    [Show full text]
  • Oxalic Acid Degradation by a Novel Fungal Oxalate Oxidase from Abortiporus Biennis Marcin Grąz1*, Kamila Rachwał2, Radosław Zan2 and Anna Jarosz-Wilkołazka1
    Vol. 63, No 3/2016 595–600 http://dx.doi.org/10.18388/abp.2016_1282 Regular paper Oxalic acid degradation by a novel fungal oxalate oxidase from Abortiporus biennis Marcin Grąz1*, Kamila Rachwał2, Radosław Zan2 and Anna Jarosz-Wilkołazka1 1Department of Biochemistry, Maria Curie-Skłodowska University, Lublin, Poland; 2Department of Genetics and Microbiology, Maria Curie-Skłodowska University, Lublin, Poland Oxalate oxidase was identified in mycelial extracts of a to formic acid and carbon dioxide (Mäkelä et al., 2002). basidiomycete Abortiporus biennis strain. Intracellular The degradation of oxalate via action of oxalate oxidase enzyme activity was detected only after prior lowering (EC 1.2.3.4), described in our study, is atypical for fun- of the pH value of the fungal cultures by using oxalic or gi and was found predominantly in higher plants. The hydrochloric acids. This enzyme was purified using size best characterised oxalate oxidase originates from cereal exclusion chromatography (Sephadex G-25) and ion-ex- plants (Dunwell, 2000). Currently, only three oxalate oxi- change chromatography (DEAE-Sepharose). This enzyme dases of basidiomycete fungi have been described - an exhibited optimum activity at pH 2 when incubated at enzyme from Tilletia contraversa (Vaisey et al., 1961), the 40°C, and the optimum temperature was established at best characterised so far enzyme from Ceriporiopsis subver- 60°C. Among the tested organic acids, this enzyme ex- mispora (Aguilar et al., 1999), and an enzyme produced by hibited specificity only towards oxalic acid. Molecular Abortiporus biennis (Grąz et al., 2009). The enzyme from mass was calculated as 58 kDa. The values of Km for oxa- C.
    [Show full text]
  • Wood Decay by Inonotus Rickii and Bjerkandera Adusta: a Micro- and Ultra-Structural Approach
    IAWARobles Journal et al.35 – (1), Wood 2014: decay 51–60 51 WOOD DECAY BY INONOTUS RICKII AND BJERKANDERA ADUSTA: A MICRO- AND ULTRA-STRUCTURAL APPROACH Carolina Analía Robles1,*, María Agueda Castro2 and Silvia Edith Lopez1 1PROPLAME-PRHIDEB-CONICET & 2Laboratorio de Anatomía Vegetal Aplicada, Departamento de Biodiversidad y Biología Experimental, Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires, Ciudad Universitaria, PB II, 4to piso, CP 1428EHA Ciudad Autónoma de Buenos Aires, Argentina *Corresponding author; e-mail: [email protected] ABSTRACT Bjerkandera adusta (Willd.) P. Karst. and Inonotus rickii (Pat.) D.A. Reid. are important xylophagous fungi affecting street trees in Buenos Aires City, Ar- gentina. The objective of this paper is to describe the decay patterns produced by these species in London plane wood (Platanus acerifolia (Ait.) Willd.), which is one of the most abundant tree species in the city, through light microscopy (LM), scanning electron microscopy (SEM) and transmission electron microscopy (TEM). A better knowledge of the decay patterns of these fungi at early stages would provide useful information for optimizing tree management programs. Microscopic observations showed that B. adusta, having caused an important loss of dry weight, showed more extensive degradation of wood after three months than I. rickii, affecting mainly fiber walls with potential consequences in tree strength and stiffness. Inonotus rickii, on the other hand, selectively af- fected vessel walls and middle lamellae between fibers. Rays remained virtually unaltered in all decayed wood. Keywords: Wood-rotting fungi, white rot, delignification, Platanus acerifolia. INTRODUCTION White-rot fungi remove lignin, cellulose and hemicelluloses from wood.
    [Show full text]
  • Hori Et Al 2013.Pdf
    Mycologia, 105(6), 2013, pp. 1412–1427. DOI: 10.3852/13-072 # 2013 by The Mycological Society of America, Lawrence, KS 66044-8897 Genomewide analysis of polysaccharides degrading enzymes in 11 white- and brown-rot Polyporales provides insight into mechanisms of wood decay Chiaki Hori cellulases belonging to families GH6, GH7, GH9 Department of Biomaterials Sciences, Graduate School of and carbohydrate-binding module family CBM1 are Agricultural and Life Sciences, University of Tokyo, l-l-l, lacking in genomes of brown-rot polyporales. In Yayoi, Bunkyo-ku, Tokyo 113-8657, Japan, and Institute for Microbial and Biochemical Technology, addition, the presence of CDH and the expansion Forest Products Laboratory, 1 Gifford Pinchot Drive, of LPMO were observed only in white-rot genomes. Madison, Wisconsin 53726 Indeed, GH6, GH7, CDH and LPMO peptides were identified only in white-rot polypores. Genes encod- Jill Gaskell ing aldose 1-epimerase (ALE), previously detected Institute for Microbial and Biochemical Technology, Forest Products Laboratory, 1 Gifford Pinchot Drive, with CDH and cellulases in the culture filtrates, also Madison, Wisconsin 53726 were identified in white-rot genomes, suggesting a physiological connection between ALE, CDH, cellu- Kiyohiko Igarashi lase and possibly LPMO. For hemicellulose degrada- Masahiro Samejima tion, genes and peptides corresponding to GH74 Department of Biomaterials Sciences, Graduate School of Agricultural and Life Sciences, University of Tokyo, l-l-l, xyloglucanase, GH10 endo-xylanase, GH79 b-glucu- Yayoi, Bunkyo-ku, Tokyo 113-8657, Japan ronidase, CE1 acetyl xylan esterase and CE15 glucur- onoyl methylesterase were significantly increased in David Hibbett white-rot genomes compared to brown-rot genomes.
    [Show full text]
  • Spelling out Jaapia Species
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Digital.CSIC Mycol Progress (2015) 14: 57 DOI 10.1007/s11557-015-1081-8 ORIGINAL ARTICLE Spelling out Jaapia species M. Teresa Telleria 1 & Margarita Dueñas1 & Ireneia Melo2 & Isabel Salcedo3 & María P. Martín1 Received: 23 March 2015 /Revised: 16 June 2015 /Accepted: 22 June 2015 /Published online: 9 July 2015 # German Mycological Society and Springer-Verlag Berlin Heidelberg 2015. This article is published with open access at Springerlink.com Abstract Jaapia is a wood-saprobic genus of corticioid fungi Keywords Basidiomycota . Agaricomycetes . Jaapiales . for which two species have been recognized: J. argillacea Corticioid fungi . Taxonomy . Barcoding . ITS . Bres. and J. ochroleuca (Bres.) Nannf. & J. Erikss. Whereas Morphological diagnostic characters the first one is easily recognized by its characteristic spores, the descriptions of the second indicated variable spores, which once led us to believe that J. ochroleuca could be a species Introduction complex rather than a single species. Eleven new ITS nrDNA sequences of J. ochroleuca were aligned with two obtained Jaapia was described by Bresadola (1911)toaccommodate from GenBank and four of J. argillacea. The molecular re- J. argillacea Bres., and for 20 years, this monotypic genus sults, parsimony analysis and KP2 distances clearly delimitate was accepted by several authors (von Höhnel 1912; Wakefield one highly supported Jaapia clade, with two subclades that and Pearson 1920; Bourdot and Galzin 1923, 1928; Rogers correspond to the two described species. Morphological stud- 1935). Nannfeldt and Eriksson (1953)consideredConiophora ies, including the holotype and isotype of J.
    [Show full text]
  • Fungal Diversity in the Mediterranean Area
    Fungal Diversity in the Mediterranean Area • Giuseppe Venturella Fungal Diversity in the Mediterranean Area Edited by Giuseppe Venturella Printed Edition of the Special Issue Published in Diversity www.mdpi.com/journal/diversity Fungal Diversity in the Mediterranean Area Fungal Diversity in the Mediterranean Area Editor Giuseppe Venturella MDPI • Basel • Beijing • Wuhan • Barcelona • Belgrade • Manchester • Tokyo • Cluj • Tianjin Editor Giuseppe Venturella University of Palermo Italy Editorial Office MDPI St. Alban-Anlage 66 4052 Basel, Switzerland This is a reprint of articles from the Special Issue published online in the open access journal Diversity (ISSN 1424-2818) (available at: https://www.mdpi.com/journal/diversity/special issues/ fungal diversity). For citation purposes, cite each article independently as indicated on the article page online and as indicated below: LastName, A.A.; LastName, B.B.; LastName, C.C. Article Title. Journal Name Year, Article Number, Page Range. ISBN 978-3-03936-978-2 (Hbk) ISBN 978-3-03936-979-9 (PDF) c 2020 by the authors. Articles in this book are Open Access and distributed under the Creative Commons Attribution (CC BY) license, which allows users to download, copy and build upon published articles, as long as the author and publisher are properly credited, which ensures maximum dissemination and a wider impact of our publications. The book as a whole is distributed by MDPI under the terms and conditions of the Creative Commons license CC BY-NC-ND. Contents About the Editor .............................................. vii Giuseppe Venturella Fungal Diversity in the Mediterranean Area Reprinted from: Diversity 2020, 12, 253, doi:10.3390/d12060253 .................... 1 Elias Polemis, Vassiliki Fryssouli, Vassileios Daskalopoulos and Georgios I.
    [Show full text]
  • Basidiomycetes Inhabiting the Ornamental Tree Catalpa (Bignoniaceae)
    ©Österreichische Mykologische Gesellschaft, Austria, download unter www.biologiezentrum.at Österr. Z. Pilzk. 19(2010) Basidiomycetes inhabiting the ornamental tree Catalpa (Bignoniaceae) JURAJ PACLT Nam Benku, Martina 24/4083 81107 Bratislava 1, Slovakia Accepted 11. 1.2010 Key words: Basidiomycetes. - Fungus-host associations, Catalpa. Abstract: Attention is paid to all basidiomycetous species hitherto known to occur on Catalpa as host plant. During 1955-1997 more than 20 new fungus-host associations from diverse species of Catalpa grown in Europe could be found by the author. Zusammenfassung: Basidiomyzeten, die bisher von Catalpa als Wirtspflanze bekannt sind, werden aufgeführt. Dem Autor gelang es, 1955-1997 mehr als zwanzig neue Pilz-Wirt-Assoziationen von ver- schiedenen in Europa angepflanzten Catalpa-Artcn zu finden. Catalpa SCOP. (Bignoniaceae), called cigar-tree in the USA, a genus native to the United States of America [Southern Catalpa = C. hignonioides WALTER, Hardy Ca- talpa = C. speciosa (WARDER ex BARNEY) ENGELM.], West Indies and/or China. Common species of the genus are favoured as ornamental trees due to their showy panicles of flowers and long cigar-like pendent capsular fruits as well. In Europe, spe- cies of Catalpa are often cultivated as park- and street-trees. OUDEMANS (1923) mentioned only four species of Basidiomycetes for Catalpa, i.e., Polyponts distortus (= Abortipoms biennis). Pistil/aha mucedina. Pistil/aria mucoroides, and Polyponis distinctus (nomen dubium). Six further basidiomycetous species collected on Catalpa were listed in the next host index by SEYMOUR (1929): Exidia saccharina, Polyponis adustus (= Bjerkandera adusta), Schizophyllum commune, Stereum albobadium (= Dendrophora alhobadia), Stereum versicolor, and Trametes sepium (= Antrodia al- bida).
    [Show full text]
  • A Preliminary Checklist of Arizona Macrofungi
    A PRELIMINARY CHECKLIST OF ARIZONA MACROFUNGI Scott T. Bates School of Life Sciences Arizona State University PO Box 874601 Tempe, AZ 85287-4601 ABSTRACT A checklist of 1290 species of nonlichenized ascomycetaceous, basidiomycetaceous, and zygomycetaceous macrofungi is presented for the state of Arizona. The checklist was compiled from records of Arizona fungi in scientific publications or herbarium databases. Additional records were obtained from a physical search of herbarium specimens in the University of Arizona’s Robert L. Gilbertson Mycological Herbarium and of the author’s personal herbarium. This publication represents the first comprehensive checklist of macrofungi for Arizona. In all probability, the checklist is far from complete as new species await discovery and some of the species listed are in need of taxonomic revision. The data presented here serve as a baseline for future studies related to fungal biodiversity in Arizona and can contribute to state or national inventories of biota. INTRODUCTION Arizona is a state noted for the diversity of its biotic communities (Brown 1994). Boreal forests found at high altitudes, the ‘Sky Islands’ prevalent in the southern parts of the state, and ponderosa pine (Pinus ponderosa P.& C. Lawson) forests that are widespread in Arizona, all provide rich habitats that sustain numerous species of macrofungi. Even xeric biomes, such as desertscrub and semidesert- grasslands, support a unique mycota, which include rare species such as Itajahya galericulata A. Møller (Long & Stouffer 1943b, Fig. 2c). Although checklists for some groups of fungi present in the state have been published previously (e.g., Gilbertson & Budington 1970, Gilbertson et al. 1974, Gilbertson & Bigelow 1998, Fogel & States 2002), this checklist represents the first comprehensive listing of all macrofungi in the kingdom Eumycota (Fungi) that are known from Arizona.
    [Show full text]