REGULATION OF CAT-1 GENE TRANSCRIPTION DURING PHYSIOLOGICAL
AND PATHOLOGICAL CONDITIONS
by
CHARLIE HUANG
Submitted in partial fulfillment of the requirements
For the degree of Doctor of Philosophy
Dissertation Advisor: Dr. Maria Hatzoglou
Department of Nutrition
CASE WESTERN RESERVE UNIVERSITY
MAY 2010 CASE WESTERN RESERVE UNIVERSITY
SCHOOL OF GRADUATE STUDIES
We hereby approve the thesis/dissertation of
______
candidate for the ______degree *.
(signed)______(chair of the committee)
______
______
______
______
______
(date) ______
*We also certify that written approval has been obtained for any proprietary material contained therein. This workis dedicated to my parents (DICK and MEI-HUI), brother (STEVE), and sister
(ANGELA) for their love and support during my graduate study.
iii TABLE OF CONTENTS
Dedication iii
Table of Contents iv
List of Tables vii
List of Figures viii
Acknowledgements ix
List of Abbreviations xi
Abstract xv
CHAPTER 1: INTRODUCTION
Amino acids and amino acid transporters 1
System y+ transporters 2
Physiological significance of Cat-1 6
Gene transcription in eukaryotic cells 7
Cat-1 gene structure 10
Regulation of Cat-1 expression 11
The Unfolded Protein Response (UPR) and Cat-1 expression 14
Objective of the thesis 20
CHAPTER 2: SP1 REGULATES THE CAT-1 TATA-LESS PROMOTER
INTRODUCTION 21
MATERIALS AND METHODS 21
Cell culture and DNA transfection 21
Plasmid constructs 22
iv Electrophoretic mobility shift assay (EMSA) 23
Chromatin immunoprecipitation (ChIP) analysis 23
RT (reverse transcriptase)-PCR and quantitative real time RP-PCR 24
(qRT-PCR)
Other methods 24
RESULTS 24
The region from -63 to -25 of the Cat-1 gene promoter is essential for 24
basal expression
Sp1 binds the Cat-1 minimal promoter element both in vitro and in 27
vivo
The minimal promoter is regulated by ATF4 that binds the AARE in 31
the first exon of the Cat-1 gene
DISCUSSION 34
CHAPTER 3: A BIFUNCTIONAL INTRONIC ELEMENT REGULATES THE
EXPRESSION OF THE ARGININE/LYSINE TRANSPORTER
CAT-1 VIA MECHANISMS INVOLVING THE PURINE-RICH ELEMENT
BINDING PROTEIN A (PUR)
INTRODUCTION 37
MATERIALS AND METHODS 39
Cell culture and DNA transfection 39
Plasmid constructs 40
Chromatin immunoprecipitation (ChIP) analysis 41
DNA affinity pull-down assays 41
v RT (reverse transcriptase)-PCR and quantitative real time RP-PCR 42
(qRT-PCR)
Other methods 42
RESULTS 42
The first intron of the Cat-1 gene contains an enhancer element 41
Identification of Pur as a potential INE-binding protein 46
ATF4 and CHOP regulate INE-mediated Cat-1 gene expression 54
during ER stress
Attenuation of Cat-1 transcription during late ER stress requires 57
CHOP
DISCUSSION 61
CHAPTER 4: SIGNIFICANCE AND FUTURE PERSPECTIVES 66
APPENDIX 71
BIBLIOGRAPHY 77
vi LIST OF TABLES
Table Page
1-1 Amino acid transport systems of mammalian cells 3
1-2 Tissue distribution and transport characteristics of expressed CAT 5
transporters
1-3 Core promoter elements and consensus sequence 9
3-1 WT and MUT (INE) biotinylated oligonucleotides 43
3-2 Sequences of RT-PCR and ChIP primers and siRNA 44
3-3 Identification of proteins associated with the WT and MUT (INE) by 50
mass spectrometry
vii LIST OF FIGURES
Figure Page
1-1 The Unfolded Protein Response 16
2-1 A GC-rich motif within the Cat-1 gene promoter is required for 26
transcription
2-2 An Sp1 binding site in the Cat-1 gene promoter is required for efficient 28
transcription
2-3 Sp1 binding is required for induction of Cat-1 transcription during amino 32
acid starvation mediated by the AARE and ATF4
3-1 Identification of a regulatory element in the first intron of the Cat-1 gene 47
3-2 Pur binds the INE to increase Cat-1 gene transcription 52
3-3 ATF4 and CHOP bind to the Cat-1 INE in vivo and modulate 55
transcription
3-4 Inhibition of Cat-1 transcription via the INE during late ER stress 58
requires CHOP
3-5 Working model of the role of the INE in the regulation of the Cat-1 gene 64
transcription during ER stress
viii ACKNOWLEDGEMENTS
I am very grateful and fortunate to have Dr. Maria Hatzoglou as my PhD advisor.
I appreciate her positive comments and outlooks when my experiments didn’t turn out the way we anticipated and her patience and understanding at the time when I was dealing with personal issues. If not for her excellent mentorship, outstanding scientific guidance, and unreserved support, I probably would not be what I am today. Her commitment and enthusiasm toward her research will serve as a model for me for my future career. I hope
I can become the person she envisions and make her proud.
I appreciate the time and the effort Dr. Cheng-Ming Chiang has spent to help me troubleshoot with my experiments.
I appreciate the comments, feedbacks, and assistance from Dr. Martin Snider in preparation of our manuscripts and figures.
I would like to express my deepest gratitude to Drs. Danny Manor, Edith Lerner,
Jonathan Whittaker, and Martin Snider for their valuable time serving on my committee and their insightful comments in helping my research projects progress.
I am thankful to former and present members of Hatzglou’s lab, Agata Toborek,
Alex Lopez, Calin-Bogdan Chiribau, Celvie Yuan, Chuanping Wang, Dawid Krokowski,
Elena Bevilacqua, Francesca Gaccioli, Haiyan Liu, James Fernandez, Lingyin Zhou,
Manas Manity, Mithu Majumder, and Yi Li, for their encouragement and support. It
ix would have been impossible to accomplish this work without their intellectual and
experimental contributions. Thank you all for providing a pleasant environment to do
research.
Lastly, I am grateful for the unconditional love, the support, and the
understanding of my parents, brother, and sister. Your presence is the driving force for
my success and accomplishment.
NOTE: Chapter 3 of this thesis was originally published in Journal of Biological
Chemistry and presented in their entirety. Huang, C. C., Chiribau, C. B., Majumder, M.,
Chiang, C. M., Wek, R. C., Kelm, R. J., Jr., Khalili, K., Snider, M. D., and Hatzoglou, M.
A bifunctional intronic element regulates the expression of the arginine/lysine transporter
Cat-1 via mechanisms involving the purine-rich element binding protein A (Pur alpha). J.
Biol. Chem. 2009; 284, 32312-32320. © the American Society for Biochemistry and
Molecular Biology.
x LIST OF ABBREVIATIONS
AARE Amino Acid Response Element
ARE AU-Rich Element
AS Asparagine Synthase
ATF Activating Transcription Factor
BCL2 B-Cell Lymphoma 2
Bax Bcl-2–associated X
Bak Bcl-2 homologous antagonist/killer
BIM BCL-2-interacting mediator of cell death
BiP Immunoglobulin heavy chain-binding protein
BRE TFIIB-recognition element bZIP basic Leucine Zipper
Cat Cationic Amino Acid Transporter
CATs Cationic Amino Acid Transporters
CBP CREB binding protein
C/EBP CAAT/Enhancer Binding Protein
ChIP Chromatin Immunoprecipitation
CHOP CEBP Homology Protein
CMV Cytomegalovirus
CRE cAMP-response element
CS Calf Serum
DCE Downstream core element
DMEM Dulbecco’s Modified Eagle’s Medium
xi DPE Downstream promoter element
DTT Dithiothreitol
EDEM ER degradation enhancing alpha mannosidase-like
EDTA Ethylenediamine Tetraacetic Acid eIF Eukaryotic Translation Initiation Factor
EMSA Electrophoretic Mobility Shift Assay
ERAD Endoplasmic Reticulum Associated Degradation
ERp57 Endoplasmic reticulum stress protein 57
ERp72 Endoplasmic reticulum stress protein 72
FBS Fetal Bovine Serum
GADD Growth Arrest and DNA Damage-Inducible Protein
GAPDH Glyceraldehyde-3-phosphate Dehydrogenase
Gcn2p General Control Non-derepressable 2 protein
GCN4 General Control Non-derepressable 4
GRP94 Glucose-regulated protein of 94 kDa
GTF General transcription factor
HDAC1 Histone deacetylase 1 hnRNP heterogeneous nuclear Ribonuclear Protein
INE Intronic enhancer element iNOS Inducible nitric oxide synthase
Inr Initiator
IRE1 Inositol-requiring enzyme 1
xii IRES Internal Ribosome Entry Sequence
ITAF IRES Trans-acting Factor
KLF Kruppel-like factor
LAP Liver-enriched transcriptional activating protein
LIP Liver-enriched transcriptional inhibitory protein
LUC Firefly Luciferase kb kilobase
MEF Mouse Embryonic Fibroblast
MTE Motif ten element nNOS Neuronal nitric oxide synthase
NO Nitric Oxide
ORF Open Reading Frame
PCR Polymerase Chain Reaction
PDI Protein disulfide isomerase
PERK PKR-like Endoplasmic Reticulum Kinase
PIC Preinitiation complex
PKU Phenylketonuria
PTB Polypyrimidine Binding Protein
Pur Purine-rich element binding protein alpha
Pur Purine-rich element binding protein beta rLUC Renilla Luciferase
RNAP II RNA polymerase II rRPL27 Ribosomal protein L27
xiii RT-PCR Reverse Transcriptase-dependent PCR
SLC7 Solute Carrier Family 7
Sp Specificity Protein
SWI/SNF Switch/Sucrose nonfermentable
TAF TBA-associated factors
TBP TATA box binding protein
TF Transcription factor
Tg Thasigargin
TRAF2 TNF receptor-associated factor 2
TRB3 Tribbles-related protein 3 uORF upstream ORF
UPR Unfolded Protein Response
UTR Untranslated Region
WT WildType
XBP1 X-box binding protein 1
YB-1 Y-box protein 1
xiv Regulation of Cat-1 Gene Transcription during Physiological and Pathological
Conditions
Abstract
by
CHARLIE HUANG
Expression of the arginine/lysine transporter Cat-1 is highly induced in proliferating and stressed cells via mechanisms that include transcriptional activation. It is shown here that basal expression of the Cat-1 gene is controlled by an Sp1-binding sequence (TCCCCGCCCACAGGGG) within a GC-rich region of the Cat-1 gene. The activity of the promoter is also positively regulated by a stress-response element, AARE, within the first exon of the gene, which binds ATF4, the master regulator of the transcriptional response to stress. A bifunctional DNA element (INE) within the first intron of the Cat-1 gene was identified and characterized in this study. The INE had high sequence homology to an AARE and was shown to act as a transcriptional enhancer in unstressed cells by binding the transcription factor Purine-rich element binding protein A
(Pur). During endoplasmic reticulum stress, binding of Pur to the element decreased and the INE acted as both a positive regulator by binding ATF4 and as a negative regulator by binding the stress-induced C/EBP family member, CHOP. We conclude that transcriptional control of the Cat-1 gene is tightly controlled by multiple cis-DNA elements, contributing to regulation of cationic amino acid transport for cell growth and
xv proliferation. In addition, we propose that genes may use stress-response elements such as the INE, to support basal expression in the absence of stress.
xvi CHAPTER 1
INTRODUCTION
Amino Acids and Amino Acid Transporters
Amino acids serve as building blocks for the synthesis of proteins, as precursors for the synthesis of other biological molecules and as signaling molecules in the regulation of cellular metabolism (1). For example, tryptophan is a precursor for the biosynthesis of the neurotransmitter serotonin that regulates various functions including regulation of mood, appetite, and muscle contraction (2). Another example is the synthesis of nitric oxide from arginine, an effector molecule for the immune response as well as improving blood flow by causing vasodilation (3).
In humans, amino acids are taken up into the body from the diet. There are 20 naturally occurring amino acids. They are classified as essential and non-essential. The essential amino acids are those that cannot be synthesized de novo from ammonium ion and an appropriate carbon source (1). However, depending on the age and health of the individual, non-essential amino acids can become essential when the demand far exceeds de novo synthesis. In infants and growing children, synthesis of cysteine, tyrosine, histidine, and arginine are limited so these amino acids become essential (4). Likewise, tyrosine becomes an essential amino acid in the diet of phenylketonuria (PKU) patients.
Individuals with PKU consume a diet low in phenylalanine to prevent mental retardation and other metabolic complications. In addition, the dietary supply of tyrosine is higher for PKU patients in order to compensate for its decreased synthesis (phenylalanine is the precursor for tyrosine synthesis).
1 Carrier proteins on the plasma membrane mediate amino acid transport into cells.
These proteins are classified into “Systems” based on their functional properties (5, 6).
For example, anionic amino acids are transported either via the sodium-dependent
- -c System X AG or sodium-independent System x . Cationic amino acid transporters include
the sodium-dependent system Bo,+ and y+L and the sodium-independent system bo.+ and y+. These cationic amino acid transporters, with the exception of system y+, can also transport neutral amino acids. Although different transporters can transport the same amino acid, they differ in the transport mechanism, regulatory properties, and substrate specificity as shown in Table 1-1 (5).
System y+ transporters
Although four different transporter systems can transport cationic amino acids
across the plasma membrane, System y+ is the major transporter system that mediates the
exchange of these amino acids at physiological concentrations (7). Members of this
transporter system belong to the subfamily of solute carrier family 7 (SLC7). Four genes
exist within this subfamily: Cat-1 (SLC7A1), Cat-2A and Cat-2B (SLC7A2), Cat-3
(SLC7A3), and Cat-4 (SLC7A4). A summary of the CAT transporters is shown in Table
1-2 (6). With the exception of Cat-4, all family members mediate the Na+-independent transport of the same amino acids but they differ in their tissue expression patterns and substrate affinities. Cat-2a and Cat-2b are different splice variants from the same gene.
The two isoforms differ in a stretch of 43 amino acids with 22 of these residues being conserved (8). Cat-2b is expressed highly in T-lymphocytes and has affinity for arginine uptake that’s 70-fold higher than the liver-enriched, Cat-2a (Km 38μM versus 2.7 mM)
(8). Cat-2 knockout mice are viable and fertile but exhibit reduced NO production by
2 TABLE 1-1
3 TABLE 1-1 (CONT.)
Table 1-1 Amino acid transport systems of mammalian cells. Transmembrane amino
acid transport is catalyzed by a number of discrete systems. The genes encoding and the
proteins responsible for these transport activities are presented (where known). Amino
acid transporters have been extensively reviewed elsewhere and the reader is encouraged
to refer to publications cited in the text. *, Holotransporter formed upon association with
the CD98 glycoprotein encoded by the gene SLC3A1; **, holotransporter formed upon
association with the rBAT glycoprotein encoded by the gene SLC3A2. BCH, -
aminoendobicyclo[2,2,1]heptane-2-carboxylic acid.
(Reproduced with permission, R. Hyde, P.M. Taylor and H.S. Hundal, 2003, Biochem. J. 373(1).1-18 © the Biochemical Society)
4 TABLE 1-2
Table 1-2. Tissue distribution and transport characteristics of expressed CAT
transporters. Tissue distribution for mouse CAT-1, CAT-2, and CAT-2a, for rat CAT-
3, and for human CAT-4 and their corresponding transcript size. Trans-stimulation is the
amount that efflux to a trans-side containing 0 substrate is increased when measured at
100 M trans-side substrate concentration. Apparent Michaelis constant (Km) values were obtained by different labs expressing murine CAT isoforms in Xenopus oocytes. aao, Zwiterionic amino acids; NA, no data available.
(Palacin et al. Physiol. Rev. (1998) 78:969-1054, used with permission)
5 cytokine-activated macrophages indicating the importance of arginine transport via the
Cat-2 transporter as a substrate of inducible nitric oxide synthase (iNOS) (9). Cat-3 was
shown to be expressed in the rat brain and was suggested to transport arginine as a
substrate for the neuronal nitric oxide synthase (nNOS) (10, 11). In humans, Cat-3 is
expressed in different tissues with the highest expression in thymus (12). Furthermore, in
mouse cells deficient for Cat-1, Cat-3 expression is elevated by at least 11-fold and can
functionally compensate for Cat-1 (13). Although Cat-4 was identified based on its
homology with Cat-1 and Cat-2 (14), it does not function as an amino acid transporter
(15).
The cationic amino acid transporter-1 (Cat-1) gene encodes the high-affinity system y+ transporter for the essential amino acids arginine and lysine.Cat-1 supports
vital metabolic functions such as synthesis of proteins, polyamines, and nitric oxide
(reviewed in ref. 16). Unlike the other Cats, Cat-1 is expressed ubiquitously except in the
adult liver. However, its expression varies in different tissues and cell types (17, 18).
Transcription of the Cat-1 gene is modulated by endoplasmic reticulum (ER) stress,
availability of nutrients, cell proliferation, growth factors, and hormones (17, 19).
Physiological Significance of Cat-1
Mice lacking Cat-1 were 25% smaller than wild type littermates, anemic, and died
shortly after birth (20). These findings suggest that Cat-1 plays critical roles in both
hematopoiesis and growth control during mouse development (20). In fact, human Cat-1
was recently shown to be important in erythroid hematopoiesis through its role in
mediating L-arginine transport that is essential for the differentiation of red blood cells
(21). Besides its role in hematopoiesis, arginine supplementation was shown to benefit
6 human health in conditions such as infection, trauma, surgery, or other metabolic and immune-function problems (22). Lysine, another ligand for Cat-1 is an essential amino acid that was shown to be in higher demand than any other essential amino acid in growing mammals (23). Therefore, Cat-1 may be important as the transporter of these cationic amino acids in normal and disease states. In addition, alterations in Cat-1 expression have been linked to diseases. For example, some patients with congestive heart failure have an abnormality in L-arginine transport due to a decreased level of Cat-1 mRNA (24). Furthermore, a recently identified C/U polymorphism in the 3’-untranslated region (3’-UTR) of the human Cat-1 mRNA seems to attenuate its expression level and contributes to hypertension and endothelial dysfunction (25). Elevated Cat-1 expression has also been reported to contribute to the pathogenesis of kidney hyperfiltration in diabetic rats (26). Despite the importance of Cat-1 in cellular metabolism, the determinant(s) for basal expression of the Cat-1 gene are not known.
Gene Transcription in Eukaryotic Cells
DNA is found in the cell nucleus wrapped around core histone proteins to form chromatin. Transcriptional activation requires the unwinding of DNA from this compacted chromatin structure through chromatin remodeling and histone modifications to expose core promoter elements (27, 28). Compilations of eukaryotic promoters have thus far identified seven core promoter elements shown in Table 1-3 (29).
The TATA box is located 25 to 30 nucleotides upstream of the transcription start site. This A/T-rich sequence serves as binding site for the TATA box binding protein
(TBP). The initiator (Inr) is comprised of the pyrimidine-rich sequence that encompasses the transcription start site. This sequence is recognized by TBP-associated factors
7 TAF1/TAF2 components of TFIID and can direct transcription initiation either alone or
in collaboration with the TATA box. Three core promoter elements are found
downstream of the transcription initiation site. These elements are MTE (motif ten
element), DPE (downstream promoter element), and DCE (downstream core element).
TAFs are found to associate with DPE and DCE. However, the protein that functions
through the MTE is still unknown. The last two core promoter elements are found
upstream and downstream of the region between 25 to 30 nucleotides upstream of the
transcription start site called upstream TFIIB-recognition element (BREu) and downstream TFIIB-recognition element (BREd), respectively. As their names suggest, these elements recruit TFIIB which helps to orient the directionality of the PIC.
Promoters may contain various combinations of these core promoter elements. These elements orchestrate the assembly of the general transcription factors (GTFs) and RNA polymerase II (RNAP II) to form the preinitiation complex (PIC) necessary for transcription initiation of protein coding genes (30, 31). Transcription initiation begins with the binding of TBP, a subunit of the TFIID, to the TATA box followed by entry of
TFIIA, TFIIB, PolII/TFIIF, TFIIE, and TFIIH (29).
However, many promoters transcribed by RNAP II (about 68% of the genes) and especially those of housekeeping genes, lack a TATA element. In the absence of this element, the other core promoter elements are able to direct accurate transcription initiation. Additionally, promoters without a TATA box may have regions that are GC- rich and initiate transcription at many sites. These GC-elements may serve as binding sites for members of the specificity factor (Sp) family (32).
Sp1 is a ubiquitously-expressed protein belonging to the family of mammalian
8 TABLE 1-3
Table 1-3. Core promoter elements and consensus sequences. The consensus sequence and positions for each of these core promoter elements is shown with their recruited proteins. n.a., not available.
(Thomas & Chiang. Crit. Rev. Biochem. Mol. Biol. (2006) 41:105-78, used with permission)
9 Sp/XKLF transcription factors characterized by their zinc-finger domains (reviewed in ref. 33, 34). The consensus sequence for Sp1 binding is 5’-
(G/T)GGGCGG(G/A)(G/A)(C/T)-3’ or 5’-(G/T)(G/A)GGCG(G/T)(G/A)(G/A)(C/T)-3’.
Sp1-binding sites are found in numerous genes including genes lacking TATA elements.
Sp1 facilitates binding of TFIID to TATA-less promoters by interacting with TAFs or other transcription factors (35-37).
Gene transcription can be enhanced or repressed by cis-DNA elements through recruitment of transcriptional activators or inhibitors. Activators bind to the enhancer and either alone or in conjunction with accessory proteins de-condense the chromatin structure by acetylation of histones and/or stabilize binding of GTFs to the promoters to enhance transcription. Repressors of transcription do the opposite; they either condense chromatin through methylation and/or deacetylation of histones or prevent stable binding of GTFs to the promoters. In addition, tissue- and cell-specific trans-acting factors can regulate gene transcription. Most eukaryotic genes contain multiple regulatory elements either upstream or downstream of their promoters. The regulatory elements within genes ensure their proper temporal and spatial expression.
Cat-1 Gene Structure
The rattus norvegicus Cat-1 gene consists of 13 exons with the first, second, and part of the third exon giving rise to the 5’-UTR of the mRNA. The promoter of the Cat-1 gene lacks a canonical TATA box suggesting that transcription initiation of the gene is independent of TBP. Two interesting features regarding the rattus norvegicus Cat-1 gene structure are the >50 kb of genomic sequence between the transcription start site and the
AUG initiation codon and the presence of a (TG)30 repeat within the first intron of the
10 gene. Dinucleotide repeats of length 12 are found mostly in the introns of inefficiently
transcribed genes. The repeats inhibit transcription because they tend to change the DNA
topology from B- to Z-form, thus affecting the movement of the RNA polymerase (38,
39). This may explain the low levels of Cat-1 gene expression in most cells and tissues.
In addition, the large spacing between the transcription start site and the translation initiation codon may harbor multiple cis-DNA elements that may influence Cat-1 gene
transcription. The identification and characterization of cis-DNA elements that modulate
Cat-1 gene transcription is one of the objectives of this thesis.
Regulation of Cat-1 expression
Cat-1 is expressed ubiquitously except in the adult liver. Expression of the Cat-1
gene is highly regulated in the liver and other tissues. The absence of Cat-1 protein in the
adult liver is partly due to miR-122, a liver specific microRNA that post-transcriptionally
inhibits translation of the Cat-1 mRNA via its 3’-UTR (40). Furthermore, administration
of insulin, dexamethasone, and partial hepatectomy can induce expression of the Cat-1
gene in quiescent liver cells (18, 41). It has been shown that in rat cells, Cat-1 gene
transcription results in the synthesis of two mRNA species (7.9 and 3.4 kb) due to the
usage of alternative polyadenylation signals (17). However, both mRNA species encode
for the same polypeptide since they do not differ in the sequence of their open reading
frame. In amino acid-depleted cells, the 7.9 kb Cat-1 mRNA increased by 5-fold but no
induction of the 3.4 kb isoform was observed (42). Subsequently, the cytoplasmic
shuttling protein HuR was shown to bind to a cis-regulatory element
UAUUUUAUUUUA in the 3’-UTR beginning at residue 6268 of the rat Cat-1 7.9kb
mRNA, thus increasing its stability (43).
11 Extensive studies have been conducted in understanding the regulation of Cat-1 under conditions of limited amino acids availability. When the extracellular amino acid supply decreases, the tRNAs that deliver amino acids to the translating ribosomes become uncharged due to reduce level of intracellular free amino acids pool. Cells sense these uncharged tRNAs and activate the kinase, general control non-derepressable 2
(Gcn2p). Gcn2p phosphorylates the alpha subunit of eukaryotic initiation factor 2 (eIF2)
(44). Phosphorylated eIF2 becomes tightly associated with eIF2B leading to a decrease
Met in the ternary complex, eIF2-GTP-Met-tRNAi , available for translation initiation and decreased global protein synthesis (45). Although global protein synthesis is decreased, a subset of mRNAs is preferentially translated, such as ATF4 and C/EBP whose function is to induce gene expression during the stress response (46-48). ATF4 induces transcription of genes such as ATF3, CHOP, and AS via short cis-DNA elements, known as the amino acid response elements (AAREs) in the promoter regions of these genes (49, 50).
Under such stress conditions, Cat-1 mRNA and protein levels increase with concurrent increase of transporter activity (51). Transcriptional regulation of the Cat-1 gene during amino acid starvation requires a DNA regulatory element (AARE) within the first exon of the gene that increases Cat-1 mRNA levels by 10-15 fold (52). It was shown that in the early hours of amino acid starvation ATF4 and C/EBP induce transcription via the AARE element, followed by ATF3-mediated transcriptional repression via the same element (53).
Expression of Cat-1 during amino acid starvation is also regulated at the level of translation via a cap-independent mechanism of translation initiation (54). The majority of the translated mRNAs in eukaryotic cells utilize the scanning mechanism. mRNAs are
12 capped at the 5’-end by a m7G cap structure. The eIF4F complex binds this cap structure and recruits the 43S preinitiation complex, comprising the 40S ribosomal subunit, eIF2,
Met GTP and Met-tRNAi , to form the 48S preinitiation complex. This preinitiation complex moves along the 5’-UTR in search of the initiation codon. When the initiation codon is found, the joining of 60S ribosomal subunit occurs forming the 80S ribosome which then is engaged in translation elongation (55). However, some mRNAs can be translated by an alternative translation initiation mechanism through the direct binding of the ribosome to specific mRNA regions known as internal ribosome entry sites (IRESs).
The IRES-dependent translation was first described for translation of viral RNAs during infection of host cells when the cap-dependent translation is hindered (56). A repertoire of cellular mRNAs including transcription factors, kinases, phosphatases, transporters, proto-oncogenes, growth factors and others has also been identified to contain IRESs.
IRES possess complex secondary and tertiary structures, which allow for interactions with IRES transacting factors (ITAFs) and the components of the translational machinery under conditions that compromise cap-dependent translation initiation (54). The Cat-1 mRNA uses this translation initiation mechanism during stress conditions, including the condition of amino acid starvation (19).
The 5’-UTR of the Cat-1 mRNA was shown to contain an IRES whose activity depends on eIF2 phosphorylation and translation of an upstream open reading frame
(uORF) encoding 48 amino acids (57). Translation of the uORF is necessary for the formation of the active IRES within the Cat-1 5’ mRNA leader (58). Furthermore, association of the hnRNA-binding proteins hnRNP L and PTB is required for efficient
13 IRES mediated translation of the Cat-1 mRNA during amino acid starvation, a condition
that causes a global decrease of protein synthesis (59).
The Unfolded Protein Response (UPR) and Cat-1 Expression
Synthesis, modification, and folding of both secretory and membrane-bound
proteins occur in the endoplasmic reticulum (ER). Mechanisms exist to monitor this
process and to protect cells from the accumulation of misfolded proteins. Accumulation
of misfolded proteins can compromise the ER folding capacity, especially in organs or
cells that synthesize large amounts of secreted proteins such as liver, pancreas, and
plasma cells (60). Insults such as overexpression of mutant proteins, nutrient deprivation,
and changes in calcium concentration and the redox state can compromise proper
functioning of the ER (60). The accumulation of unfolded or aggregated proteins in this
organelle results in ER stress and activates the Unfolded Protein Response (UPR)
(reviewed in ref. 61, 62).
Inside the ER lumen, the chaperone GRP78/BiP, binds to unfolded proteins and assists protein folding (63). BiP also binds to three effector proteins in the UPR, PKR- like ER-localized eIF2 kinase (PERK), inositol-requiring enzyme 1 (IRE1), and activating transcription factor 6 (ATF6). However, accumulation of misfolded/unfolded proteins is associated with the release of BiP from these effector proteins, leading to their activation. Activation of PERK results in its homodimerization and autophosphorylation.
Active PERK phosphorylates the alpha subunit of eukaryotic initiation factor 2 at Ser51
(eIF2), which causes a decrease in global mRNA translation initiation and an increase
in translation of the ATF4 mRNA analogous to that of Gcn2p activation by amino acid
deprivation (48). Activation of IRE1 leads to the activation of its endonucleolytic
14 activity that cleaves the XBP1 mRNA leading to a spliced mRNA that encodes the potent bZIP transcription factor XBP1s (64, 65). Finally, release of ATF6 from BiP causes its transport to the Golgi apparatus where it is cleaved by specific proteases to produce the active transcription factor (66). The three arms of the UPR induce the basic leucine zipper (bZIP) transcription factors, ATF4, XBP1, and ATF6 which can form either homodimers or heterodimers with other bZIP proteins and induce gene expression by binding to their respective cis-DNA sequences in the promoters of specific genes (62).
Among the target genes are the ones coding for proteins that promote synthesis of ER resident proteins to assist in protein folding or ER-associated protein degradation
(ERAD) to restore homeostasis within the ER (67). However, under prolonged stress, cells may fail to recover and ultimately are directed towards the apoptotic pathway (68).
A summary of the three effectors of UPR and their regulated targets is shown in Figure 1-
1 (69).
Transcriptional repressors are also induced during the UPR. These repressors include members of the bZIP family, ATF3, CHOP, and TRB3 (70). They can also form homodimers or heterodimers with other transcription factors and repress gene expression either indirectly by sequestering the bZIP transcriptional activators or directly through binding to target genes (71).
The early response to ER stress induces expression of survival proteins that can reduce the level of unfolded proteins and limit the UPR. These include ER chaperones
(BiP, GRP94, and calreticulin) that assist in protein folding and ERAD proteins (PDI,
ERp57, and ERp72) that degrade unfolded proteins (67). However, if cells aren’t able to restore ER homeostasis during the prosurvival phase, apoptosis ensues though the
15 FIGURE 1-1
Figure 1-1. The unfolded protein response. On aggregation of unfolded proteins,
GRP78 dissociates from the three endoplasmic reticulum (ER) stress receptors, pancreatic ER kinase (PKR)-like ER kinase (PERK), activating transcription factor 6
(ATF6) and inositol-requiring enzyme 1 (IRE1), allowing their activation. The activation of the receptors occurs sequentially, with PERK being the first, rapidly followed by
ATF6, whereas IRE1 is activated last. Activated PERK blocks general protein synthesis by phosphorylating eukaryotic initiation factor 2 (eIF2). This phosphorylation enables translation of ATF4, which occurs through an alternative, eIF2-independent translation pathway. ATF4, being a transcription factor, translocates to the nucleus and induces the transcription of genes required to restore ER homeostasis. ATF6 is activated by limited proteolysis after its translocation from the ER to the Golgi apparatus. Active ATF6 is also a transcription factor and it regulates the expression of ER chaperones and X box-binding protein 1 (XBP1), another transcription factor. To achieve its active form, XBP1 must
16 undergo mRNA splicing, which is carried out by IRE1. Spliced XBP1 protein (sXBP1)
translocates to the nucleus and controls the transcription of chaperones, the co-chaperone
and PERK-inhibitor P58IPK, as well as genes involved in protein degradation. This concerted action aims to restore ER function by blocking further build-up of client proteins, enhancing the folding capacity and initiating degradation of protein aggregates.
(Szegezdi et al. EMBO Rep. (2006) 7:880-885, used with permission).
17 activation of caspases. Both, calpain and IRE1/TRAF2 cause caspase activation through
cleavage of procaspase-12 (72, 73). CHOP can also induces cell death by inducing the
expression of BIM, a proapoptotic protein, and suppressing Bcl2 expression, an
antiapoptotic protein (74, 75). Furthermore, Bax and Bak can increase calcium levels
thus altering calcium homeostasis in the cells during ER stress and activate the cell death
machinery (76).
It has been demonstrated that Cat-1 mRNA levels increase and remain elevated
between 0 and 12 h of the UPR followed by a gradual decline thereafter (52, 77). The
transcription factor ATF4 mediates this induction by binding to the AARE (77). Cat-1
transcription is downregulated during the later hours of the UPR by the LIP isoform of
C/EBP (77). C/EBP mRNA generates three different proteins, two of which function
as transcriptional activators (LAP1 and LAP2) whereas the third acts as a transcriptional
repressor (LIP). In the early hours of the UPR, LIP levels decrease while LAP levels
remain elevated leading to increased target gene transcription. However, during the later
hours of the UPR, LIP is stabilized, consistent with inactivation of the proteasome
function that degrades LIP. This increases the ratio of LIP/LAP. Subsequently, LIP was
shown to repress Cat-1 gene transcription during late ER stress by attenuating ATF4- mediated induction (77). The altered ratio of LIP/LAP also affects expression of many stress-response genes including TRB3, CHOP, and GADD34 (77).
Because cells within growing tumors experience ER stress due to the hypoxic
environment (78) and because actively proliferating tumor cells have elevated Cat-1 gene
18 expression (79), we sought to identify additional regulatory mechanisms that influence
Cat-1 gene transcription during ER stress as one of the objectives of this thesis.
19 Objective of the Thesis
The objective of the thesis is to understand the transcriptional regulation of the
Cat-1 gene. To this end, the studies presented here aim to (1) identify the minimal promoter sequence and the transcription factor(s) that are needed to maintain basal expression of the Cat-1 gene; (2) identify regulatory proteins that modulates transcription; (3) identify regulatory sequences for binding by these regulatory proteins.
It is shown here that sequences between -65 and -25 upstream of the transcription start site of the Cat-1 gene are essential for basal expression. These sequences serve as a binding site of the transcription factor, Sp1. Furthermore, the sequence, TGATGCAAC, within intron 1 of the Cat-1 gene enhances basal expression by recruiting the weak transcriptional activator, Pur. We show that during ER stress, this sequence acts as a molecular switch on modulating induction and repression of the Cat-1 gene. In the early hours of ER stress, ATF4 displaces Pur and increases gene transcription. CHOP then replaces ATF4 and attenuates gene transcription during late hours of ER stress.
20 CHAPTER 2
SP1 REGULATES THE CAT-1 TATA-LESS PROMOTER
INTRODUCTION
We have shown earlier that transcription of the Cat-1 gene is mediated by a
TATA-less promoter within the 1.4 kb region upstream of the transcription start site (52).
However, the promoter sequence that drives transcription of this important gene remains unknown. The transcription start site of the Cat-1 gene has to be tightly controlled because it is important in generating the 5’-untranslated region that regulates translation of the Cat-1 mRNA (58, 80). Therefore, studies uncovering the mechanism of transcription start site selection in the TATA-less Cat-1 gene can be of great importance.
It is shown here that sequences between -63 and -25 upstream of the transcription start site of the Cat-1 gene consist of a functional promoter. This sequence is required for recruitment of the transcription factor, Sp1, for directing Cat-1 gene transcription.
Furthermore, this minimal promoter is sufficient to confer to ATF4 regulation through binding to the AARE in the first exon of the Cat-1 gene. Sp1 is required for maximal expression of the Cat-1 gene during stress conditions that we have previously shown to induce expression of the Cat-1 gene.
MATERIALS AND METHODS
Cell culture and DNA transfection
Cells were cultured in high glucose Dulbecco’s modified Eagle’s medium
(DMEM) supplemented with penicillin (100 IU/ml), streptomycin (100 μg/ml), and 2
21 mM L-Gln under a humidified atmosphere of 5% CO2 at 37°C. C6 rat glioma cells were cultured in media supplemented with 5% heat-inactivated fetal bovine serum (FBS) and
5% calf serum. Mouse embryonic fibroblasts (MEFs) were grown in media supplemented with 10% FBS. Embryonic stem cells with homozygous deletions of the
Sp1 gene (a gift from J.M. Boss, Department of Microbiology and Immunology, Emory
University School of Medicine, Georgia, U.S.A.) were grown in -modified Eagle’s medium supplemented with 5% FBS, 1 mM L-Gln, penicillin (50 IU/ml), streptomycin
(50 μg/ml), 1 ng/ml basic fibroblast growth factor, and 4 μg/ml insulin (81). Because a
WT line was not available, MEFs from the same genetic background were used as a control. Fugene 6 HD (Roche Applied Science) was used to transfect cultured cells according to the manufacturer’s instructions. Expression plasmids for -galactosidase were co-transfected to monitor transfection efficiency (19). Luciferase (LUC) and - galactosidase activities were measured as described previously (19). Depletion of amino acids and induction of ER stress were performed as described (19, 77).
Plasmid constructs
The CMVmin and PA1.4/Cat-1 5’-UTR LUC reporters were constructed as described (19, 52). The promoterless vector was generated by re-ligation of the vector remaining after digestion of CMVmin with XhoI and EcoRI. Promoterless/Cat-1 5’-UTR was generated by PCR-directed mutagenesis to remove the 1.4 kb sequence upstream of the Cat-1 exon1. The 5’-end truncation constructs were generated by PCR using
PA1.4/Cat-1 5’-UTR as a template and were inserted between the XhoI and NcoI sites in the CMVmin plasmid. Mutations in these vectors were generated using PCR-directed mutagenesis. Regions of the Cat-1 promoter (-63 to -1) without or with mutations in GC-
22 rich regions were cloned in a vector lacking any promoter activity (pGL3-Basic,
Promega) to generate constructs 13 and 13m, respectively. Constructs 13-AARE and
13m-AARE contained three copies of the Cat-1 exon 1 AARE (53) were subcloned into the SalI site of the enhancer region of this vector. The expression vector for Sp1 was from Dr. Duna Massillon and for XBP1u, XBP1s, IRE1, and ATF6 were from Dr.
Randal Kaufman.
Electrophoretic mobility shift assay (EMSA)
Double-stranded DNA oligonucleotides containing the Cat-1 basal promoter sequence, Cat-1 (WT) and Cat-1 mutant (Sp1 MUT) are
GGTGTCCCCGCCCACAGGGGCGCGGCCGCG and
GGTGTCCCCTTTAAATTTTTCGCGGCCGCG (underlined sequences denote mutated
sequences of WT oligonucleotides), were radiolabeled with [-32P]ATP using T4
polynucleotide kinase. For each binding reaction, 5 μg of C6 nuclear extract or 50 ng of
recombinant Sp1 protein was incubated in 20% glycerol, 40 mM Tris-HCl (pH 7.5), 5
mM MgCl2, 100 mM NaCl, 0.01% IGEPAL CA-630 (Sigma), 1 mM dithiothreitol, and
20 mg/ml poly(dI-dC) for 1 h at 4°C. Competition assays were performed using a 50-
fold excess of unlabeled WT or Sp1 MUT oligonucleotides. Products were resolved on
4% non-denaturing polyacrylamide gels, dried and analyzed using the Storm
Phosphorimager system (GE Healthcare).
Chromatin immunoprecipitation (ChIP) analysis
Chromatin immunoprecipitation analysis was performed on nuclear extracts as
described (53) using normal IgG or antibodies to RNA polymerase II (N-20) and Sp1
(Santa Cruz Biotechnology). Immunoprecipitated and purified DNA fragments were
23 analyzed by PCR. The primers used for Cat-1 promoter were 5’-
TCGGTTGGGGCTGCTGAGGACCAA-3’ (forward) and 5’-
TTTCATCAGCCGCGCGCCGCCCT-3’ (reverse); for Cat-1 exon 13: 5’-
AGCAAACCTGAGCAGTAAAGTGCT-3’ (forward) and 5’-
CGGACTTAATCTAATGTCATTGTA-3’ (reverse).
RT (reverse transcriptase)-PCR and quantitative real time RT-PCR (qRT-PCR) analysis
cDNAs were synthesized from RNA samples using Superscript III First-Strand
Synthesis SuperMix for qRT-PCR (Invitrogen) as described (53, 77). Real-time PCR was performed using an iCycler (BioRad) and SYBR GreenER qPCR SuperMix for the iCycler (Invitrogen) according to the manufacturer’s instructions. The primers used for
GAPDH: 5’-ACTTTGGCATCGTGGAAGGG-3’ (forward) and 5’-
TCATCATACTTGGCAGGTTTCTCC-3’ (reverse); for Cat-1: 5’-
CTTTGGATTCTCTGGTGTCCTGTC-3’ (forward) and 5’-
GTTCTTGACTTCTTCCCCTGTGG-3’ (reverse).
Other Methods
Total cell and nuclear extracts were prepared as described (77, 80).
RESULTS
The region from -63 to -25 of the Cat-1 gene promoter is essential for basal expression
The presence of a dominant transcription start site for the rat Cat-1 gene and the absence of a TATA box (52) suggested that a cis-DNA element may mediate Cat-1 gene
24 transcription initiation by binding a member of the Sp/XKLF family of transcription factors. To test this hypothesis, we first compared the strength of the Cat-1 gene promoter to the CMVmin-TATA box-containing promoter (Fig. 2-1A). We used the previously-reported chimeric construct (53) that contains 1.4 kb of genomic DNA upstream of the Cat-1 transcription start site and 270 bp of the 5'-UTR containing the first three exons linked to a LUC reporter (Figs. 2-1A, PA1.4/Cat-1 5’-UTR and 2-1B, construct 1). We previously showed that the first exon of the gene contains regulatory elements for transcriptional control during stress (53). Promoter activities were determined by LUC assays in transiently transfected C6 rat glioma cells. LUC activity in cells transfected with the Cat-1 promoter construct was higher than with the promoterless or the promoterless/Cat-1 5’UTR-containing constructs (Fig. 2-1A). However, LUC activity was 2.8-fold lower than the CMV minimal promoter harboring a typical TATA box (Fig. 2-1A). These data suggest that the 1.4 kb genomic region of the Cat-1 gene contains a weak TATA-less promoter, which is in agreement with the weak Cat-1 expression in fed cells (52).
To define the region of the Cat-1 promoter necessary for basal expression, we made a series of 5’-end truncation constructs and tested their activity in C6 cells. The promoter activity severely decreased in constructs that contained less than 63 nucleotides upstream of the transcription start site (Fig. 2-1B, constructs 8 and 9). These results indicate that the GC-rich region between -63 and -25 is necessary for basal promoter activity. To further examine the relevance of this GC-rich region for promoter activity, we generated mutations in the three GC boxes within the (-481)/5’-UTR construct (Fig.
2-1C, constructs 2, 10, 11, and 12). The promoter activity decreased in the construct with
25 FIGURE 2-1
A promoterless
CMVmin promoterless/ Cat-1 5’-UTR PA1.4/ Cat-1 5’-UTR 02468 LUC/β-GAL
B construct -1400 +270LUC 1 uORF -481 2 -408 3 -337 4 -191 5
-148 6 -63 7 -25 8 +14 9 0123 LUC/β-GAL
C LUC -481
construct GC-I GC-III GC-II -113AAGGGCGCGCGCGGGAGGCGCCCAAGGCGGCGGGGA-78...-63TGTCCCCGCCCACAGGGGCGCGGCCGCGC-35 2
-113AAGttCGCGCGCGttAGGCGCttAAttCGGCttGGA-78...-63TGTCCCCGCCCACAGGGGCGCGGCCGCGC-35 10
-113AAGGGCGCGCGCGGGAGGCGCCCAAGGCGGCGGGGA-78...-63TGTCCCCGCCCACAGGGGtttatttaCGC-35 11
-113AAGGGCGCGCGCGGGAGGCGCCCAAGGCGGCGGGGA-78...-63TGTCCCCtttaAatttttCGCGGCCGCGC-35 12 0 0.5 1 1.5 LUC/μg protein
Figure 2-1. A GC-rich motif within the Cat-1 gene promoter is required for transcription. (A-C) The indicated vectors were transfected into C6 glioma cells along with an expression plasmid for -gal (-GAL) to normalize for transfection efficiency except in (C) where protein content was used for normalization. Enzymatic activities were measured in cell extracts 48 h post-transfection. Means ± SEM from triplicate experiments is shown for all transfection experiments.
26 mutations in the sequence -56GCCCACAGGGG-46 (construct 12), but not with mutations
in the other GC boxes. We conclude that the sequence between -63 and -25 constitutes
the Cat-1 basal promoter and the GC box at the 5’-end of this sequence is required to
support basal transcription.
Sp1 binds the Cat-1 minimal promoter element both in vitro and in vivo.
To determine the transcription factors that bind to the basal promoter, we scanned
the -63 to -25 region using MatInspector software (Genomatix). A putative Sp1 binding
site was identified in the promoter region corresponding to the GC box that is required
for promoter activity. To investigate the role of Sp1 in Cat-1 gene transcription driven by
this sequence, we cloned the fragment (-63 to -1) into the promoterless pGL3-Basic
vector (construct 13) and compared its activity to a construct with a mutation in the
putative Sp1 binding site (construct 13m) (Fig. 2-2A). In order to specifically examine
the effect of the introduced sequences and not the sequences of the cloning vector, the
data were expressed as the ratio of LUC activity from cells transfected with construct 13
to 13m. Transient transfection of these constructs showed a 5-fold difference between construct 13 and 13m (Fig. 2-2B, CONTROL). Furthermore, Sp1 overexpression caused an additional 3-fold increase in the ratio of 13/13m (Fig. 2-2B, Sp1). To further determine the significance of Sp1 in regulating Cat-1 gene transcription, we compared the levels of the Cat-1 mRNA in Sp1-/- and WT cells using qRT-PCR. The Cat-1 mRNA
levels in the Sp1-/- cells were 17% of the WT cells (Fig. 2-2C). Western blotting for Cat-
1 protein using cell extracts derived from these cell lines showed comparable results (data
not shown). Our results suggest that Sp1 is required for the basal transcription of the
Cat-1 gene.
27 FIGURE 2-2
A D E
Cat-1 promoter (-1 to -63) in pGL3-Basic C6 extract - + + + Recombinant Sp1 - + + + WT - - + - WT - - + - -63 SP-1 13 LUC Sp1 MUT - - - + Sp1 MUT - - - +
13-AARE 3x AARE -63 13m LUC 13 m-AARE 3x AARE
B 10 * 8
m 6
13/13 4
2
0 CONTROL Sp1
C 1.2 Cat-1 probe Cat-1 probe
0.8
0.4 Cat-1/GAPDH
0 Sp1-/- Sp1+/+
F G -/- 6 Sp1 Sp1+/+ Cat-1 promoter 5 4 Cat-1 exon 13 3 1:100 Input - - Ab Pol II IgG Sp1 2 Cat-1/GAPDH 1 0 CON 3 6 63
Starved (h) Tg (h)
28 Figure 2-2. An Sp1 binding site in the Cat-1 gene promoter is required for efficient
transcription. (A) Constructs used in this study. (B) C6 cells were transfected with construct 13 or 13m without (CONTROL) or with Sp1 expression plasmids. LUC assays were performed and normalized to protein content. Data are expressed as the ratio of
13/13m. The significance of differences among means was evaluated using the unpaired t-
test; * denotes p < 0.05 between Sp1 and CONTROL samples. (C) Cat-1 mRNA levels in
Sp1-/- and Sp1+/+ cells. Data from qRT-PCR analysis of total RNA using gene-specific primers were normalized to the GAPDH mRNA signal. EMSA were performed by incubating a 32P-labeled double-stranded oligonucleotide containing the Sp1 site of the
Cat-1 gene with nuclear extracts from C6 cells (D) or recombinant Sp1 (E). (D, E)
Competition assays with unlabeled Cat-1 (WT) or Cat-1 mutant (Sp1 MUT) oligonucleotides. (F) ChIP was performed using C6 cells with antibodies against RNA polymerase II (Pol II) and Sp1. Samples without antibody (-Ab) or with normal rabbit
IgG were used as negative controls. PCR was performed with primer sets specific for the regions of interest. (G) Cat-1 mRNA levels in Sp1-/- and Sp1+/+ either amino acids starved
or thapsigargin treated for the indicated time. Means ± SEM from triplicate experiments
is shown for B, C, and G. Representative gel from triplicate experiments is shown for D
and E.
29 We next determined the sequence-specific binding of Sp1 to a 32P-labeled double- stranded oligonucleotide containing the putative Sp1 binding site using EMSA (Fig. 2-
2D). Competing oligonucleotides were used to confirm the specificity of the complexes.
The appearance of slowly migrating complexes was observed when nuclear extracts from
C6 cells were incubated with an oligonucleotide containing the Cat-1 Sp1 binding site
(Fig. 2-2D). These complexes were effectively competed by an excess of unlabeled WT but not mutant (Sp1 MUT) oligonucleotide (Fig. 2-2D). In addition, similar complexes were observed when recombinant Sp1 protein was incubated with the WT oligonucleotide (Fig. 2-2E, compare lane 2 with lane 2 of Fig. 2-2D). Again, these complexes were effectively competed by an excess of unlabeled WT but not Sp1 MUT oligonucleotide (Fig. 2-2E).
To obtain direct proof of Sp1 binding to the Cat-1 promoter in vivo, we performed
ChIP analysis. Chromatin from C6 glioma cells was immunoprecipitated with antibodies to Sp1, Pol II, or IgG, and DNA fragments containing the Sp1 binding site within the promoter region or the thirteenth exon of the Cat-1 gene (used as control) were amplified by PCR (Fig. 2-2F). In agreement with the EMSA results, Sp1 bound only the minimal promoter region and not the thirteenth exon of the gene. Pol II was present within the
Cat-1 thirteenth exon demonstrating that the absence of Sp1 within this region is not due to difficulty in PCR amplification. Furthermore, lack of PCR amplification in both regions from samples with no antibody or immunoprecipitated with normal IgGs confirmed the specificity of the immunoprecipitation. These results clearly demonstrate that the Cat-1 promoter contains a functional Sp1 binding site.
We also determine the importance of Sp1 in Cat-1 gene transcription during stress
30 conditions that we have previously shown to induce expression of the Cat-1 gene (52).
Induction of Cat-1 mRNA levels during ER stress and amino acid deprivation as
compared to control condition were similar between WT and Sp1-/- cells. However, the absolute amount of Cat-1 mRNA during stress conditions were at least 2-fold lower in cells lacking Sp1 as compared to WT cells (Fig. 2-2G). These results indicated that Sp1 is dispensable for Cat-1 mRNA induction during stress conditions, but, Sp1 is necessary for maximal induction of Cat-1 mRNA levels under these conditions.
The minimal promoter is regulated by ATF4 that binds the AARE in the first exon of the Cat-1 gene.
We previously showed that during amino acid starvation, Cat-1 is transcriptionally induced via the bZIP transcription factors C/EBP and ATF4 through the AARE within the first exon of the gene (53). To examine whether the AARE confers the same regulation in the presence of the minimal Cat-1 promoter, we inserted three tandem repeats of this element downstream of the LUC open reading frame in constructs
13 and 13m (Fig. 2-2A, 13-AARE and 13m-AARE). The effects of amino acid starvation
(Fig. 2-3A) and ATF4 cotransfection (Fig. 2-3B) on AARE-mediated transcriptional induction from the minimal promoter were determined in transiently transfected C6 cells.
The AARE was indispensible for induction of the minimal promoter by amino acid starvation and ATF4 (Figs. 2-3 A and B). In contrast, the absence of an Sp1 binding site in 13m and 13m-AARE renders them unresponsive to starvation (Fig. 2-3A). The
observed induction of LUC activity from construct 13m-AARE when ATF4 was over-
expressed (Fig. 2-3B) may involve recruitment of the Pol II transcription complex by
ATF4 in the artificial setting of the expression vector system (82). We further confirmed
31 FIGURE 2-3
A 5 FED 4 Starved
3
2
LUC/ μ g protein 1
0 13 13-AARE 13m 13m-AARE
B 36 Control ATF4 20
4
2 LUC/ μ g protein
0 13 13-AARE 13m 13m-AARE
C 3 FED Starved
2
1 Relative to FED
0 +/+ -/- ATF4 ATF4
32 Figure 2-3. Sp1 binding is required for induction of Cat-1 transcription during amino acid starvation mediated by the AARE and ATF4. (A, B) C6 glioma cells were transiently transfected with the indicated constructs (Fig. 2A) and (C) ATF4+/+ or ATF4-/-
MEFs were transfected with 13-AARE. (A, C) Cells were incubated for 9 h under amino
acid fed or starved condition. (B) Cells were co-transfected with an expression plasmid
for ATF4. (A-B) LUC activity was normalized to protein content. (C) Data are expressed
relative to the amino acid fed condition where the LUC activity was first normalized to
the co-transfected Renilla luciferase activity and then expressed over protein content.
Means ± SEM from triplicate experiments is shown.
33 ATF4-dependent induction of the 13-AARE construct by amino acid starvation using
ATF4-/- MEFs. As expected, amino acid starvation caused a 2.5-fold induction in LUC activity with the 13-AARE construct in WT MEFs but no induction was observed in
ATF4-/- MEFs (Fig. 2-3C). Our results show for the first time, that the Sp1 site within the
Cat-1 promoter is regulated by amino acid starvation via the ATF4-AARE interaction.
DISCUSSION
In our previous studies, we demonstrated that Cat-1 gene expression is under the control of a TATA-less promoter, consistent with its low expression in most tissues (52,
53). In the present study, we characterized the Cat-1 basal promoter. These findings are supported by the following results: (i) the region -63 to -25 nt upstream of the transcription start site contains a GC-rich motif that is essential for promoter activity; (ii) the trans-activator Sp1 bound the GC-rich motif of the Cat-1 promoter both in vivo and in vitro, as demonstrated by ChIP and EMSA studies; (iii) the minimal promoter is sufficient to confer transcriptional regulation during amino acid limitation by the AARE and ATF4; (iv) Sp1 is not necessary for induction of Cat-1 gene transcription during amino acid starvation or the UPR.
TATA-less genes (~68% of the protein-encoding human genes) have alternative mechanisms for recruitment of the polymerase and the subsequent transcription initiation
(29) that involve GC and CCAAT boxes. Some GC boxes in TATA-less promoters have been shown to bind the transcriptional activator Sp1, which can interact with TFIID via direct binding of the TATA-box binding protein (TBP) or the TFIID subunits TAF4 and
TAF7 (35). Sp1 has also been implicated in chromatin remodeling through its interaction
34 with HDAC1, CBP/p300, and the SWI/SNF complex, resulting in activation or inhibition
of gene transcription. We have previously shown that the Cat-1 promoter is GC rich and
contains several putative binding sites for the Sp/KLF (Kruppel-like factor) transcription
factor family (83). Our finding that a single GC box is the major determinant of Cat-1
basal promoter activity indicates the lack of synergism with other putative GC boxes in
the promoter. It also suggests that Sp3, which represses Sp1-mediated activation of
promoters with more than two Sp1-binding sites (84), does not negatively regulate Cat-1.
The single Sp1 binding site in the Cat-1 promoter is also consistent with our previous
identification of a predominant transcription start site (52).
The importance of Sp1 in basal Cat-1 gene expression was demonstrated by the 6-
fold decrease of Cat-1 mRNA levels in Sp1-/- cells (Fig. 2-2C). Furthermore, although
the extent of induction of Cat-1 mRNA levels by amino acid starvation and ER stress was
similar in WT and Sp1-/- cells (Fig. 2-2G), the absence of Sp1 resulted in lower Cat-1
mRNA levels under all conditions. This suggests that Sp1 is required for efficient Cat-1
transcription under basal and stress conditions, but is not involved in the induction by
stress. The expression of Cat-1 in Sp1-/- cells may be due to binding of the functionally similar but weaker trans-activator Sp3 to GC boxes (34). The binding of Sp proteins to
GC boxes in stress-induced gene expression has also been reported for the TATA- containing AS gene (85).
The levels and activity of Sp proteins are regulated during stress (34). For example, oxidative stress increases both the level and the DNA-binding activity of Sp1 and Sp3 in cortical neurons (86). This induction may promote neuronal survival by activating Sp1-mediated transcription of anti-apoptotic genes (86). Cat-1 is expressed in
35 cortical neurons and arginine transport is an important defense mechanism against
oxidative stress (87). It is therefore possible that the Cat-1 gene is part of the Sp1-
mediated survival response during oxidative stress.
The significance of Sp1 in Cat-1 gene expression is highlighted by the regulation
of this gene during cell growth and physiological stress (16). We have previously shown
that the stress-induced transcription factor ATF4 enhances Cat-1 expression by binding to
the AARE (53). It is shown here that the AARE/ATF4 regulatory system can also
increase Sp1-mediated transcription of the minimal promoter (Fig. 2-3).This regulatory mechanism may function during various physiological states and in development.
Cat-1-/- mice develop severe anemia and die within a few hours of birth. The major deficiency is impairment in erythrocyte maturation (20). Interestingly, a similar phenotype was observed in Sp1+/-/Sp3+/- and ATF4-/- mice (88, 89). Because of these
similarities, the Cat-1 gene may be a target of Sp1 and ATF4 in fetal liver that is
important for hematopoiesis.
36 CHAPTER 3
A BIFUNCTIONAL INTRONIC ELEMENT REGULATES THE EXPRESSION
OF THE ARGININE/LYSINE TRANSPORTER CAT-1 VIA MECHANISMS
INVOLVING THE PURINE-RICH ELEMENT BINDING PROTEIN A (PUR)
INTRODUCTION
Transcriptional control is an important mechanism for induction of Cat-1 gene
expression under different hormonal or nutritional needs, including stress conditions that
increase the phosphorylation of translation initiation factor eIF2 and decrease global
protein synthesis (16, 54). Under stress conditions, expression of the Cat-1 gene is
regulated at multiple levels: (i) transcriptional control via an amino acid response element
(AARE) located in the first exon of the gene (52, 53); (ii) control of mRNA decay via the
binding of the HuR protein to an AU-rich element within the 3’-UTR (43); (iii)
translational control of Cat-1 mRNA via a cap-independent initiation mechanism
involving an internal ribosome entry site (IRES) (58, 90). Additionally, miR-122, a liver
specific microRNA has been suggested to post-transcriptionally inhibit translation of the
human Cat-1 mRNA via the 3’-UTR (40). The miR-122-mediated repression was
relieved under different stress conditions. However, little is known about the
mechanisms that regulate Cat-1 mRNA levels under normal/unstressed conditions.
It is shown here that an intronic enhancer element (INE), TGATGAAAC, in the first intron of the gene plays a key role in regulating transcription of the TATA-less Cat-1 promoter. The INE increases promoter activity in unstressed conditions by binding purine-rich element binding protein A (Pur).
37 Pur is a member of the Pur protein family that includes Pur, and two isoforms
of Pur that arise from the usage of alternative polyadenylation sites (reviewed in ref. 91).
Pur was initially identified in HeLa cells as a protein that binds to a sequence element,
PUR, near the center of the initiation of DNA replication upstream of c-Myc gene (92).
Subsequently, both the human and mouse Pur cDNAs were cloned (93, 94). The peptide sequences of the two homologues differ only by 2 amino acid residues. Analysis of the amino acid sequences revealed three class I repeats and two class II repeats which are prevalent among DNA binding proteins. In addition, biochemical analysis demonstrated helix-unwinding ability of the protein independent of ATP (95).
Inactivation of Pur gene in mouse revealed its importance in postnatal brain development. Pur-/- mouse appears normal at birth but developed neurological problems and failed to survive pass week four due to lack of precursor cells proliferation in the brain cortex, hippocampus, and cerebellum (96).
Pur interacts with both DNA and RNA either directly or via regulatory proteins to control processes in DNA replication, gene transcription, RNA localization, and mRNA translation (reviewed in ref. 91). Canonical binding sites for the protein are
(GGN)n>(GGNN)n>(GGNNN)n where N is not a G. Depending on the genes, recruitment of Pur to promoter region can either function as activator or repressor of gene expression. Examples of Pur mediated transcriptional activation include 2- integrin promoter under hypoxic condition, human JC polyomavirus early promoter and recruitment of YB-1 for transition to late promoter activity at the late phase of infection, and myelin basic protein during brain development (97-99). In opposition, inhibition of transcription by Pur includes repression of alpha-myosin heavy chain during heart
38 failure, of somatostatin gene by suppressing the enhancer activity of cAMP-response
element (CRE)-mediated transcription, as well as down-regulation of its own
transcription (100-102).
We also show that the INE plays a bifunctional role during the UPR. In early ER
stress, it stimulated transcription by binding ATF4, whereas, it inhibited transcription by
binding the transcription factor CHOP during prolonged stress. Our findings suggest that
the regulated binding of Pur, ATF4, and CHOP to the INE plays a key role in Cat-1
gene expression in physiological and pathological states.
MATERIALS AND METHODS
Cell culture and DNA transfection
Cells were cultured in high glucose Dulbecco’s modified Eagle’s medium
(DMEM) supplemented with penicillin (100 IU/ml), streptomycin (100 μg/ml), and 2
mM L-glutamine under a humidified atmosphere of 5% CO2 at 37°C. C6 rat glioma cells
were cultured in media supplemented with 5% heat-inactivated fetal bovine serum (FBS)
and 5% calf serum. Mouse embryonic fibroblasts (MEFs) with or without homozygous
deletions of the Pur gene (96) or the CHOP gene (103) were grown in media supplemented with 10% FBS. Fugene 6 HD (Roche Applied Science) was used to transfect cultured cells according to the manufacturer’s instructions. Expression plasmids for -galactosidase or Renilla luciferase were co-transfected to control for transfection efficiency (19). Luciferase and -galactosidase activities were measured as described previously (19). Lipofectamine 2000 Transfection Reagent (Invitrogen) was used for transfections with siRNAs (Dharmacon) according to the manufacturer’s protocol.
39 Briefly, cells were transfected with 50 nM siRNA using 5 μl Lipofectamine per ml, and
used for experiments after 48 h or as indicated. Induction of ER stress was performed as
described (19, 77).
Plasmid constructs
Construct 1 was constructed from CMVmin pUHD 10-3 containing luciferase
(LUC) and the Cat-1 promoter vector, PA1.4/Cat-1 5’-UTR as described (19, 52). PCR
amplification was used to generate two fragments: (i) a fragment containing the Cat-1
exon 1 and 296 nucleotides from the 5’-splice site of intron 1 including the splice donor
site and (ii) a fragment containing exon 2 and 316 nucleotides upstream of the 3’-splice
site of intron 1 including the splice acceptor site. Fragments (i) and (ii) were introduced
into construct 1 to generate construct 2. Construct 3 was generated by a PCR-based
strategy to replace the chimeric intron 1 in construct 2 with the intron from the pCAT-3
control vector (Promega). Construct 2del was generated by PCR looping, removing
nucleotides 64 to 298 downstream of the exon1/intron1 junction. Construct 3ins was generated by PCR, introducing the same nucleotides that were removed from construct
2del into construct 3 near the 5’-splice site of the heterologous intron. Constructs 2mut and
3ins/mut were generated by PCR-directed mutagenesis of constructs 2 and 3ins, respectively,
using a primer containing a mutation of the INE sequence (TGATGCAAC to
TGTAACCAC). Constructs 4 and 4mut were prepared by ligating an oligonucleotide
containing either 3xWT-INE or 3xMUT-INE (Table 3-1) into the Sal I enhancer site of
the pGL3-promoter vector (Promega). Constructs 5 and 5mut were previously described
(53). Mouse CHOP cDNA was cloned into pcDNA3.1 (Invitrogen) via the EcoRI site to generate the CHOP expression vector. The expression vector for ATF4 was from D. Ron
40 (104).
Chromatin immunoprecipitation (ChIP) analysis
Chromatin immunoprecipitation analysis was performed as described (53) using a
Sonic Dismembrator 550 (Fisher Scientific) at setting 4 and 15-20% duty cycle. Nuclear extracts were sonicated with 8 cycles of 1 s pulse and 1 s rest for 2 min with 2 min cooling between cycles. Antibodies (2 μg) were added for immunoprecipitation. ATF4 and CHOP antibodies were from Santa Cruz Biotechnology. Pur antibodies were from
Dr R. J. Kelm (105, 106). Immunoprecipitated and purified DNA fragments were analyzed by PCR and qPCR. Regions encompassing the Cat-1 exon 1 AARE and intronic element were amplified. The PCR primers used are listed in Table 3-2.
DNA affinity pull-down assays
HeLa nuclear extracts were loaded onto a phosphocellulose column and eluted with increasing KCl concentration as described (107). The fraction eluted with 0.5 M
KCl was used to purify proteins that interact with the intronic element. The eluted nuclear extracts and biotinylated double-stranded DNA oligonucleotides containing three copies of WT-INE or MUT-INE (Table 3-1) were incubated in binding buffer (20mM
Tris pH 8.0, 20% glycerol, 0.2mM EDTA pH 8.0, 100mM KCl, 1mM DTT, 0.5mM
PMSF, and 3 μg poly(dI-dC)). The complexes were captured by incubation for 20 min at room temperature with 25 μl magnetic beads (Dynabeads® M-280 Streptavidin,
Invitrogen). Beads were washed 4 times with binding buffer and the associated proteins were eluted in 50 μl 1X SDS-PAGE sample buffer and resolved by SDS-PAGE. The regions of interest were excised from the Coomassie Brilliant Blue-stained gel and analyzed by liquid chromatography/mass spectrometry at the Cleveland Clinic
41 Foundation Mass Spectrometry Facility. Alternatively, nuclear extracts from Pur-/- or
Pur-/+ MEFs were incubated with 3xWT-INE or 3xMUT-INE oligonucleotide as
described above and isolated proteins were separated by SDS-PAGE and analyzed by
Western blotting.
RT (reverse transcriptase)-PCR and quantitative real time RT-PCR (qRT-PCR)
analysis
cDNAs were synthesized from RNA samples using Superscript III First-Strand
Synthesis SuperMix for qRT-PCR (Invitrogen) as described (53, 77). Real-time PCR
was performed using iCycler (BioRad) and SYBR GreenER qPCR Supermix for the
iCycler (Invitrogen) according to the manufacturer’s instructions. PCR primers used are
listed in Table 3-2.
Other Methods
Total cell and nuclear extracts were prepared as described (77, 80). Proteins
were detected on Western blots with primary antibodies specific for Pur (E. M. Johnson)
or Pur and Pur (R. J. Kelm), tubulin (Sigma), and CHOP (Santa Cruz Biotechnology)
and visualized after incubation with horseradish peroxidase-conjugated secondary
antibody (Perkin Elmer).
RESULTS
The first intron of the Cat-1 gene contains an enhancer element
During work on a related research project, we identified a putative enhancer
element in the first intron of the Cat-1 gene. In order to characterize its function, we
constructed a truncated version of intron 1 in its natural position between exons 1 and 2
42 Table 3-1
The oligonucleotide names and their corresponding sequences are listed in the table.
Underlined lower-case letters denote mutated nucleotides.
WT and MUT (INE) biotinylated oligonucleotides Name Sequences WT-INE TGATGCAAC MUT-INE TGtaaCcAC
3xWT-INE (GCGTGGTGCATGATGCAACAGCGGGAGGGA)3
3xMUT-INE (GCGTGGTGCATGtaaCcACAGCGGGAGGGA)3
43 Table 3-2
The sequences of primers and siRNA used in this study are listed in the table.
Sequences of RT-PCR and ChIP Primers and siRNA mRNA Sequence 18S Forward 5’-CAACAACTGGGCTAAGGGTCACTAC-3’ Reverse 5’-CACCACATCCAAGACAGAGTCAACC-3’ AS Forward 5’-TTGACCCGCTGTTTGGAATG-3’ Reverse 5’-CGCCTTGTGGTTGTAGATTTCAC-3’ -GAL Forward 5’-ATCTCTATCGTGCGGTGGTTGAACTG-3’ Reverse 5’-ATGACCTGACCATGCAGAGGATGATG-3’ Cat-1 Forward 5’-CTTTGGATTCTCTGGTGTCCTGTC-3’ Reverse 5’-GTTCTTGACTTCTTCCCCTGTGG-3’ GAPDH Forward 5’-ACTTTGGCATCGTGGAAGGG-3’ Reverse 5’-TCATCATACTTGGCAGGTTTCTCC-3’ Cat-1 5’-UTR/LUC Forward 5’-ATCCCCTCAGCTAGCAGGTGTGA-3’ Reverse 5’-TTTCTTTATGTTTTTGGCGTCTTC-3’ rRPL27 Forward 5’-GCAAGAAGAAGATCGCCAAG-3’ Reverse 5’-CGCTCCTCAAACTTGACCTT-3’ ChIP Primers Sequence Forward 5’-CGCTGTCATTGGTGCCTGGGAAG-3’ Cat-1 exon1 AARE Reverse 5’-GGAATCCGAGCCGGTTTCATCAG-3’ Forward 5’-CGCCTCCTCCGAGTCCATCTTG-3’ Cat-1 INE Reverse 5’-CCAGGTCGCCCGTGCTCAC-3’ siRNA Sequence Pur 5’-GUUUCUACCUGGACGUGAA-3’ 5’-GCGACUACCUGGGCGACUU-3’ 5’-ACAAGUACGGCGUGUUUAU-3’ 5’-GGAAGAAGAUUGAUCAAAC-3’
44 (Fig. 3-1A, construct 2).
Construct 2, which contains the Cat-1 mini-intron, was generated by inclusion of a 618 bp fragment that combined the 5’- and 3’-ends of intron 1 (intron 1 is > 20 kb) in construct 1. Construct 2 produced 5-fold higher LUC activity and mRNA in C6 cells compared to the intronless construct 1 (Fig. 3-1C). RT-PCR detected the mRNA species derived from splicing of the mini-intron (data not shown). It was possible that the enhanced expression of construct 2 was due to a cryptic promoter element in intron 1, or pre-mRNA splicing, which may stabilize the chimeric Cat-1-LUC mRNA and enhance its translation (108). Alternatively, intronic sequences may contain enhancer elements that support transcription from the upstream promoter. We first determined that the intronic sequence does not contain a cryptic promoter. Transfection of C6 cells with promoterless vectors containing the mini-intron did not produce any LUC activity (not shown). To assess the possible influence of splicing, we generated construct 3, in which the Cat-1 mini-intron was replaced with a heterologous intron (Fig. 3-1A, construct 3). Although the LUC activities from cells transfected with constructs 1 and 3 showed a 2-fold difference, this is significantly lower than the 5-fold increase observed for the construct containing the mini-intron (Fig. 3-1C). Splicing of the introns was confirmed by RT-
PCR (not shown). The difference in activity between the Cat-1 intron and the heterologous intron was maintained in all cell lines tested (Fig. 3-1C and data not shown).
Our results indicate that the induced transcription observed in the presence of the Cat-1 intron 1 is likely the result of the recruitment of sequence-specific DNA-binding proteins.
To identify potential enhancer elements within the Cat-1 intronic sequence, we compared this region from human, mouse, and rat. Sequence alignment for intron 1
45 revealed a conserved 24 nt region containing the sequence (TGATGCAAC) that
resembled an ATF site, a known target for transcription factors such as ATF4 (71) (Fig.
3-1B). We hypothesized that this conserved region contributes to the enhancement of
transcription via the mini-intron. To test our hypothesis, we performed deletion and
mutation analyses (Fig. 3-1D). Deletion of the conserved region from construct 2 (Fig. 3-
1A, construct 2del) abolished the increase in both LUC mRNA and protein levels (Fig. 3-
1D and data not shown). Furthermore, introduction of the consensus sequence into the
construct containing the heterologous intron (Fig. 3-1A, construct 3ins) increased both
LUC mRNA and protein levels (Fig. 3-1D and data not shown). mRNAs from these constructs were correctly spliced; they produced the expected PCR fragments using primers flanking the splice junction of exons 1 and 2 (data not shown). Mutation of the
TGATGCAAC motif within the Cat-1 mini-intron (Fig. 3-1A, construct 2mut) or within
the heterologous intron (Fig. 3-1A, construct 3ins/mut) abolished the stimulatory effect of the intronic enhancer (Fig. 3-1D). Furthermore, similar results were observed with these constructs in MEFs and other cell lines (Fig. 3-1D and data not shown). These results indicate that sequence-specific binding of proteins to DNA, rather than mRNA splicing, is the major contributor for the increased gene expression via the mini-intron. We conclude that expression of the Cat-1 gene is regulated via an enhancer element that contains an AARE-like site within the first intron of the gene (INE: intronic enhancer
element).
Identification of Pur as a potential INE-binding protein
In order to determine possible interacting proteins, biotinylated DNA
oligonucleotides containing 3 tandem repeats of the INE sequence were tested in binding
46 FIGURE 3-1
A construct Cat-1 1 promoter exon1 exon2 exon3-luciferase SV40pA 1.4kb
5’GT AG3’ 2 Cat-1 mini intron1 2del Cat-1 mini intron1 (del) 2mut Cat-1 mini intron1 (mut) 3 pCAT3 chimeric intron ins pCAT3 chimeric intron/ 3 partial Cat-1 mini intron1 ins/mut pCAT3 chimeric intron/ 3 partial Cat-1 mini intron1 (mut) B rat +233 TTGCAGGCGCGGCGTGGTGCATGATGCAACAGCGGG mouse +200 TTGCAGGCGCGGCGTGGTGCATGATGCAACAGCGGG human +237 CTGAAACCGCGGCGTGGTGCATGATGCAACACC--G ** * ************************ * * AARE-like
C 40 MEF 3 LUC C6 β-GAL 30 GAPDH 2 12 20 RT-PCR
1 LUC/ β -GAL
LUC/ β -GAL 10
0 0 123 23
D C6 50 40 MEF 40 30 30 20
LUC/ β -GAL 20
LUC/ β -GAL 10 10
0 del mut ins ins/mut 0 232 2 3 3 22mut 33ins 3ins/mut
47 Figure 3-1. Identification of a regulatory element in the first intron of the Cat-1 gene.
(A) Constructs used in this study. (B) Alignment of the conserved sequence in intron 1 of mammalian Cat-1 genes. Distance from the 5’-splice junction is indicated. Shading denotes the site of mutations in construct 2mut and 3ins/mut. (C, D) C6 and MEFs were transiently transfected with the indicated vectors. LUC activity normalized to -GAL activity is shown. (C, inset) RT-PCR of LUC, -GAL, and GAPDH mRNA in the indicated transfected cells. Means ± SEM from triplicate experiments is shown.
48 experiments using fractionated HeLa nuclear extracts. Oligonucleotides with WT
(3xWT-INE) or the mutated INE sequence (3xMUT-INE) were used. We used the HeLa
cell nuclear fraction that bound to phosphocellulose and eluted with 0.5 M KCl. This
fraction was used because: (i) Transfection of constructs 2 and 3 in HeLa cells showed a
6-fold difference in LUC activities, suggesting that the INE is functional in these cells
(data not shown); (ii) EMSA analysis using radiolabeled WT-INE oligonucleotide and
HeLa nuclear extracts showed shifted bands, which were competed with the WT-INE but
not with the MUT-INE oligonucleotides (data not shown); (iii) Shifted bands with this
fraction were similar to ones seen with unfractionated extract and were stronger than
bands seen with fractions eluted with different KCl concentrations (data not shown).
Proteins bound to the streptavidin-containing magnetic beads alone, 3xWT-INE,
or 3xMUT-INE from DNA affinity pulldown were resolved using SDS-PAGE and
stained with Coomassie Brilliant Blue. Several bands were observed in 3xWT-INE and
3xMUT-INE samples (Fig. 3-2A). In the 3xWT-INE lane, there was a band of 30-37
kDa that was absent in the 3xMUT-INE lane (Fig. 3-2A, white bracket). This region
from both lanes was excised and proteins were analyzed by mass spectrometric analysis.
Three proteins were identified (Table 3-3). Of interest, the purine-rich element-binding
protein A (Pur) was identified as interacting with the 3xWT-INE but not the 3xMUT-
INE oligonucleotide. This was further confirmed by performing DNA affinity pull-down
experiments using extracts from Pur-/- and Pur-/+ MEFs (Fig. 3-2B). Western blot analyses with antibodies specific for Pur showed strong binding to the 3xWT-INE in
Pur-/+ extracts. The specificity of the antibody was confirmed in Pur-/- cells. The related purine-rich element-binding protein B (Pur) was also identified via mass
49 Table 3-3
The interacting proteins to the biotinylated oligonucleotide probe are listed in the table.
Their molecular weights, the number of peptide recovered, and the percentage of the sequence covered are included.
Identification of proteins associated with the WT and MUT (INE) by mass spectrometry
Probe Protein name Calculated Peptide # M.W. (% Seq. (kDa) coverage) 3xWT-INE Purine rich binding protein A 33 10 (27%) Purine rich binding protein B 33 12 (46%) Poly (ADP-ribose) polymerase family 113 8 (12%) member 1 3xMUT- Purine rich binding protein B 33 7 (23%) INE Poly (rC) binding protein 1 38 6 (19%) Poly (ADP-ribose) polymerase family 113 9 (13%) member 1
50 spectrometry, but in contrast to Pur, it bound to both the 3xWT-INE and 3xMUT-INE
in extracts from Pur-/- MEFs (Fig. 3-2B and Table 3-3). These data emphasize the
specificity of the Pur binding to the INE of Cat-1. Because this sequence is required for
enhancer activity (Fig. 3-1), it suggests that binding of Pur to the INE facilitates the
enhancer activity of this region.
We next tested if Pur also regulates Cat-1 transcription. We first determined
whether Pur binds to the INE in vivo using ChIP analysis. Chromatin from C6 glioma
cells was immunoprecipitated with antibodies to Pur or normal IgG, and DNA
fragments containing the INE and the AARE of the Cat-1 gene were amplified by PCR
(Fig. 3-2C). We found that Pur was present at the INE but not the AARE (Fig. 3-2C).
The absence of signals in either region when normal IgG was used further confirmed the
specificity of the ChIP result. To test whether Pur is an important determinant of Cat-1
gene transcription, we examined the effect of siRNA knockdown of Pur on Cat-1
mRNA levels. Cells transfected with siRNA against Pur showed a 57% decrease in
Pur protein levels compared to control siRNA cells (Fig. 3-2D, lower panel). This
decrease in Pur level produced a 22% decrease in the abundance of the Cat-1 mRNA
(Fig. 3-2D, upper panel). We next determined if the levels of Pur influence the
enhancer activity of the INE. To this end, we transfected Pur-/- and Pur-/+ MEFs with
constructs 2 and 2mut. The resulting LUC/-GAL values were expressed as the ratio of
2/2mut (Fig. 3-2E). This ratio was 2-fold higher in Pur-/+ than in Pur-/- MEFs, suggesting a role of Pur in the function of the INE as an enhancer (Fig. 3-2E). Taken together, these results demonstrate the importance of Pur in regulation of Cat-1 gene transcription via the INE.
51 FIGURE 3-2
A
181.8
115.5 82.2 64.2 48.8
37.1
25.9
M Input Beads 3xWT-INE 3xMUT-INE (kDa) only (90mers) (90mers) HeLa P11 0.5M fraction
B WB Purα
Purβ Input Beads 3xWT-INE 3xMUT-INE Input Beads 3xWT-INE 3xMUT-INE Purα−/+ Purα−/−
C AARE INE Input IgG Pur α
D E 1.5 C6 4
1.2 * 3
0.9 mut 2 2/2 0.6 1 0.3 Cat-1/rRPL27 mRNA 0 0 siControl siPurα Purα-/+ Purα-/- WB Purα tubulin α
siCON siPur
52 Figure 3-2. Pur binds the INE to increase Cat-1 gene transcription. (A) Coomassie
Brilliant Blue staining of an SDS-PAGE gel used for mass spectrometry analysis.
Proteins from HeLa cell nuclear extracts that bind to oligonucleotides containing 3xWT-
INE or 3xMUT-INE were isolated and analyzed as described under Materials and
Methods. White brackets indicate the region used for mass spectrometry analysis. (B)
The same oligonucleotides as in (A) were used for DNA affinity pull-down analysis
using nuclear extracts from Pur-/+ and Pur-/- MEFs as described under Materials and
Methods. Samples were analyzed for Pur and Pur on Western blots. (C) ChIP was
performed using antibodies against Pur or with normal IgG as control. PCR was
performed with primer sets specific for the regions of interest (Table 3-2). (D, upper) C6
cells were transfected with either control or Pur-specific siRNAs. The level of Cat-1
mRNA was analyzed using qRT-PCR and normalized to rRPL27. The significance of
differences among means was evaluated using the unpaired t-test; *, P < 0.05. (D, Lower)
Pur and tubulin protein levels in total cell extracts were assessed by Western blotting.
(E) Constructs 2 and 2mut were transiently transfected into Pur-/+ and Pur-/- MEFs.
LUC activity was normalized to the activity of the co-transfected Renilla luciferase as
described under Materials and Methods. The normalized LUC values were expressed as
the ratio of 2 to 2mut. Expression from constructs 2 and 2mut were 10- and 5-fold lower, respectively, in Pur-/- than in Pur-/+ MEFs. Means ± SEM for triplicate determinations are shown.
53 ATF4 and CHOP regulate INE-mediated Cat-1 gene expression during ER stress
We previously reported that Cat-1 mRNA levels increase during stress via a
mechanism that involves binding of the transcription factor ATF4 to the AARE (52, 53).
Given that the INE resembles an ATF binding site and its core sequence is identical with
the ATF3 AARE, we hypothesize that it can recruit stress-induced transcription factors
such as ATF4 and CHOP. To test this hypothesis, we generated expression vectors
containing three WT or mutant INEs (constructs 4 and 4mut) and WT or mutant AAREs
(constructs 5 and 5mut) in the enhancer region of the pGL3 promoter vector (Fig. 3-3A).
Transient transfection of these constructs with or without co-transfected ATF4 or CHOP
showed that ATF4 overexpression increased the ratio of 4/4mut by almost 7-fold, whereas,
CHOP overexpression decreased this ratio by almost 2-fold (Fig. 3-3B). Transfection of
ATF4 increased transcription mediated by the AARE-containing vectors but transfection
of CHOP had no effect (Fig. 3-3B, 5/5mut). These data suggest that both the AARE and
INE can activate transcription by binding ATF4 but only the INE can repress transcription by binding CHOP. To confirm that ATF4 and CHOP bind the INE in vivo, chromatin from C6 cells was immunoprecipitated with antibodies against CHOP, ATF4 or normal IgG, and DNA fragments containing the region encompassing the INE were amplified by PCR (Fig. 3-3C-E). In agreement with the functional analyses, we found that ATF4 binding to the INE peaked at ~3 h of endoplasmic reticulum stress induced by
Tg treatment (77) and decreased thereafter. Pur, which binds the INE in unstressed cells, was found to dissociate between 1 to 3 h of ER stress, a time when ATF4 binding to the INE increased (Fig. 3-3D). CHOP binding to the same region showed low levels of association at 3 h of ER stress, and a sharp increase following 12 h (Fig. 3-3C, E). A
54 FIGURE 3-3
A 4 WT-INE GCGTGGTGCATGATGCAACAGCGGGAGGGA x3 mut GCGTGGTGCATGttaCcACAGCGGGAGGGA 4 MUT-INE x3 5 WT-AARE GGCTGATGAAACC x3 5mut MUT-AARE GGaTGtTtAAACC x3
SV40 LUC SV40 promoter poly(A) signal
B D 40 4 20 ATF4
30 3 mut mut 20 2 4/4 4/4 10
10 1
0 0 0 Vector ATF4 Vector CHOP precipitated by ChIP DNA 0123 Tg (h) 2.5 0.6 1.0 2.0 0.5 Purα 0.4 0.8
mut 1.5 mut 0.3 5/5 5/5 0.6 1.0 0.2 0.4 0.5 0.1 0.0 0.0 0.2 Vector ATF4 Vector CHOP 0.0 DNA precipitated by ChIP DNA 0123 Tg (h)
C E
Input Input AARE INE 10 IgG IgG INE CHOP ATF4 8 3612(h) 3612(h) CON Tg CON Tg 6
4
2
DNA precipitated by ChIP DNA 0 0612 Tg (h)
55 Figure 3-3. ATF4 and CHOP bind to the Cat-1 INE in vivo and modulate
transcription. (A) Constructs 4, 4mut, 5, and 5mut contain three repeats of the sequence in the enhancer site of the pGL3-promoter vector. (B) C6 cells were transiently co- transfected with the indicated constructs and expression plasmids or vector. Cell extracts were assayed for LUC activity and normalized to the co-transfected -GAL activity as described under Materials and Methods. The normalized values were expressed as the ratio of 4 to 4mut or 5 to 5mut. ATF4 increased expression from construct 4 by 4-fold, but decreased expression from 4mut by 30%. ATF4 also increased expression from construct
5 by 2-fold but decreased expression from 5mut by 50%. CHOP decreased expression
from constructs 4 and 4mut by 60% and 10%, respectively. CHOP also decreased expression from constructs 5 and 5mut by 25%. (C) C6 glioma cells were treated with Tg for the indicated times and ChIP was performed with antibodies against ATF4 and CHOP as described under Materials and Methods. (D-E) qPCR analysis using primers for the
INE (D, E) or AARE (E) of DNA isolated from ChIP analysis using ATF4 and Pura (D) or CHOP (E) antibodies. Values were obtained relative to input DNA and expressed as a fold change relative to untreated cells.
56 smaller increase in association of CHOP to the AARE was observed at 3-12 h of ER
stress (Fig. 3-3E). This lower binding of CHOP to the AARE is likely the result of
binding to the INE on chromatin fragments that contain both the AARE and INE.
Because these elements are separated by 355 bp, ChIP may have isolated fragments that
contain both elements. Alternatively, weak binding of CHOP to the AARE may occur in
vivo. We conclude that during early ER stress, ATF4 enhances transcription by replacing
the weak transcriptional activator Pur on the INE, whereas late in ER stress CHOP
binding inhibits transcription. The specificity of ATF4 and CHOP binding was
confirmed using normal IgG as negative control or by the lack of binding to the genomic
DNA corresponding to the 3’-UTR of the Cat-1 mRNA (Fig. 3-3C and data not shown).
Attenuation of Cat-1 transcription during late ER stress requires CHOP
A recent report by Su et al. demonstrated that CHOP/ATF4 heterodimers inhibit
the stress-dependent induction of the AS gene during amino acid starvation (109).
Interestingly, they also reported that induction of the Cat-1 mRNA during amino acid
starvation was not attenuated by CHOP. We hypothesized that CHOP may attenuate Cat-
1 transcription during late ER stress via binding to the INE. This idea was supported by
the following findings: (i) overexpression of CHOP inhibits transcription of a reporter
construct that contains the Cat-1 INE and (ii) ChIP analysis showed recruitment of
CHOP to the INE in C6 cells upon Tg treatment. Therefore, we investigated whether
CHOP modulates Cat-1 gene transcription during ER stress by examining the relative levels of Cat-1 mRNA in WT and CHOP-deficient MEFs during ER stress (Fig. 3-4A).
In the absence of CHOP, we found a sustained induction of Cat-1 mRNA between 6 and
18 h of ER stress (Fig. 3-4A). This trend is opposite from that of the WT MEFs which
57 FIGURE 3-4
A CHOP+/+ CHOP-/- CHOP-/- (CHOP) 400
300 * 200 Cat-1/18S
100
0
300
200 * ASNS/18S 100
0 0 6 12 18 Tg (h)
WB CHOP tubulin Tg (h) 0 3 6 12 18 0 3 6 12 18 0 3 6 12 18 CHOP+/+ CHOP-/- CHOP-/- (CHOP)
B C -/- 2.5 CON Tg (18h) 4 CHOP WB CHOP 2.0 3 tubulin Vector CHOP mut mut 1.5 2 4/4 2/2 1.0 1 0.5
0 0 CHOP+/+ CHOP-/- Vector CHOP
58 Figure 3-4. Inhibition of Cat-1 transcription via the INE during late ER stress
requires CHOP. (A, Upper) Quantification of mRNA levels for the indicated genes in
Tg-treated CHOP+/+, CHOP-/-, and CHOP-/- transiently expressing CHOP (CHOP-/-
(CHOP)). Data from qRT/PCR analysis of total RNA using gene-specific primers were
normalized to the 18S ribosomal RNA signal. The significance of differences among
means was evaluated between CHOP-/- and CHOP-/- (CHOP) using the unpaired t-test; *,
P < 0.05. (A, Lower) Western blot analysis of total cell extracts from the indicated Tg-
treated MEFs. Blots were probed with antibodies against the indicated proteins. (B)
CHOP+/+ and CHOP-/- MEFs were transiently transfected with the indicated reporter
constructs for 24 h followed by incubation in the presence or absence of Tg for 18 h. (C)
CHOP-/- MEFs were transiently co-transfected with the indicated constructs and the
CHOP expression plasmid or vector. (C, inset) Cell extracts were subjected to immunoblot analysis. Cell extracts were assayed for LUC activity and normalized to the activity of the co-transfected Renilla luciferase (B) or -galactosidase (C) vector as
described under Materials and Methods. The normalized values were expressed as the
ratio of the WT to MUT. (B) Tg caused 18- and 16-fold increases in expression from
constructs 2 and 2mut, respectively, in CHOP+/+ MEFs and 17- and 8-fold increases in
expression in CHOP-/- MEFs. (C) Overexpression of CHOP in CHOP-/- MEFs decreased expression from construct 4 and increased expression from the corresponding mutant.
59 showed attenuation of mRNA during this time. Similar results were obtained for the AS
mRNA, consistent with the recent report documenting the inhibition of AS gene
transcription by CHOP (109). This sustained induction of both Cat-1 and AS mRNAs
during late ER stress was partially attenuated by transient overexpression of CHOP in
CHOP-/- MEFs (Fig. 3-4A). The partial attenuation could be explained by the low levels of CHOP protein transfected in the CHOP-/- MEFs as compared to the high levels of the endogenous CHOP protein in the CHOP+/+ MEFs (Fig. 3-4A, lower panel). The gradual decrease in the exogenous CHOP protein during ER stress was probably due to the lack of transcriptional control elements in the expression vector for CHOP. The increased levels of the endogenous CHOP protein are the result of transcriptional induction during
ER stress.
We next tested if the lack of inhibition of Cat-1 mRNA expression during late stress was also seen with reporter constructs. We transfected the constructs 2 and 2mut
into CHOP+/+ and CHOP-/- MEFs and compared LUC activities from control and Tg-
treated cells (Fig. 3-4B). As expected, we observed a 2-fold increase in the ratio of 2/2mut
only in the CHOP-/- MEFs. The reason that we did not observe a change in this ratio in
CHOP+/+ MEFs treated with Tg, was that the untreated and 18 h-treated cells have similar levels of Cat-1 mRNA due to transcriptional attenuation (compare Figs. 3-4A and 3-4B).
To further address the CHOP-mediated inhibition of Cat-1 gene transcription via the
INE, we examined the effect of expressing CHOP in CHOP-/- MEFs (Fig. 3-4C, left
panel). In agreement with the inhibitory function of CHOP via the INE, CHOP
expression caused a ~60% decrease in the 4/4mut ratio. CHOP expression in the
transfected cells was confirmed by Western blotting (Fig. 3-4C). Taken together, our
60 data suggest that CHOP inhibits transcription of the Cat-1 gene via the INE during late
ER stress.
DISCUSSION
It is shown here that a novel regulatory element (INE) within the first intron of the
Cat-1 gene transcription activity during unstressed and stress conditions. This finding is
supported by the following results: (i) promoter activity was regulated by two DNA
elements downstream of the transcription start site: a positive element in the first exon
(AARE) and a bifunctional element in the first intron (INE); (ii) bifunctional regulation
by the INE involves activation of the promoter by Pur binding and attenuation during
ER stress by CHOP binding. The identification of the bifunctional INE and Pur as an
interacting protein reveals novel regulatory features of Cat-1 gene transcription. This interaction may be an important activator of Cat-1 expression in both basal and stress conditions. In fact, Pur is highly expressed in the adult brain (96), the only adult tissue that also expresses Cat-1 at high levels (16). Pur is a multi-functional protein that can bind single-stranded RNA and DNA and modulates DNA replication, transcription or mRNA translation in a positive or negative manner (reviewed in ref. 91). Pur also regulates transcription via GA/GC-rich regions with the cooperative action of Sp1 and
Sp3 (105, 110).
We show here that the binding of Pur to the Cat-1 INE depends on its AARE- like sequence. The element is identical to the AARE in the ATF3 promoter (111) and has only one mismatch with the Cat-1 AARE. The Cat-1 AARE and INE bind ATF4, but only the INE binds Pur (data not shown), suggesting that Pur binds to regions in the
61 INE adjacent to the AARE-like sequence. A possible mechanism involves binding of
Pur to a flanking region (through interactions with single- or double-stranded DNA)
stabilized by interaction with a protein that binds the AARE-like site. This mechanism
explains the absence of Pur binding to both the mutant INE and the Cat-1 AARE (Fig.
3-2B and C). Pur is known to interact with other proteins such as Sp1 and YB-1
(reviewed in ref. 91) but there are no reports of interactions with ATF family members.
However, it was recently shown in prostate cancer cells that Pur overexpression induces
ER stress response genes, including ATF3 (112). ATF3 and other stress response genes
contain AAREs, which regulate transcription of many genes during stress (113). This is
consistent with the idea that Pur acts in concert with ATF family members to regulate stress responses.
We have previously shown that transcription of the Cat-1 gene (53) increases
early in the ER stress response and is attenuated at later times via a mechanism that
involves the C/EBP gene product LIP (53, 77). The AARE plays a role in this
attenuation during late ER stress, possibly by the binding of LAP/LIP or ATF4/LIP
heterodimers (53). We show here that CHOP is also involved in transcriptional
attenuation via binding to the INE. Because CHOP interacts with LAP or LIP during ER
stress (114), it is possible that CHOP/LIP or CHOP/LAP heterodimers attenuate Cat-1
gene transcription via binding to the INE.
A report by Su and Kilberg showed that CHOP associates with ATF4 during
stress to attenuate transcription of the AS gene via its AARE (109). The authors also
concluded that the Cat-1 AARE is not a target of CHOP repression because Cat-1 mRNA
levels were not affected by CHOP overexpression. We also found that CHOP is an
62 attenuator of AS gene transcription during stress (Fig. 3-4). However, we showed that
Cat-1 expression is attenuated by CHOP during Tg treatment. This apparent discrepancy
could be due to different times of Tg treatment (4 h compared to 18 h in our study).
Consistent with our data, Su et al. found a significant increase in binding of CHOP to the
Cat-1 gene in vivo during Tg treatment. However, the interpretation of this finding is
difficult because the AARE and INE are separated by 355 bp and could be isolated on the
same DNA fragment in this ChIP experiment. Although we agree with this group that
CHOP binds to the Cat-1 promoter during ER stress, our interpretation is that CHOP
attenuates Cat-1 transcription via the INE and not the AARE (Figs. 3-3 and 3-4).
A model is proposed for the role of INE in the regulation of the Cat-1 gene
transcription in the absence of stress, and during early and late ER stress (Fig. 3-5). The
model includes the following features: 1) Pur interacts with the INE under basal
conditions to stimulate transcription. 2) ATF4 acts as an inducer by replacing Pur on the
INE during early ER stress. In addition to the ChIP analysis (Fig. 3-3), we found that
overexpression of ATF4 stimulates expression from an INE-containing plasmid relative
to controls in C/EBP-/- MEFs (data not shown), demonstrating that the effect of ATF4 is independent of C/EBP. 3) CHOP acts at the INE to repress transcription during late ER stress. Although CHOP's dimerization partner is not known, ATF4 binding decreases during prolonged stress and our previous studies suggest that transcriptional attenuation requires LAP or LIP (77). Therefore, C/EBP isoforms are likely dimerization partners with CHOP in transcriptional attenuation.
This study introduces Pur and CHOP as novel factors in modulating Cat-1 gene transcription. Because CHOP is viewed as a factor that promotes apoptosis and
63 FIGURE 3-5
No Stress (Basal)
Purα TATAless promoter exon1 exon2 INE
intron1
Early ER Stress (Induction)
TATAless ATF4 promoter exon1 INE exon2
intron1
Late ER Stress (Attenuation)
CHOP LAP, LIP, or TATAless ATF4 promoter exon1 INE exon2
intron1
Figure 3-5. Working model of the role of the INE in the regulation of the Cat-1 gene transcription during ER stress. Pur binds to the INE and supports transcription under basal conditions. Pur dissociates and is replaced by ATF4 during early stress, which stimulates transcription. The dimerization partner of ATF4 is unknown. During late stress, CHOP and one of several dimerization partners replace ATF4, which inhibits expression.
64 terminates survival signals during severe stress (114), it will be interesting to determine if attenuating Cat-1 expression is important for these processes, as has been shown for other nutrient transporters (115). An additional important finding is the binding of Pur to
AARE-containing elements. Although AARE flanking sequences from different stress response genes have (GGN)n motifs and there are purine-rich sequences close to AAREs that have inhibitory function in basal gene transcription (116), their regulation by Pur has yet to be proven experimentally. Future experiments using Pur-null cells should define Pur-regulated genes and their impact in the cellular response to physiological stress.
65 CHAPTER 4
SIGNIFICANCE AND FUTURE PERSPECTIVES
The regulation of Cat-1 gene expression has been extensively studied. Controls at both transcriptional and post-transcriptional levels are employed to ensure its proper expression. These findings are summarized in the introduction section of the thesis. This thesis primarily focused on Cat-1 gene regulation at the transcriptional level. It is shown here that the minimal promoter of the Cat-1 gene requires the sequence,
GCCCACAGGGG for its basal transcriptional activity. In a reporter system lacking any other core promoter elements, this sequence alone was sufficient to support transcription.
Biochemical and functional analyses identified Sp1 as an important mediator of basal
Cat-1 gene transcription through this sequence. Furthermore, studies presented here demonstrated the requirement of Sp1 for maximal Cat-1 gene transcription during both basal and stress conditions. This finding is consistent with studies showing functional importance of specificity proteins in modulating stress-response genes. For example, Sp1 was shown to increase basal transcriptional activity of the AS promoter but Sp1 was not
important for induction of the AS gene during amino acid deprivation. Expression of the
AS gene was regulated by Sp3 which enhanced both basal and starvation-induced
expression (85). Furthermore, Sp proteins were shown to bind constitutively to the GC-
rich region (N9) of the ER stress response element (ERSE) and siRNA of these proteins inhibited activation of GRP78/BiP by tunicamycin or thapsigargin (117). The consensus sequence for the ERSE element is (CCAAT(N9)CCACG) (118, 119). However, the molecular mechanisms as to how these specificity proteins function in concert with
66 stress-induced transcription factors are not known. Immunoprecipitation of stress- inducible factors that bind to the INE or the AARE and blot for specificity proteins can provide insights as to whether these proteins interact. Future studies should aim to unravel the mechanisms and possible interactions of these specificity proteins and the trans-acting factors that bind to the stress-response elements within the Cat-1 gene promoter. Furthermore, it is known that Sp1 undergoes posttranslational modifications that can influence its stability and transcriptional activity (34, 120). Mutations to these modified residues in Sp1 can potentially identify modifications that are important for its function during stress conditions.
The significance of Cat-1 is highlighted by the anemic phenotype and perinatal mortality of the homozygous deletion of the Cat-1 gene in mice (20). These mice not only failed to survive one day after birth. They were also 25% smaller than their wild- type littermates. These findings suggest the importance of the Cat-1 gene in embryogenesis and fetal development as well as functions in postnatal survival. As discussed previously, Sp1/Sp3 compound heterozygous mice are embryonic lethal and display growth retardation and anemia (88). Both Sp1/Sp3 compound heterozygous and
Cat-1-/- mice are defective in erythrocyte maturation. An interesting question is whether the observed Sp1/Sp3 compound heterozygous mice phenotype is the result of lower Cat-
1 expression and whether or not overexpression of Cat-1 can rescue these mice. Given the importance of Sp1 in modulating Cat-1 gene transcription, we anticipate that Cat-1 expression to be lower in these Sp1/Sp3 compound heterozygous mice. Furthermore, given the importance of L-arginine in human erythrocytes differentiation and proliferation (21) as well as for synthesis of polyamines which are necessary for cellular
67 growth (121), Cat-1 overexpression might rescue some of the aforementioned defects in these mutant mice.
Although Cat-1 is ubiquitously expressed except in the liver, its expression varies significantly between tissues. One of the primary goals of this thesis was to identify the potential transcriptional mechanisms that mediate this difference. It is shown here that the transcription factor, Pur, increases basal Cat-1 gene transcription. Pur is essential for postnatal brain development that functions as a transcriptional activator for a number of genes (96, 122). Pur has the highest expression in the brain, consistent with its importance in postnatal brain development and the neurologic defects that were observed in the Pur null mice (96). Cat-1 expression is also at highest levels in the brain. Future studies may be directed toward examining the dependence of Cat-1 expression on Pur in different cell types in the brain and if altered Cat-1 expression can contribute to the neurologic defects of the Pur null mice. The same dependence can also be investigated in other tissues that display atypical Cat-1 expression. If there is a positive correlation, a treatment for diseases with altered Cat-1 expression may be applied by fine-tuning
Pur’s expression. For example, patients with congestive heart failure have significant reduction in Cat-1 mRNA level and L-arginine uptake, as shown in the myocardial samples derived from their failing hearts (123). In the heart, NO derived from L-arginine plays an imperative role in cardiac contractility and cardiomyocyte proliferation.
Therefore, if these patients also show lower levels of Pur, Pur may serves as a therapeutic target to increase Cat-1 expression and improve cardiac function.
We have also shown that an intronic enhancer element (INE) functions during the
UPR to increase transcription of the Cat-1 gene during early ER stress and to decrease
68 transcription at later times, via binding of the transcription factors ATF4 and CHOP, respectively. These two proteins are well known transcription factors in mediating the cellular response to the UPR as discussed in the introduction section. It is interesting that
ER-stressed cells modulate expression of Cat-1 at a time when protein synthesis and folding are compromised. The purpose of this regulation is still a mystery. A plausible hypothesis is that stressed cells upregulate their amino acid transporter genes with the commitment to maintain amino acid transport and protein synthesis as part of their prosurvival stress response. However, once a critical threshold is attained and cells are unable to restore homeostasis, down-regulation of Cat-1 expression maybe a requirement to direct cells toward the apoptotic pathway. Furthermore, understanding Cat-1 regulation during ER stress may provide insights into how to inhibit growth of cancer cells. It is shown that tumors and cancer cells have elevated Cat-1 expression. A recent report also suggested that adaptation to ER stress helps cells within tumor to thrive under hypoxic conditions and to promote cell growth (124). Therefore, under these conditions,
Cat-1 is expected to increase in the tumors to deliver the amino acids arginine and lysine to the nutritionally poor environments of the solid tumors, thus supporting their growth.
ER stress has also been shown as one of the contributing factors leading to congestive heart failure. Prolonged ER stress was observed in failing hearts of mice after aortic constriction (125). Induction of ER chaperones was evident at 1 and 4 weeks after transverse aortic constriction (125). CHOP was markedly induced 4 weeks after operation. These observations along with our finding that attenuation of Cat-1 gene transcription by CHOP may provide the first insight at the molecular level that explains the decrease of Cat-1 mRNA levels in some patients with congestive heart failure.The
69 findings presented in this thesis along with future projects that aim to understand regulation of Cat-1 expression during ER stress may identify potential mechanisms to hamper tumor growth as well as to prevent heart failure in patients that have lower Cat-1 expression.
70 APPENDIX
Contents in Table 1-1, 1-2, 1-3, and Figure 1-1 from indicated references were used with permission.
Table 1-1 Used with permission Approved by Mark Ffrench on Mar 18th, 2010
Table 1-2 Used with permission Approved by Penny Pripka on Mar 2nd, 2010
Table 1-3 Publication: Critical Reviews in Biochemistry and Molecular Biology Title: The General Transcription Machinery and General Cofactors Type of Use: Thesis/Dissertation Note: Taylor & Francis is pleased to offer reuses of its content for a thesis or dissertation free of charge contingent on resubmission of permission request if work is published.
Figure 1-1 Licensee: Charlie Huang License Date: Feb 27, 2010 License Number: 2377290283127 Publication: EMBO reports Title: Mediators of endoplasmic reticulum stress-induced apoptosis Type Of Use: Thesis / Dissertation Total: $0.00
71 Ref: BJ100011
Charlie Huang
18 March 2010
Dear Charlie Huang
RE: Your request to reproduce Table 1 from: Amino acid transporters: roles in amino acid sensing and signaling in animal cells R. Hyde, P.M. Taylor and H.S. Hundal, Biochem. J. 373(1).1-18
We hereby grant you permission to reprint the aforementioned material, for use in your Ph.D Dissertation, at no charge subject to the following conditions:
1. If any part of the material to be used is credited to another source, permission must be sought from that source.
2. The following credit line is to be placed on the page where the material appears: Reproduced with permission, from Author(s), (year of publication), (Journal title), (volume number), (page range). © the Biochemical Society.
3. This permission is granted for one-time use only and is for non-exclusive world rights in electronic and print format.
Yours sincerely,
Mark Ffrench Pre-Press Specialist [email protected]
72
73
74
75
76 BIBLIOGRAPHY
1. Reeds PJ. Dispensable and indispensable amino acids for humans. J Nutr. 2000 Jul;130(7):1835S-40S.
2. Fernstrom JD. Role of precursor availability in control of monoamine biosynthesis in brain. Physiol Rev. 1983 Apr;63(2):484-546.
3. Alderton WK, Cooper CE, Knowles RG. Nitric oxide synthases: structure, function and inhibition. Biochem J. 2001 Aug 1;357(Pt 3):593-615.
4. Furst P, Stehle P. What are the essential elements needed for the determination of amino acid requirements in humans? J Nutr. 2004 Jun;134(6 Suppl):1558S-65S.
5. Hyde R, Taylor PM, Hundal HS. Amino acid transporters: roles in amino acid sensing and signalling in animal cells. Biochem J. 2003 Jul 1;373(Pt 1):1-18.
6. Palacin M, Estevez R, Bertran J, Zorzano A. Molecular biology of mammalian plasma membrane amino acid transporters. Physiol Rev. 1998;78(4):969-1054.
7. Closs EI, Boissel JP, Habermeier A, Rotmann A. Structure and function of cationic amino acid transporters (CATs). J Membr Biol. 2006;213(2):67-77.
8. Kavanaugh MP, Wang H, Zhang Z, Zhang W, Wu YN, Dechant E, et al. Control of cationic amino acid transport and retroviral receptor functions in a membrane protein family. J Biol Chem. 1994 Jun 3;269(22):15445-50.
9. Nicholson B, Manner CK, Kleeman J, MacLeod CL. Sustained nitric oxide production in macrophages requires the arginine transporter CAT2. J Biol Chem. 2001 May 11;276(19):15881-5.
10. Hosokawa H, Sawamura T, Kobayashi S, Ninomiya H, Miwa S, Masaki T. Cloning and characterization of a brain-specific cationic amino acid transporter. J Biol Chem. 1997 Mar 28;272(13):8717-22.
11. Ito K, Groudine M. A new member of the cationic amino acid transporter family is preferentially expressed in adult mouse brain. J Biol Chem. 1997 Oct 17;272(42):26780-6.
12. Vekony N, Wolf S, Boissel JP, Gnauert K, Closs EI. Human cationic amino acid transporter hCAT-3 is preferentially expressed in peripheral tissues. Biochemistry. 2001 Oct 16;40(41):12387-94.
13. Nicholson B, Sawamura T, Masaki T, MacLeod CL. Increased Cat3-mediated cationic amino acid transport functionally compensates in Cat1 knockout cell lines. J Biol Chem. 1998;273(24):14663-6.
77 14. Sperandeo MP, Borsani G, Incerti B, Zollo M, Rossi E, Zuffardi O, et al. The gene encoding a cationic amino acid transporter (SLC7A4) maps to the region deleted in the velocardiofacial syndrome. Genomics. 1998;49(2):230-6.
15. Wolf S, Janzen A, Vékony N, Martiné U, Strand D, Closs EI. Expression of solute carrier 7A4 (SLC7A4) in the plasma membrane is not sufficient to mediate an amino acid transport activity. Biochem J. 2002;364:767-75.
16. Hatzoglou M, Fernandez J, Yaman I, Closs E. Regulation of cationic amino acid transport: the story of the CAT-1 transporter. Annu Rev Nutr. 2004;24:377-99.
17. Aulak KS, Liu J, Wu J, Hyatt SL, Puppi M, Henning SJ, et al. Molecular sites of regulation of expression of the rat cationic amino acid transporter gene. J Biol Chem. 1996 Nov 22;271(47):29799-806.
18. Wu JY, Robinson D, Kung HJ, Hatzoglou M. Hormonal regulation of the gene for the type C ecotropic retrovirus receptor in rat liver cells. J Virol. 1994 Mar;68(3):1615- 23.
19. Fernandez J, Yaman I, Mishra R, Merrick WC, Snider MD, Lamers WH, et al. Internal ribosome entry site-mediated translation of a mammalian mRNA is regulated by amino acid availability. J Biol Chem. 2001 Apr 13;276(15):12285-91.
20. Perkins CP, Mar V, Shutter JR, del Castillo J, Danilenko DM, Medlock ES, et al. Anemia and perinatal death result from loss of the murine ecotropic retrovirus receptor mCAT-1. Genes Dev. 1997;11(7):914-25.
21. Shima Y, Maeda T, Aizawa S, Tsuboi I, Kobayashi D, Kato R, et al. L-arginine import via cationic amino acid transporter CAT1 is essential for both differentiation and proliferation of erythrocytes. Blood. 2006 Feb 15;107(4):1352-6.
22. Wu G, Meininger CJ, Knabe DA, Bazer FW, Rhoads JM. Arginine nutrition in development, health and disease. Curr Opin Clin Nutr Metab Care. 2000 Jan;3(1):59-66.
23. Wilkerson VA, Klopfenstein TJ, Britton RA, Stock RA, Miller PS. Metabolizable protein and amino acid requirements of growing cattle. J Anim Sci. 1993 Oct;71(10):2777-84.
24. Kaye DM, Ahlers BA, Autelitano DJ, Chin-Dusting JP. In vivo and in vitro evidence for impaired arginine transport in human heart failure. Circulation. 2000 Nov 28;102(22):2707-12.
25. Yang Z, Venardos K, Jones E, Morris BJ, Chin-Dusting J, Kaye DM. Identification of a novel polymorphism in the 3'UTR of the L-arginine transporter gene SLC7A1: contribution to hypertension and endothelial dysfunction. Circulation. 2007 Mar 13;115(10):1269-74.
78 26. Schwartz IF, Iaina A, Benedict Y, Wollman Y, Chernichovski T, Brasowski E, et al. Augmented arginine uptake, through modulation of cationic amino acid transporter-1, increases GFR in diabetic rats. Kidney Int. 2004 Apr;65(4):1311-9.
27. Luo RX, Dean DC. Chromatin remodeling and transcriptional regulation. J Natl Cancer Inst. 1999 Aug 4;91(15):1288-94.
28. Wolffe AP, Guschin D. Review: chromatin structural features and targets that regulate transcription. J Struct Biol. 2000 Apr;129(2-3):102-22.
29. Thomas MC, Chiang CM. The general transcription machinery and general cofactors. Crit Rev Biochem Mol Biol. 2006 May-Jun;41(3):105-78.
30. Orphanides G, Lagrange T, Reinberg D. The general transcription factors of RNA polymerase II. Genes Dev. 1996 Nov 1;10(21):2657-83.
31. Roeder RG. The role of general initiation factors in transcription by RNA polymerase II. Trends Biochem Sci. 1996 Sep;21(9):327-35.
32. Gidoni D, Dynan WS, Tjian R. Multiple specific contacts between a mammalian transcription factor and its cognate promoters. Nature. 1984 Nov 29-Dec 5;312(5993):409-13.
33. Safe S, Abdelrahim M. Sp transcription factor family and its role in cancer. Eur J Cancer. 2005 Nov;41(16):2438-48.
34. Wierstra I. Sp1: emerging roles--beyond constitutive activation of TATA-less housekeeping genes. Biochem Biophys Res Commun. 2008 Jul 18;372(1):1-13.
35. Chiang CM, Roeder RG. Cloning of an intrinsic human TFIID subunit that interacts with multiple transcriptional activators. Science. 1995 Jan 27;267(5197):531-6.
36. Gill G, Pascal E, Tseng ZH, Tjian R. A glutamine-rich hydrophobic patch in transcription factor Sp1 contacts the dTAFII110 component of the Drosophila TFIID complex and mediates transcriptional activation. Proc Natl Acad Sci U S A. 1994 Jan 4;91(1):192-6.
37. Suske G. The Sp-family of transcription factors. Gene. 1999 Oct 1;238(2):291- 300.
38. Peck LJ, Wang JC. Transcriptional block caused by a negative supercoiling induced structural change in an alternating CG sequence. Cell. 1985 Jan;40(1):129-37.
39. Sharma VK, Kumar N, Brahmachari SK, Ramachandran S. Abundance of dinucleotide repeats and gene expression are inversely correlated: a role for gene function in addition to intron length. Physiol Genomics. 2007 Sep 19;31(1):96-103.
79 40. Bhattacharyya SN, Habermacher R, Martine U, Closs EI, Filipowicz W. Relief of microRNA-mediated translational repression in human cells subjected to stress. Cell. 2006 Jun 16;125(6):1111-24.
41. Liu J, Hatzoglou M. Control of expression of the gene for the arginine transporter Cat-1 in rat liver cells by glucocorticoids and insulin. Amino Acids. 1998;15(4):321-37.
42. Aulak KS, Mishra R, Zhou L, Hyatt SL, de Jonge W, Lamers W, et al. Post- transcriptional regulation of the arginine transporter Cat-1 by amino acid availability. J Biol Chem. 1999 Oct 22;274(43):30424-32.
43. Yaman I, Fernandez J, Sarkar B, Schneider RJ, Snider MD, Nagy LE, et al. Nutritional control of mRNA stability is mediated by a conserved AU-rich element that binds the cytoplasmic shuttling protein HuR. J Biol Chem. 2002 Nov 1;277(44):41539- 46.
44. Wek RC, Jiang HY, Anthony TG. Coping with stress: eIF2 kinases and translational control. Biochem Soc Trans. 2006 Feb;34(Pt 1):7-11.
45. Krishnamoorthy T, Pavitt GD, Zhang F, Dever TE, Hinnebusch AG. Tight binding of the phosphorylated alpha subunit of initiation factor 2 (eIF2alpha) to the regulatory subunits of guanine nucleotide exchange factor eIF2B is required for inhibition of translation initiation. Mol Cell Biol. 2001 Aug;21(15):5018-30.
46. Calkhoven CF, Muller C, Leutz A. Translational control of C/EBPalpha and C/EBPbeta isoform expression. Genes Dev. 2000 Aug 1;14(15):1920-32.
47. Lu PD, Harding HP, Ron D. Translation reinitiation at alternative open reading frames regulates gene expression in an integrated stress response. J Cell Biol. 2004 Oct 11;167(1):27-33.
48. Vattem KM, Wek RC. Reinitiation involving upstream ORFs regulates ATF4 mRNA translation in mammalian cells. Proc Natl Acad Sci U S A. 2004 Aug 3;101(31):11269-74.
49. Averous J, Bruhat A, Mordier S, Fafournoux P. Recent advances in the understanding of amino acid regulation of gene expression. J Nutr. 2003 Jun;133(6 Suppl 1):2040S-5S.
50. Kilberg MS, Pan YX, Chen H, Leung-Pineda V. Nutritional control of gene expression: how mammalian cells respond to amino acid limitation. Annu Rev Nutr. 2005;25:59-85.
51. Hyatt SL, Aulak KS, Malandro M, Kilberg MS, Hatzoglou M. Adaptive regulation of the cationic amino acid transporter-1 (Cat-1) in Fao cells. J Biol Chem. 1997 Aug 8;272(32):19951-7.
80 52. Fernandez J, Lopez AB, Wang C, Mishra R, Zhou L, Yaman I, et al. Transcriptional control of the arginine/lysine transporter, cat-1, by physiological stress. J Biol Chem. 2003 Dec 12;278(50):50000-9.
53. Lopez AB, Wang C, Huang CC, Yaman I, Li Y, Chakravarty K, et al. A feedback transcriptional mechanism controls the level of the arginine/lysine transporter cat-1 during amino acid starvation. Biochem J. 2007 Feb 15;402(1):163-73.
54. Komar AA, Hatzoglou M. Internal ribosome entry sites in cellular mRNAs: mystery of their existence. J Biol Chem. 2005 Jun 24;280(25):23425-8.
55. Hershey J, Merrick W. The pathway and mechanism of initiation of protein synthesis. In: N Sonenberg JWBH, M B. Mathews, editor. Translational control of gene expression. Cold Spring Harbor: CSHL Press; 2000. p. 33-88.
56. Hellen CU, Sarnow P. Internal ribosome entry sites in eukaryotic mRNA molecules. Genes Dev. 2001;15(13):1593-612.
57. Fernandez J, Yaman I, Merrick WC, Koromilas A, Wek RC, Sood R, et al. Regulation of internal ribosome entry site-mediated translation by eukaryotic initiation factor-2alpha phosphorylation and translation of a small upstream open reading frame. J Biol Chem. 2002 Jan 18;277(3):2050-8.
58. Yaman I, Fernandez J, Liu H, Caprara M, Komar AA, Koromilas AE, et al. The Zipper Model of Translational Control. A Small Upstream ORF Is the Switch that Controls Structural Remodeling of an mRNA Leader. Cell. 2003;113(4):519-31.
59. Majumder M, Yaman I, Gaccioli F, Zeenko VV, Wang C, Caprara MG, et al. The hnRNA-binding proteins hnRNP L and PTB are required for efficient translation of the Cat-1 arginine/lysine transporter mRNA during amino acid starvation. Mol Cell Biol. 2009 May;29(10):2899-912.
60. Wu J, Kaufman RJ. From acute ER stress to physiological roles of the Unfolded Protein Response. Cell Death Differ. 2006 Mar;13(3):374-84.
61. Mori K. Signaling pathways in the unfolded protein response: development from yeast to mammals. J Biochem. 2009 Oct 30.
62. Schroder M, Kaufman RJ. The mammalian unfolded protein response. Annu Rev Biochem. 2005;74:739-89.
63. Ron D, Walter P. Signal integration in the endoplasmic reticulum unfolded protein response. Nat Rev Mol Cell Biol. 2007 Jul;8(7):519-29.
81 64. Calfon M, Zeng H, Urano F, Till JH, Hubbard SR, Harding HP, et al. IRE1 couples endoplasmic reticulum load to secretory capacity by processing the XBP-1 mRNA. Nature. 2002 Jan 3;415(6867):92-6.
65. Yoshida H, Matsui T, Yamamoto A, Okada T, Mori K. XBP1 mRNA is induced by ATF6 and spliced by IRE1 in response to ER stress to produce a highly active transcription factor. Cell. 2001 Dec 28;107(7):881-91.
66. Shen J, Chen X, Hendershot L, Prywes R. ER stress regulation of ATF6 localization by dissociation of BiP/GRP78 binding and unmasking of Golgi localization signals. Dev Cell. 2002;3(1):99-111.
67. Yamamoto K, Sato T, Matsui T, Sato M, Okada T, Yoshida H, et al. Transcriptional induction of mammalian ER quality control proteins is mediated by single or combined action of ATF6alpha and XBP1. Dev Cell. 2007 Sep;13(3):365-76.
68. Ferri KF, Kroemer G. Organelle-specific initiation of cell death pathways. Nat Cell Biol. 2001 Nov;3(11):E255-63.
69. Szegezdi E, Logue SE, Gorman AM, Samali A. Mediators of endoplasmic reticulum stress-induced apoptosis. EMBO Rep. 2006 Sep;7(9):880-5.
70. Jousse C, Deval C, Maurin AC, Parry L, Cherasse Y, Chaveroux C, et al. TRB3 inhibits the transcriptional activation of stress-regulated genes by a negative feedback on the ATF4 pathway. J Biol Chem. 2007 May 25;282(21):15851-61.
71. Hai T, Hartman MG. The molecular biology and nomenclature of the activating transcription factor/cAMP responsive element binding family of transcription factors: activating transcription factor proteins and homeostasis. Gene. 2001;273(1):1-11.
72. Nakagawa T, Yuan J. Cross-talk between two cysteine protease families. Activation of caspase-12 by calpain in apoptosis. J Cell Biol. 2000 Aug 21;150(4):887- 94.
73. Yoneda T, Imaizumi K, Oono K, Yui D, Gomi F, Katayama T, et al. Activation of caspase-12, an endoplastic reticulum (ER) resident caspase, through tumor necrosis factor receptor-associated factor 2-dependent mechanism in response to the ER stress. J Biol Chem. 2001 Apr 27;276(17):13935-40.
74. McCullough KD, Martindale JL, Klotz LO, Aw TY, Holbrook NJ. Gadd153 sensitizes cells to endoplasmic reticulum stress by down-regulating Bcl2 and perturbing the cellular redox state. Mol Cell Biol. 2001 Feb;21(4):1249-59.
75. Puthalakath H, O'Reilly LA, Gunn P, Lee L, Kelly PN, Huntington ND, et al. ER stress triggers apoptosis by activating BH3-only protein Bim. Cell. 2007 Jun 29;129(7):1337-49.
82 76. Scorrano L, Oakes SA, Opferman JT, Cheng EH, Sorcinelli MD, Pozzan T, et al. BAX and BAK regulation of endoplasmic reticulum Ca2+: a control point for apoptosis. Science. 2003 Apr 4;300(5616):135-9.
77. Li Y, Bevilacqua E, Chiribau CB, Majumder M, Wang C, Croniger CM, et al. Differential control of the CCAAT/enhancer-binding protein beta (C/EBPbeta) products liver-enriched transcriptional activating protein (LAP) and liver-enriched transcriptional inhibitory protein (LIP) and the regulation of gene expression during the response to endoplasmic reticulum stress. J Biol Chem. 2008 Aug 15;283(33):22443-56.
78. Koumenis C. ER Stress, Hypoxia Tolerance and Tumor Progression. Curr Mol Med. 2006 Feb;6(1):55-69.
79. Yoshimoto T, Yoshimoto E, Meruelo D. Enhanced gene expression of the murine ecotropic retroviral receptor and its human homolog in proliferating cells. J Virol. 1992;66(7):4377-81.
80. Fernandez J, Bode B, Koromilas A, Diehl JA, Krukovets I, Snider MD, et al. Translation mediated by the internal ribosome entry site of the cat-1 mRNA is regulated by glucose availability in a PERK kinase-dependent manner. J Biol Chem. 2002 Apr 5;277(14):11780-7.
81. Guo Z, Boekhoudt GH, Boss JM. Role of the intronic enhancer in tumor necrosis factor-mediated induction of manganous superoxide dismutase. J Biol Chem. 2003 Jun 27;278(26):23570-8.
82. De Angelis R, Iezzi S, Bruno T, Corbi N, Di Padova M, Floridi A, et al. Functional interaction of the subunit 3 of RNA polymerase II (RPB3) with transcription factor-4 (ATF4). FEBS Lett. 2003 Jul 17;547(1-3):15-9.
83. Suske G, Bruford E, Philipsen S. Mammalian SP/KLF transcription factors: bring in the family. Genomics. 2005 May;85(5):551-6.
84. Yu B, Datta PK, Bagchi S. Stability of the Sp3-DNA complex is promoter- specific: Sp3 efficiently competes with Sp1 for binding to promoters containing multiple Sp-sites. Nucleic Acids Res. 2003 Sep 15;31(18):5368-76.
85. Leung-Pineda V, Kilberg MS. Role of Sp1 and Sp3 in the nutrient-regulated expression of the human asparagine synthetase gene. J Biol Chem. 2002;277(19):16585- 91.
86. Ryu H, Lee J, Zaman K, Kubilis J, Ferrante RJ, Ross BD, et al. Sp1 and Sp3 are oxidative stress-inducible, antideath transcription factors in cortical neurons. J Neurosci. 2003 May 1;23(9):3597-606.
83 87. Huang Y, Kang BN, Tian J, Liu Y, Luo HR, Hester L, et al. The cationic amino acid transporters CAT1 and CAT3 mediate NMDA receptor activation-dependent changes in elaboration of neuronal processes via the mammalian target of rapamycin mTOR pathway. J Neurosci. 2007 Jan 17;27(3):449-58.
88. Kruger I, Vollmer M, Simmons DG, Elsasser HP, Philipsen S, Suske G. Sp1/Sp3 compound heterozygous mice are not viable: impaired erythropoiesis and severe placental defects. Dev Dyn. 2007 Aug;236(8):2235-44.
89. Masuoka HC, Townes TM. Targeted disruption of the activating transcription factor 4 gene results in severe fetal anemia in mice. Blood. 2002 Feb 1;99(3):736-45.
90. Fernandez J, Yaman I, Huang C, Liu H, Lopez AB, Komar AA, et al. Ribosome stalling regulates IRES-mediated translation in eukaryotes, a parallel to prokaryotic attenuation. Mol Cell. 2005 Feb 4;17(3):405-16.
91. Johnson EM. The Pur protein family: clues to function from recent studies on cancer and AIDS. Anticancer Res. 2003 May-Jun;23(3A):2093-100.
92. Bergemann AD, Johnson EM. The HeLa Pur factor binds single-stranded DNA at a specific element conserved in gene flanking regions and origins of DNA replication. Mol Cell Biol. 1992 Mar;12(3):1257-65.
93. Bergemann AD, Ma ZW, Johnson EM. Sequence of cDNA comprising the human pur gene and sequence-specific single-stranded-DNA-binding properties of the encoded protein. Mol Cell Biol. 1992 Dec;12(12):5673-82.
94. Haas S, Thatikunta P, Steplewski A, Johnson EM, Khalili K, Amini S. A 39-kD DNA-binding protein from mouse brain stimulates transcription of myelin basic protein gene in oligodendrocytic cells. J Cell Biol. 1995 Sep;130(5):1171-9.
95. Darbinian N, Gallia GL, Khalili K. Helix-destabilizing properties of the human single-stranded DNA- and RNA-binding protein Puralpha. J Cell Biochem. 2001;80(4):589-95.
96. Khalili K, Del Valle L, Muralidharan V, Gault WJ, Darbinian N, Otte J, et al. Puralpha is essential for postnatal brain development and developmentally coupled cellular proliferation as revealed by genetic inactivation in the mouse. Mol Cell Biol. 2003 Oct;23(19):6857-75.
97. Kong T, Scully M, Shelley CS, Colgan SP. Identification of Pur alpha as a new hypoxia response factor responsible for coordinated induction of the beta 2 integrin family. J Immunol. 2007 Aug 1;179(3):1934-41.
84 98. Tretiakova A, Steplewski A, Johnson EM, Khalili K, Amini S. Regulation of myelin basic protein gene transcription by Sp1 and Puralpha: evidence for association of Sp1 and Puralpha in brain. J Cell Physiol. 1999 Oct;181(1):160-8.
99. Chen NN, Khalili K. Transcriptional regulation of human JC polyomavirus promoters by cellular proteins YB-1 and Pur alpha in glial cells. J Virol. 1995 Sep;69(9):5843-8.
100. Gupta M, Sueblinvong V, Raman J, Jeevanandam V, Gupta MP. Single-stranded DNA-binding proteins PURalpha and PURbeta bind to a purine-rich negative regulatory element of the alpha-myosin heavy chain gene and control transcriptional and translational regulation of the gene expression. Implications in the repression of alpha- myosin heavy chain during heart failure. J Biol Chem. 2003 Nov 7;278(45):44935-48.
101. Sadakata T, Kuo C, Ichikawa H, Nishikawa E, Niu SY, Kumamaru E, et al. Puralpha, a single-stranded DNA binding protein, suppresses the enhancer activity of cAMP response element (CRE). Brain Res Mol Brain Res. 2000 Apr 14;77(1):47-54.
102. Muralidharan V, Sweet T, Nadraga Y, Amini S, Khalili K. Regulation of Puralpha gene transcription: evidence for autoregulation of Puralpha promoter. J Cell Physiol. 2001 Mar;186(3):406-13.
103. Jiang HY, Wek RC. Phosphorylation of the alpha-subunit of the eukaryotic initiation factor-2 (eIF2alpha) reduces protein synthesis and enhances apoptosis in response to proteasome inhibition. J Biol Chem. 2005 Apr 8;280(14):14189-202.
104. Harding HP, Novoa I, Zhang Y, Zeng H, Wek R, Schapira M, et al. Regulated translation initiation controls stress-induced gene expression in mammalian cells. Mol Cell. 2000 Nov;6(5):1099-108.
105. Ji J, Tsika GL, Rindt H, Schreiber KL, McCarthy JJ, Kelm RJ, Jr., et al. Puralpha and Purbeta collaborate with Sp3 to negatively regulate beta-myosin heavy chain gene expression during skeletal muscle inactivity. Mol Cell Biol. 2007 Feb;27(4):1531-43.
106. Kelm RJ, Jr., Cogan JG, Elder PK, Strauch AR, Getz MJ. Molecular interactions between single-stranded DNA-binding proteins associated with an essential MCAT element in the mouse smooth muscle alpha-actin promoter. J Biol Chem. 1999 May 14;274(20):14238-45.
107. Meisterernst M, Roy AL, Lieu HM, Roeder RG. Activation of class II gene transcription by regulatory factors is potentiated by a novel activity. Cell. 1991 Sep 6;66(5):981-93.
108. Le Hir H, Nott A, Moore MJ. How introns influence and enhance eukaryotic gene expression. Trends Biochem Sci. 2003 Apr;28(4):215-20.
85 109. Su N, Kilberg MS. C/EBP Homology Protein (CHOP) Interacts with Activating Transcription Factor 4 (ATF4) and Negatively Regulates the Stress-dependent Induction of the Asparagine Synthetase Gene. J Biol Chem. 2008 Dec 12;283(50):35106-17.
110. Subramanian SV, Polikandriotis JA, Kelm RJ, Jr., David JJ, Orosz CG, Strauch AR. Induction of vascular smooth muscle alpha-actin gene transcription in transforming growth factor beta1-activated myofibroblasts mediated by dynamic interplay between the Pur repressor proteins and Sp1/Smad coactivators. Mol Biol Cell. 2004 Oct;15(10):4532- 43.
111. Pan YX, Chen H, Thiaville MM, Kilberg MS. Activation of the ATF3 gene through a co-ordinated amino acid-sensing response programme that controls transcriptional regulation of responsive genes following amino acid limitation. Biochem J. 2007 Jan 1;401(1):299-307.
112. Inoue T, Maeno A, Talbot C, Jr., Zeng Y, Yeater DB, Leman ES, et al. Purine- rich element binding protein (PUR) alpha induces endoplasmic reticulum stress response, and cell differentiation pathways in prostate cancer cells. Prostate. 2009 Jun 1;69(8):861- 73.
113. Kilberg MS, Barbosa-Tessmann IP. Genomic sequences necessary for transcriptional activation by amino acid deprivation of mammalian cells. J Nutr. 2002;132(7):1801-4.
114. Wang XZ, Kuroda M, Sok J, Batchvarova N, Kimmel R, Chung P, et al. Identification of novel stress-induced genes downstream of chop. Embo J. 1998 Jul 1;17(13):3619-30.
115. Edinger AL, Cinalli RM, Thompson CB. Rab7 prevents growth factor- independent survival by inhibiting cell-autonomous nutrient transporter expression. Dev Cell. 2003 Oct;5(4):571-82.
116. Palii SS, Thiaville MM, Pan YX, Zhong C, Kilberg MS. Characterization of the amino acid response element within the human sodium-coupled neutral amino acid transporter 2 (SNAT2) System A transporter gene. Biochem J. 2006 May 1;395(3):517- 27.
117. Abdelrahim M, Liu S, Safe S. Induction of endoplasmic reticulum-induced stress genes in Panc-1 pancreatic cancer cells is dependent on Sp proteins. J Biol Chem. 2005 Apr 22;280(16):16508-13.
118. Mori K. Tripartite management of unfolded proteins in the endoplasmic reticulum. Cell. 2000 May 26;101(5):451-4.
86 119. Roy B, Lee AS. The mammalian endoplasmic reticulum stress response element consists of an evolutionarily conserved tripartite structure and interacts with a novel stress-inducible complex. Nucleic Acids Res. 1999 Mar 15;27(6):1437-43.
120. Tan NY, Khachigian LM. Sp1 phosphorylation and its regulation of gene transcription. Mol Cell Biol. 2009 May;29(10):2483-8.
121. Igarashi K, Kashiwagi K. Modulation of cellular function by polyamines. Int J Biochem Cell Biol. 2010 Jan;42(1):39-51.
122. White MK, Johnson EM, Khalili K. Multiple roles for Puralpha in cellular and viral regulation. Cell Cycle. 2009 Feb 1;8(3):1-7.
123. Kaye DM, Parnell MM, Ahlers BA. Reduced myocardial and systemic L-arginine uptake in heart failure. Circ Res. 2002 Dec 13;91(12):1198-203.
124. Bi M, Naczki C, Koritzinsky M, Fels D, Blais J, Hu N, et al. ER stress-regulated translation increases tolerance to extreme hypoxia and promotes tumor growth. EMBO J. 2005 Oct 5;24(19):3470-81.
125. Okada K, Minamino T, Tsukamoto Y, Liao Y, Tsukamoto O, Takashima S, et al. Prolonged endoplasmic reticulum stress in hypertrophic and failing heart after aortic constriction: possible contribution of endoplasmic reticulum stress to cardiac myocyte apoptosis. Circulation. 2004 Aug 10;110(6):705-12.
87