CIRCADIAN MECHANISMS of CALORIE RESTRICTION in DELAYING AGING KULDEEP MAKWANA Bachelor of Dental Surgery Pacific Dental College

CIRCADIAN MECHANISMS OF CALORIE RESTRICTION IN DELAYING AGING

KULDEEP MAKWANA

Bachelor of Dental Surgery Pacific Dental College and General Hospital, Udaipur, India December 2010

submitted in partial fulfillment of requirements for the degree

DOCTOR OF PHILOSOPHY IN REGULATORY BIOLOGY

at the

CLEVELAND STATE UNIVERSITY

December 2018

We hereby approve this dissertation For Kuldeep Makwana Candidate for the Doctor of Philosophy in Regulatory Biology Degree for the Department of Biological, Geological and Environmental Sciences AND CLEVELAND STATE UNIVERSITY College of Graduate Studies by

Date: 11/14/2018 Dr. Roman Kondratov, GRHD/BGES, Cleveland State University Major Advisor

Date: 11/14/2018 Dr. Girish Shukla, GRHD/BGES, Cleveland State University Advisory Committee Member

Date: 11/14/2018 Dr. Crystal Weyman, GRHD/BGES, Cleveland State University Advisory Committee Member

Date: 11/14/2018 Dr. Justin Lathia, Department of Cellular and Molecular Medicine, CCF Advisory Committee Member

Date: 11/14/2018 Dr. Aaron Severson, GRHD/BGES, Cleveland State University Internal Examiner

Date: 11/14/2018 Dr. Yana Sandlers, Department of Chemistry, Cleveland State University External Examiner

Student’s Date of Defense: 11/14/2018

DEDICATION

I dedicate my work to my family and friends. To my parents for their support and faith, they have shown in all my decisions, I have ever taken to achieve my goals. To all my friends without whom this journey would not have been this eventful.

ACKNOWLEDGEMENTS

“A GOOD TEACHER CAN INSPIRE HOPE, IGNITE THE IMAGINATION, AND

INSTILL A LOVE OF LEARNING” - BRAD HENRY

First and foremost, I would like to acknowledge Dr. Roman Kondratov for being a mentor that epitomizes the sayings of Brad Henry. I would like to thank him for his support and believe he has shown in my abilities. He has been the guiding torch for all these years and played an important role in the development of my scientific intellect as well as interpersonal skills. Not only he guided me in my Ph.D. dissertation work but also taught about life lessons like a friend from time to time. He is one humble person and a very cool professor I have ever met.

I’d like to acknowledge my parents. I’d always be indebted by their unconditional love and support.

I’d like to extend my deepest regards and thanks to my advisory committee members: Dr.

Shukla, Dr. Crystal Weyman, and Dr. Justin Lathia. They have always motivated me and helped me transform my project in various ways. At the end of every committee meeting,

I have always learned something new which I will carry with me forever and implement in future as well. I’d also like to thank Dr. Aron Severson and Dr. Yana Sandlers for agreeing to serve on my committee as an internal and external reviewer.

I’d like to thank all my lab mates, current and former, and friends in the BGES department for making this lengthy and difficult journey, at times, to be the one that will always remain a part of my life. I’d like to thank Sonal Patel for being a good friend and take all my stupid jokes lightly with no offense. Ravinder Kaur and Amra Ismail for being a family away from my family. Thanks to all these amazing people, going to the lab never felt like going to work. I thoroughly enjoyed and will cherish the time I spent in

Dr. Roman Kondratov’s lab at Cleveland state university.

Lastly, thanks to the almighty God for bestowing his blessing and love upon me.

CIRCADIAN MECHANISMS OF CALORIE RESTRICTION IN DELAYING AGING

KULDEEP MAKWANA

ABSTRACT

Calorie Restriction (CR) is a dietary intervention known to delay age associated pathologies and conditions. Its beneficial effects on the longevity are reported in variety of organisms ranging from unicellular to multi-cellular organisms like mammals. Various mechanisms have been proposed for the beneficial effect of CR on the lifespan. One of the proposed mechanisms by which CR brings about its beneficial effects on the lifespan is regulation of protein synthesis. Various studies have demonstrated an increase in protein synthesis under CR, some claimed inhibition of protein synthesis under CR, and some claimed no effect on protein synthesis under CR. In this work, using comprehensive circadian experimental setup, I have demonstrated inhibition of global protein synthesis under CR diet in mouse liver. Animals were subjected to two months of CR followed by polysome profiling of liver tissue. Protein translation was down-regulated in the liver of

CR animals at all time points but after four hours of feeding, where it was found to be higher than AL animals. Transcripts associated with polysomes were isolated and mRNA-sequencing was performed. CR was found to be involved in the temporal reprogramming of circadian rhythms in protein translation. Furthermore, the effect of CR on differential translation was studied. mRNA-Sequencing assayed 26,913 transcripts associated with polysomes, 0.1% of the total number of transcripts were found to be differentially abundant in the polysomes. My study has revealed, for the first, CR mediated induced expression of ACOT enzymes which are known to be involved fat metabolism. Thus, I demonstrated circadian mechanism of calorie restriction in

vii

regulating metabolism via controlling the gene expression at the level of translation in

CR animals.

viii

TABLE OF CONTENTS

Page

ABSTRACT...... vii

LIST OF TABLES ...... xii

LIST OF FIGURES ...... xiii

LISTOFABBREVIATIONS...... xv

CHAPTER

I. INTRODUCTION

1.1. The Process Of Aging……………………………………..…………1

1.2. Calorie Restriction- A Dietary Regimen Known To Extend

Lifespan.……………………………………………………………..6

1.3. Circadian Clocks………………………………………..…………..14

1.4. Protein Translation…………………………………….…..……...... 19

1.5. Fat/Lipid Metabolism And Aging…………………………..………30

1.6. Role Of ACOTs In Fat Metabolism……………………………..….39

II. MATERIALS AND METHODS

2.1. Animal Experiments…...…………………………………..……….45

2.2. Polyribosome Profiling…………………….…………….………....46

2.3. RNA Isolation…………………………………………….….……..46

2.4. RNA-Sequencing………………………………………………..….47

2.5. Western Blotting………………………………………..…………..47

2.6 Quantitative RT-PCR………………………………...……………...47

2.7. KEGG Pathway Analysis…..……………………………………….48

2.8 Analysis Of mRNA Sequencing Library……………………..……..48

2.9. JTK_Cycle Analysis……………………………………………...... 49

2.10. Statistical Analysis…………………………………….………….49

III. CALORIE RESTRICTION INHIBITS GLOBAL PROTEIN

TRANSLATION IN MOUSE LIVER……………………………………..50

3.1. Introduction…………………………………………………….…...50

3.2. Result………………………………………………………..……...51

3.3. Discussion……………………..……………………………………56

3.4. Conclusion………………….………………………..……..………58

IV. CALORIE RESTRICTION REPROGRAMS DIURNAL RHYTHMS IN

PROTEIN TRANSLATION TO REGULATE

METABOLISM…………………………………..…………………………60

4.1. Abstract…………………………..…………………………………60

4.2. Introduction……………………..…………………………………..61

4.3. Results…………………………………..…………………………..63

4.4. Discussion…………………….……………….……...………….....89

4.6. Acknowledgements………………………………………………....99

V. CALORIE RESTRICTION INDUCED ACOTs EXPRESSION IS BMAL1

DEPENDENT……………………………………………………..………..100

5.1. Introduction……………………………………………..…………100

5.2. Results………………………………………………………….….101

5.3. Discussion…………………………………………………………108

VI. CONCLUSION...…………………………………………….……………..106

BIBLIOGRAPHY………………………………………………………………………107

APPENDICES

A. Supplemental Table………………....…………………………..…………..131

B. Supplemental Figure………...…...….……………………..……….…….…132

C. Supplemental Figure ……………………...………………….……..……....134

LIST OF TABLES

Table Page

1. Substrate specificity of mouse peroxisomal ACOTs…………………...……………42

2. Primers for RT-qPCR………………………….…….…………..…………………...48

3. Phase of rhythmicity in translation and transcription for circadian

clock genes…………………………………………………………...……………...131

xii

LIST OF FIGURES

Figure . Page

1-1. Beneficial Effects of Calorie Restriction………………………...……………...... 7

1-2. Circadian clock organization ………………………………...…………………….16

1-3. Molecular clock………………………………………..…………………………...19

1-4. Initiation of translation………………………………..……………………………24

1-5. Mechanism of translation elongation…………………..…………………………..27

1-6. Mechanism of protein translation termination step……….…….………………….29

1-7. Mechanism of Acyl CoA shuttling inside the Mitochondria….……..………...... 33

1-8. Mechanism of β-oxidation……………………………..……….…………………..35

1-9. Structure of animal FASI……………………………….…………………………..36

1-10. Subcellular localization of type I ACOTs………………………..……………….44

3-1. Inhibition of global protein translation in the mouse liver under CR…………...….53

3-2. Method for rate of protein translation quantification……………..………………..54

3-3. Rate of protein translation under 30% CR in mouse liver……………...…………..55

4-1. Schematic representation of experimental workflow………………..……………..64

4-2. Differential translation induced by CR diet………………...……………………....66

4-3. Validation of RNA-Seq data………………………...………………...…………....67

xiii

4-4. KEGG analysis of differentially abundant P-mRNAs under CR…………..………68

4-5. Rhythmic Translation of circadian core clock genes………………...……………..70

4-6. Rhythmic P-mRNAs in the liver polysomes of AL and CR animals……...……….72

4-7. KEGG analysis of rhythmic P-mRNAs…………………………………...………..73

4-8. KEGG analysis of rhythmic P-mRNAs displaying peak abundance at light to dark

and dark to light transition…………………………………………………………75

4-9. Time of the day dependent effect on P-mRNA abundance….…………..…………79

4-10.Time dependent effect of CR on P-mRNA abundance in the liver polysomes of AL

and CR animals…………………………………………………………………….81

4-11. Translation of P-mRNAs involved in the fatty acid metabolism in the liver

polysomes of AL and CR animals…………………………………………………84

4-12. Induced translation of ACOTs under CR…...……....……………...….…………..87

4-13. CR induced reprogramming of fatty acid metabolism...….……...…....…………..98

5-1. ACOT1 induction under CR is Bmal1 dependent…………………...………..…...... 102

5-2. ACOT4 induction under CR is Bmal1 dependent……………...………….………...... 103

xiv

LIST OF ABBREVIATION

Abcd2: ATP-binding cassette, sub-family D (ALD), member 2

Acot1: Acyl-CoA thioesterase 1

Acot3: Acyl-CoA thioesterase 3

Acot4: Acyl-CoA thioesterase 4

Acadl: Acyl-Coenzyme A dehydrogenase, long chain

Acadm: Acyl-Coenzyme A dehydrogenase, medium chain

Acadsb: Acyl-Coenzyme A dehydrogenase, short/branch chain

Acnat1: Acyl-coenzyme A amino acid N-acyltransferase 1

Acnat2: Acyl-coenzyme A amino acid N-acyltransferase 2

AMPK: AMP-activated protein kinase

AL: Ad libitum

Bmal1: Brain and Muscle ARNTL 1

Clock: Circadian Locomotor Output Cycles Kaput

CR: Calorie Restriction

Cry: Cryptochromes

Cyp4a14: Cytochrome P450, family 4, subfamily a, polypeptide 14

Cyp4a10: Cytochrome P450, family 4, subfamily a, polypeptide 10

Cpt1a: Carnitine palmitoyl transferase 1A

Crat: Carnitine acetyltransferase

Cyp2a5: Cytochrome P450, family 2, subfamily a, polypeptide 5

FOXO: Forkhead box

Fmo3: Flavin mono oxygenase

FFAs: Free fatty acids

Fabp1&2: Fatty acid-binding protein 1&2

LCA-CoA: Long chain Acyl-CoA

LCDA-CoA: Long chain dicarboxylic acid Acyl-CoA

Mup1: Major urinary protein 1 mRNA-Seq: mRNA Sequencing

Nr1d1&2: Nuclear Receptor Subfamily 1 Group D Member 2

Per: Periods

PPARα: Peroxisome proliferator-activated receptor alpha

Ppargc1a: Peroxisome proliferative activated receptor, gamma, coactivator 1α

Ppargc1b: Peroxisome proliferative activated receptor, gamma, coactivator 1β

P-mRNA: Polysome associated mRNA

Rorc: RAR-related orphan receptor gamma

xvi

SCN: Suprachiasmatic nucleus

SCDA-CoA : Short chain dicarboxylic acid Acyl-CoA vLCA-CoA: Very long chain Acyl-CoA

xvii

CHAPTER I

INTRODUCTION

1.1 The Process Of Aging

Aging is a complex mechanism where the cell losses its physiological abilities progressively with time, its integrity, decline in functioning, and eventually leads to increased vulnerability to death(López-Otín et al., 2013). Aging is associated with increased incidences of pathological diseases and conditions such as metabolic syndromes, cardiovascular diseases, impaired immunity, cancers, and chronic inflammatory conditions(Mahmoudi and Brunet, 2012). A research paper by Klass

MR.(Klass, 1983), described mutants of C.elegans having longer lifespan, began the new era in the field of aging. Given the complex nature of the aging process, there are various hallmarks of aging. Here I will discuss some well-known hallmarks of aging.

DNA damage and repair:

Aging is associated with damaged nucleic acids along with proteins and lipids accumulated over time inside a cell. Several premature aging syndromes are associated with accumulated DNA damage and repair defects, presenting strong evidence that loss of genomic maintenance may be associated with early aging. Nucleic acids are prone to

damage by either exogenous or endogenous stresses. Exogenous stress includes diet, environment, radiation, and chemicals. DNA damage inside the cell due to various endogenous sources: reactive oxygen species, chemical instability, DNA replication, and repair errors. Both Nuclear, as well as mitochondrial DNA damages are seen to be associated with the age-related phenotype. Normal cells when encountered with irreparable DNA damage, undergo cellular senescence. Cellular senescence is a strategy to suppress the proliferation of cells those who are at higher risk of undergoing neoplastic transformation due to DNA damage. Conversely, senescent cells secrete inflammatory cytokines which cause changes in the tissue microenvironment. The secretion of cytokines is associated with senescent cells having persistent DNA damage but not after transient DNA damage(Rodier et al., 2009). Low-level chronic inflammation is a risk factor associated with many age-related pathologies(López-Otín et al., 2013). Cell senescence also triggers other hallmarks of aging such as stem cell exhaustion, proteostatic dysfunction, and nutrient signaling dysfunction(McHugh and Gil, 2018).

A) Telomere Deterioration:

Nucleoprotein-DNA structures called as Telomeres protect the end of the linear chromosomes. Critically shortened telomere ends introduce cellular senescence, genomic instability, and are related to age related pathologies. Telomeres get shortened with each replication, hence they restrict the number of times a cell can replicate(Barnes, Fouquerel and Opresko, 2018). A special DNA polymerase known as Telomerase is the enzyme involved in the repair of telomeres. Most of the mammalian somatic cells lack this enzyme which explains cumulative and progressive loss of DNA sequences from the

terminal ends of chromosomes. The relation between telomere length and aging has been explored using genetically modified model organisms (7,8). Regulation of the telomerase activity has also been studied in reversing the effect aging(Jaskelioff et al., 2011;

Bernardes de Jesus et al., 2012).

B) Proteostasis:

Dysregulation in the protein homeostasis is linked to many age-related pathologies. Protein homeostasis is being controlled by the variety of pathways and coordination among these pathways: protein synthesis, folding, trafficking, aggregation, disaggregation, and degradation(Powers et al., 2009). Proteostasis mainly involves the stability of the correctly folded proteins by heat shock family proteins and lysosomal and proteasomal protein degradation mechanisms.

Calderwood et al found that synthesis of cytosolic and organelle-specific chaperones is impaired in aging(Calderwood, Murshid and Prince, 2009). The link between chaperone decline and longevity has been studied in animal models.

Overexpression of chaperones extends the lifespan in various organisms. Accelerated aging occurs in mutant mice deficient in the co-chaperone of heat shock protein family, whereas upregulation of heat shock protein has been observed in long lived mice(Walker and Lithgow, 2003; Morrow et al., 2004; Min et al., 2008; Swindell et al., 2009).

The proteolytic process via autophagy and ubiquitin-proteosome system declines upon aging (17,18) Discovery of Rapamycin, a mTOR inhibitor, extends lifespan, triggered tremendous interest in the extension of lifespan studies via inducing the mediators of autophagy (17,19–22). Another macro autophagy inducer, Spermidine, extends lifespan in yeast, flies, and worms(Eisenberg et al., 2009). Activation of autophagy in nematodes on dietary supplementation with ω-6 polyunsaturated fatty acids also extends lifespan(O’Rourke et al., 2013).

Increased expression of various components of ubiquitin-proteosome system upon activation of EGF extends lifespan in nematodes, whereas, increasing the proteasome activity by deubiquitylase inhibitors or proteasome activators, in human cultured cells, enhances the clearance of toxic proteins (Liu et al., no date)(Lee et al., 2010) and replicative lifespan in yeast(Kruegel et al., 2011).

C) Deregulated Nutrient Signaling:

Impaired glucose intolerance and insulin resistance have been observed with advanced age. Whereas, longevity in humans has been associated with a reduced insulin resistance.

Growth hormone (GH) is a hormone secreted from the anterior pituitary gland which acts on the liver and stimulates the production of Insulin-like growth factor 1(IGF-

1). Having the same intracellular signaling pathway, both IGF1 and insulin signaling is known as Insulin and IGF1 signaling pathway (IIS). Mutations that interfere with the action of GH, IGF1, and Insulin action have been observed to extend the lifespan in mice,

flies, and worms(Fontana, Luigi, Partridge L, 2010; Bartke, 2011). Genetic GH deficiency or resistance, in the laboratory mice, which extends the longevity is believed to improve anti-oxidant defenses, increases insulin sensitivity and reduced insulin levels, reduced inflammation and cellular senescence, stress-resistant, and a shift in the metabolism(Bartke and Darcy, 2017). Long-lived Ames dwarf and Snell dwarf mice with hypopituitary function, and GHRKO mice share the common feature of increased insulin sensitivity and reduced levels of insulin(Bartke, 2011). Other than the IIS pathway, mTOR signaling pathway has also been investigated for the extension of lifespan across various organism(Johnson Simon C., Rabinovitch Peter S., 2013)

E). Stem cell exhaustion.

One of the most obvious signs of aging is the decline in the regenerative potential of the tissues. A deficient proliferation of stem cells and progenitor cells result in the failure of long-term maintenance of the organism. Shaw et al., 2010(Shaw et al., 2010) demonstrated a decline in the hematopoiesis with aging resulting in increased incidences of anemia, myeloid malignancies, and diminished production of adaptive immune cells.

Rossi et al., 2007(Rossi et al., 2007) revealed a decline in the cell cycle activity of hematopoietic stem cells (HSCs). Old HSCs were found to be undergoing fewer cells divisions compared to young HSCs. Similar attrition in stem cells has been observed in mouse forebrain(Molofsky et al., 2006), bone(Gruber et al., 2006), and muscle fibers(Conboy and Rando, 2012). DNA damage and accumulation of cell cycle inhibitory proteins have been found to be closely correlated with the above-mentioned functional attrition in the stem cells(Rossi et al., 2007)(Janzen et al., 2006).

On the other hand, excessive stem cell proliferation exhausts stem cell niches and prove to be detrimental. The study by Rera et al.,2011(38), in the intestinal stem cells of

Drosophila, demonstrated premature aging due to excessive stem cell proliferation and exhaustion.

1.2 Calorie Restriction: A Dietary Intervention Known To Extend Lifespan

Calorie restriction (CR) is a dietary intervention which is well known to extend lifespan in various organisms. It delays the process of aging by reducing the incidence of various age-related pathologies, such as cancer, metabolic disorders, and atherosclerosis.

The study by McCay et al(McCay, Crowell and Maynard, 1935), published in 1935, demonstrated the effect of reduced intake of nutrients without malnutrition (CR) on the lifespan of rats. They found increased mean as well as maximum lifespan. Following this study, many researchers implemented the phenomenon of CR in a range of different organisms, such as yeast, Drosophila, nematodes, and mice, with similar results.

CR CANCER CARDIOVASCULAR DISEASES

METABOLIC DISORDERS LONGEVITY

CIRCADIAN CLOCK

Figure 1-1: Beneficial Effects of Calorie Restiction

A) Calorie restriction and yeast lifespan

Yeast has been the simplest model organism to study aging for decades now.

Yeast has played a pivotal role in the discovery of two of the major pathways implicated in aging: mTOR and sirtuin. There are two ways of measuring lifespan in yeast:

Replicative lifespan and chronological lifespan(Longo et al., 2012). Replicative lifespan

(RLS) is the time taken by a cell to produce the last daughter cell in its budding lifespan.

Whereas, chronological lifespan (CLS) is the time it survives since the last daughter cell it reproduced. Extension of RLS in yeast has been studied extensively under calorie restricted diet. Calorie restriction in yeast is implemented by modulating the

concentration of glucose from 2% to 0.5%-0.05% range in the growth media. Sir2 gene has been implicated in the extension of RLS of yeast upon CR. The study by Su-Ju Lin et al published in 2003(Lin et al., 2004) showed that CR decreases NADH levels, a competitive inhibitor of Sir2, and therefore activates Sir2 gene. But later studies demonstrated that the extension of RLS in yeast occurs in Sir2 independent manner(Lamming et al., 2005; Kaeberlein et al., 2006; Tsuchiya et al., 2006; Easlon et al., 2007). These studies lead to a consensus that extension of RLS under calorie restriction can occur in Sir2 dependent and independent manner.

Apart from SIR2 pathway, nutrient-responsive signaling pathways, Ras-PKA, and

TOR/Sch9 have demonstrated to be involved in the extension of RLS under CR.

Signaling through these pathways under CR are known to be reduced. Confirmation of these observations come from the fact that mutations in these signaling pathways are enough to extend RLS in presence of plenty of nutrients, and these mutations along with

CR failed to further extend the RLS(Fabrizio P, Pletcher SD, Minois N, Vaupel JW,

2004; Kaeberlein et al., 2005). These pathways have also been observed to be involved in a similar manner in the extension of chronological lifespan (CLS) in yeast, longevity in worms, flies, and mice(Fontana, Luigi, Partridge L, 2010). Deletion of TOR1 and SCH9 was found to extend lifespan but was not found to be additive with CR(Kaeberlein et al.,

2005). The observation made by Kaeberlein et al(Kaeberlein et al., 2005) that the deletion of TOR1 and SCH9 along with some ribosomal proteins extends yeast lifespan suggested that CR may extend lifespan by regulating ribosomal biogenesis. Steffen et al.,

2008(Steffen et al., 2008) explored the relationship between reduced ribosomal

biogenesis (depletion of 60s ribosomal subunit) and extended RLS, and found that increased RLS due to reduced ribosomal biogenesis is more similar to RLS by CR.

Several mutations that decrease mRNA translation initiation also increased RLS(Longo et al., 2012). Similar observations were also made in C.elegans(Smith et al., 2008). This has led to the idea that TOR dependent regulation of mRNA translation may be a conserved mechanism which links nutrient availability to aging in a diverse range of species. Apart from TOR/SCH9 signaling, AMPK signaling was also found to be implicated in the extension of CLS in yeast(Wierman et al., 2017)

B) Calorie restriction and longevity in Drosophila melanogaster

Drosophila has been studied extensively to understand the process of life extension under dietary restrictions. Lifespan in Drosophila has been reported to be extended by calorie restriction (Metaxakis and Partridge, 2013). Unlike yeast, Drosophila is an aerobe similar to humans which may relate to the accumulated aging related damages observed in humans. Drosophila is also dioecious, hence sex-dependent responses by CR can be investigated. The standard method of implementing Calorie restriction in Drosophila is by altering the availability of yeast and dilution of nutritional components of the food media to which flies have ad libitum access. In laboratories,

Drosophila are feed on a food medium that contains nutritional components which are either dissolved or suspended on an agar gel. Usual nutritional components include sugar, yeast, and corn flour or corn meal. Several laboratories in the past have had unsuccessful

attempts in extending Drosophila lifespan in a variety of fly species by implementing DR

(calorie restriction is referred as dietary restriction (DR) in yeast studies) using intermittent feeding regimen(Le Bourg and Minois, 1996; Carey et al., 2002; Cooper et al., 2004; Piper and Partridge, 2007). These results were interpreted by some researchers as a failure of DR to extend lifespan in flies. An alternate explanation to this observation is that DR in flies has detrimental effects on the lifespan due to an extended period of fasting when fed intermittently. This detrimental effect may be due to lack of specific nutrient needed by flies to survive this extended period of starvation, and thus this could be the reason for the lack of success of DR in Drosophila in extended lifespan.

Interestingly, Partridge et al.(Partridge, Green and Fowler, 1987) in his study, intermittently fed yeast to flies (every sixth day) and constant access to sugar-water. He found that lifespan was extended by some 30% in comparison with flies fed yeast and sugar ad libitum. These results were found to be in contrast of other intermittent feeding studies, where the flies had constant access to water that did not contain sucrose(Le

Bourg and Minois, 1996; Carey et al., 2002; Cooper et al., 2004; Piper and Partridge,

2007).

Five mechanisms have been implicated for the lifespan extension in Drosophila under DR: the cotransporter encoded by Indy, the insulin/IGF-like signaling (IIS) pathway, the Rpd3 deacetylase, the dSir2 (silent information regulator) protein deacetylase and the target of rapamycin (TOR) signaling pathway.

C) Calorie restriction and longevity in C.elegans

CR in C.elegans is often referred to as dietary restriction (DR). CR in C.elegans is implemented by diluting the bacteria, E.coli, which they feed on. Dilution of bacterial density by ten folds, as done by Klass et al(Klass, 1977), have demonstrated lifespan extension of 60%. Thereafter many research studies investigated the possible mechanism behind CR mediated lifespan extension. Reduced TOR signaling is among such mechanisms. The study by Di Chen demonstrated that CR mediated lifespan extension observed in C.elegans is hypoxia-inducible factor-1 (HIF-1) dependent. HIF-1 is a transcriptional factor downstream of a kinase known as ribosomal S6 kinase (S6K), which itself is a downstream target of TOR activity. They observed increased lifespan under CR conditions. They observed lifespan extension in deletion mutant of hif-1 under ad libitum (AL) diet, no further extension in the lifespan was observed when this hif-1 mutant was subjected to CR. When they put hif-1 gain of function mutant under CR, the lifespan extension was diminished suggesting that HIF-1, downstream target of TOR signaling, modulates CR mediated lifespan extension in C.elegans (Chen, Thomas and

Kapahi, 2009).

mTOR is a nutrient-sensing kinase which regulates many cellular processes like protein synthesis, cell growth, and autophagy. Kailiang Jia(Jia and Levine, 2007) have demonstrated that autophagy is required for calorie restriction mediated lifespan extension in C.elegans, by using dietary restricted mutant eat-2 which has a defect in feeding and known to live longer than wild type animals. They knocked down two

autophagic genes, bec‑1 and Ce‑atg7, which are orthologs of yeast ATG6 and ATG7.

Knockdown of these two genes diminished the longer lifespan of eat-2 to that of wild type.

D) Calorie restriction in mammals

CR is well known to delay the process of aging and age-related pathologies and improves metabolism in mammals. Since the first paper published by MacCay in 1935, describing calorie restriction mediated extension of lifespan in rats, many studies have published observing similar effects of CR in mammals. Extension of lifespan under CR is considered a universal paradigm in the field of gerontology. However, the effects of CR are seemed to be dependent on many factors such as strain and sex of the animal.

CR-related increase in lifespan of mice was found to be greater in the non-inbred than in the inbred strains. CR elicited a negative or a weak response in some genotypes of mice and rats(Sohal and Forster, 2014). Variability in CR responsiveness was also noted by McCay et al. as a CR-related increase in lifespan was observed only in calorie restricted male but not in female rats. Liao CY el al studied 41 recombinant inbred strain under 40% CR. He observed that lifespan was shortened in more strains than those in which lifespan extension was observed under 40% CR(Liao et al., 2010).

Due to anatomical, behavioral, and physiological similarities between human and non-human primates, the non-human primates make more appealing model organisms to

get insight into the aging process of humans. Many of the age-associated changes are also observed in rhesus macaques (Macaca mulatta) such as diabetes, neoplasia, sarcopenia, bone loss and immune function(Uno, 1997; Austad and Fischer, 2011).

Two prominent calorie restriction studies that have been done on non-human primates have proved to be more controversial than any other model organism. The study by Wisconsin National Primate Research Center (WNPRC) on rhesus monkey found a significant increase in the lifespan of rhesus monkeys under long-term 30% CR(Colman et al., 2009). On the contrary, the study conducted by the National institute of aging

(NIA) did not find any significant improvement in the lifespan of rhesus monkeys under

CR(Cava and Fontana, 2013). The reason behind this discrepancy between these two studies was attributed to the difference in the design of the study, in the composition of the diet, and the difference in genetic origin of the animals(Colman et al., 2014).

CR in humans has resulted in similar metabolic and molecular adaptation that has been shown to be linked with longevity in animal models according to the data obtained from randomized clinical trials. Metabolic and hormonal factors that are implicated in the pathogenesis of type 2 diabetes, cardiovascular diseases, and cancer are ameliorated by moderate CR treatment in humans(Most et al., 2017).

Various mechanisms have been proposed based on studies in a wide range of organisms for the beneficial effects of CR on the lifespan. However, whether these

mechanisms are conserved in humans and would provide same beneficial results is the interesting question which is still open for a debate.

a. Circadian Clocks

Circadian clocks are entrainable internal biological timekeeping system regulating circadian rhythms in physiological, behavior, and biochemical processes. The disruption of circadian rhythms, in animal models, demonstrated to be associated with the increased incidences of age-related pathologies. Similar consequences of disruption of circadian rhythms have are also associated with human health(Scheer et al., 2009; Li, Li and Wang,

2012; Savvidis and Koutsilieris, 2012; Potter et al., 2016). The clock mutant mice,

Bmal1-/- is well known for accelerated premature aging and reduce life span(Kondratov et al., 2006) suggesting role of circadian clocks in aging. The master clock is situated in the suprachiasmatic nucleus (SCN) of the hypothalamus, whereas peripheral clocks are situated in the peripheral organs. The master clock in SCN take cues from the external light/dark cycles to synchronize internal timekeeping according to the external environment, and this information is passed to peripheral clocks via neuronal and hormonal signals. The SCN consists of a circadian network of neurons and perceives external light signals through the retinohypothalamic tract (RHT). The clock in the SCN is less prone to perturbation due to a high degree of intercellular coupling among neurons. Whereas, based on the synchronization by the SCN via hormonal and neuronal signals, the peripheral clocks are more susceptible to adjustments. For the master clock in

the SCN light is the dominant cue, but peripheral clocks can be reset by the feeding time.

Damiolo et al(Damiola et al., 2000) demonstrated that how feeding time can uncouple and reset the peripheral clock in the liver. Mice are nocturnal animals who consume

~80% of their food in the night time. In this study, the experimental group of mice were provided food only during the daytime or only during the night time, while control animals were fed ad libitum. All animals were kept on 12h light/ 12h dark cycles. Night time fed animals showed mRNA profiles of clock genes in the liver similar to ad libitum animals, but animals fed exclusively during the daytime showed an inversed phase of mRNA levels of core clock genes in the liver. Interestingly, when mRNA levels of clock genes were assayed in the SCN there was no different in the night time fed or daytime fed animals suggesting that feeding regimen can uncouple peripheral clocks from the master clock situated in the SCN.

LIGHT SCN

FOOD

ADIPOSE LIVER MUSCLE TISSUE

Figure 1-2: Circadian clock organization: Master clock situated in the SCN organizes and operates peripheral clocks under its control. Master clock predominantly take cues from the external light to adjust internal timekeeping and send cues through hormonal and neuronal signals to adjust peripheral clocks accordingly. Peripheral clocks, although under the control of master clock in the SCN, can be uncoupled by the feeding cues.

At the molecular level, circadian clock in the SCN and peripheral organs share similar molecular architecture. The molecular clock is an interconnected network of transcription/translation feedback loops which generates approximately 24hrs of circadian rhythms in the gene expression. The main feedback loop is formed by the heterodimer formed by two transcription factors: BMAL1 and CLOCK. The rhythmic binding of BMAL1:CLOCK heterodimer to the DNA promotes rhythmic chromatin modeling ensued binding of other transcription factors adjacent to BMAL:CLOCK (81)

BMAL1:CLOCK induces the expression of their transcriptional activity repressors namely: Period (Per,1Per2, and Per3) and Cryptochromes ( Cry1 and Cry2). PERs and

CRYs forms a heterodimer and translocates to the nucleus and represses the transcriptional activity of BMAL1:CLOCK heterodimer(Ko and Takahashi, 2006).

BMAL1:CLOCK also drive the transcription of Rev Erb (Rev-Erbα and β) , Ror

(Rorα, β and γ), and other clock control genes (ccg)(Sato et al., 2004). Ror and Rev Erb presents another feedback loop. Bmal1 gene in its promoter site contains a ROR responsive element (RER). Ror and Rev Erb compete to bind to the RER on the Bmal1 and generate rhythms in its transcription. Ror drives the transcription of Bmal1, whereas

Rev Erb suppresses Bmal1 transcription.

DEC1 and DEC2, clock-controlled transcription factor, form an additional loop of regulation. The BMAL1:CLOCK heterodimer binds to the Ebox element present in the promoter of DEC1 and DEC2 and induces their transcription. DEC1 and DEC2 suppress the transactivation of BMAL1:CLOCK target genes by direct protein-protein interaction

with BMAL1 or by competing with BMAL1:CLOCK for E box element in their target genes(Honma et al., 2002).

Role of post-translational modifications cannot be excluded in generating 24h rhythms in gene expression. Post-translational modifications such as phosphorylation, acetylation,

SUMOylation, methylation, and ubiquitination(Robinson and Reddy, 2014) play an indispensable role in the robust function of circadian clocks at the molecular level.

Integral core clock proteins are targets for phosphorylation by various kinases and dephosphorylation by phosphatases. These phosphorylation and dephosphorylation events not only regulate the stability but also localization of core clock proteins. Clock proteins are also degraded by ubiquitin-dependent proteasome pathways. In contrast to ubiquitination, SUMOylation regulates other function of clock proteins like protein– protein interactions, nuclear localization, and transcriptional activity and ubiquitination.

Aging bring changes in the central and peripheral clocks resulting in the alterations in the behavior and metabolism. CR is known to delay aging and revert some of the age-related changes. CR regulates gene expression(Katewa et al., 2016; Patel, Velingkaar, et al.,

2016; Astafev, Patel and Kondratov, 2017; Sato et al., 2017) and therefore modulates central and peripheral clocks and CR mediated effects on delayed aging is well conserved among various organisms(Heilbronn and Ravussin, 2003; Lee and Longo, 2016). In this study, I have explored the mechanism of calorie restriction interaction with circadian clocks and regulating the diurnal rhythms in protein translation to regulate metabolism

(Chapter IV).

Ror Rev-Erb

Bmal1 Clock

RER Bmal1

Clock

Bmal1 Clock Bmal1 Clock E box Per Per E box Ror Bmal1 Clock Cry Bmal1 Clock E box Cry E box Rev-Erb

NUCLEUS

CYTOPLASM

Figure 1-3: Molecular clock. At the molecular level, a circadian clock is a network of transcription/translational loops. BMAL1:CLOCK forms a heterodimer and drives the expression of Pers, Crys, Rors, and Rev-Erbs. PER:CRY heterodimer inhibits the transcriptional activity and represses their own expression. Ror and Rev-Erb bind to ROR response element in the promotor site of Bmal1 and regulates its expression.

1.4 Protein Translation

Most biological activities are carried out by proteins inside the cell. The information to generate a protein molecule is encoded in a DNA molecule. This information is conveyed through messenger RNA (mRNA) molecule which latter on

translates into a protein molecule. The correct order of amino acid sequence in a protein joined through a peptide bond, is decoded from mRNAs. This correct sequence of amino acids is essential for the proper folding and in the formation of functionally normal proteins.

Translation is the complete process which results decoding of the nucleotide sequence in a mRNA molecule into correct sequence of amino acids in a protein molecule. In a eukaryotic cell, three types of RNA’s are required for the process of translation to be carried out.

1.4.1 mRNA

The genetic information carried out by mRNA in a form of a nucleotide sequence is read in a set of three adjacent nucleotides in a sequence. This set of three nucleotides is called as a codon. Each codon codes for a specific amino acid during the polypeptide synthesis. There are 64 codons, out of these 61 codons code for amino acids while 3 are known as stop codons signaling the termination of translation. Every amino acid is synthesized by more than one codon but methionine and tryptophan.

mRNA has a specific codon located in its transcription start site known a start codon which is made of nucleotide sequence AUG. This start codon codes for methionine

(initiator) and synthesis of every polypeptide begins with methionine. Three codons that terminate translation are UAA, UAG, and UGA.

1.4.2 Transfer RNAs (tRNA's)

tRNAs are 70-80 nucleotide long molecule responsible for carrying amino acids to the growing end of polypeptide chain when the next codon sequence in the mRNA warrants it. tRNAs contains a codon sequence of its own which is known as anticodon.

This anticodon is complementary to the codon sequence on the mRNA. tRNAs with an amino acid attached to it binds to the mRNA codon with its anticodon and adds a respective amino acid to the growing polypeptide. There are many amino acids which can bind to more than one tRNA, and there are more tRNAs than the number of amino acids used in protein synthesis. tRNAs resemble a cloverleaf like structure when represented in two dimensions. A tRNA molecule has four stems, three out of four have loop structure while the fourth has free 5’ and 3’ end. The 3’ end is known as acceptor arm as it receives amino acid to form an aminoacyl-tRNA molecule with the help of an enzyme known as an aminoacyl-tRNA synthetase. There are 20 different aminoacyl-tRNA synthetase recognizing one amino acid and all its possible cognate tRNA molecules. Once a tRNA is linked with amino acid via a high energy bond it is said to be activated.

1.4.3 Ribosomal RNA (rRNA)

Ribosomal RNA along with a set of proteins called as ribosomal proteins form ribosomes. Ribosomes are made up of a smaller unit (40s) and a larger subunit (60s).

Each subunit has its own set of ribosomal proteins and ribosomal RNA (rRNA). During protein translation, the larger and smaller subunit assembles on the mRNA in a sequential

manner and scan for start codon and thereafter ribosomes decode the nucleotide sequence and catalyze the addition of amino acid into growing polypeptide.

1.4.4 Steps in protein synthesis:

i) Initiation: During initial steps of translation initiation, the smaller and larger ribosomal subunits assemble on mRNA in a sequential manner. This assembly of a ribosome and correct positioning of an aminoacyl-tRNA charged with methionine

(tRNAi met) happens with the help of a set of proteins known as initiation factors (eIF).

Some of these initiation factors are coupled with GTP and hydrolysis of GTP to GDP provides a proofreading step to allow the next step into translation to proceed only if the preceding step was correct. Additionally, phosphorylation of some of these initiation factors can block translation process (85).

Firstly, there is a formation of pre-initiation complex (PIC). The PIC is formed when smaller subunit of ribosome (40s) associates with eIF3, eIF1A, and a ternary complex composed of eIF2-GTP + Met- tRNAi met. The PIC then associates with the

5’cap binding complex known as eIF4 complex. The eIF4 complex is made up of different subunits: eIF4A (helicase activity during scanning), eIF4B (architectural role), eIF4G (binds to eIF3 in PIC), and eIF4E (binds to 5’ cap of mRNA). This complete association of PIC, eIF4 complex and mRNA is called an initiation complex. The initiation complex (IC) then scans the mRNA in the 5’-3’ direction to find the start codon

AUG. Once the correct start codon has been recognized, the eIF2-GTP undergoes hydrolysis to GDP form (proofreading step) followed by dissociation of eIF3 and eIF4

complex. This is an irreversible step which preempts any further scanning. At this step, the 40s subunit unites with larger subunit (60s) associated with eIF6 and eIF5-GTP. The correct assembly of 40s and 60s subunit on mRNA is followed by hydrolysis of eIF5-

GTP to GDP form (another proofreading step which is irreversible), resulting in dissociation of eIF5-GDP and eIF6. This leads to complete assembly of an intact ribosome (80s) over the mRNA. A ribosome has three sites: A site to receive incoming aminoacyl-tRNAs charged with amino acid, P site where polypeptide chain grows, and E site known as exit site. The assembly of ribosome on mRNA happens in such a way that the first donor tRNAi met sits in the P site. The ribosome then decodes mRNA in 5’-3’ direction keep adding new amino acid to the polypeptide chain which is received in the A site(Hinnebusch and Lorsch, 2012).

A B Met 2 GTP C Met 2 GTP

3 1 3 1 3 40s 40s 40s 4 AUG mRNA PIC IC AUG ATP 1 4 mRNA 2 GTP ADP Met + tRNAi met 1 3 2 GDP

Met 2 GTP Met 2 GTP Met 1 3 1 3

40s 40s 1 eIF1A 4 AUG AUG mRNA 5’ PIC IC 2 eIF2

3 eIF3

4 eIF4

D Met

AUG 6 5’

60s + 5 GTP 6 + 5 GDP

Met

AUG 5’ 5 eIF5

6 eIF6

Figure 1-4: Initiation of translation. A) 40s subunit associated with eIF3 joins eIF1A and

met ternary complex of eIF2-GTP- Met + tRNAi to form preinitiation complex (PIC). B) PIC binds to 5’cap structure of mRNA with the help of eIF4 complex. C) PIC scans for start codon

AUG. As the start codon is recognized correctly there follows hydrolysis of eIF2-GTP to GDP form. This is the first proofreading step which is irreversible. D) After the correct recognition of

met start codon and correct binding of Met + tRNAi to its complementary codon on mRNA the 60s subunit associated with eIF6 unites with 40s subunit. This step is catalyzed by eIF5-GTP which is hydrolyzed at the end of this reaction to eIF5-GDP and dissociated along with eIF6 to form the ribosome.

ii) Elongation: At the end of a proper initiation step the Met- tRNAi met is present in the P site of the assembled ribosome. During the elongation process, like initiation step, a

set of proteins are required called as elongation factors (eEFs). According to the codon present in vacant A site, the second aminoacyl-tRNA (aa-tRNA) enters ribosomes as a ternary complex of aa-tRNA and eEF1α bound to GTP. This ternary complex enters the

A site and upon correct binding of aa-tRNA binds its anticodon in A site there occurs hydrolysis of GTP bound to eEF1α. This is followed by the release of eEF1α-GDP. This hydrolysis of eEF1α is yet another proofreading step which occurs only if the correct aa- tRNA binds to A site.

Next, the amino group of amino acid present on A site (bound to its respective tRNA) forms a peptide bond with the methionine present on initiator tRNA (tRNAi Met).

This reaction is catalyzed by the rRNA of the large subunit. Following peptide bond synthesis, the ribosome translocated to next codon towards 3’ end. This step requires eEF2α-GTP. Once ribosome has translocated a distance equal to three nucleotides there occurs hydrolysis of eEF2α-GTP followed by the release of eEF2α-GDP. This is an irreversible step which prevents backward movement of ribosome This results in the shift of the second tRNA with a dipeptide in the P site. This leaves A site vacant for the next aa-tRNA and empty tRNAi shift to E site(Dever and Green, 2012). At the end of the translocation, A site is again vacant and ready to accept a new aa-tRNA.

Met i A B

1 1

2 AUG AUG 5’ 5’ E P A 1α GTP E P A

1α GDP D C 1 1 2 2

2α GTP

AUG 5’ 5’ 1α eEF1α E P A E P A 2α GDP 2α eEF2α

Figure 1-5: Mechanism of translation elongation. (A) After the recognition of the start codon and initiator tRNA with initiator methionine is in P site of the ribosome. (B) The ternary complex of eEF1α-GTP and aa-tRNA enters ribosomal A site and binds to its complementary codon. The correct binding of aa-tRNA at A site is monitored by the hydrolysis of eEF1α-GTP to its GDP form. (C)Peptidyl transferase activity of larger subunit rRNA helps to form the peptide bond between first and second amino acid. (D) The ribosome translocates to next codon. This step is monitored by the hydrolysis of eEF2α-GTP to its GDP form. After translocation, the A site is vacant again to receive next aa-tRNA, whereas, the empty tRNAi is in the E site will exit from the E site in the subsequent new cycle at step (B).

iii) Termination: Termination requires a set of proteins knowns as release factors

(RFs). Two types of RFs have been discovered: eRF1(similar in shape to tRNA) and

eRF3 which is a GTP binding protein. eRF1 recognizes and binds to stop codon in the A site. eRF3-GTP working in tandem with eRF1 help to cleave the peptidyl-tRNA from ribosome and thus polypeptide chain is released.

A B

eRF1

eRF1 UAA eRF3 GTP UAA 5’ 5’ E P A E P A

eRF1 eRF3 GDP C

60S

Figure 1-6: Mechanism of protein translation termination step. (A) When the ribosome reaches a stop codon (UAA, UAG, UGA), (B) eRF1 along with eRF3-GTP enters A site and recognizes the stop codon. (C) This is followed by the hydrolysis of GTP to release eRF3-GDP and eRF1 accompanied by the cleavage of a polypeptide chain from the mRNA in the P site and release of tRNAs and both 60s and 40s subunits.

As discussed earlier, upon aging, dysregulation of protein homeostasis is seen in many diseases. This dysregulation could be caused by a variety of reasons like a discrepancy in protein synthesis, trafficking, folding, aggregation, and degradation. One of the proposed mechanisms for the beneficial effect of CR in delaying aging is the regulation of protein homeostasis. Studies have shown that CR alters proteome homeostasis and reverses the effect of aging(Karunadharma et al., 2015). CR treatment has been demonstrated to be involved in quality control of protein, removal of dysfunctional proteins(Yang et al., 2016), effects on proteasome(Bonelli et al., 2008), and on protein synthesis. Interestingly, there are contradictory claims which have been made on the effect of CR on protein synthesis in the mouse liver(Miller et al., 2013;

Karunadharma et al., 2015). Therefore, I decided to study the effect of CR on protein synthesis in the mouse liver was investigated and will be discussed in chapter III.

1.5 Fat/Lipid Metabolism And Aging

Fat tissue is one of the focal points to investigate pathways involved in longevity, age-related pathologies, inflammation and, metabolic dysfunctions. Upon aging, the body fat redistributes from subcutaneous to intra-abdominal visceral deposits and to ectopic sites like liver, muscle and bone marrow(Zamboni et al., 1997; Denino et al., 2001;

Hughes et al., 2004). These changes in the distribution of fat are linked to the development of diabetes, hypertension, cancer, and atherosclerosis(Guo et al., 1999;

Lutz, Sanderson and Scherbov, 2008). Insulin resistance is one of the hallmarks of aging, and ectopic fat accumulation and insulin resistance have been found to be associated with

elevated oxidative stress and abnormal mitochondrial functioning(Abumrad, Harmon and

Ibrahimi, 1998).

Lipids are not just required to maintain energy homeostasis but also for the physiology of organs, reproduction, and for cellular biology. Lipid metabolism comprises two main sets of metabolic reactions: Fatty acid synthesis and fatty acid degradation (β- oxidation of fats). Dysregulation of either of these processes has been demonstrated to be associated with metabolic diseases and aging(Nguyen et al., 2013; Sanders and Griffin,

2016). Before I discuss the effects of CR on lipid metabolism, it is imperative to discuss the fatty acid synthesis, degradation, and transportation in brief.

1.5.1 Fatty acid degradation (β-oxidation)

Lipids stores energy in form of esters of triglycerols. When energy is required, triglycerides are oxidized to release free fatty acids (FFA). When energy is abundant, free fatty acids are synthesized and incorporated into Triglycerols and these can be stored in adipose tissues.

To burn FFAs as fuel first requires the mobilization of free fatty acids from fat depots. This step requires a set of enzymes known as lipases. These enzymes cause hydrolytic cleavage of triglycerides (TG esterified with fatty acids) to release FFAs. As

FFAs are not soluble in blood plasma, they associate with albumin which serves as a carrier molecule to transport FFAs in the tissues requiring them to consume as fuel. FFAs enters the cell through the cell membrane with the help of transport proteins after dissociating from serum albumin.

A) Activation and shuttling of FFAs into mitochondria

Before FFAs undergo β-oxidation, they must get activated to be able to enter mitochondria. FFAs get activated by reacting with coenzyme A(CoA) to form Acyl CoA.

This reaction is catalyzed by the enzyme called acyl CoA synthetase on the outer membrane of mitochondria. Next, on the outer mitochondrial membrane, Acyl CoA molecule reacts with a carnitine molecule to form Acylcarnitine by the help of enzyme carnitine acyltransferase I (also known as carnitine palmitoyltransferase I). Acylcarnitine thus formed is shuttled through the inner mitochondrial membrane by an enzyme: translocase. In the mitochondrial matrix, with the help of carnitine acyl transferase II and

CoA molecule, Acylcarnitine gets converted back to Acyl CoA molecule.

Mitochondria Acyl CoA 1 CoA Outer Carnitine Membrane CPT1

Acyl Carnitine Inner Membrane

CPT2 3 2 CoA Carnitine CPT1 carnitine acyl tranferase I Acyl CoA Acyl Carnitine Acyl Carnitine CPT2 carnitine acyl tranferase II

Figure 1-7: Mechanism of Acyl CoA shuttling inside the Mitochondria. Acyl CoA, formed by the reaction of FFA and CoA enzyme catalyzed by acyl CoA synthetase, 1) react with carnitine in the presence of CPT1 enzyme located on the outer mitochondrial membrane. As a result, Acyl

Carnitine is formed which moves inside the intermembrane space of mitochondria. 2) Acyl

Carnitine with the help of translocase gets into the mitochondrial matrix. 3) Acyl Carnitine reacts with CoA enzyme in the presence of CPT2 (located on the inner mitochondrial membrane) to release Acyl CoA molecule and carnitine. Carnitine thus formed will move out of the mitochondria for next round of reaction.

B) β-oxidation

In the mitochondrial matrix, degradation of FFA takes place by a repetition of four reactions in a sequence: Oxidation, hydration, oxidation, and thiolysis. In the first reaction, Acyl CoA is oxidized to form enoyl CoA with the help of acyl CoA

dehydrogenase. Next, enoyl CoA undergoes hydration with the help of enoyl CoA hydratase to form 3-Hydroxyacyl CoA. 3-Hydroxyacyl CoA undergoes a second round of oxidation with the help of 3-hydroxy acyl CoA dehydrogenase to form 3-Ketoacyl

CoA. The final step involves cleavage of 3-Ketoacyl CoA by the thiol group of the second molecule of CoA producing one molecule of NADH, FADH2, acetyl CoA and acyl CoA molecule shortened by two Carbon atoms. This step is catalyzed by β- ketothiolase. The shortened Acyl CoA undergoes another cycle of β-oxidation producing more of NADH, FADH2, acetyl CoA and shortened acyl CoA. ATPs are produced when

NADH, FADH2, are oxidized in respiratory chain reactions.

R-CoA

E-CoA R-CoA C(n-2)

H-CoA A-CoA TCA cycle Mitochondrial K-CoA Matrix Ketone Bodies

acyl CoA dehydrogenase enoyl CoA hydratase 3-hydroxy acyl CoA dehydrogenase β-ketothiolase R-CoA Acyl CoA E-CoA Enoyl CoA H-CoA 3-Hydroxy Acyl CoA K-CoA 3-Ketoacyl CoA. A-CoA Acetyl CoA. R-CoA C(n-2) Acyl CoA (shortened by 2 carbon)

Figure 1-8: Mechanism of β-oxidation. Acyl CoA in the mitochondrial matrix undergoes oxidation in presence of acyl CoA dehydrogenase to produce Enoyl CoA. Enoyl CoA undergoes hydration in the presence of enoyl CoA hydratase and generate 3-Hydroxy acyl CoA, 3-Hydroxy acyl CoA further undergoes oxidation in the presence of 3-Hydroxy acyl CoA dehydrogenase to produce 3-Ketoacyl CoA. In the last step, in the presence of β-Ketothiolase, 3-ketoacyl CoA is converted into Acyl CoA (short by two carbons) and acetyl CoA. This acetyl CoA can go into the

TCA cycle and can be used to produce ketone bodies or fatty acids.

1.5.2 Fatty acid synthesis

Fatty acid synthesis occurs in the cytoplasm and starts with acetyl CoA molecule.

This acetyl CoA mainly comes from the metabolism of carbohydrates. Acetyl CoA reacts with HCO3- to form malonyl CoA molecule. This is the committed step in the synthesis of fatty acid which occurs in the presence of acetyl CoA carboxylase enzyme. In eukaryotes, subsequent all the reactions are carried out by a multifunctional dimer of polypeptides known as fatty acid synthase.

FAS I

KS β-ketoacyl synthase AT acetyl transacylase MT malonyl transacylase DH dehydratase ER enoylreductase KR ketoreductase ACP acyl carrier protein TE thioesterase

Figure 1-9: Structure of animal FASI. Represents the structure of animal FASI, modified from

Deepa et al study(Deepa et al., 2011). FASI is a dimer of two identical polypeptide chains containing all the catalytic domains.

The elongation step in the fatty acid synthesis begins after the formation of malonyl CoA. Thereafter, Acetyl CoA reacts with malonyl CoA and following a series of reaction 16 carbon containing palmitate molecule is formed.

Upon aging, the balance between lipolysis and lipogenesis is known to be altered, shifting towards lipogenesis, leading to fat accumulation(Kuhla et al., 2011). CR is known to extend lifespan in various model organisms. Beneficial effects of a diet containing reduced calories suggest that there is some relation between aging and metabolic regulators.

Mice under a lifelong CR demonstrated to have a decreased concentration of systemic triglyceride and systemic LDL/VLDL fraction (Figure2C). These animals

(74weeks) also showed no lipid accumulation in the hepatocytes unlike their age matched

AL controls. In line with this, it was found that lipogenesis was suppressed, and lipolysis was found to be induced in these animals(Kuhla et al., 2014). CR induces a cyclic, diurnal shift in the whole-body fat metabolism. 4-6hrs after the provision of food, mice on CR predominantly are involved in oxidation of carbohydrates and fatty acid synthesis, whereas the prolonged fasting period (18-20hrs) is marked with an increase in fatty acid oxidation Moreover, mice under CR oxidized as many as 4 times more fat than AL animals with three-fold increase in fatty acid synthesis in the adipose tissue(Bruss et al.,

2010). In agreement with these observations, under CR regimen, the expression of genes involved in fatty acid oxidation are known to be induced and those of fatty acid synthesis to be suppressed(Cao et al., 2001; Tsuchiya et al., 2004; Chen et al., 2008; Mulligan,

Stewart and Saupe, 2008). Despite all these observations, the mechanism underlying the metabolic adaption made by the animals under CR regimen is not yet fully understood.

Also, what signals/pathways that hints cell to make a transition from fatty oxidation state

(during 18-20hr fasting) to carbohydrate metabolism and fatty acid synthesis (4-6hrs after feeding) is not well understood as well.

In this study, I have tried to shed some light on the possible mechanism involved in the metabolic adaption of animal physiology to CR. We have investigated the expression of genes involved in fatty acid metabolism at the level of translation (to our knowledge has never been assayed before) and further investigated how a cell regulates its transition from fatty acid oxidation to carbohydrate oxidation state under CR. I have demonstrated that under CR treatment there is induction in the expression of ACOT protein family enzymes. These are enzymes are involved in fat metabolism. I have also hypothesized role of ACOTs in the metabolic adaption to CR and in making a transition from fat to carbohydrate metabolism and vice versa by cells in response to the energy demand and resources available to produce ATP inside the cell. (discussed in detail in chapter IV).

1.6 Role of ACOT protein family in fat metabolism

The ACOT (acyl-CoA thioesterase) family comprised of enzymes that are

involved in the hydrolysis of activated fatty acid molecules (acyl-CoA). As discussed in

the previous chapter, for a fatty acid to enter mitochondria to undergo beta-oxidation,

fatty acid must form an ester with CoA enzyme. ACOT enzymes hydrolyze these esters

of activated fatty acids to release FFA and CoA. In this way, ACOTs help in maintaining

the pool of acyl-CoA, FFAs and CoA enzyme inside the cell. The acyl-CoA thioesterase

family is further subdivided into two types: Type I and Type II. Type I and Type II

members despite of catalyzing the same reaction are structurally not similar. In this

section, I will just be focusing on the Type I ACOTs. Type I ACOTs have been identified

to belong to the α/β-hydrolase fold enzyme superfamily(Brocker et al., 2010).

The human type I ACOTs is comprised of ACOT1, ACOT2, ACOT4, and

ACOT6. These ACOTs share high sequence identity. ACOT1 and ACOT2 are 98%

similar in their amino acid sequence, whereas ACOT4 is 70% similar to ACOT1 and

ACOT2. ACOT6 is 57% similar to ACOT1 and ACOT2, while 54% similar to ACOT4

in terms of sequence identity. ACOT1, ACOT2, and ACOT4 contain hydrolase domain

on N-terminus and an esterase-lipase superfamily domain on the C-terminus which is

responsible for all the catalytic activity(Brocker et al., 2010). This domain is also called

α/β-hydrolase fold). ACOTs have distinct subcellular localization, substrate specificity,

and non-redundant functions. ACOT1 is cytoplasmic and ACOT2 is in mitochondria.

They both act on long chain acyl-CoA molecules but in different cellular organelles.

Whereas, ACOT4 is present in the peroxisomes. ACOT4 uses succinyl-CoA, short-chain

dicarboxylic-CoAs., medium- and long-chain saturated- and unsaturated-CoAs as substrates inside the peroxisomes. ACOT6 is predicted to be cytosolic

A similar situation is found in rats and mouse. In mouse, type I ACOTs contains a total of 6 proteins. ACOT1, ACOT2, ACOT3, ACOT4, ACOT5, and ACOT6. Mouse peroxisomes contain three peroxisomal ACOT enzyme unlike human with just ACOT4.

Human ACOT4 catalyze all the substrate of mouse ACOT3, ACOT4, and ACOT5, and it is proposed that a single peroxisomal ACOT4 enzyme in humans is a result of convergent evolution of human genome where single human ACOT4 has the capability to perform functions of three mouse peroxisomal ACOTs(Hunt et al., 2006). Substrate specificity of each of these mouse ACOTs are mentioned in the following table.

Table 1: Substrate specificity of mouse peroxisomal ACOTs

Protein Substrate

ACOT3 Long-chain acyl-CoAs

ACOT4 Succinyl-CoA, glutaryl-CoA

ACOT5 Medium-chain acyl-CoAs

ACOT6 Phytanoyl-CoA, pristanoyl-CoA

1.6.1 Role of ACOTs in fat metabolism

As discussed earlier, oxidation of fatty acids requires activation of fatty acid molecules with the help of acyl-CoA synthetase to produce acyl-CoA. ACOTs does the opposite of this causing hydrolysis of acyl-CoA to FFAs and CoA enzymes.

ACOT1: FA oxidation produces mild reactive oxygen species (ROS)(C García-

Ruiz, A Colell, A Morales, 1995), and this production of ROS is balanced by the antioxidant activity which protects the mitochondria from oxidative stress(Slimen et al.,

2014). However, when the oxidative stress increases, such as during increased FA oxidation during the period of fasting, the antioxidant capacity could not handle it(Brookes PS, 2005; Murphy, 2009).

ACOT1 is primarily a cytosolic protein in the liver cells. Acot1 gene expression is under the control of a nuclear receptor known as PPARα which binds to the response element present in the Acot1 gene. PPARα is known to drive the expression of genes involved in FA oxidation. Upon fasting, ACOT1 expression is induced both in whole body PPARα knock out and liver-specific PPARα knock out animals. This suggests that

Acot1 expression is induced by fasting and it can occur via PPARα independent mechanism. Moreover, Acot1 knock out animals showed reduced liver triglyceride because of enhanced beta-oxidation. This suggests that ACOT1 is involved in FA trafficking during fasting-induced lipid influx to keep the enhanced oxidative stress, due to increased FA oxidation, inside the mitochondria under a limit. There is a study which supports this interpretation(Franklin, Sathyanarayan and Mashek, 2017). It has been observed that induces expression of ACOT1 reduces the FA oxidation and ROS

production in cardiomyocytes of in the mouse model of diabetic cardiomyopathy (Yang et al., 2012).

ACOT2: ACOT2 is localized in mitochondria and performs the hydrolysis of the long chain acyl-CoA molecules as that of ACOT1 in the cytosol. It has been observed that ACOT2 levels also increase under fasting and ACOT2 enhances beta-oxidation inside the mitochondria. This facilitation of FAO is related to a possible efflux- activation-uptake circuit, where excessive FA released due to increased ACOT2 activity is thrown out of mitochondria. This action may relieve mitochondria from the inhibitory effects of FFAs buildup. These FFAs gets reactivated and up taken inside the mitochondria latter on for beta-oxidation(Moffat et al., 2014).

Peroxisomal ACOTs: The mouse peroxisomes have ACOT3, ACOT4, ACOT5, and ACOT6. Peroxisome plays a very important role in fat metabolism. During the fasting period, there is an influx of FFAs from the adipose tissue inside the liver.

Peroxisome uptake acyl-CoA molecules which are usually unable to mitochondria for beta-oxidation such as very long chain and long-chain fatty acids, dicarboxylic fatty acids, prostaglandins, leukotrienes, bile acid intermediates, thromboxanes, pristanic acid, and xenobiotic carboxylic acids. These lipids undergo beta-oxidation inside the peroxisomes (not coupled with energy production in the form of ATP) and the chain shortened version of these Acyl-CoAs are transported to mitochondria for further beta- oxidation (coupled with energy production). Some of these carboxylic acids are so slowly oxidized that they may sequester CoA enzyme to such an extent that it becomes limiting.

Therefore, to maintain an appropriate pool of CoA enzyme and for hydrolysis of such chain shortened dicarboxylic acid these peroxisomal ACOTs are suggested to play an important role(Hunt et al., 2002).

There are studies which have shown that different ACOTs are induced upon fasting(Moffat et al., 2014; Ellis, Bowman and Wolfgang, 2015; Franklin, Sathyanarayan and Mashek, 2017). I have demonstrated that ACOTs expression is induced under CR regimen which could explain physiological adaption of mice to CR treatment (discussed in chapter IV). I have also demonstrated that this CR mediated induction in the expression of ACOTs is circadian clock protein BMAL-1 dependent (discussed in chapter V).

Cytoplasm

ACOT1 Acyl-CoA FA + CoA

Beta Oxidation Mitochondria ACOT2

Figure 1-10: Subcellular localization of type I ACOTs. ACOT1 is present inside the cytoplasm, whereas, ACOT2 is present inside the mitochondria. Both ACOT1 and ACOT2 act on long chain acyl-CoA molecules. Peroxisomes oxidize very long chain acyl-CoA (VLCA-CoA), long chain dicarboxylic acid (LCDCA-CoA), methyl branch chain containing Acyl-CoA (BA(I)-

CoA, and long chain Acyl-CoA (LCA-CoA). Beta-oxidation inside the peroxisomes of these substrates produces chain shortened acyl-CoA substrates, each peroxisomal ACOT has a substrate specificity. Hydrolysis of these short-chained substrate produces FFAs and CoA enzyme. These

FFAs can then be exported out of peroxisome and then enter into the mitochondria for energy coupled beta-oxidation. This figure is modified from Trends in endocrinology and metabolism(Tillander, Alexson and Cohen, 2017).

CHAPTER II

METHODS AND MATERIALS

2.1 Animal Experiments

All experiments with mice were performed according to the protocol #21141-

KON-AS approved by Cleveland State University IACUC. Carbon dioxide was used as the euthanizing agent followed by cervical dislocation to confirm the death. This method is consistent with the recommendations of the Panel on Euthanasia of the American

Veterinary Medical Association. C57B6/J male littermates were randomly grouped in CR or AL groups and kept at alternate 12:12hrs light and dark periods in groups. At the start of the experiment, all animals were 3 months of age. Control group was fed ad libitum, whereas, Calorie restricted animals were fed a restricted diet with 30% fewer calories with no malnutrition. Both groups received 18% Envigo Teklad (composition protein

18.6%, Fat 5%, and carbohydrate 44.2%). Calories were restricted gradually, a 10% reduction of calorie in the first week, 20% in the second week, and 30% reduction was

started in the third week. Calorie restricted animals received food once per day: 2hrs after the lights were turned off (ZT14). At 5 months of age liver tissues were harvested across a 24-hrs: at the interval of 4hrs and immediately frozen and kept at -80°C for subsequent processing.

2.2 Polysome profiling

Liver tissues were lysed and homogenized using mortar and pestle in a lysis buffer: KCL (2M), HEPES (Ph 7.4), Mgcl2 (1M), DTT (1M), 2% Triton X-100,

Cyclohexamide (20mg/ml), and RNAsin (Promega, N2115). For polyribosomes separation, lysates were loaded on 10-50% sucrose gradient containing KCL (2M), Mgcl2

(1M), DTT (1M), Cyclohexamide (20mg/ml), and HEPES (Ph 7.4). The gradient was centrifuged (4°C and 17000 rpm for 14 hours) using Beckman SW 32.1 rotor. Gradients were collected using ISCO Programmable Density Gradient System at 254 nm using an

ISCO UA-6 absorbance detector.

2.3 RNA Isolation

RNA was isolated from the polysomal fractions using Trizole LS (Ambion Cat#

79852301) according to the manufacturer’s protocol. Equal concentration of RNA from individual polysomal fractions were pooled together. Two biological replicates per circadian time point for AL and CR animals were sent for mRNA-Sequencing. For experiments involving Total RNA: RNA from liver tissues of three or more biological

replicates for each circadian time for was isolated from AL and CR animals using Trizole

(Ambion Cat# 157708) according to the manufacturer’s protocol. Concentration was determined by Nanodrop (Thermo Scientific Nanodrop 2000).

2.4 mRNA-Sequencing

RNA isolated from polysome fractions was sent for mRNA Sequencing to

GENEWIZ, NJ. Libraries were prepared using poly A tail selection and were paired-end and non-strand specific.

2.5 Western Blotting

Lysis of frozen liver was done in cell signaling buffer with protease/phosphatase inhibitor cocktail (Cell Signaling Technology). Bradford protein assay kit from Bio-Rad

(Cat# 500-0006) was used for concentration determination. Total of 30ug protein was loaded equally. Proteins were transferred on PVDF membrane at 110mA for 70 minutes.

Ponceau staining was done to check for the uniform loading of the lysates. Anti-GAPDH antibody (Cell Signaling Technology, Cat#5174) was used as a loading control. To assay, the total levels of ACOT1 and ACOT4 proteins following anti-ACOT1 antibodies

(Abcam, ab133948) and anti-ACOT4 antibodies (Thermo Fisher Scientific, Cat#

PA551453) were used.

2.6 Quantitative RT-PCR

1 ug of RNA was used to make cDNA using Superscript IV reverse transcriptase

(Invitrogen). Quantitative RT-PCR was done using 50ug of cDNA using universal SYBR

Green mix (Biorad Cat# 1725124). 18S was used for normalization of PCR for total mRNA, beta actin was used for normalization of PCR for samples extracted from polysomes. See Table S1 for primer sequences.

Table 2: Primer sequences

Primers Forward Reverse Acot1 CTTGGATAGCTCCAGTTTCCA CTTGGATAGCTCCAGTTTCCA Acot3 CACCGCTACCTGGAATGTAAT CCTTCCAAGCCTCTTTCTAGTC Acot4 CATCCTGGAACTTGCCATGTA GGCCGAGCCTTTAATCCTATC Fmo3 CACCACCATCCAGACAGATTAC CCTTGAGAAACAGCCATAGGAG Serpina 12 CTGGACCCACTGATAAT CCTGACTGGAGAATCATA 18s GCTTAATTTGACTCAACACGGG AGCTATCAATCTGTCAATCCTGTC A Beta Actin CCTCTGAACCCTAAGGCCAA AGCCTGGATGGCTACGTACA

2.7 KEGG Pathway Analysis

KEGG pathway analysis was done using DAVID 6.8 tool. Stable gene ID’s from

ENSEMBL was used for analysis. Pathways were sorted according to p-value < 0.01.

2.8 Analysis Of mRNA Sequencing Library

Fastq raw data files were checked for Quality before and after the removal of adapters using FastQC. Adapters sequences were removed using AfterQC (Chen et al.,

2017). Reads were aligned to the mouse reference genome (GRCm38.p5 Release M15) by the use of STAR aligner (Dobin et al., 2013). All these steps were done using Owens cluster at Ohio Supercomputer Center. Galaxy platform was used for further analysis

(usegalaxy.org.). Read counts were done using HTSeq (Anders, Pyl and Huber, 2015) and differential expression was analyzed using DESeq2 (Love, Huber and Anders, 2014) using default parameters. Differentially abundant read sequences were sorted out with p- value for false discovery less than 0.049, mean base higher than 249, and log2 value equal to or more than +/- 0.7.

2.9 JTK_Cycle analysis

. Normalized read counts generated from DESeq2 (Love, Huber and Anders,

2014) were used for this analysis. Rhythmic association of transcripts with polysomes was Analyzed using JTK_Cycle software from Hughes Lab. p-value less than 0.05 was set as a cut off. Heatmaps were generated using gplots package in Rstudio.

2.10 Statistical Analysis

3 biological replicates for every time point for each diet were used for all PCR and WB experiments (for mRNA Seq data n=2 for every time point for both each diet). Data are shown as average +/- standard deviation. GraphPad Prism software was used for statistical analysis. The AL versus CR effect and time of day effect were tested for significance with two-way repeated ANOVA corrected for multiple comparisons using Bonferroni. p-value < 0.05 was considered to be a statistically significant difference.

CHAPTER III

CALORIE RESTRICTION INHIBITS GLOBAL PROTEIN TRANSLATION IN

MOUSE LIVER

3.1 Introduction

One of the proposed mechanisms behind the beneficial effect of CR on lifespan extension is regulation of proteostasis. Protein and energy metabolism have been long known to be dependent on each other(Cuthbertson, McGirr and Munro, 1937; Butterfield and Calloway, 1984; Todd, Butterfield and Calloway, 1984). Protein synthesis is an energy-dependent process. It is not economical to produce protein during the times of energy deficient state. Surprisingly, there are reports suggesting an increase in protein synthesis and transcription of genes involved in protein turnover in animals subjected to

CR (Lewis SE, Goldspink DF, Phillips JG, Merry BJ, 1985; B.J.Merrya, A.M.Holehana,

S.E.M. Lewisb, 1987). Male Sprague Dawley rats under 50% CR from 3 weeks of age was reported for increased whole body protein turnover(Lewis SE, Goldspink DF,

Phillips JG, Merry BJ, 1985). Male Wistar rats on a 40% CR was reported to have decreased protein turnover in liver and skeletal muscle but is maintained in heart

(Yuan et al., 2008). On the hand, there is a study which demonstrated that there is no increase in the rate of protein synthesis under CR condition. In this study, Male B6D2F1 male mice were kept under 40% CR for 6 weeks period and assayed mixed protein levels in liver, skeletal muscles, and heart(Miller et al., 2013). They found no difference in the protein synthesis in the CR and control groups (AL-fed) of animals. Whereas,

Karunadharma PP et al (Karunadharma et al., 2015) found that under 40% CR diet in female mice the protein synthesis is inhibited. They performed polysomal profiling and found reduced ribosomal loading under CR diet. They also observed that under CR not only protein synthesis burden and damage is reduced but CR also increased the quality of the liver proteome. One thing which stands out in all these studies is that time of the tissue collection was not given importance. Depending on the time of the day protein synthesis may well show daily changes. Also, different strengths of CR diet used may also have influenced the outcome in these studies and so as the sex and species of the rodent animals used as model organisms. Therefore, I decided to investigate the effect of

30 % CR on the global protein synthesis in C57BL/6 male mice using comprehensive circadian experimental setup.

3.2 Result

3.2.1 30% CR inhibits global translation in the male mouse liver.

2 months old male mice were put under 30% CR treatment. Treatment was carried out for 3 months. At 5 months of age animals were sacrificed at 6 different time points

(refer to experimental set up) and liver tissue was harvested. Polysomal profiling, one of the standard techniques used to assay actively translating mRNA’s, was performed on the liver lysates of CR and AL animals. I observed that ribosomal loading (denoted by the number of polysomal peaks) was reduced, at multiple time points across the 24hr cycle, and rate of translation of protein translation was inhibited in CR animals at most of the time points (Figure 3.1). The rate of protein translation is represented as the ratio of the area under the polysomal region to monosome as shown in Figure 3.2. The rate of protein translation for CR animals was significantly higher only at ZT18: 4hrs after the food was provided.

A ZT2 ZT6 ZT10

Time (sec)

UV Absorbance (A254nm)AbsorbanceUV Time (sec) UV Absorbance (A254nm)AbsorbanceUV UV Absorbance (A254nm)AbsorbanceUV Time (sec) Top Bottom Top Bottom Top Bottom

B ZT14 ZT18 ZT22

Time (sec) Time (sec) UV Absorbance (A254nm)AbsorbanceUV UV Absorbance (A254nm) Absorbance UV Time (sec) UV Absorbance (A254nm) Absorbance UV Top Bottom Top Bottom Top Bottom

AL CR

Figure 3-1: Inhibition of global protein translation in the mouse liver under CR.

Representative image for the result s obtained from after polysomal profiling done on three or more biological replicates for every individual time point. 10-50% sucrose gradient was used to fractionate polysomes. “Top” on X-axis represents 10% sucrose at the top of the centrifuge tube, whereas “Bottom” represents 50% sucrose at the bottom of the tube. Red line denotes CR animals, whereas, black line denotes AL animals. (A) Profiles for time points across the day. Red arrows (ZT6) represents subsequent peaks for 40s, 60s and monosome (80s) followed by peaks for polysomes. (B) profiles for the time points in the actively feeding period across the night.

Food was provided to CR animals at ZT14. Light bar represents the light phase and black bar

represents the dark phase. ZT is the Zeitgeber time (Light id on at ZT0 and off at ZT12). n=3 for every time point for each diet.

UV UV absorbance (254nm)

Time (sec)

Figure 3-2: Method for rate of protein translation quantification. Ratio of the area under the curve for polysomal region (yellow) to the monosomal region (green) was calculated to analyze the rate of protein translation.

* * * * 1

P/M Ratio,

AUC

0 0 4 8 12 16 20 24

AL CR

Figure 3-3: Rate of protein translation under 30% CR in mouse liver. Using the method described in figure 3-2, rate of protein translation was calculated for CR and AL animals from the data presented on Figure 3-1. Light bar represents the light phase and black bar represents dark phase. X-axis displays the Zeitgeber time of the day (Light is on at ZT0 and off at ZT14). n = 2 for every time point for each diet. * represents statistical significance, p<0.05.

3.3 Discussion

CR is a dietary intervention known to delay aging and extend lifespan in a range of organisms. Among many proposed mechanisms for the beneficial effect of CR on the lifespan is regulation of proteostasis. Upon aging, there is a dysregulation in the protein homeostasis. Studies have shown that CR not only improves the half-life of proteins but prevents damages and regulates quality control mechanisms, and protein synthesis.

However, various studies which investigated the effect of CR on the protein synthesis presents a murky picture. According to some reports, protein synthesis is increased under

CR, while others claim CR to have no effect on the protein synthesis or inhibition of protein synthesis. I will discuss here a few possible reasons for such discrepancies among various studies on the effect of CR on protein translation.

Firstly, the thing which stands out from these reports is that effect of CR on the protein translation may well be a tissue-specific phenomenon. A study performed in male

Wistar rats has documented decreased protein turn over in the liver and skeletal muscle but no effect on heart muscle under 40% CR(Yuan et al., 2008). Similarly, no changes were observed in the lung tissue in the rats(Goldspink DF1, 1988).

As I have already discussed in chapter 1.2, the effect of CR on the lifespan, in some cases, has found to be sex and strain specific. Studies which investigated the rate of protein synthesis in mouse liver of different genders have reported CR effects which are

not in agreement(Miller et al., 2013; Karunadharma et al., 2015). Therefore, the possibility of CR having a different effect on the protein synthesis despite extending lifespan in different strains cannot be excluded.

Thirdly, the discrepancies could also have resulted because of technical issues.

Reports, where CR is reported to increase protein synthesis, have used flooding doses of essential amino acid tracers to track protein synthesis. Studies have found that flooding doses of essential amino acid could activate mTOR signaling involved in the protein synthesis. The flooding doses used in these reports were over two times of what is required in humans and rats to stimulate protein synthesis.

Lastly, an important factor, which most of these reports had not taken into the account is the time of the day of tissue harvesting. Depending on the time of the day when the tissue is harvested, protein synthesis can appear to be increased or decreased.

Therefore, I decided to investigate the effect of CR on the protein synthesis in the male mouse liver across a 24hr cycle. I selected only male mouse to exclude the gender- specific effects. We harvested liver tissues across a 24hr cycle at 6 different time points at the interval of 4hrs. To assay the global protein synthesis, we performed polysome profiling. As can be seen on the figure 3-3, the rate of global protein synthesis was inhibited at multiple time points with reduced ribosomal loading, in agreement with the previous report(Karunadharma et al., 2015). However, the rate of synthesis was significantly high at one-time point i.e. ZT18 for CR. Therefore, based on these results it

can be said that depending on the time of the day, the rate of protein synthesis changes, and hence results can seem confounding and counterintuitive if the attention of the tissue harvesting time is not paid full attention, as seen in earlier reports.

The peak observed at ZT 18 under CR diet is four hours after the food was provided. This peak in the rate of protein synthesis in CR animals could have following possible explanations: 1) it is a response to periodic feeding, 2) it is a consequence of reduced calories, and 3) it could be a result of combined effect of reduced calories fed in a periodic feeding. To test these possible reason warrants to set up with this experiment in animals who are fed unlimited food in a time restricted periodic manner for 12hrs (TR

12hr). If the peak at ZT18 still persists in TR 12hr group of animals that would suggest that it is a consequence of periodic feeding.

3.4 Conclusion:

Different claims were made by earlier reports on the effect of CR on the rate of protein synthesis in the mouse liver. These reports did not pay attention to the time of the day of the tissue collection, and I believed this could be one possible reason for the discrepancy in the observations made by these reports. I assayed the effect of CR on global protein translation across the 24hr cycle and found that the rate of protein synthesis was significantly downregulated at multiple time under CR. However, the rate of protein synthesis was found to be significantly higher in CR animals at ZT18: 4hr after the food was provided. This explains that the rate of protein synthesis can be interpreted

incorrectly as increased or decreased depending on the time of the day. Therefore, this type of experiments warrants a comprehensive circadian experimental setup across a 24hr cycle to get complete details of a biological process.

CHAPTER IV

CALORIE RESTRICTION REPROGRAMS DIURNAL RHYTHMS IN PROTEIN

TRANSLATION TO REGULATE METABOLISM

Abstract

Calorie restriction (CR) reprograms circadian rhythms in gene expression, affects the circadian clocks and delays aging. To expand circadian mechanisms in CR, I assayed polysome associated mRNAs in the liver of mice fed ad libitum (AL) and CR diets to analyze rhythms in the protein translation. Less than 1% of transcripts were found to be differentially abundant in the polysomes across the day under CR diet (all the replicates of CR were collectively compared to that of AL replicates). In contrast, when CR and AL diets were compared at individual times throughout the day, a large differential was detected. Transcripts found to be rhythmic under AL lost their rhythms upon CR treatment, and a new cohort of transcripts gained rhythms under CR. Only a small fraction of transcripts, including the circadian clock genes, were rhythmic under both diets. Thus, CR strongly reprograms translation. The bioinformatical analysis revealed that CR has a major impact on lipid metabolism. CR affected the translation of enzymes of acyl-CoA thioesterase (ACOT) family which regulates the metabolism of very long

chain, long chain, and Acyl-CoA molecules containing dicarboxylic group.

Induced expression of ACOT’s upon CR resulted in the increased transcriptional activity of PPARα, a transcriptional factor which regulates fat metabolism, and is regulated by

ACOT products. Therefore, I propose that the differential translation induced by CR led to a temporal partition and reprogramming of metabolic processes and provided a link between CR, lipid metabolism, and the circadian clock.

4.1 Introduction

There are accumulating evidence on the possible interplay between feeding, aging process, and the circadian system (Chalasani et al., 2012; Froy, 2013; Asher and Sassone-

Corsi, 2015; Chaudhari et al., 2017; Manoogian and Panda, 2017). In mammals, the circadian system consists of circadian clocks operating in a hierarchal network. A central clock is situated in the suprachiasmatic nuclei (SCN) which controls circadian clocks situated in the peripheral organs. At the molecular level, clocks are composed of several transcriptional factors that regulate the activity and expression of each other (Ko and

Takahashi, 2006). There are a dozen core clock genes which are essential for the circadian clock to operate. The circadian rhythms generated by the clocks play an important role to synchronize the physiological processes inside the organism that allow better adaptation to the periodic environment by orchestrating gene expression, metabolic processes, and cell signaling. Disruption of these rhythms in animal models leads to metabolic syndromes and later to the development of diabetes, cardiometabolic pathology, and cancer by significantly affecting many metabolic processes such as

glucose, fat, and redox homeostasis. Importance of the circadian clocks and rhythms have been known to have implications on human health as well. Disruption of circadian rhythms by environmental factors, as evidenced in shift workers, increases the risk of development of similar diseases (Scheer et al., 2009; Li, Li and Wang, 2012; Savvidis and Koutsilieris, 2012; Potter et al., 2016).

Aging is associated with changes in the central and peripheral clocks. These changes are manifested by alterations of circadian rhythms in the behavior and metabolism. Calorie restriction (CR) is known to delay aging and lifespan extension in a variety of organisms (Heilbronn and Ravussin, 2003; Lee and Longo, 2016) and affects circadian clocks. CR regulates circadian rhythms in gene expression in behavior, thus regulating central and peripheral clocks, and the effect is conserved between flies and rodents (Katewa et al., 2016; Patel, Velingkaar, et al., 2016; Acosta-Rodríguez et al.,

2017; Astafev, Patel and Kondratov, 2017; Sato et al., 2017). Circadian clocks are master regulators of metabolism (Bass, 2012), and it was speculated that some of the beneficial outcomes of CR are due to the CR mediated regulation of circadian clocks (Froy, 2013;

Chaudhari et al., 2017). A recent analysis, in the liver and skeletal muscles of young and old mice under AL or CR diets, identified a significant reprogramming of the circadian transcriptome by aging and CR (Sato et al., 2017; Solanas et al., 2017) providing further insights on the importance of the interaction between biological clocks, diet, and aging.

To study the effects of CR on metabolism, multiple high-throughput analyses such as transcriptomic, proteomic, acetylomic and metabolomic analysis have been

performed in different tissues and organisms including primates (Swindell, 2009; Jové et al., 2014; Rhoads et al., 2018). Interestingly, only a little congruency was found between transcriptome and proteome (Maier, Güell and Serrano, 2009), suggesting the significance of post-transcriptional regulation such as RNA processing (Rhoads et al.,

2018), or regulation of protein translation in the CR mechanism. To further understand how organism physiology adapts to CR and establish a mechanistic connection between the CR induced changes in the expression and metabolism, I studied the effect of CR on differential translation. Association of mRNAs in polysomes is a good reflection of active translation (Chassé et al., 2017; Dermit, Dodel and Mardakheh, 2017; S.Iwasaki, 2017). I assayed the polysome association of mRNAs (P-mRNAs) in the liver of mice on AL and

CR diets across the day using polysome profiling followed by RNA-seq. This study has revealed novel genes that were not previously implicated in CR mechanisms, such as enzymes involved in long-chain Acyl-CoA metabolism. Significant changes were also found in the translational for many transcripts whose products are known to be associated with CR such as components of insulin, AMPK, and FOXO signaling pathways

(Anderson and Weindruch, 2010). My study provides insights into the mechanism of CR explaining CR induced effects on physiology. It also underlines the importance of the interaction between circadian clocks and translational machinery as a mechanism of adaptation to dietary challenges by the organism.

4.2 Results

4.2.1 Effect of CR on differential mRNA translation in the liver

Actively translated mRNAs are associated with polysomes (Chassé et al., 2017;

Dermit, Dodel and Mardakheh, 2017; S.Iwasaki, 2017). To investigate the effect of CR on differential protein translation, polyribosomes were isolated from livers of wild type mice on AL and CR diets. Liver tissues were harvested at 6-time points across a 24hr cycle with intervals of 4hrs, sucrose density gradient was used to fractionate ribosomes

(Figure 4-1). mRNA sequencing was performed on RNA samples extracted from polysomes (P-mRNAs) as illustrated in

Figure 1A.

Figure 4-1: Schematic representation of experimental workflow. Liver lysates of AL and CR were fractionated and polysomal fractions were used for P-mRNA isolation. This was followed by mRNA-Sequencing.

P-mRNAs for 26,913 genes were found in polysomes. To assess the effect of CR on the mRNA translation across the day, all the biological replicates of CR collectively were compared with AL replicates. The abundance of 134 P-mRNAs was found to be

induced in the polysomes, whereas the abundance of 149 P- mRNAs were found to be downregulated under CR (Figure 1B). This accounted for only about 0.1% of transcripts

(the cut off was set to 1.6-fold change) manifesting differential association with polysomes in the liver of mice on CR and AL diets (Figure 1B and C).

CR/AL MA plot Diet: CR/AL

134 149 2

0 logfold change -2

Downregulated Upregulated 1e-02 1e+00 1e+02 1e+04 1e+06 mean of normalized counts

Figure 4-2: Differential translation induced by CR diet. A) Differential abundance of P- mRNA in the liver polysomes upon CR treatment. B) MA plot, X-axis represents fold change, Y- axis is normalized mean count. Every dot represents a gene. Red dots are genes significantly changed under CR treatment.

P-mRNA sequence reads mapped to DNA regions mainly coding for mRNA.

Reproducibility for mRNA sequencing data was high (Figure 4-3A and B). RNA-seq data validation was done using quantitative real time PCR on same mRNA samples, as used for RNA-Sequencing. Polysome associated mRNA from all the biological replicates of

CR collectively were compared with AL replicates to detect the levels of Fmo3 and

Serpina12 (Figures 1A). I found induced polysome association for Fmo3 and decreased for Serpina12 (Figures 1B) which is in good agreement with their RNA-sequencing data.

PCR on several other transcripts confirmed the reproducibility of RNA-Seq data (see late

Figure 7). Therefore, I was confident in my RNA-Seq data.

m-RNA- Seq RT-qPCR

6 Fmo3 Serpina12 9 Fmo3 Serpina12 3 * 24

4 2 6 18 12 2 1 3 *

6 Log2 Fold change Fold Log2

0 change Fold Log2 0 0 0 Relative Relative Expression, a.u. AL CR AL CR Relative Expression, a.u. AL CR AL CR

Figure 4-3: Validation of mRNA-Seq data. A) mRNA-Seq data for Fmo3 and Serpina12. B)

RT-qPCR data for Fmo3 and Serpina12.

KEGG pathway analysis was performed using publicly available DAVID bioinformatic database. Retinol, metabolic, and steroid metabolism were among the top pathways enriched under CR (Figure 4-4).

CR/AL

9 9 21 12 21

18 55 17 14 16 Retinol metabolism Chemical carcinogenesis Steroid hormone biosynthesis Complement and coagulation cascades Arachidonic acid metabolism Drug metabolism - cytochrome P450 Metabolic pathways Metabolism of xenobiotics by cytochrome P450 Staphylococcus aureus infection

Figure 4-4: KEGG analysis for differentially abundant P-mRNAs under CR.

4.2.2 Rhythms in translation of circadian clock genes under AL and CR diets

Studies have demonstrated, ours and others, that mRNAs for core circadian clock genes oscillate under both AL and CR diets , and CR has been found to induce the expression of several genes in the mouse liver (Patel, Velingkaar, et al., 2016; Astafev,

Patel and Kondratov, 2017), Drosophila fat-body, and head (Katewa et al., 2016). I was interested in analyzing the effect of CR on the rhythmic abundance of P-mRNAs for several core circadian clock and clock-controlled genes. JTK algorithm software was used for this purpose. P-mRNAs for most of the clock genes (Clock, Bmal1, Per1, Per2,

Cry1, Nr1d1, Nr1D2, and Rorc) were associated with polysome in a rhythmic manner under both diets (Figure 4-5). P-mRNAs for Cry2 were arrhythmic under AL and CR.

Time-dependent induction was observed in the P-mRNAs for Per1, Per2, Cry1, and

Cry2. The phase of P-mRNAs as in a good agreement with the phases of the rhythms for the appropriate mRNAs (Astafev et al., 2017, See also S1_TABLE). Thus, for most of the clock gene transcripts, CR induced changes in transcript abundance were the driving force for the changes observed for their polysome association under the CR diet.

Importantly, CR did not affect the phases of clock gene expression, confirming that the food for the CR group was provided in the physiologically most appropriate time for feeding.

Clock Cry1 Cry2

2 3 3

2 2 1 1 1

0 0 0 ZT 0 4 8 12 16 20 24 Relative Relative Expression, a.u. 0 4 8 12 16 20 24

Relative Relative Expression, a.u. ZT ZT0 4 8 12 16 20 24 Relative Relative Expression, a.u.

Per2 Per1 Bmal1 3 8 3 6 2 2 4 1 2 1 0 0 0 0 4 8 12 16 20 24

ZT 0 4 8 12 16 20 24 ZT Relative Expression, a.u. 0 4 8 12 16 20 24

Relative Relative Expression, a.u. ZT Relative Relative Expression, a.u.

Rorc Nr1d1 Nr1d2 4 3 4 3 3 2 2 2 1 1 1 0 0 0

Relative Relative Expression, a.u. 0 4 8 12 16 20 24 Relative Relative Expression, a.u. Relative Relative Expression, a.u. ZT 0 4 8 12 16 20 24 ZT ZT 0 4 8 12 16 20 24 AL CR

Figure 4-5: Rhythmic Translation of circadian core clock genes. P-mRNAs abundance of core clock genes in the liver polysomes of AL and CR animals.

4.2.3 Rhythmic polysomal association of transcripts in the liver of mice on AL and

CR diets

JTK algorithm was used to identify rhythmically translated P-mRNAs. Under AL condition, 1180 P-mRNAs were found to be translated rhythmically (Figure 4-6A, B and

C), and 1541 P-mRNAs were found to be translated rhythmically under CR conditions.

Interestingly, about the same percentage of P-mRNAs were rhythmically abundant in the liver polysomes under AL and CR diets i.e. 4.7% P-mRNA on AL, and 5.7% P-mRNA on CR, however, lists of P-mRNAs was very different from each other. A small fraction

of 234 P-mRNAs (about 1% of the total number (26,913) and about 20% of rhythmic under AL) were rhythmic under both dietary conditions (Figure 4-6A & D) Thus, most of the rhythmically translated P-mRNAs under AL diet became arrhythmic after CR diet.

Whereas, an equally large group of new P-mRNAs became rhythmic under CR treatment.

Recently it was reported that CR reprograms the circadian transcriptome in the mouse liver, and the number of genes which were rhythmic under AL only partially overlaps with the list of genes rhythmic under CR (Sato et al., 2017). Thus, like the effect of CR on the transcriptome, these results suggest that circadian translatome was also significantly reprogrammed under CR.

AL CR

1180 234 1307

Common AL CR AL CR

ZT 2 6 10 14 18 22 2 6 10 14 18 22 ZT 2 6 10 14 18 22 2 6 10 14 18 22

Figure 4-6: Rhythmic P-mRNAs in the liver polysomes of AL and CR animals. A) P-mRNAs rhythmic exclusively under AL, under both diets, and exclusively under CR. B) Radar diagram displaying the phase distribution of rhythmic genes. Numbers at the periphery of the radar represents the time of the day and on the circle represents the number of P-mRNAs rhythmic. C) Heat map for the distribution pattern and peak abundance of all the rhythmic P-mRNAs rhythmic under AL or CR.

D) Heat map for the distribution pattern and peak abundance of all the rhythmic P-mRNAs rhythmic under both AL or CR (234 P-mRNAs).

KEGG pathway analysis of these rhythmic P-mRNAs revealed a significant shift

in rhythmic biological processes induced by CR. As it is illustrated in Figure 4-7A,

transcripts that were rhythmically translated exclusively under AL diet were involved in

the ribosomal protein synthesis, which is in the agreement with previously reported

circadian rhythms in ribosome biogenesis (Jouffe et al., 2013) and translation (Atger et

al., 2015). The circadian rhythm was one of the main pathways that were enriched under

both AL and CR diets. (Fig 4-7B). AMPK signaling pathway was enriched for P-mRNAs

rhythmic exclusively under CR diet (Figure 4-7C) and may contribute to well reported

CR induced improvement in glucose homeostasis (Canto and Auwerx, 2011). Non-

Alcoholic Fat Liver Disease pathway was another pathway which was enriched for

rhythmically translated P-mRNAs under CR diet (Figure 4-7C), which is in agreement

with well-documented changes in fat metabolism upon CR (Chalasani et al., 2012;

Hernandez-Rodas, Valenzuela and Videla, 2015). Thus, the data on changes in the

rhythmic translation of various transcripts exclusively under AL or CR diets suggest that

translation was reprogramed to fit metabolic needs of the organism.

A C AL COMMON C L om R 4 8 Circadian mo rhythm

Metabolic n47 pathways

Cysteine and 27 methionine metabolism

Ribosome

20 24 Non-alcoholic fatty liver disease (NAFLD) 17 16 26 Huntington's disease Metabolic pathways 12 Glyoxylate and dicarboxylate metabolism 17 CR Protein processing in endoplasmic reticulum 19 Parkinson's disease 104 Spliceosome 21 8 PPAR signaling pathway AMPK signaling pathway Oxidative phosphorylation Alzheimer's disease

Figure 4-7: KEGG analysis of rhythmic P-mRNAs. A) Enriched pathway for P-mRNAs exclusively rhythmic under AL. B) Enriched pathway for P-mRNAs rhythmic under both diets.

C) Enriched pathway for P-mRNAs exclusively rhythmic. under CR. ZT is the Zietgeber time

(ZT0 is the time when light was on and ZT12 is the time when light was off).

For both diets, the peak of rhythmic P-mRNA abundance was around light/dark and dark/light transition i.e. at ZT14 and ZT2 (Figure 4-6B &C). For AL animals, KEGG analysis revealed that circadian rhythm and fat metabolism pathways (Figure 4-8A) were enriched at ZT2 and at ZT14 ribosomal protein synthesis pathway was enriched (Figure

4-8B). For CR animals, at ZT14, TCA cycle, oxidative phosphorylation, and metabolic pathways were among the significantly enriched pathways (Figure 4-8C). Protein processing endocytosis and pathways were enriched at ZT2 upon CR but not shown, as they fall above cut off p-value of 0.01.

AL ZT2 AL ZT14

Fatty acid metabolism 4 5 Biosynthesis of 51 unsaturated fatty acids

4 Circadian rhythm

Ribosome

CR ZT14

5 5 Huntington's disease 7 18 Metabolic pathways 10 Ribosome 13 Parkinson's disease 7 50 Oxidative phosphorylation 15 Biosynthesis of amino acids Non-alcoholic fatty liver disease (NAFLD) 13 Biosynthesis of antibiotics 10 15 13 14 Cysteine and methionine metabolism Alzheimer's disease Carbon metabolism Glyoxylate and dicarboxylate metabolism Citrate cycle (TCA cycle) Peroxisome

Figure 4-8: KEGG analysis of rhythmic P-mRNAs displaying peak abundance at light to dark and dark to light transition. A) Enriched pathways at AL ZT2. B) Enriched pathways at

AL ZT14. C) Enriched pathways at CR ZT14. ZT is the Zeitgeber time (ZT0 is the time when light was on and ZT12 is the time when light was off).

For rhythmic P-mRNA under both diets (Figure 3D), I investigated the effect of the CR on their phase, amplitude, and daily average. I found that for most of the rhythmic transcripts CR did not change the phase: peaks for 178 (76%) transcripts were not shifted or shifted by only 2hrs, peaks for 38 transcripts were phase shifted by 4hrs, and for 18 transcripts by 6 and more hours (See Fig S1). For 11 transcripts, the daily average abundance was increased upon CR by 1.5-fold or more, and for 37 transcripts, the daily average abundance was reduced by 1.5-fold or more. 1.5-fold increase and decrease in rhythm amplitude was observed for 47 and for 30 transcripts, respectively.

As discussed as earlier, I observed some rhythmic P-mRNAs under both diets

(234 P-mRNAs) demonstrating that CR did not have effect on their rhythmicity across a

24hrs cycle, however, closer examination of these P-mRNAs revealed CR induced changes in their rhythmic profiles: changes in the phase, amplitude, and daily average.

The examples illustrating this CR induced changes in the rhythm, phase, amplitude, and daily average are presented in figure S2.

4.2.4 CR significantly changed temporal translation in the liver

In the previous section, I analyzed the effect of CR diet on the Rhythmically

(circadian) translated transcripts. However, arrhythmic transcripts might also be affected by CR, but these changes could be missed in the analysis presented in Figure 4-2. The transcripts translated during the light (rest) and dark (active) phase of the day might be different. To understand the effect of just time of the day as well time-dependent effect of

CR on the differential translation, I compared the P-mRNAs abundance in the liver polysomes of AL and CR animals at all six individual time points across a 24hrs cycle of the day. In this analysis, I did not differentiate between rhythmic and arrhythmic P- mRNAs.

Firstly, the effect of time on P-mRNA abundance within the liver polysomes of

AL and CR animals was analyzed (Figure 4-9A). For both diets, at every time point of the day, different pathways were enriched. Interestingly, the circadian times can be clustered based on the number of differentially abundant P-mRNAs between them. For

AL diet, ZT2 and ZT22 formed a group with a low number of P-mRNAs different between these times (only 49 transcripts are different) (Figure 4-9A); ZT6, ZT14, and

ZT18 formed another group (the numbers of differential transcripts are 69, 11 or 3 as shown in Figure 4-9A). The number of P-mRNAs differential was big between these two groups (259 for ZT14 versus ZT22 and 993 for ZT22 versus ZT18 as shown in Figure 4-

9A). Differential abundance analysis was made between these groups followed by KEGG analysis. 900 P-mRNAs were differentially abundant between these two groups. The most significant pathway enriched for these differential abundant P-mRNAs was ribosomal protein synthesis. I further dissected this cohort of P-mRNAs found to be involved in ribosomal biogenesis coding for ribosomal subunit proteins. The translation of all P-mRNAs was significantly downregulated at time points ZT22- ZT2 in comparison to the group formed by time points ZT6-14-18 in AL animals. Some notable ribosomal proteins whose translation was downregulated were RPS6 and RPL13. Other pathways enriched between these two clustered groups were oxidative phosphorylation,

Non-alcoholic fatty liver disease, and spliceosome (Figure 4-9B). ZT10 group was

moderately different from the above-clustered groups in AL animals. (No significant pathways were enriched upon a comparison between AL ZT10 with clustered formed by

AL-ZT2, ZT6, ZT14, ZT18, and ZT22 time points). Similarly, for CR animals, low number of P-mRNAs were differentially abundant in liver polysomes between ZT2, ZT6,

ZT10 and ZT 22. Thus, these time points formed one group (except for the difference between ZT2 and ZT6 – 379 as shown in Figure 4-9A). The second group was formed by

ZT14 (time of feeding) and ZT18 (4hrs after feeding). The ZT14-ZT18 group showed high numbers of P-mRNAs different from ZT2 (>1500) and ZT22 (several hundred as shown in Figure 4-9A). The difference between ZT14 & ZT18 and ZT6 and ZT10 groups was modest (Figure 4-9A). 681 P-mRNAs were differentially abundant between ZT2-

ZT6-ZT10-ZT22 and ZT14-18. The most significant pathway was ribosomal subunit protein synthesis. The translation of ribosomal subunit protein was upregulated at ZT14-

ZT18. P-mRNAs coding for RPS6 and RPL13 were the notable examples whose translation was upregulated. Other enriched pathways were oxidative phosphorylation, and enzymes involved in ribosomal biogenesis were among the enriched pathways

(Figure 4-9C). Interestingly, the number of P-mRNA differentially abundant was also high between ZT14 and ZT18 (738 transcripts Figure 4-9A). These P-mRNAs were found to be involved in Insulin signaling, Insulin resistance, and AMPK signaling (Figure

4-9D).

CR/AL ALZT6-14-18/22-2

7 9 Ribosome 23 66 24 Oxidative phosphorylation 21 Huntington's disease 41 18 Parkinson's disease Alzheimer's disease 47 Proteasome Non-alcoholic fatty liver disease (NAFLD) 131 40 Metabolic pathways 40 Spliceosome 35 19 RNA transport Epstein-Barr virus infection RNA polymerase Biosynthesis of antibiotics Fatty acid metabolism CRZT 2-6-10-22 / 14-18 CR ZT18/14

Protein processing in 10 16 Ribosome 13 9 25 endoplasmic reticulum 71 15 Metabolic pathways 27 Oxidative phosphorylation 20 Insulin signaling pathway Parkinson's disease AMPK signaling pathway 32 Huntington's disease 11 13 93 Insulin resistance 35 Alzheimer's disease 14 Glucagon signaling pathway 38 Non-alcoholic fatty liver 34 16 disease (NAFLD) 20 PPAR signaling pathway Cardiac muscle contraction

Ribosome biogenesis in eukaryotes

Figure 4-9: Time of the day dependent effect on P-mRNA abundance. A) P-mRNAs differentially present in the liver polysomes of AL and CR animals at different times of the day

(Blue for AL animals and Red for CR animals). Time dependent effect of CR on differential P- mRNA are shown in black boxes. B) KEGG analysis for differential P-mRNAs between group

AL ZT6-14-18 vs AL ZT22-2. C) KEGG analysis for differential P-mRNAs between group CR

ZT2-6-10-22 vs CR ZT14-18. D) KEGG analysis for differential P-mRNAs between group CR

ZT18 vs CR ZT14. Light and dark bar at the top represents light and dark phase of the day. ZT is the Zeitgeber time (ZT0 is the time when the light was on and ZT12 is the time when the light was off).

To analyze the time-dependent effect of CR on translation, I compared AL and

CR animals at every time followed by KEGG pathway analysis to find unique pathways enriched at every time points across the day resulted after CR treatment. I found that there is a significant effect of the diet on the translation at every time point. The translation for many mRNAs was found to be increased or decreased (Figure 4-10A). The largest difference in P-mRNA abundance between CR and AL group was found to be at

ZT2; these differentially abundant transcripts are involved in fatty acid metabolism and biosynthesis of unsaturated fatty acids (Figure 4-10B). Differentially abundant P-mRNA numbers were also high at ZT14 and were involved in oxidative phosphorylation and

Non-alcoholic fatty liver disease (Figure 4-10C). For ZT22, pathways enriched were biosynthesis of amino acids and 2-oxocarboxyllic acid metabolism (Figure 4-10D). The minimal difference between the diets was observed at ZT6 (Figure 4-10A). Unique pathway enriched after the comparison between CR and AL animals at ZT6 was ascorbate & aldarate metabolism, at ZT10 it was inflammatory mediator regulation of

TRP channels, and at ZT18, cardiac muscle contraction pathway was enriched.

CR /AL CR ZT2/AL ZT2

400 5 9 318 Fatty acid metabolism 5 300 267 270 Prion diseases 7 216 6 Staphylococcus aureus infection 200 173 Linoleic acid metabolism 136 6 8 92 Fatty acid elongation 100 77 68 8 50 25 35 Biosynthesis of unsaturated fatty acids 0 Steroid biosynthesis ZT2 ZT6 ZT10 ZT14 ZT18 ZT22 Phenylalanine metabolism Downregulated Upregulated

CR ZT14/AL ZT14 CR ZT22/AL ZT22

Non-alcoholic fatty liver disease 13 16 4 Biosynthesis of amino Oxidative acids phosphorylation

14 Parkinson's disease 14 8 2-Oxocarboxylic acid 14 Alzheimer's disease metabolism

Huntington's disease

Figure 4-10: Time dependent effect of CR on P-mRNA abundance in the liver polysomes of AL and CR animals. A) Time-dependent differential abundance of P-mRNAs under CR. Red bars for induced abundance, while Black bars for suppressed P-mRNAs abundance in the liver polysomes. B)

Pathways enriched at ZT2 after CR treatment. C) Pathways enriched at ZT14 after CR treatment. D)

Pathways enriched at ZT22 after CR treatment. ZT is the Zeitgeber time (ZT0 is the time when light was on and ZT12 is the time when light was off).

4.2.5 CR regulated the translation of enzymes regulating long chain Acyl CoA

metabolism

As shown in Figure 4-1D, Lipid metabolism pathways were the most enriched pathways that were affected by CR. In agreement to this finding, changes in the expression of many genes involved in lipid metabolic under CR have been reported

(Kulkarni, Armstrong and Slitt, 2013; Park et al., 2017). I observed similar effects of CR on the P-mRNAs that were discovered to be involved in lipid metabolism. Interestingly, there was an enrichment of transcripts involved in long-chain Acyl-CoA metabolism.

Importantly, many of these transcripts were not previously associated with CR. Fatty acid binding proteins (FABP) are lipid chaperons that regulate lipid transport and availability

(Furuhashi and Hotamisligil, 2008). Under CR, reduction in P-mRNA for the liver- specific Fabp1 and no change for Fabp2 P-mRNA was observed (Figure 4-11 A & B).

Transport of FAs into mitochondria is regulated by Carnitine acyltransferases. P-mRNA for Cpt1a (Jogl et al., 2004, preferentially transport long chain FAs) was increased at the late stage of fasting period (Figure 4-11 C), whereas, increase in P-mRNA for Crat

(Hsiao et al., 2004, preferentially transport short chain) was observed after the feeding

(Figure 4-11D). The rate-limiting step in the beta-oxidation of fatty acids in mitochondria is regulated by the enzymes from Acyl-CoA dehydrogenases family (Swigoňová,

Mohsen and Vockley, 2009). I observed induction of P-mRNA for Acadl and Acadm

(specific for long chain and medium Acyl-CoA, Figure 4-11E &G), but not for Acadsb

(specific for short chain Acyl-CoA, Figure 4-11F). N-acyltransferases (BAAT, ACNAT1, and ACNAT2), inside the peroxisomes, conjugate acyl CoA molecules with glycine and

taurine and releases CoA-SH. Substrates for ACNAT1 are long chain and very long chain

Acyl-CoA molecules, whereas, substrates for ACNAT2 are not yet known(Hunt, Siponen and Alexson, 2012). Acnats P-mRNAs were induced at several time points (Figure 4-11H

&I). Acyl-CoA thioesterase (ACOT) enzymes hydrolyzes Acyl CoA molecules to release free fatty acids and CoA-SH (Hunt et al., 2006; Brocker et al., 2010; Ellis et al., 2015).

Strong time-dependent induction in the P-mRNA for Acot1, 3 and 4 (Figure 4-11J-L) was observed, and these enzymes act on long chain Acyl-CoAs, succinyl-CoA, and glutaryl-

CoA (Yang et al., 2012; Hunt et al., 2012). The expression of other family members was not significantly affected. Interestingly, ACOTs and ACNATs compete for the same substrate inside the peroxisomes. Apparently, the peak induction in the P-mRNA for

ACOTs was at the end of the rest period, and for ACNAT1 at the end of the active period. Thus, CR significantly changed the translation of several rate limiting enzymes involved in very long and long chain Acyl Co A metabolism, and the effect of CR on enzymes involved in short chain Acyl CoA metabolism was minimal.

Figure 4-11: Translation of P-mRNAs involved in the fatty acid metabolism in the liver polysomes of AL and CR animals. (A & B) P-mRNA abundance of fatty acid binding proteins. Fabp1 and Fabp2 in the liver polysomes of AL and CR animals. (C & D) P-mRNA abundance of Acyltransferases, Cpt1a and Crat. (E-G) P-mRNA abundance of Acyl-CoA dehydrogenases, Acadl, Acadsb, and Acadm. (H-I) P-mRNA abundance of N-acyltransferases: Acnat1 and Acnat2. (J-L) P- mRNA abundance of Acot1, Acot3, and Acot4. Light and dark bar at the top represents light and dark phase of the day (n=2 for every time point for each diet). ZT is Zeitgeber Time (light is on at ZT0 and light is off at ZT12).

4.2.6 CR induced the translation of proteins from ACOT family

Based on the observation I made in the earlier section, I decided to investigate the effect of CR on the expression of ACOT proteins. First, I confirmed the results of RNA-

Seq for Acots by doing PCR on polysomal fraction. None of the P-mRNAs were found to be rhythmically associated with polysomes in AL animals. Under CR, only P-mRNA for

Acot4 turned out to be rhythmically abundant in liver polysomes. CR has following effects on the Acot P-mRNAs: time of the day-dependent induction (maximum at ZT14) and phase shift (Figure 4-12A- C). Under CR, all three Acots peaked at ZT14, while under AL, Acot1 and Acot3 peaked at ZT2, and Acot4 peaked at ZT10. Under CR, the mRNA expressions for Acots were also affected (Figure 4-12D- F), mRNA was significantly induced with no change in the peak expression for all the three Acots. Acots

P-mRNA levels to some extent correlated with the corresponding mRNA abundance.

However, P-mRNAs for all three, Acot1, Acot3 and Acot4, peaked at ZT14 under CR

(Figure 4-12A-C), whereas, corresponding mRNAs reached peaks at different times:

ZT14 for Acot1, ZT10 for Acot3 and ZT14 for Acot4 under CR (Figure 4-12D- F). I performed western blotting, for ACOT1 and ACOT4, to further investigate if changes in

P-mRNA abundance could be reflected on total protein levels. The expression of ACOT proteins was significantly induced by CR, in agreement with the increased translation.

(Figures 4-12G-J). P-mRNA abundance profile for Acots does not exactly match up with the total protein expression profile. This difference could be due to a difference in the half-life of proteins in AL and CR animals. In addition, it is important to mention

ACOT1 and ACOT2 share high sequence homology and almost the same molecular

weights, therefore, it possible that ACOT1 antibody probed for both ACOT1 and ACOT2 proteins. Similar is the case with ACOT3 and ACOT4 protein and their antibody.

A Acot1 B Acot3 C Acot4 15 30 * 8 * * 6 10 20 * 4 * 5 10 2

0 0 0

Relative Expression, a.u. Expression, Relative Relative Expression, a.u. Expression, Relative ZT 0 4 8 12 16 20 24 ZT 0 4 8 12 16 20 24 a.u. Expression, Relative ZT 0 4 8 12 16 20 24 D E F Acot1 Acot3 Acot4 15 * * 25 * 6 * 20 * 10 * 4 * * * 15 * * * 5 10 2 5

0 0 a.u. Expression, Relative 0 Relative Expression, a.u. Expression, Relative Relative Expression, a.u. Expression, Relative ZT 0 4 8 12 16 20 24 ZT 0 4 8 12 16 20 24 ZT 0 4 8 12 16 20 24 G AL CR H ACOT1 3 2 6 10 14 18 22 2 6 10 14 18 22 * * ACOT1 2 *

1 GAPDH 0 Relative Expression, a.u. Expression, Relative ZT 0 4 8 12 16 20 24 I AL CR J ACOT4 2 2 6 10 14 18 22 2 6 10 14 18 22 * * * * * ACOT4 1

GAPDH

0 Relative Expression, a.u. Expression, Relative ZT 0 4 8 12 16 20 24

AL CR

Figure 4-12: Induced translation of ACOTs under CR. (A-C) P-mRNA abundance of Acot1, Acot3, and Acot4 as assayed by RT-qPCR in the liver polysome of CR and AL animals. Beta actin gene was used as a control. Beta Actin gene was used as a control. (D-F) mRNA expression of Acot1, Acot3, and Acot4 in total RNA from the liver of CR and AL animals. 18s gene was used as a control. (G) Total ACOT1 protein level, assayed by western blot, in the liver of CR and AL animals. GAPDH protein was used as a loading control. (H) Quantification of ACOT1 protein levels. (I) Total ACOT4 protein level, assayed by western blot, in the liver of CR and AL animals. GAPDH protein was used as a loading control. (J) Quantification of ACOT1 protein levels. Three biological replicates (n=3 for every time point for each diet) were analyzed. Two-way ANOVA was performed using GraphPad prism for statistical analysis and p-value < 0.05 was considered significant. * - statistical significant difference.

4.2.7 CR induced the rhythms in PPARα transcriptional activity

Cytoplasmic ACOT1 inactivates acyl-CoA molecule after removing CoA enzyme and release free fatty acids (FFAs). Some of these FFAs serve as ligands to PPARα and regulate its transcriptional activity, therefore, increased ACOT1 expression under CR could result in increased PPARα transcriptional activity. To test this hypothesis, I analyzed the expression of mRNAs for PPARα and its target genes (Figure S2). Cyp4a14 is a member of cytochrome P450 superfamily and a known target of PPARα.

Upregulation of Cyp4a14 mRNA level (Figure S2A) was observed under CR. Cyp4a14 expression was significantly upregulated under CR according to RNA-Seq data as well.

P-mRNA level (Figure S2B). PCR assay on the polysomal fraction (Figure S2C) confirmed the RNA-seq data finding for Cyp4a14 (Figure S2B). Interestingly, Acots are also transcriptional targets of PPARα. As earlier demonstrated, induced expression of

Acots mRNA (Figure 4-12D-F) also confirms induced transcriptional activity of PPARα.

Figure S2D-J illustrate changes in P-mRNAs for several other known PPARα targets. As it was expected, the P-mRNAs for Abcd2, Cyp4a10, and Cyp2a5 were induced and for

Mup1 was suppressed under CR (Rakhshandehroo et al., 2010; Gachon et al., 2011;

Mandard et al., 2004). P-mRNAs of PPARγ co-activators was also investigated:

Ppargc1a and Ppargc1b transcripts. P-mRNAs were induced at ZT10 for Ppargc1a, and

ZT6 for Ppargc1b by CR. Thus, ACOT1 expression might be one of the contributing factors behind CR induced activity of transcriptional factor PPARα.

4.3 Discussion

To expand on the molecular mechanisms of CR and circadian clock interaction polysome profiling in the liver of mice on AL and CR diets across the day was performed

(Figure 4-1A). The analysis revealed the following major impacts of CR on liver metabolism. Firstly, I observed that under CR, the translation of clock gene transcripts was driven probably mainly by the abundance of their respective mRNA abundance. This observation comes from the fact that the mRNA abundance profile for these genes is broadly in agreement with the P-mRNA profile for the corresponding clock gene. Thus, it can be said that CR did not cause any disruption of the rhythms in circadian clock genes. most likely because the food was provided during the physiological active period.

However, CR completely altered the circadian output in translation. Although almost similar fractions of P-mRNAs were rhythmic under AL (4.7 %) or CR (5.7 %) diets, the list of these genes was totally different. Only a small fraction of transcripts (234 P- mRNAs) was rhythmic (rhythmically abundant in liver polysomes) under AL and CR diet

(Figure 4-1B). Atger et al. recently studied the difference in the ribosomal associated transcripts for the night time-restricted feeding and AL diets in the mouse liver (Atger et al., 2015). They observed an increased amplitude in the rhythm. However, they did not report any significant change in the pattern of the rhythms, in contrast to my study.

Therefore, CR induced changes in circadian rhythms in P-mRNAs are very different from the effect of time restricted feeding.

What is the driving force for the observed rhythms in P-mRNAs? Recently, it was reported, by Atger et al 2015, that about 70% of rhythmically transcribed mRNAs are also rhythmically associated with ribosomes in mouse liver, under AL diet (Atger et al.,

2015). Another recent analysis of circadian hepatic transcriptome revealed about 1900 genes that oscillate exclusively under AL diet and 4000 genes oscillate exclusively under

CR diets. They also found 2300 genes that oscillated under both AL and CR diets (Sato et al., 2017). Thus, more than 50% of total transcripts found to be rhythmic under AL were rhythmic under both diets. Apparently, In my study, less than 20% of polysomal transcripts rhythmic under both AL and CR diets. At least some of these changes in polysomal transcripts induced by CR are expected to be a direct consequence of the changes in transcriptome, and other mechanisms might exist as well. For example, CR did not induce changes in P-mRNA for Clock, however, it was reported that under CR there is downregulation of clock mRNA. (Figure 4-2A). Thus, an additional level of regulation of Clock gene expression exists at the level of translation. Of note, I cannot directly compare my data with Sato et al., 2017 due to difference in age of mice (22 weeks in my study versus 46-56 weeks in Sato), duration of the CR (2 months in my study versus 6 months in Sato et al), and time of feeding (ZT14 in my study versus ZT12 in Sato et al.).

Another important change mediated by CR is the effect on the translation of p- mRNAs involved in different metabolic pathways. KEGG analysis revealed numerous signaling pathways in which these observed rhythmically translating P-mRNAs were involved (Figure 3E-J). These changes are in agreement with known changes in physiology induced by CR: for example, changes in AMPK signaling are in agreement with improved glucose metabolism under CR (Larson-Meyer et al., 2006; Long and

Zierath, 2006; Weiss et al., 2006; Canto and Auwerx, 2011). Another noticeable pathway

enriched was ribosomal protein synthesis (Figure 3F & I). Ribosomal protein synthesis was rhythmic under AL which resonates with previously reported circadian rhythms in ribosome biogenesis (Jouffe et al., 2013). These rhythms were proposed to be an important driving force for rhythms in translation (Sinturel et al., 2017). CR is known to change protein homeostasis, however, there is a controversy on the CR mediated changes in protein synthesis (D’Costa et al., 1993; Miller et al., 2013; Karunadharma et al.,

2015). In my study, under CR diet, rhythms in ribosomal protein synthesis was ceased.

The ribosome biogenesis is an energy consuming process and ceased rhythms in ribosomal protein synthesis suggest that under conditions of limited resources, cells adopt different strategies to regulate translation and this warrants further investigation.

Interestingly, the recent study in the liver of rhesus monkey on the effect of CR on transcriptome and proteome revealed significant changes in ribosomal gene expression, but transcript and protein data were found to be not in agreement (Rhoads et al., 2018).

My data demonstrate that under CR there is regulation of ribosomal proteins at the level of translation, thus, providing a potential reason for the discrepancy observed in the above-mentioned study.

To analyze the effect of CR diet on the differential translation, we made a global comparison between AL and CR P-mRNAs in the liver polysomes. A small number of P- mRNAs (283) were differentially translated across the day, and KEGG analysis revealed these mRNAs to be involved in metabolic pathways such as retinol and steroid hormone synthesis (Figure 4-1B, C, and D). While only a small number of P-mRNA were differentially translated, significantly higher number of P-mRNAs were differentially

translated when analyzed for every circadian time: for example, 585 transcripts were differentially translated between AL and CR at ZT2 (Figure 4-10A).

Circadian times affected the translation of P-mRNAs in the liver polysomes irrespective of the type of diets: for example, 2021 transcripts were differentially translated between ZT2 and ZT14 for CR and 1226 transcripts were differentially translated between ZT2 and ZT18 for AL (Figure 4-9A). Therefore, CR caused temporal partition of metabolic processes through differential translation of P-mRNAs involved in various metabolic pathways across the day. For example, P-mRNAs linked with oxidative phosphorylation were differentially translated between ZT2 and ZT14 for CR

(Figure 4-9C), this is the time when liver may predominantly dependent on fat as an energy source. While P-mRNAs for insulin signaling were enriched at ZT18, time when carbohydrates are utilized predominantly to produce ATP (Figure 4-9D). CR mediated effects on energy metabolism are well reported. Multiple transcriptome analyses have demonstrated that CR cause changes in transcription of the components of the TCA cycle, mitochondria electron transport chain (Anderson and Weindruch, 2010). My study presented an additional level of regulation energy metabolism and provided further mechanistic links through temporal control of differential translation.

Another time of the day dependent effect was observed in ribosomal subunit protein synthesis in the liver of AL and CR animals but with a different kinetics. It was revealed that in AL animals, translation of ribosomal subunit protein was downregulated between ZT22-ZT2, whereas, upregulated between ZT6-ZT18 circadian time of the day

(I made a comparison between AL ZT6-14-18 group with AL ZT22-2, see Figure 4-9B).

Interestingly, ZT22 & ZT2 are time points when animal is making a transition from active to rest period (ZT22- last few hours of the dark period, ZT2- beginning of day period). As they are not actively feeding during the resting period, the translation of ribosomal protein synthesis is downregulated probably due to lack of energy resources.

While the translation of ribosomal protein synthesis was upregulated during the feeding period i.e. ZT6-ZT-14-ZT18 (ZT6 is a time during the rest period. It is possible that the major difference in translation upon comparing AL ZT6-14-18 & AL ZT22-2 group is just coming from times ZT14 and ZT18, or AL animals may be consuming some amount food during ZT6 as well). It can be speculated that for most circadian times, liver of AL animals is involved in protein translation via regulating ribosomal biogenesis and this can explain higher global protein translation in AL animals, see Figure 3-3). For CR animals, the situation is rather clearer, with upregulation of ribosomal protein synthesis from ZT14 till ZT18, an active feeding period for CR animals (ZT14-time when food is provided, see

Figure 4-9C). For most of the circadian times, the translation of ribosomal protein synthesis was downregulated and upregulated only from ZT14 till ZT 18 which can very well explain the only peak seen in global protein translation for CR animals, see Figure 3-

3).

In Drosophila and mammals, CR is known to induce changes in lipid metabolism

(Katewa et al., 2016). My study revealed strong effect of CR on long chain Acyl-CoA metabolism suggesting that the effect is evolutionary conserved. I identified type I

ACOTs as potential targets of CR (Figure 4-11J-L). ACOTs are enzymes that hydrolyze

Acyl-CoA to release CoA enzyme and free fatty acids. Acots expression is known to be regulated by different diets: high fat diet, ketogenic diet and fasting (Ellis et al., 2015;

Tognini et al., 2017). It was reported that the Acot1 mRNA expression is induced during fasting and decreased in response to feeding (61). The increased mRNA expression for

Acots cannot be simply explained by response to fasting. In our study, under CR diet, the expression is high at ZT18 (after the feeding) and low at ZT6-10 (fasting state). Thus, there is a difference in the regulation of Acot1 expression between CR and fasting. CR induced the abundance of both mRNAs and P-mRNAs for Acots (Figure 4-12A-F).

Acot1-6 genes form a cluster located on mouse chromosome 12. PPARα and by bZip transcriptional factors are known to regulate the expression of this whole cluster and it was proposed that these clustered genes are expressed in synchrony(Gachon et al., 2011).

The increased mRNA expression might be a consequence of the increased PPARα activity. However, the changes observed in the P-mRNAs of Acots were not exclusively an outcome of changes in their mRNA abundance. As can be seen on Figure 4-12A-C, peaks in P-mRNAs is different between AL and CR animals, although peaks of Acots mRNA (Figure 4-12D-F) were not different in the liver polysomes of AL and CR animals. As well, the phase shift observed, in P-mRNA of Acots but not in their corresponding mRNAs between AL and CR suggests that CR additionally regulates the expression of some of the Acots (no changes in P-mRNAs of Acot2, 5 and 6 were observed) at the level of translation. Interestingly, recently it was reported that Acot1 expression in the liver can be induced in PPARα independent manner (61). Also, regulation at the level of protein stability cannot be excluded as there is no absolute correlation between changes in ACOT protein level and appropriate P-mRNA. Thus, I

proposed that CR regulates Acots expression on several levels: transcription, translation, and protein stability.

To explain the CR induced changes in ACOT expression I proposed the following explanation. (Figure 4-13). ACOT3 and ACOT4, inside the peroxisomes, is involved in the hydrolysis of long chain acyl-CoA (LCA-CoA) and short chain dicarboxylic acyl-

CoA (SCDA-CoA). These LCA-CoA and SCDA-CoA are produced in the peroxisomes after the beta-oxidation of very long chain acyl-CoA (vLCA-CoA) and long chain dicarboxylic acyl-CoA (LCDA-CoA). This beta-oxidation is not coupled with ATP production. The hydrolysis of LCA-CoA and SCDA-CoA inside peroxisome, by ACOT3

(LCA-CoA) and ACOT4 (SCDA-CoA), releases free fatty acids (FFAs) and CoA enzyme. These long chain FFAs are exported from peroxisomes, gets activated in the cytoplasm using the cytoplasmic pool of CoA enzymes to generate activated long acyl

CoA. These activated long acyl CoA are transported into mitochondria by long chain acyl

CoA specific carnitine palmitoyl transferase 1 (CPT1). CR induced abundance of Cpt1 P- mRNA is also in agreement with this explanation (Figure 4-11C). In mitochondria, the beta-oxidation of activated long acyl CoA is coupled with ATP production. Interestingly, the P-mRNA of rate-limiting long chain acyl CoA dehydrogenases (ACADL) enzyme was also observed to be induced under CR (Figure 4-11E). Thus, under nutrient-limited conditions, coordinated increased expression of peroxisomal ACOTs and mitochondrial enzymes help to utilize substrates that are not oxidized inside the mitochondria for ATP production. Importantly, peroxisomal enzymes from ACNAT family as well use Acyl-

CoA molecules as substrates to produce Acyl-taurines(Hunt, Siponen and Alexson,

2012). However, their translation occurs in antiphase with Acots: Acots peaked at ZT10-

ZT14, and Acnats peaked at ZT22-ZT2. Therefore, their translation is timely partitioned to reduce the competition for similar substrate.

ACOT1, localized in the cytoplasm, is known to regulate at fat metabolism(Franklin, Sathyanarayan and Mashek, 2017). Under CR diet, mice consume the provided food in 2-3 hours, therefore, and fast for about 21 hours. During the fasting period in the liver, fatty acids are used for β-oxidation and to generate ketone bodies. For these processes, fatty acids must be activated (converted to Acyl-CoA), but hydrolysis of

Acyl-CoA into inactive free fatty acid by CR induced ACOT1 seems counterintuitive. I propose the following explanation for this observation: During fasting, significant influx of free fatty acids may result in the increased accumulation of activated fatty acid molecules inside mitochondria compromising β-oxidation, hence compromising the efficiency TCA cycle to produce ATP. ACOT1 limits the supply of Acyl-CoA molecules available for β-oxidation and keep this process in synchrony with the demands of the

TCA cycle and giving enough time for the oxidative phosphorylation complex to adjust accordingly. Suppressed translation of lipid chaperon FABP1 (Furuhashi and

Hotamisligil, 2008) under CR, involved in FAs transport into the liver, supports this idea of ACOT1 limiting the supply of activated fatty acids to mitochondria (Figure 4-11A).

When an animal is about to receive food, the liver must prepare to burn carbohydrates to produce energy. High level of Acyl-CoA during this time would impair glycolysis

(Parvin and Dakshinamurti, 1970) and interfere with glucose uptake and limit metabolic flexibility at the time when liver must switch from fat to carbohydrate metabolism.

Therefore, ACOT1 prepares the liver for the consumption of carbohydrates when animals are expecting food. ACOT1 may also be responsible for replenishing the levels of CoA for smooth running of glycolysis upon receiving food. Finally, products of ACOT1 enzymatic activity i.e. FFAs, serve as ligands for PPARα regulating its transcriptional activity. In support of this, I observed increased polysome association of mRNA for several well-known targets of PPARα (Figure S2). The increased PPARα activity regulates fat metabolism by inducing gene expression of genes involved in fat metabolism. The potential importance of ACOTs in CR mechanisms is coming from the observation that mice with significantly reduced expression of Acot1-6 genes (mice triple deficient for transcriptional factors in bZIp family) fail to adapt to CR (Gachon et al.,

2011).

Fasting Feeding Glucose Lipids Glucose Lipids Plasmatic Membrane KB

Acyl-CoA Glycolysis LCDCA-CoA vLCA-CoA

β-oxidation LCA-CoA SCDCA-CoA LCA-CoA ACOT1 FFA ACOT4 ACOT3 PPARα Acs, Acot, Lpl, HMGCoAR, Cyp450 FFA SDCFA LFA Peroxisome CoA Nucleus LCA-CoA SDCFA LFA

SDCA-CoA LFA-CoA

LFA-CoA SDCA-CoA β-oxidation Acetyl-CoA

ATP production TCA Cycle Mitochondrion

Figure 4-13: CR induced reprogramming of fatty acid metabolism. Only enzymes whose translation has been affected by CR, in my study (highlighted by yellow) are presented in the

Figure. CR is a periodic feeding and fasting dietary regmen. During the fasting state, there is a significant influx of fatty acids in the liver. Activated fatty acids – Acyl-CoA can be utilized to produce ketone bodies or be oxidized in mitochondria to generate ATP for hepatocyte homeostasis and to fuel gluconeogenesis. vLCA-CoA and LCDA-CoA molecules are oxidized in the peroxisomes. It was proposed that after few rounds of carbon chain shortening of vLCA-CoA and LCDCA-CoA forms SDCA-CoA and LCA-CoA. ACOTs localized in peroxisome i.e.

ACOT3 and ACOT4 hydrolyze LCA-CoA and SDCA-CoA to generated) long chain (LFA) free fatty acid and short chain (SDFA) molecules which leave the peroxisome, gets activated in the cytoplasm and through carnitine-dependent shuttle (catalyzed by CPT1) enter into the mitochondria. In mitochondria, Acyl-CoA molecules undergo beta-oxidation (ACADL is the rate limiting enzyme for this step) and generated acetyl-CoA enters the TCA cycle to produce ATPs.

Cytoplasmic ACOT1 hydrolyzes acyl-CoA into free fatty acids (FFA) and CoA. It was proposed

that this can serve several purposes: limit the acyl-CoA supply into mitochondria and reduce the level of cytoplasmic acyl-CoA molecules which are known to inhibit glycolysis, thus, contributing to metabolic flexibility. Finally, free fatty acids produced as a product of hydrolysis of activated Acyl-CoA serve as ligands for nuclear receptor PPARα master regulator of fat metabolism.

Evidence are accumulating that protein translation is not a simple transition from mRNA to protein but an important regulatory step. Cells change both global translation and translation of selective proteins in response to the external and internal signals. A significant rewiring of many physiological processes including chromatin organization, transcription, and translation is required by the animals to adaptation to CR diet, as my data demonstrates. In addition to the previously reported changes in global protein translation, I found that CR induced the changes in the translational rate for proteins involved in metabolic pathways previously not known to be affected by CR. Importantly, these changes in translation were mediated at least in part by the circadian clock and establishes the link between the circadian rhythms and liver response to nutrients and aging.

4.5 AKNOWLEDGEMENTS

This work was supported by NIH grant 5RO1-AG039547 and internal support by the GRHD department at CSU.

Chapter V

CALORIE RESTRICTION INDUCED ACOTs EXPRESSION IS

TRANSCRIPTIONAL FATOR BMAL1 DEPENDENT

5.1. Introduction

Bmal1 is a core component of the circadian clock known to regulate circadian rhythms. Interestingly, Bmal1 knock out mice have reduced lifespan with symptoms of accelerated aging such as sarcopenia, cataracts, and less subcutaneous fat(Kondratov et al., 2006). The target of rapamycin (mTOR) is a nutrient-responsive signaling pathway which is known to play a critical role in the process of aging. Accelerated aging has been found to be associated with induced mTOR signaling, whereas suppressed mTOR signaling pathway is associated with a delay in the aging process. Moreover, this phenomenon is very well conserved among many organisms(Blagosklonny, 2010;

Kaeberlein, 2010). Interestingly, BMAL1 inhibits mTOR activity as demonstrated in

Bmal1-/- fibroblast cells and Bmal1-/- mice have induced mTOR activity and reduced lifespan(Khapre et al., 2014). Calorie restriction (CR) is a dietary intervention know to

100

delay aging and reduce the incidence of age-related pathologies. In previous works from our lab, we have demonstrated that Bmal1 is necessary for CR mediated extension of lifespan. When CR was implemented on Bmal1-/- mice it did not extend the lifespan of these animals rather it reduced the lifespan significantly. Moreover, 40 animals died with

10 weeks of CR treatment. This was interpreted as the failure of animals to make necessary initial metabolic adjustments to CR treatment(Patel, Chaudhari, et al., 2016).

In chapter IV, I have shown how CR induces translation and protein expression of

ACOTs. I discussed that this induction of ACOTs may be playing a critical role in the metabolic adaptation of animals to CR treatment. Therefore, I hypothesized, based on the previous published data on Bmal1-/- mice, CR fails to extend lifespan in Bmal1-/- animals due to suppressed expression of ACOTs and lack of metabolic adaptation.

5.2 Results:

5.2.1 CR induced expression of ACOTs is dependent on Bmal1.

Calorie restriction induces translation and protein expression of Acots in WT animals (Figure 4-12). I investigated the total protein levels of ACOT1 and ACOT4 in

Bmal1-/- animals fed ad libitum or calorie restricted. Experimental set up for Bmal1-/- animals under CR was same as explained in section 2.1. Total protein levels for ACOT1 in the liver for BKO (Bmal1-/-) animals fed AL showed relatively no change from that of

WT animals fed AL (some time-dependent induction at ZT2 and ZT18 for WT-AL).

101

However, when the liver tissue of WT animals fed CR (CR-WT) was compared to BKO animals fed CR (CR-BKO), the results were very pronounced. ACOT1 level was reduced in CR-BKO animals. Similar results were observed for ACOT4 protein levels.

AL-WT AL-BKO A

2 6 10 14 18 22 2 6 10 14 18 22 ACOT1

GAPDH

B CR-WT CR-BKO

2 6 10 14 18 22 2 6 10 14 18 22

ACOT1

GAPDH

Figure 5-1: ACOT1 induction upon CR is Bmal1 dependent. A) Total ACOT1 protein assayed in WT and Bmal1 knock out animals (BKO) fed ad libitum (AL). B) Total ACOT1 protein assayed in WT (CR-WT) and Bmal1 knock out animals (CR-BKO) fed CR assayed by western blot, in the liver of WT and BKO animals. GAPDH protein was used as a loading control. Light and dark bar at the top represents light and dark phase of the day (n=2 for every time point for each diet). ZT is Zeitgeber Time (light is on at ZT0 and light is off at ZT12).

102

A AL-WT AL-BKO

2 6 10 14 18 22 2 6 10 14 18 22 ACOT4

GAPDH CR-WT CR-BKO 2 6 10 14 18 22 2 6 10 14 18 22 ACOT4

GAPDH

Figure 5-2: ACOT4 induction under CR is Bmal1 dependent. A) Total ACOT4 protein assayed in WT and Bmal1 knock out animals (BKO) fed ad libitum (AL). B) Total ACOT4 protein assayed in WT (CR-WT) and Bmal1 knock out animals fed CR (CR-BKO) assayed by western blot, in the liver of WT and BKO animals. GAPDH protein was used as a loading control. Light and dark bar at the top represents light and dark phase of the day (n=2 for every time point for each diet). ZT is Zeitgeber Time (light is on at ZT0 and light is off at ZT12).

5.3 Discussion

Bmal1 is a circadian core clock transcriptional factor which regulates circadian rhythms along with other core clock components. There are pieces of evidence that suggest Bmal1 has an important role in delaying the aging process. Most interesting evidence comes from the study conducted by S.Patel et.al. and R.Khapre et. al. demonstrating that Bmal1 inhibits mTOR signaling(Khapre et al., 2014) (reduced mTOR is known to delay aging) and that CR mediated lifespan extension requires Bmal1. In absence of Bmal1, animals were unable to adapt to initial metabolic stress implemented under CR diet(Patel, Chaudhari, et al., 2016). Since I observed a higher expression of ACOTs under CR which may be responsible for the adaptation of animals to CR diet, I

103

decided to investigate the role of Bmal1 in CR induced ACOTs expression. We observed that under AL, loss of Bmal1 gene did not have much effect on the total protein levels of ACOTs. However, there was a manifold difference seen between CR-WT and CR-BKO animals fed CR. Total protein levels were suppressed in CR-BKO animals under CR. These observations warrant further investigation on the role of Bmal1 in regulating CR induced ACOTs expression. Does Bmal1 increases the half-life and stability of ACOTs under CR? CR is known to increase protein half-life and quality of proteome. Or, does Bmal1 induces transcription as well as translation of Acots. Bmal1 is known to regulate protein synthesis by interacting with protein synthesis machinery(Lipton et al., 2015). These are interesting questions which need to be answered in future. To answer some of these questions, it requires to study protein translation in Bmal1-/- animals using similar approaches as implemented in chapter IV.

Future directions:

Future studies would focus on understanding the impact of CR on fat metabolism. It would be interesting to investigate how Acots and various other enzymes, discussed in this study, are involved in long chain fatty acid metabolism in the liver under calorie restriction. My study suggests that under CR, beta-oxidation of long chain fatty acids is preferred. In future, it would be interesting to investigate why and how does mouse liver choose to prefer long chain fatty acid molecules over short chain fatty acid molecules. Under CR, there is induced expression of peroxisomal ACOTs. Is the induced expression of peroxisomal ACOTs under CR due to increased biomass of peroxisomes? This could be answered by isolation of peroxisomes from fresh mouse liver tissues and detecting for canonical peroxisomal markers or alternatively by immunohistochemistry.

Fatty acid released as a result of hydrolysis of Acyl-CoA esters by ACOTs are ligands to PPARα nuclear receptors. PPARα is known to induce the gene expression of genes involved in fat metabolism. Efforts would be directed to explore the ACOTs- PPARα signaling axis in the future.

104

It would also be interesting to investigate changes in the pool of Co-A enzyme in the cytoplasm, mitochondria, and peroxisomes. Co-A is essential for many biochemical cellular processes and changes in Co-A enzyme can limit these metabolic reactions inside the cell.

Another interesting future direction is to study the role of core clock proteins in regulating the expression of ACOTs. Preliminary results discussed in this study demonstrate that Bmal1 plays an important role in regulating the expression of ACOTs. It would be interesting to investigate if Cryptochromes have any role as well in regulating ACOTs. Cryptochrome double knockout animals shows some phenotype similar to CR animals (reduced insulin signaling). So, would Cryptochrome double knock out animals induced expression of ACOTs as WT animals under CR?

Also, how calorie restriction inhibits global protein translation in mouse liver? The mechanism of this inhibition of protein synthesis would be explored in the future.

Answers to these interesting questions will generate exciting information about the mechanistic links between calorie restriction, circadian clocks, and metabolism.

105

CHAPTER VI

CONCLUSION

In this study, I tried to investigate mechanisms behind Calorie restriction (CR) mediated extension of lifespan using mice model reported to have longer lifespan under

CR. There are many proposed mechanisms reported for CR mediated longevity, my study explored on one such mechanism i.e. regulation of proteostasis. Protein synthesis is one important step in the regulation of protein homeostasis. There are several reports which have made counter claims for the effect of CR on protein synthesis in longer living animals. The counterintuitive results reported by these studies are may be result of difference in tissue being studies, gender, and lack of account of time of the day when the tissues were harvested. Interestingly, there are such counterintuitive results reported for mouse liver tissue treated with CR diet. Therefore, I decided to study the effect of CR on protein synthesis in the mouse liver using comprehensive circadian experimental set up. I demonstrated inhibition of global protein synthesis under CR in mouse liver.

Following the above-mentioned result, I studied differentially translated transcript and assayed their importance on physiology of animals. CR has significant effect on the diurnal rhythms in protein translation. There was an alteration of circadian translatome under CR. This alteration of rhythmically translated transcripts had significant impact on

106

animal physiology and metabolism. Some of the major pathways that were impacted under CR were ribosomal biogenesis, oxidative phosphorylation, AMPK signaling, and Lipid metabolism. I discovered that in mouse liver, Acots, along with enzymes involved in long chain fatty acid molecules displayed induced translation.

ACOTs levels were confirmed to be induced under CR on the total protein level as well.

Based on the data presented, I propose that induced expression of ACOTs is well coordinated according to the cellular demand and sources made available to the cell at a particular time of day to produce energy. This coordinated induction in ACOTs was responsible for the metabolic adjustments needed to adapt to CR diet. Moreover, we observed that CR induced induction of ACOTs was Bmal1 dependent. Bmal1-/- animals displayed reduced expression of ACOTs in the mouse liver in comparison to WT animals under CR. Bmal1-/-animals manifest symptoms of premature aging according to previous published data. Under CR, Bmal1-/- animals have been reported, in previous studies, to have reduced life-span and failure to survive CR treatment. Since, Bmal1-/- animals show reduced expression of ACOTs, I believe this to be the reason for these animals not been able to adapt to the challenge of CR diet. To test this hypothesis requires concrete experiments on Bmal1-/- animals under CR, which will be undertaken in the future.

BIBLIOGRAPHY

Abumrad, N., Harmon, C. and Ibrahimi, A. (1998) ‘Membrane transport of long- chain fatty acids: evidence for a facilitated process’, J. Lipid Res., 39, pp. 2309–2318.

Acosta-Rodríguez, V. A. et al. (2017) ‘Mice under Caloric Restriction Self-

Impose a Temporal Restriction of Food Intake as Revealed by an Automated Feeder

107

System’, Cell Metabolism, 26(1), p. 267–277.e2. doi: 10.1016/j.cmet.2017.06.007.

Anders, S., Pyl, P. T. and Huber, W. (2015) ‘HTSeq-A Python framework to work with high-throughput sequencing data’, Bioinformatics, 15(31), pp. 166–169. doi:

10.1093/bioinformatics/btu638.

Anderson, R. M. and Weindruch, R. (2010) ‘Metabolic reprogramming, caloric restriction and aging’, Trends in Endocrinology and Metabolism, 21(3), pp. 134–41. doi:

10.1016/j.tem.2009.11.005.

Armanios, M. et al. (2009) ‘Short Telomeres are Sufficient to Cause the

Degenerative Defects Associated with Aging’, American Journal of Human Genetics,

85(6), pp. 823–32. doi: 10.1016/j.ajhg.2009.10.028.

Asher, G. and Sassone-Corsi, P. (2015) ‘Time for food: The intimate interplay between nutrition, metabolism, and the circadian clock’, Cell, 161(1), pp. 84–92. doi:

10.1016/j.cell.2015.03.015.

Astafev, A. A., Patel, S. A. and Kondratov, R. V. (2017) ‘Calorie restriction effects on circadian rhythms in gene expression are sex dependent’, Scientific Reports,

7(1), p. 9716. doi: 10.1038/s41598-017-09289-9.

Atger, F. et al. (2015) ‘Circadian and feeding rhythms differentially affect rhythmic mRNA transcription and translation in mouse liver’, Proceedings of the

National Academy of Sciences, 112(47), pp. E6579–E6588. doi:

10.1073/pnas.1515308112.

Austad, S. N. and Fischer, K. E. (2011) ‘The development of small primate models for aging research’, ILAR journal / National Research Council, Institute of

Laboratory Animal Resources, 50(1), pp. 78–88.

108

B.J.Merrya, A.M.Holehana, S.E.M. Lewisb, D. F. G. (1987) ‘The effects of ageing and chronic dietary restriction on in vivo hepatic protein synthesis in the rat.’,

Mechanisms of Ageing and Development, 39(2), pp. 189–199.

Barnes, R. P., Fouquerel, E. and Opresko, P. L. (2018) ‘The impact of oxidative

DNA damage and stress on telomere homeostasis’, Mechanisms of Ageing and

Development, p. In press. doi: 10.1016/j.mad.2018.03.013.

Bartke, A. (2011) ‘Growth hormone, insulin and aging: The benefits of endocrine defects’, Experimental Gerontology, 46(2–3), pp. 108–111. doi:

10.1016/j.exger.2010.08.020.

Bartke, A. and Darcy, J. (2017) ‘GH and ageing: Pitfalls and new insights’, Best

Practice and Research: Clinical Endocrinology and Metabolism, 31(1), pp. 113–125. doi: 10.1016/j.beem.2017.02.005.

Bass, J. (2012) ‘Circadian topology of metabolism’, Nature, 491(7424), pp. 348–

56. doi: 10.1038/nature11704.

Bernardes de Jesus, B. et al. (2012) ‘Telomerase gene therapy in adult and old mice delays aging and increases longevity without increasing cancer’, EMBO Molecular

Medicine, 4, pp. 691–704. doi: 10.1002/emmm.201200245.

Bjedov, I. et al. (2010) ‘Mechanisms of Life Span Extension by Rapamycin in the

Fruit Fly Drosophila melanogaster’, Cell Metabolism, 11, pp. 35–46. doi:

10.1016/j.cmet.2009.11.010.

Blagosklonny, M. V. (2010) ‘Revisiting the antagonistic pleiotropy theory of aging: TOR-driven program and quasi-program.’, Cell Cycle, 9(16), pp. 3151–6.

Blagosklonny, M. V. (2011) ‘Rapamycin-induced glucose intolerance: Hunger or

109

starvation diabetes’, Cell Cycle, pp. 4217–4224. doi: 10.4161/cc.10.24.18595.

Bonelli, M. A. et al. (2008) ‘Low-level caloric restriction rescues proteasome activity and Hsc70 level in liver of aged rats’, Biogerontology, 9(1), pp. 1–10. doi:

10.1007/s10522-007-9111-9.

Le Bourg, E. and Minois, N. (1996) ‘Failure to confirm increased longevity in

Drosophila melanogaster submitted to a food restriction procedure’, Journals of

Gerontology - Series A Biological Sciences and Medical Sciences, 51(4), pp. B280-3. doi:

10.1093/gerona/51A.4.B280.

Brocker, C. et al. (2010) ‘Evolutionary divergence and functions of the human acyl-CoA thioesterase gene ( ACOT ) family’, Human Genomics, 4(6), pp. 411–20. doi:

10.1186/1479-7364-4-6-411.

Brookes PS (2005) ‘Mitochondrial H(+) leak and ROS generation: an odd couple.’, Free Radical Biology and Medicine, 38(1), pp. 12–23.

Bruss, M. D. et al. (2010) ‘Calorie restriction increases fatty acid synthesis and whole body fat oxidation rates’, American Journal of Physiology - Endocrinology and

Metabolism, 298, pp. E108-16. doi: 10.1152/ajpendo.00524.2009.

Butterfield, G. E. and Calloway, D. H. (1984) ‘Physical activity improves protein utilization in young men.’, The British journal of nutrition, 51(2), pp. 171–84. doi:

10.1079/BJN19840021.

C García-Ruiz, A Colell, A Morales, N. K. and J. C. F.-C. (1995) ‘Role of oxidative stress generated from the mitochondrial electron transport chain and mitochondrial glutathione status in loss of mitochondrial function and activation of transcription factor nuclear factor-kappa B: studies with isolated mitochondria and’,

110

Moleclar Pharmacology, 48(5), pp. 825–834.

Calderwood, S. K., Murshid, A. and Prince, T. (2009) ‘The shock of aging: molecular chaperones and the heat shock response in longevity and aging--a mini- review.’, Gerontology, 55, pp. 550–558. doi: 10.1159/000225957.

Canto, C. and Auwerx, J. (2011) ‘Calorie Restriction: Is AMPK a Key Sensor and

Effector?’, Physiology, 26(4), pp. 214–24. doi: 10.1152/physiol.00010.2011.

Cao, S. X. et al. (2001) ‘Genomic profiling of short- and long-term caloric restriction effects in the liver of aging mice.’, Proceedings of the National Academy of

Sciences of the United States of America, 98, pp. 10630–10635. doi:

10.1073/pnas.191313598.

Carey, J. R. et al. (2002) ‘Life history response of Mediterranean fruit flies to dietary restriction’, Dietary restriction of Mediterranean fruit flies, J. R. Carey et al., 1, pp. 140–148. doi: 10.1046/j.1474-9728.2002.00019.x.

Cava, E. and Fontana, L. (2013) ‘Will calorie restriction work in humans?’,

Aging, 5(7), pp. 507–14. doi: 10.18632/aging.100581.

Chalasani, N. et al. (2012) ‘The diagnosis and management of non-alcoholic fatty liver disease: Practice Guideline by the American Association for the Study of Liver

Diseases, American College of Gastroenterology, and the American Gastroenterological

Association’, Hepatology, 55(6), pp. 2005–23. doi: 10.1002/hep.25762.

Chassé, H. et al. (2017) ‘Analysis of translation using polysome profiling’,

Nucleic acids research, 45(3), p. e15. doi: 10.1093/nar/gkw907.

Chaudhari, A. et al. (2017) ‘Circadian clocks, diets and aging’, Nutrition and

Healthy Aging, 4(2), pp. 101–112. doi: 10.3233/NHA-160006.

111

Chen, D. et al. (2008) ‘Tissue-specific regulation of SIRT1 by calorie restriction’,

Genes and Development, 22, pp. 1753–1757. doi: 10.1101/gad.1650608.

Chen, D., Thomas, E. L. and Kapahi, P. (2009) ‘HIF-1 modulates dietary restriction-mediated lifespan extension via IRE-1 in Caenorhabditis elegans’, PLoS

Genetics, 5(5). doi: 10.1371/journal.pgen.1000486.

Chen, S. et al. (2017) ‘AfterQC: Automatic filtering, trimming, error removing and quality control for fastq data’, BMC Bioinformatics, 18, p. 80. doi: 10.1186/s12859-

017-1469-3.

Colman, R. J. et al. (2009) ‘Caloric restriction delays disease onset and mortality in rhesus monkeys’, Science, 325(5937), pp. 201–204. doi: 10.1126/science.1173635.

Colman, R. J. et al. (2014) ‘Caloric restriction reduces age-related and all-cause mortality in rhesus monkeys’, Nature Communications, 5, p. 3557. doi:

10.1038/ncomms4557.

Conboy, I. M. and Rando, T. A. (2012) ‘Heterochronic parabiosis for the study of the effects of aging on stem cells and their niches.’, Cell Cycle, 11, pp. 2260–2267.

Cooper, T. M. et al. (2004) ‘Effect of caloric restriction on life span of the housefly, Musca domestica.’, FASEB journal : official publication of the Federation of

American Societies for Experimental Biology, 18(13), pp. 1591–3. doi: 10.1096/fj.03-

1464fje.

Cuthbertson, D. P., McGirr, J. L. and Munro, H. N. (1937) ‘A study of the effect of overfeeding on the protein metabolism of man: The effect of muscular work at different levels of energy intake, with particular reference to the timing of the work in relation to the taking of food.’, The Biochemical journal, 31(12), pp. 2293–305.

112

Available at: http://www.ncbi.nlm.nih.gov/pubmed/16746577%0Ahttp://www.pubmedcentral.nih.gov/ articlerender.fcgi?artid=PMC1267212%0Ahttp://www.ncbi.nlm.nih.gov/pubmed/167465

77%0Ahttp://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=PMC1267212.

D’Costa, A. P. et al. (1993) ‘Moderate caloric restriction increases type 1 IGF receptors and protein synthesis in aging rats’, Mechanisms of Ageing and Development,

71(1–2), pp. 59–71. doi: 10.1016/0047-6374(93)90035-P.

Damiola, F. et al. (2000) ‘Restricted feeding uncouples circadian oscillators in peripheral tissues from the central pacemaker in the suprachiasmatic nucleus’, Genes and

Development, 14(23), pp. 2950–2961. doi: 10.1101/gad.183500.

Deepa, P. R. et al. (2011) ‘Chemical inhibition of fatty acid synthase: Molecular docking analysis and biochemical validation in ocular cancer cells’, Journal of Ocular

Biology, Diseases, and Informatics, 3(4), pp. 117–28. doi: 10.1007/s12177-011-9065-7.

Denino, W. F. et al. (2001) ‘Contribution of Abdominal Adiposity to Age-Related

Differences in Insulin Sensitivity and Plasma Lipids in Healthy Nonobese Women’,

Diabetes Care, 24, pp. 925–932. doi: 10.2337/diacare.24.5.925.

Dermit, M., Dodel, M. and Mardakheh, F. K. (2017) ‘Methods for monitoring and measurement of protein translation in time and space’, Molecular BioSystems. Royal

Society of Chemistry, 13(12), pp. 2477–2488. doi: 10.1039/c7mb00476a.

Dever, T. E. and Green, R. (2012) ‘The elongation, termination, and recycling phases of translation in eukaryotes’, Cold Spring Harbor Perspectives in Biology, 4(7), p. a013706. doi: 10.1101/cshperspect.a013706.

Dobin, A. et al. (2013) ‘STAR: Ultrafast universal RNA-seq aligner’,

113

Bioinformatics, 29(1), pp. 15–21. doi: 10.1093/bioinformatics/bts635.

Easlon, E. et al. (2007) ‘The dihydrolipoamide acetyltransferase is a novel metabolic longevity factor and is required for calorie restriction-mediated life span extension’, Journal of Biological Chemistry, 282(9), pp. 6161–71. doi:

10.1074/jbc.M607661200.

Eisenberg, T. et al. (2009) ‘Induction of autophagy by spermidine promotes longevity’, Nature Cell Biology, 11, pp. 1305–1314. doi: 10.1038/ncb1975.

Ellis, J. M., Bowman, C. E. and Wolfgang, M. J. (2015) ‘Metabolic and Tissue-

Specific Regulation of Acyl-CoA Metabolism’, PLoS ONE, 10(3), p. e0116587. doi:

10.1371/journal.pone.0116587.

Fabrizio P, Pletcher SD, Minois N, Vaupel JW, L. V. (2004) ‘Chronological aging-independent replicative life span regulation by Msn2/Msn4 and Sod2 in

Saccharomyces cerevisiae.’, FEBS Letters, 557(1–3), pp. 136–42.

Fontana, Luigi, Partridge L, L. VD (2010) ‘Extending healthy life span--from yeast to humans.’, Science, 328, pp. 321–326.

Franklin, M. P., Sathyanarayan, A. and Mashek, D. G. (2017) ‘Acyl-CoA thioesterase 1 (ACOT1) regulates PPARα to couple fatty acid flux with oxidative capacity during fasting’, Diabetes, 66(8), pp. 2112–2123. doi: 10.2337/db16-1519.

Froy, O. (2013) ‘Circadian aspects of energy metabolism and aging’, Ageing

Research Reviews, 12(4), pp. 931–40. doi: 10.1016/j.arr.2013.09.002.

Furuhashi, M. and Hotamisligil, G. S. (2008) ‘Fatty acid-binding proteins: Role in metabolic diseases and potential as drug targets’, Nature Reviews Drug Discovery, 7(6), pp. 489–503. doi: 10.1038/nrd2589.

114

Gachon, F. et al. (2011) ‘Proline- and acidic amino acid-rich basic leucine zipper proteins modulate peroxisome proliferator-activated receptor alpha (PPARalpha) activity.’, Proceedings of the National Academy of Sciences of the United States of

America, 108(12), pp. 4794–9. doi: 10.1073/pnas.1002862108.

Goldspink DF1, M. B. (1988) ‘Changes in protein turnover and growth of the rat lung in response to ageing and long-term dietary restriction.’, Mechanisms of Ageing and

Development, 42(3), pp. 253–62.

Gruber, R. et al. (2006) ‘Fracture healing in the elderly patient’, Experimental

Gerontology, 41, pp. 1080–1093.

Guo, S. S. et al. (1999) ‘Aging, body composition, and lifestyle: The Fels

Longitudinal Study’, American Journal of Clinical Nutrition, 70, pp. 405–411. doi:

10.1093/ajcn/70.3.405.

Harrison, D. E. et al. (2009) ‘Rapamycin fed late in life extends lifespan in genetically heterogeneous mice’, Nature, 460, pp. 392–395. doi: 10.1038/nature08221.

Heilbronn, L. K. and Ravussin, E. (2003) ‘Calorie restriction and aging: review of the literature and implications for studies in humans’, The American Journal of Clinical

Nutrition, 78(3), pp. 361–69. doi: 10.1093/ajcn/78.3.361.

Hernandez-Rodas, M. C., Valenzuela, R. and Videla, L. A. (2015) ‘Relevant aspects of nutritional and dietary interventions in non-alcoholic fatty liver disease’,

International Journal of Molecular Sciences, 16(10), pp. 25168–98. doi:

10.3390/ijms161025168.

Hinnebusch, A. G. and Lorsch, J. R. (2012) ‘The mechanism of eukaryotic translation initiation: New insights and challenges’, Cold Spring Harbor Perspectives in

115

Biology, 4(10), p. a011544. doi: 10.1101/cshperspect.a011544.

Honma, S. et al. (2002) ‘Dec1 and Dec2 are regulators of the mammalian molecular clock’, Nature, 419(6909), pp. 841–1. doi: 10.1038/nature01123.

Hsiao, Y. S., Jogl, G. and Tong, L. (2004) ‘Structural and biochemical studies of the substrate selectivity of carnitine acetyltransferase’, Journal of Biological Chemistry,

279(30), pp. 31584–9. doi: 10.1074/jbc.M403484200.

Hughes, V. A. et al. (2004) ‘Anthropometric assessment of 10-y changes in body composition in the elderly.’, The American journal of clinical nutrition, 80, pp. 475–482. doi: 80/2/475 [pii].

Hunt, M. C. et al. (2002) ‘Characterization of an acyl-CoA thioesterase that functions as a major regulator of peroxisomal lipid metabolism’, Journal of Biological

Chemistry, 277, pp. 1128–38. doi: 10.1074/jbc.M106458200.

Hunt, M. C. et al. (2006) ‘Analysis of the mouse and human acyl-CoA thioesterase (ACOT) gene clusters shows that convergent, functional evolution results in a reduced number of human peroxisomal ACOTs.’, FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 20(11), pp. 1855–64. doi: 10.1096/fj.06-6042com.

Hunt, M. C., Siponen, M. I. and Alexson, S. E. H. (2012) ‘The emerging role of acyl-CoA thioesterases and acyltransferases in regulating peroxisomal lipid metabolism’,

Biochimica et Biophysica Acta - Molecular Basis of Disease, 1822(9), pp. 1397–410. doi:

10.1016/j.bbadis.2012.03.009.

Janzen, V. et al. (2006) ‘Stem-cell ageing modified by the cyclin-dependent kinase inhibitor p16INK4a’, Nature, 443, pp. 421–426. doi: 10.1038/nature05159.

116

Jaskelioff, M. et al. (2011) ‘Telomerase reactivation reverses tissue degeneration in aged telomerase-deficient mice’, Nature, 469(7238), pp. 102–6. doi:

10.1038/nature09603.

Jia, K. and Levine, B. (2007) ‘Autophagy is required for dietary restriction- mediated life span extension in C. elegans’, Autophagy, 3(6), pp. 597–9. doi:

10.4161/auto.4989.

Jogl, G., Hsiao, Y. S. and Tong, L. (2004) ‘Structure and function of carnitine acyltransferases’, Annals of the New York Academy of Sciences, 1033, pp. 17–29. doi:

10.1196/annals.1320.002.

Johnson Simon C., Rabinovitch Peter S., K. M. (2013) ‘mTOR is a key modulator of ageing and age-related disease.’, Nature, 493, pp. 338–345.

Jouffe, C. et al. (2013) ‘The Circadian Clock Coordinates Ribosome Biogenesis’,

PLoS Biology, 11(1), p. e1001455. doi: 10.1371/journal.pbio.1001455.

Jové, M. et al. (2014) ‘Caloric restriction reveals a metabolomic and lipidomic signature in liver of male mice’, Aging Cell, 13(5), pp. 828–37. doi: 10.1111/acel.12241.

Kaeberlein, M. et al. (2005) ‘Cell biology: Regulation of yeast replicative life span by TOR and Sch9 response to nutrients’, Science, 310(5751), pp. 1193–6. doi:

10.1126/science.1115535.

Kaeberlein, M. et al. (2006) ‘Comment on “HST2 mediates SIR2-independent life-span extension by calorie restriction”.’, Science, 312(5778), p. 1312.

Kaeberlein, M. (2010) ‘Lessons on longevity from budding yeast.’, Nature,

464(7288), pp. 513–9.

Karunadharma, P. P. et al. (2015) ‘Subacute calorie restriction and rapamycin

117

discordantly alter mouse liver proteome homeostasis and reverse aging effects’, Aging cell, 14(4), pp. 547–57. doi: 10.1111/acel.12317.

Katewa, S. D. et al. (2016) ‘Peripheral Circadian Clocks Mediate Dietary

Restriction-Dependent Changes in Lifespan and Fat Metabolism in Drosophila’, Cell

Metabolism, 23(1), pp. 143–54. doi: 10.1016/j.cmet.2015.10.014.

Khapre, R. V. et al. (2014) ‘BMAL1-dependent regulation of the mTOR signaling pathway delays aging’, Aging, 6(1), pp. 48–57. doi: 10.18632/aging.100633.

Klass, M. R. (1977) ‘Aging in the nematode Caenorhabditis elegans: Major biological and environmental factors influencing life span’, Mechanisms of Ageing and

Development, 6, pp. 413–429. doi: 10.1016/0047-6374(77)90043-4.

Klass, M. R. (1983) ‘A method for the isolation of longevity mutants in the nematode Caenorhabditis elegans and initial results’, Mechanisms of Ageing and

Development, 22(3–4), pp. 279–286. doi: 10.1016/0047-6374(83)90082-9.

Ko, C. H. and Takahashi, J. S. (2006) ‘Molecular components of the mammalian circadian clock’, Human Molecular Genetics, 217, pp. 3–27. doi: 10.1093/hmg/ddl207.

Kondratov, R. V. et al. (2006) ‘Early aging and age-related pathologies in mice deficient in BMAL1, the core component of the circadian clock’, Genes and

Development, 20(14), pp. 1868–1873. doi: 10.1101/gad.1432206.

Kruegel, U. et al. (2011) ‘Elevated proteasome capacity extends replicative lifespan in saccharomyces cerevisiae’, PLoS Genetics, 7, p. e1002253. doi:

10.1371/journal.pgen.1002253.

Kuhla, A. et al. (2011) ‘Aging is associated with a shift of fatty metabolism toward lipogenesis’, Journals of Gerontology - Series A Biological Sciences and Medical

118

Sciences, 66, pp. 1192–1200. doi: 10.1093/gerona/glr124.

Kuhla, A. et al. (2014) ‘Lifelong caloric restriction reprograms hepatic fat metabolism in mice’, Journals of Gerontology - Series A Biological Sciences and

Medical Sciences, 69(8), pp. 915–22. doi: 10.1093/gerona/glt160.

Kulkarni, S. R., Armstrong, L. E. and Slitt, A. L. (2013) ‘Caloric restriction- mediated induction of lipid metabolism gene expression in liver is enhanced by keap1- knockdown’, Pharmaceutical Research, 30(9), pp. 2221–2231. doi: 10.1007/s11095-013-

1138-9.

Lamming, D. W. et al. (2005) ‘HST2 mediates SIR2 independent life span extension by calorie restriction’, Science, 309(5742), pp. 1861–4. doi:

10.1126/science.1124608.

Larson-Meyer, D. E. et al. (2006) ‘Effect of calorie restriction with or without exercise on insulin sensitivity, beta-cell function, fat cell size, and ectopic lipid in overweight subjects.’, Diabetes Care, 29(6), pp. 1337–44. doi: 10.2337/dc05-2565.

Lee, B. H. et al. (2010) ‘Enhancement of proteasome activity by a small-molecule inhibitor of USP14’, Nature, 467, pp. 179–184. doi: 10.1038/nature09299.

Lee, C. and Longo, V. (2016) ‘Dietary restriction with and without caloric restriction for healthy aging’, F1000Research, 5, p. F1000 Rev-117. doi:

10.12688/f1000research.7136.1.

Lewis SE, Goldspink DF, Phillips JG, Merry BJ, H. A. (1985) ‘The effects of aging and chronic dietary restriction on whole body growth and protein turnover in the rat.’, Experimental Gerontology, 20(5), pp. 253–63.

Li, M.-D., Li, C.-M. and Wang, Z. (2012) ‘The role of circadian clocks in

119

Metabolic disease’, YALE JOURNAL OF BIOLOGY AND MEDICINE, 85(3), pp. 387–

401.

Liao, C. Y. et al. (2010) ‘Genetic variation in the murine lifespan response to dietary restriction: From life extension to life shortening’, Aging Cell, 9(1), pp. 92–5. doi:

10.1111/j.1474-9726.2009.00533.x.

Lin, S. J. et al. (2004) ‘Calorie restriction extends yeast life span by lowering the level of NADH’, Genes and Development, 18(1), pp. 12–16. doi: 10.1101/gad.1164804.

Lipton, J. O. et al. (2015) ‘The circadian protein BMAL1 regulates translation in response to S6K1-mediated phosphorylation’, Cell, 161(5), pp. P1138-1151. doi:

10.1016/j.cell.2015.04.002.

Liu, G. et al. (no date) ‘EGF signalling activates the ubiquitin proteasome system to modulate C. elegans lifespan’, EMBO Journal, 30, pp. 2990–3003. doi:

10.1038/emboj.2011.195.

Long, Y. C. and Zierath, J. R. (2006) ‘Review series AMP-activated protein kinase signaling in metabolic regulation’, The Journal of Clinical Investigation, 116(7), pp. 1776–83. doi: 10.1172/JCI29044.1776.

Longo, V. D. et al. (2012) ‘Replicative and chronological aging in saccharomyces cerevisiae’, Cell Metabolism. Elsevier Inc., 16(1), pp. 18–31. doi:

10.1016/j.cmet.2012.06.002.

López-Otín, C. et al. (2013) ‘The Hallmarks of Aging’, Cell, 153, pp. 1194–1217. doi: 10.1016/j.cell.2013.05.039.

Love, M. I., Huber, W. and Anders, S. (2014) ‘Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2’, Genome Biology, 15(12), p. 550.

120

doi: 10.1186/s13059-014-0550-8.

Lutz, W., Sanderson, W. and Scherbov, S. (2008) ‘The coming acceleration of global population ageing’, Nature, 451, pp. 716–719. doi: 10.1038/nature06516.

Mahmoudi, S. and Brunet, A. (2012) ‘Aging and reprogramming: A two-way street’, Current Opinion in Cell Biology, pp. 744–56. doi: 10.1016/j.ceb.2012.10.004.

Maier, T., Güell, M. and Serrano, L. (2009) ‘Correlation of mRNA and protein in complex biological samples’, FEBS Letters, 583(24), pp. 3966–73. doi:

10.1016/j.febslet.2009.10.036.

Mandard, S., Müller, M. and Kersten, S. (2004) ‘Peroxisome proliferator- activated receptor a target genes’, Cellular and Molecular Life Sciences, 61(4), pp. 393–

416. doi: 10.1007/s00018-003-3216-3.

Manoogian, E. N. C. and Panda, S. (2017) ‘Circadian rhythms, time-restricted feeding, and healthy aging’, Ageing Research Reviews, 39, pp. 59–67. doi:

10.1016/j.arr.2016.12.006.

McCay, C. M., Crowell, M. F. and Maynard, L. A. (1935) ‘The Effect of Retarded

Growth Upon the Length of Life Span and Upon the Ultimate Body Size’, The Journal of

Nutrition, 10(1), pp. 63–79. doi: 10.1093/jn/10.1.63.

McHugh, D. and Gil, J. (2018) ‘Senescence and aging: Causes, consequences, and therapeutic avenues’, Journal of Cell Biology, pp. 65–77. doi: 10.1083/jcb.201708092.

Metaxakis, A. and Partridge, L. (2013) ‘Dietary Restriction Extends Lifespan in

Wild-Derived Populations of Drosophila melanogaster’, PLoS ONE, 8, p. e74681. doi:

10.1371/journal.pone.0074681.

Miller, B. F. et al. (2013) ‘Calorie restriction does not increase short-term or long-

121

term protein synthesis.’, The journals of gerontology. Series A, Biological sciences and medical sciences, 68(5), pp. 530–8. doi: 10.1093/gerona/gls219.

Min, J.-N. et al. (2008) ‘CHIP Deficiency Decreases Longevity, with Accelerated

Aging Phenotypes Accompanied by Altered Protein Quality Control’, Molecular and

Cellular Biology, 28, pp. 4018–4025. doi: 10.1128/MCB.00296-08.

Moffat, C. et al. (2014) ‘Acyl-CoA thioesterase-2 facilitates mitochondrial fatty acid oxidation in the liver’, Journal of Lipid Research, 55, pp. 2458–70. doi:

10.1194/jlr.M046961.

Molofsky, A. V. et al. (2006) ‘Increasing p16INK4aexpression decreases forebrain progenitors and neurogenesis during ageing’, Nature, 443, pp. 448–452. doi:

10.1038/nature05091.

Morrow, G. et al. (2004) ‘Overexpression of the small mitochondrial Hsp22 extends Drosophila life span and increases resistance to oxidative stress.’, The FASEB journal : official publication of the Federation of American Societies for Experimental

Biology, 18, pp. 598–599. doi: 10.1096/fj.03-0860fje.

Most, J. et al. (2017) ‘Calorie restriction in humans: An update.’, Aging Res Rev,

39, pp. 36–45.

Mulligan, J. D., Stewart, A. M. and Saupe, K. W. (2008) ‘Downregulation of plasma insulin levels and hepatic PPARγ expression during the first week of caloric restriction in mice’, Experimental Gerontology, 43, pp. 146–153. doi:

10.1016/j.exger.2007.10.011.

Murphy, M. P. (2009) ‘How mitochondria produce reactive oxygen species’,

Biochemical Journal, 417(1), pp. 1–13. doi: 10.1042/BJ20081386.

122

Nguyen, D. et al. (2013) ‘Impaired mitochondrial fatty acid oxidation and insulin resistance in aging: Novel protective role of glutathione’, Aging Cell, 12(3), pp. 415–25. doi: 10.1111/acel.12073.

O’Rourke, E. J. et al. (2013) ‘ω-6 Polyunsaturated fatty acids extend life span through the activation of autophagy’, Genes and Development, 27, pp. 429–440. doi:

10.1101/gad.205294.112.

Park, C. Y. et al. (2017) ‘Effects of mild calorie restriction on lipid metabolism and inflammation in liver and adipose tissue’, Biochemical and Biophysical Research

Communications, 490(3), pp. 636–642. doi: 10.1016/J.BBRC.2017.06.090.

Partridge, L., Green, A. and Fowler, K. (1987) ‘Effects of egg-production and of exposure to males on female survival in Drosophila melanogaster’, Journal of Insect

Physiology, 33, pp. 745–749. doi: 10.1016/0022-1910(87)90060-6.

Parvin, R. and Dakshinamurti, K. (1970) ‘Inhibition of gluconeogenic enzymes by free fatty acids and palmitoyl coenzyme A.’, Journal of Biological Chemistry, 245(21), pp. 5773–5778.

Patel, S. A., Velingkaar, N., et al. (2016) ‘Calorie restriction regulates circadian clock gene expression through BMAL1 dependent and independent mechanisms’,

Scientific Reports, 6(25970). doi: 10.1038/srep25970.

Patel, S. A., Chaudhari, A., et al. (2016) ‘Circadian clocks govern calorie restriction-mediated life span extension through BMAL1- and IGF-1-dependent mechanisms’, FASEB Journal, 30(4), pp. 1634–1642. doi: 10.1096/fj.15-282475.

Piper, M. D. W. and Partridge, L. (2007) ‘Dietary restriction in Drosophila:

Delayed aging or experimental artefact?’, PLoS Genetics, 3(4), pp. 0461–0466. doi:

123

10.1371/journal.pgen.0030057.

Potter, G. D. M. et al. (2016) ‘Circadian rhythm and sleep disruption: Causes, metabolic consequences, and countermeasures’, Endocrine Reviews, 37(6), pp. 584–608. doi: 10.1210/er.2016-1083.

Powers, E. T. et al. (2009) ‘Biological and Chemical Approaches to Diseases of

Proteostasis Deficiency’, Annual Review of Biochemistry, 78, pp. 959–991. doi:

10.1146/annurev.biochem.052308.114844.

Rakhshandehroo, M. et al. (2010) ‘Peroxisome Proliferator-Activated Receptor

Alpha Target Genes’, PPAR Research, 2010, p. 612089. doi: 10.1155/2010/612089.

Rera, M. et al. (2011) ‘Modulation of longevity and tissue homeostasis by the drosophila PGC-1 homolog’, Cell Metabolism, 14, pp. 623–634. doi:

10.1016/j.cmet.2011.09.013.

Rhoads, T. W. et al. (2018) ‘Caloric Restriction Engages Hepatic RNA

Processing Mechanisms in Rhesus Monkeys’, Cell Metabolism, 27(3), p. p677–688.e5. doi: 10.1016/j.cmet.2018.01.014.

Robinson, I. and Reddy, A. B. (2014) ‘Molecular mechanisms of the circadian clockwork in mammals’, FEBS Letters, 588(15), pp. 2477–2483. doi:

10.1016/j.febslet.2014.06.005.

Rodier, F. et al. (2009) ‘Persistent DNA damage signalling triggers senescence- associated inflammatory cytokine secretion’, Nature Cell Biology, 8, pp. 973–9. doi:

10.1038/ncb1909.

Rossi, D. J. et al. (2007) ‘Deficiencies in DNA damage repair limit the function of haematopoietic stem cells with age’, Nature, 447, pp. 725–729. doi:

124

10.1038/nature05862.

Rubinsztein, D. C., Mariño, G. and Kroemer, G. (2011) ‘Autophagy and aging’,

Cell, 146(5), pp. 682–695. doi: 10.1016/j.cell.2011.07.030.

Rudolph, K. L. et al. (1999) ‘Longevity, stress response, and cancer in aging telomerase-deficient mice’, Cell, 96(5), pp. 701–12. doi: 10.1016/S0092-8674(00)80580-

S.Iwasaki, N. I. (2017) ‘The Growing Toolbox for Protein Synthesis Studies.’,

Trends in Biochemical Sciences, 42(8), pp. 612–624.

Sanders, F. W. B. and Griffin, J. L. (2016) ‘De novo lipogenesis in the liver in health and disease: More than just a shunting yard for glucose’, Biological Reviews,

91(2), pp. 452–468. doi: 10.1111/brv.12178.

Sato, S. et al. (2017) ‘Circadian Reprogramming in the Liver Identifies Metabolic

Pathways of Aging’, Cell, 170(4), p. 664–677.e11. doi: 10.1016/j.cell.2017.07.042.

Sato, T. K. et al. (2004) ‘A functional genomics strategy reveals rora as a component of the mammalian circadian clock’, Neuron, 43(4), pp. 527–37. doi:

10.1016/j.neuron.2004.07.018.

Savvidis, C. and Koutsilieris, M. (2012) ‘Circadian rhythm disruption in cancer biology.’, Molecular medicine (Cambridge, Mass.), 18(1), pp. 1249–1260. doi:

10.2119/molmed.2012.00077.

Scheer, F. A. J. L. et al. (2009) ‘Adverse metabolic and cardiovascular consequences of circadian misalignment’, Proceedings of the National Academy of

Sciences, 106(11), pp. 4453–4458. doi: 10.1073/pnas.0808180106.

Shaw, A. C. et al. (2010) ‘Aging of the innate immune system.’, Current Opinion

125

in Immunology, 22, pp. 507–513.

Sinturel, F. et al. (2017) ‘Diurnal Oscillations in Liver Mass and Cell Size

Accompany Ribosome Assembly Cycles’, Cell, 169(4), pp. 651–663. doi:

10.1016/j.cell.2017.04.015.

Slimen, I. B. et al. (2014) ‘Reactive oxygen species, heat stress and oxidative- induced mitochondrial damage. A review’, International Journal of Hyperthermia, 30(7), pp. 513–523.

Smith, E. D. et al. (2008) ‘Quantitative evidence for conserved longevity pathways between divergent eukaryotic species’, Genome Research, 18(4), pp. 564–70. doi: 10.1101/gr.074724.107.

Sohal, R. S. and Forster, M. J. (2014) ‘Caloric restriction and the aging process: A critique’, Free Radical Biology and Medicine, 73, pp. 366–382. doi:

10.1016/j.freeradbiomed.2014.05.015.

Solanas, G. et al. (2017) ‘Aged Stem Cells Reprogram Their Daily Rhythmic

Functions to Adapt to Stress’, Cell, 170(4), p. 678–692.e20. doi:

10.1016/j.cell.2017.07.035.

Steffen, K. K. et al. (2008) ‘Yeast Life Span Extension by Depletion of 60S

Ribosomal Subunits Is Mediated by Gcn4’, Cell, 133, pp. 292–302. doi:

10.1016/j.cell.2008.02.037.

Swigoňová, Z., Mohsen, A. W. and Vockley, J. (2009) ‘Acyl-coA dehydrogenases: Dynamic history of protein family evolution’, Journal of Molecular

Evolution, 69(2), pp. 176–93. doi: 10.1007/s00239-009-9263-0.

Swindell, W. R. et al. (2009) ‘Endocrine regulation of heat shock protein mRNA

126

levels in long-lived dwarf mice’, Mechanisms of Ageing and Development, 130, pp. 393–

400. doi: 10.1016/j.mad.2009.03.004.

Swindell, W. R. (2009) ‘Genes and gene expression modules associated with caloric restriction and aging in the laboratory mouse’, BMC Genomics, 10, p. 1. doi:

10.1186/1471-2164-10-585.

Tillander, V., Alexson, S. E. H. and Cohen, D. E. (2017) ‘Deactivating Fatty

Acids: Acyl-CoA Thioesterase-Mediated Control of Lipid Metabolism.’, Trends in

Endocrinology and Metabolism, 28(7), pp. 473–484.

Todd, K. S., Butterfield, G. A. and Calloway, D. H. (1984) ‘Nitrogen balance in men with adequate and deficient energy intake at three levels of work’, Journal of

Nutrition, 114, pp. 2107–2118. doi: 10.1093/jn/114.11.2107.

Tomaru, U. et al. (2012) ‘Decreased proteasomal activity causes age-related phenotypes and promotes the development of metabolic abnormalities’, American

Journal of Pathology, 180, pp. 963–972. doi: 10.1016/j.ajpath.2011.11.012.

Tsuchiya, M. et al. (2006) ‘Sirtuin-independent effects of nicotinamide on lifespan extension from calorie restriction in yeast’, Aging Cell, 5(6), pp. 505–14. doi:

10.1111/j.1474-9726.2006.00240.x.

Tsuchiya, T. et al. (2004) ‘Additive regulation of hepatic gene expression by dwarfism and caloric restriction’, Physiological Genomics, 17, pp. 307–315. doi:

10.1152/physiolgenomics.00039.2004.

Uno, H. (1997) ‘Age-related pathology and biosenescent markers in captive rhesus macaques’, Journal of the American Aging Association, 20(1), pp. 1–13. doi:

10.1007/s11357-997-0001-5.

127

Walker, G. A. and Lithgow, G. J. (2003) ‘Lifespan extension in C. elegans by a molecular chaperone dependent upon insulin-like signals.’, Aging cell, 2, pp. 131–139. doi: 10.1046/j.1474-9728.2003.00045.x.

Weiss, E. P. et al. (2006) ‘Improvements in glucose tolerance and insulin action induced by increasing energy expenditure or decreasing energy intake: a randomized controlled trial.’, The American journal of clinical nutrition, 85(5), pp. 1033–42. doi:

10.1093/ajcn/84.5.1033.

Wierman, M. B. et al. (2017) ‘Caloric Restriction Extends Yeast Chronological

Life Span by Optimizing the Snf1 (AMPK) Signaling Pathway’, Molecular and Cellular

Biology, 37(13), pp. e00562-16. doi: 10.1128/MCB.00562-16.

Wilkinson, J. E. et al. (2012) ‘Rapamycin slows aging in mice’, Aging Cell, 11, pp. 675–682. doi: 10.1111/j.1474-9726.2012.00832.x.

Yang, L. et al. (2016) ‘Long-Term Calorie Restriction Enhances Cellular Quality-

Control Processes in Human Skeletal Muscle’, Cell Reports, 14(3), pp. 422–428. doi:

10.1016/j.celrep.2015.12.042.

Yang, S. et al. (2012) ‘Protective Effects of Acyl-coA Thioesterase 1 on Diabetic

Heart via PPARα/PGC1α Signaling’, PLoS ONE, 7(11), p. e50376. doi:

10.1371/journal.pone.0050376.

Yuan, C. L. et al. (2008) ‘Preserved protein synthesis in the heart in response to acute fasting and chronic food restriction despite reductions in liver and skeletal muscle.’,

American journal of physiology. Endocrinology and metabolism, 295(1), pp. E216-22. doi: 10.1152/ajpendo.00545.2007.

Zamboni, M. et al. (1997) ‘Effects of age on body fat distribution and

128

cardiovascular risk factors in women’, The American journal of clinical nutrition, 66(1), pp. 111–115.

129

APPENDIX [APPENDICES]

130

Appendix A

Table S1: Table S1: Phase of rhythmicity in translation and transcription for circadian clock genes.

Gene Name Translation Transcription

AL- CR- Circadian AL- CR- Circadian Phase Phase Phase Phase BMAL1 22 22 Both 22.64 22.8 Both Diets Diets Per1 12 10 Both 12.12 11.22 Both Diets Diets Per2 16 12 Both 14.36 15.51 Both Diets Diets Cry1 18 18 Both 18.7 19.7 Both Diets Diets Cry2 22 10 NO 13.51 18.86 AL

131

Appendix B

Figure S1. Effects of diet on phase, amplitude and daily average for P-RNAs rhythmic under both AL and CR.

Figure S1: (A) P-mRNA abundance for transcripts rhythmic under both AL and CR diets. (B)

Number of genes with change or no change in phase under CR treatment. The examples illustrating CR induced changes in the rhythm, phase, amplitude, and daily average of P-mRNAs.

(C) Paip2, arrhythmic under both diets. (D) Ugt2b35, lost rhythmicity under CR. (E) Sorbs3, gained rhythmicity under CR. (F-L) P-mRNAs, rhythmic under both diets: (F) Car14, no significant effect of the diet on the rhythms, (G) P Slc17a4, phase delayed. (H) Ophn1, phase

132

advanced, (I) Mcm10, decreased daily average, (J) Pck1, increased daily average, (K) Elovl5, decreased amplitude, (L) Errfi1, increased amplitude under CR. Light and dark bar at the top represents light and dark phase of the day (n=2 for every time point for each diet). ZT is

Zeitgeber Time (light is on at ZT0 and light is off at ZT12).

133

Appendix C

Fig S2: CR induce changes in P-mRNA of PPARα target gene.

RT-qPCR mRNA-Seq RT-qPCR

A Cyp4a14 mRNA B Cyp4a14 C Cyp4a14 P-mRNA

. .

* a.u * a.u * * * * * *

ZT Relative Expression, a.u. ZT ZT

Relative Relative Expression, Relative Relative Expression, mRNA-Seq

D E Ppargc1a F Ppargc1b

PPARα . a.u

Relative Expression, a.u. Relative Relative Expression, a.u. ZT ZT Relative Expression, ZT

G H I

Mup1 Cyp4a10 . Abcd2 .

a.u a.u

Relative Relative Expression, a.u.

ZT ZT Relative Expression, ZT Relative Relative Expression,

J Cyp2a5

ZT Relative Relative Expression, a.u.

Figure S2: (A) mRNA abundance for Cyp4a14 assayed by in the total RNA in the liver of CR and

AL animals (n=3 for every time point for each diet); (B) mRNA-Seq data for P-mRNA of

Cyp4a14, a target of PPARα transcription factor, in the liver polysomes of CR and AL animals

134

(n=2 for every time point for each diet); (C) Validation of mRNA-Seq data of Cyp4a14 P-mRNA

(n=3 for every time point for each diet). 18s gene was used as control for total RNA, whereas

Beta actin for P-mRNA expression analysis. Two-way ANOVA was performed using GraphPad prism and p value < 0.05 was considered significant. Light and dark bar at the top represents light and dark phase of the day. ZT is Zeitgeber Time (light is on at ZT0 and light is off at ZT12). * - statistically significant difference (P<0.05). (A) P-mRNA of PPARα in the liver polysomes of

AL and CR and animals. (B-G) P-mRNA of PPARα target genes in the liver polysomes of AL and CR and animals. Log2 fold change values were used to plot the data for CR and AL animals

(n=2 for every time point for each diet). Light and dark bar at the top represents light and dark phase of the day. ZT is Zeitgeber Time (light is on at ZT0 and light is off at ZT12).

135