Organic Anion Transporter Blockade to Improve Beta Cell Function in Diabetes

Judith Andrea Eversley

A thesis submitted in conformity with the requirements for the degree of Master of Science in Physiology Department of Physiology University of Toronto

Organic Anion Transporter Blockade to Improve Beta Cell Function in Diabetes Judith Andrea Eversley Department of Physiology University of Toronto

2016

ABSTRACT

The furan fatty acid metabolite 3-carboxy-4-methyl-5-propyl-2-furanpropanoic acid (CMPF) is elevated in Type 2 Diabetes. CMPF delivery to diabetic levels in mice causes glucose intolerance, impairing glucose-stimulated insulin secretion (GSIS). CMPF enters the β cell through Organic

Anion Transporters (OATs). Here, we investigate whether OAT blockade represents a therapeutic target for diabetes prevention, blocking CMPF action on the β cell. First, we block CMPF transport in vivo using pharmacological OAT inhibition. CMPF impairs glucose tolerance, and islets isolated from CMPF-treated mice showed impaired GSIS, while co-treatment with pan-OAT inhibitor probenecid rescues glucose tolerance and islet function. Next, we developed Oat3 knockout

(Oat3KO) mice which were also protected against the negative effects of CMPF in vivo, and remarkably, Oat3KO mice were more glucose tolerant than Wildtype controls. These novel studies demonstrate the requirement of OAT transport for CMPF to alter β cell function, and highlight potential for OAT inhibition to improve diabetes.

ACKNOWLEDGEMENTS

I owe the productivity and success I enjoyed during my Master’s degree to many people who have helped guide and support me along the way, and I would like to take this opportunity to acknowledge these people.

First to my supervisor, Mike: thanks for providing me with endless opportunities to explore my scientific interests. You took a chance on me—even though you thought I was too timid to be a Master’s Student in the Wheeler Lab—and I’m so proud of how much I have grown under your supervision.

Next to my colleagues in the Wheeler Lab: how lucky am I to have been surrounded by so many caring, intellectual individuals during my two years in the lab? Alpana and Elena, you are both so kind and have been so much help. Ying and Tseegii thank you for your guidance throughout these two years, and for being my bonus bosses. Sean and Rida, thank you for being great friends and keeping me going. Finally Dr. Prentice, thank you for teaching me literally everything I know about anything from western blots to intracellular signalling pathways to appropriate conference attire.

To my Graduate Committee, Drs. Bazinet, Cummins, and Ng: it was a pleasure to work with all of you. Thank you for your insights, patience, and support!

To my friends: it’s such a gift to have an amazing support network in Toronto and London. My AGD family, Western Phys/Pharm friends, and MCI friends deserve special recognition here. Importantly, I can’t write acknowledgements without mentioning my best friends Julia and Reid: thinking about the love and encouragement you’ve shown me makes me an emotional wreck. I couldn’t have done this without you.

Finally to my family: Jude, John, and Jenn. Growing up in a family with a bunch of geniuses wasn’t easy at first but it certainly paid off in the end. I’ve always aspired to be as motivated, hardworking, and successful as you. It’s going to be a tight race to be the next Dr. J. A. Eversley, so I’ll have to keep on track. I want Grandpa’s sign now.

iii

TABLE OF CONTENTS Section Title Page Abstract ii Acknowledgements iii Table of Contents iv List of Tables viii List of Figures ix Abbreviations xi

Chapter 1 – Introduction 1 1.1 Diabetes Mellitus 1 1.1.1 Classification of Diabetes 1 1.1.1a Type 1 Diabetes 1 1.1.1b Type 2 Diabetes 2 1.1.1c Gestational Diabetes 4 1.1.2 Complications of Diabetes 4 1.1.2a Macrovascular Complications 4 1.1.2b Microvascular Complications 5 1.1.2c GDM Complications 5 1.1.2d Managing Diabetes 5 1.1.3 The Pancreatic β Cell 7 1.1.3a Insulin 7 1.1.3b Glucose-Stimulated Insulin Secretion 8 1.1.3c Other Receptors Regulating Insulin Secretion 9 1.1.4 β Cell Dysfunction 10 1.1.4a Glucotoxicity, Lipotoxicity, Glucolipotoxicity 11 1.1.4b Oxidative Stress 11 1.1.5 Discovery-based Screening to Identify Factors Involved in T2D 12 1.1.5a Metabolomics 13 1.2 3-carboxy-4-methyl-5-propyl-2-furanpropanoic acid (CMPF) 15 1.2.1 Discovery of CMPF in Diabetes 15 1.2.1a CMPF is Elevated in populations with GDM and T2D 15 1.2.1b What is CMPF 15 1.2.1c CMPF is Elevated Prior to Overt Diabetes Onset 17 1.2.1d Rapid Elevation in Circulating CMPF may Accelerate T2D 17 Progression 1.2.1e CMPF Predicts AUCglucose in GDM women 18 1.2.2 CMPF Directly Impairs β cell Function 18 1.2.2a CMPF Impairs Glucose Tolerance in vivo 18 1.2.2b CMPF Impairs Insulin Secretion 19 1.2.2c CMPF Directly Impairs Insulin Biosynthesis and Secretion in 19 vitro 1.2.3 Rapid Elevation in CMPF Accelerates Diabetes Progression in vivo 20 1.2.3a CMPF Accelerates T2D in Diet Induced Obesity 20

1.2.3b CMPF Accelerates T2D in Genetic Prediabetes Models 21 1.2.3c CMPF Reduces Glycolysis and Increases Oxidative Stress 21 1.2.4 CMPF enters the β cell through OATs 22 1.2.4a OAT3 is Present in Insulin-Positive Cells 22 1.2.4b OAT3 Inhibition Protects against CMPF in vivo 23 1.3 Organic Anion Transporters 24 1.3.1 Classification of Drug Transporters 24 1.3.1a Characteristics of Drug Transporters 24 1.3.1b Drug Transporter Gene Families 25 1.3.2 The Organic Anion Transporter Family 27 1.3.2a OAT Nomenclature 27 1.3.3 Organic Anion Transporter 3 28 1.3.3a OAT3 Structure and Function 28 1.3.3b Renal Elimination of Organic Anions by OAT3 31 1.3.3c OAT3 Substrates 33 1.3.3d OAT3 Inhibitors 37 1.3.3e Factors Influencing OAT3 Expression 38

Chapter 2 – Research Aims and Hypotheses 39 2.1 Rationale 39 2.2 Objective and Hypotheses 39 2.3 Scientific Aims 39 2.3.1 OAT Blockade to Improve β cell Function in vivo 39 2.3.1a Aim 1a: in vivo Genetic Elimination of Oat3 40 2.3.1b Aim 1b: in vivo Pharmacological OAT Inhibition 40 2.3.2 Screening Methods to Discover Novel OAT3 Inhibitors 40

Chapter 3 – OAT Blockade to Improve β cell Function in vivo 41 3.1 Introduction 41 3.2 Materials and Methods 42 3.2.1 CMPF, Probenecid Preparation 42 3.2.2 Human Islets 42 3.2.3 Mitochondrial Membrane Potential Measurements 42 3.2.4 Generation of Oat3KO mice 43 3.2.4a Oat3KO mice 43 3.2.4b Oat3BKO mice 43 3.2.4c Genotyping Slc22a8 floxed mice 44 3.2.5 Intraperitoneal Injection of CMPF, Probenecid 46 3.2.5a Oat3KO-CMPF experiments 46 3.2.5b Probenecid then CMPF experiments 47 3.2.5c Long-term CMPF experiments 47 3.2.6 SRM/MS for the Quantification of CMPF 48 3.2.7 Tolerance Tests 48 3.2.8 Islet Isolation, Glucose-Stimulated Insulin Secretion, Insulin 48 HTRF

3.2.9 Islet Oxygen Consumption Measurement 49 3.2.10 Gene Expression & Western Blotting 49 3.2.11 Statistical Analysis 50 3.3 Results 50 3.3.1 OAT Blockade to protect against CMPF in vitro 50 3.3.1a Human Islet ROS Accumulation 50 3.3.1b Glucose-Stimulated Insulin Secretion 51 3.3.1c Islet CMPF Metabolism 52 3.3.1d CMPF causes a Metabolic Switch in vitro 53 3.3.2 Characterization of Oat3KO mice 54 3.3.3 Genetic Elimination of Oat3 to protect against CMPF in vivo 56 3.3.3a Measurement of CMPF in Oat3KO mice 56 3.3.3b Glucose Tolerance Testing 56 3.3.3c Glucose-Stimulated Insulin Secretion 58 3.3.3d Islet Glucose Metabolism 58 3.3.4 Pharmacological Oat Inhibition to protect against CMPF in vivo 59 3.3.4a Measurement of CMPF in Probenecid-treated mice 59 3.3.4b Glucose Tolerance Testing 60 3.3.4c Glucose-Stimulated Insulin Secretion 61 3.3.4d Islet ROS Accumulation 61 3.3.5 CMPF Causes Persistent Glucose Intolerance 62 3.3.5a CMPF is Eliminated from Circulation 24h Following 62 Injection 3.3.5b CMPF has Long-term Action on Glucose Tolerance 63 with an Insulin Resistant Background 3.3.5c Long-term Action of CMPF is Inhibited by Oat3 64 Elimination 3.3.5d Long-term Action of CMPF is Inhibited by 65 Pharmacological OAT Inhibition 3.4 Discussion 65

Chapter 4 – Screening Methods to Discover Novel OAT3 Inhibitors 66 4.1 Introduction 66 4.2 Materials and Methods 67 4.2.1 CMPF, Probenecid Preparation 67 4.2.2 HEK293 Cell Culture, Transfection 68 4.2.3 Reactive Oxygen Species Measurement 68 4.2.4 6-CF Measurement of OAT3 Transport 68 4.2.5 Statistical Analysis 68 4.3 Results 69 4.3.1 Overexpression of OAT3 in HEK293 Cells 69 4.3.2 OAT inhibitor Screening Assays 70 4.3.2a Using CMPF-induced ROS Accumulation in HEK293- 70 OAT3 Cells

4.3.2b Using CMPF-induced ROS Accumulation in HEK293 70 Cells 4.3.2c Using 6-CF Transport 71 4.4 Discussion 72

Chapter 5 – Discussion 74 5.1 Concluding Remarks and Future Directions 74

References 78

vii

LIST OF TABLES Table 1 Canadian Diabetes Association Criteria for the Diagnosis of IGT and T2D. Table 2 List of current antihyperglycemic agents approved for treatment of T2D Table 3 Changes in circulating CMPF from baseline to follow-up in prospective cohort of T2D “progressors” and “non-progressors” Table 4 List of identified Organic Anion Transporters Table 5 List of OAT3 Substrates Table 6 Primer Pairs to Genotype Slc22a8 floxed mice Table 7 Results of PCR based on genotype for Slc22a8 floxed mice Table 8 Primer sequences for genotyping Slc22a8 floxed mice Table 9 List of qPCR primer pairs (Chapter 3)

viii

LIST OF FIGURES Figure 1 Representative Timeline showing compensation then decline in β cell mass and insulin secretion during progression of T2D Figure 2 Glucose-Simulated Insulin Secretion Pathway Figure 3 Factors in the blood which may contribute to β cell dysfunction by decreasing cell mass, function, and insulin secretion Figure 4 CMPF structure Figure 5 Classification of superfamilies of Multispecific Drug transporters which transport Organic Anions and Cations Figure 6 Graphical representation of OAT3 Structure Figure 7 Graphical representation of tertiary active OAT transport Figure 8 Proposed “rocker switch” mechanism for translocation of substrates across the membrane through OAT3 Figure 9 Renal elimination of organic anions through OATs at the level of the proximal tubule cells Figure 10 Molecular Structure of OAT inhibitor Probenecid Figure 11 Breeding program for the generation of whole body Oat3 KO Figure 12 Breeding program for the generation of β cell-specific Oat3 KO Figure 13 Treatment paradigm of CMPF delivery in WT and Oat3KO mice for 7 days. Figure 14 Probenecid then CMPF Treatment paradigm. Figure 15 CMPF increases ROS in Human Islets which can be inhibited by pharmacological OAT inhibition. Figure 16 Glucose-Stimulated Insulin Secretion of WT and KO mice treated with CMPF for 24 hours in vitro. Figure 17 MMP measurements in response to acute CMPF or Vehicle (EtOH) addition in WT or Oat3KO islets Figure 18 MMP measurements in response to acute Palmitate addition in HEK293 Cells treated with CMPF Figure 19 Oat3KO mice lose Oat3 expression Figure 20 Oat3KO mice have an improved metabolic phenotype Figure 21 CMPF injection kinetics in Oat3KO mice Figure 22 Oat3KO-CMPF in vivo Figure 23 Oat3KO-CMPF Seahorse Figure 24 CMPF injection kinetics in PBN mice Figure 25 PBN then CMPF in vivo

Figure 26 Islet ROS is increased with in vivo CMPF treatment Figure 27 CMPF is eliminated from the circulation 24 hours following injection Figure 28 CMPF causes persistent glucose intolerance beyond HFD-Controls Figure 29 Genetic Elimination of Oat3 protects against persistent action of CMPF on islet function Figure 30 Probenecid protects against long-term action of CMPF in vivo Figure 31 Cells transfected with hOAT3 increase expression of OAT3 and HA-tag protein Figure 32 OAT3 protein expression is increased with transfection Figure 33 Assay 1 to Screen for Novel OAT3 inhibitors: CMPF induced ROS in HEK293 Cells overexpressing OAT3 Figure 34 Assay 2 to Screen for Novel OAT3 inhibitors: CMPF increases ROS in HEK293 Cells Figure 35 Assay 3 to Screen for Novel OAT3 inhibitors: 6-CF for Measurement of OAT3 Transport

LIST OF ABBREVIATIONS

6-CF 6-Carboxyflourescin NaDC3 Sodium Dicarboxylate AGE Advanced Glycosylation Co-transporter 3 End Product Na+/K+ Sodium Potassium ATP Adenosine Triphosphate ATPase ATPase AUCglucose Area Under the Glucose NGT Normal Glucose Tolerant Curve OAT Organic Anion AUCinsulin Area Under the Insulin Transporter Curve OAT1 Organic Anion BMI Body Mass Index Transporter 1 cAMP Cyclic adenosine OAT3 Organic Anion monophosphate Transporter 3 CMPF 3-carboxy-4-methyl-5- Oat3BKO OAT3 β Cell-Specific propyl-2-furanpropanoic Knockout acid Oat3KO OAT3 Whole Body DIO Diet-Induced Obesity Knockout ELISA Enzyme-linked OATP Organic Anion Immunosorbent Assay Transporting Polypeptide ER Endoplasmic Reticulum OCT Organic Cation ETC Electron Transport Chain Transporter G6P Glucose-6-phosphate OCTN Organic Cation GDM Gestational Diabetes Transporter Novel Mellitus OGTT Oral Glucose Tolerance GIP Glucose-dependent Test Insulinotropic Peptide Ox1T Oxalate Antiporter GLP-1 Glucagon-like Peptide 1 PBN Probenecid GSIS Glucose-Stimulated PC Pro-protein convertase Insulin Secretion PCG Penicillin G GTT Glucose Tolerance Test RIP-Cre Rat Insulin Promoter Cre IGT Impaired Glucose ROS Reactive Oxygen Species Tolerant T1D Type 1 Diabetes ITT Insulin Tolerance Test T2D Type 2 Diabetes ISSI-2 Insulin-Secretion TMD Transmembrane Domain Sensitivity Index 2 WT Wild Type KRB Kreb’s Ringer Buffer ΔΨm Change in Mitochondrial LacY Lactose Permease Membrane Potential MMP Mitochondrial Membrane Potential

Chapter 1: INTRODUCTION

1.1 DIABETES MELLITUS

Dating back to its first recorded documentation by ancient Egyptians who recounted a disease characterized by frequent urination and dramatic weight loss (Ahmed, 2002), diabetes mellitus remains one of the most popular diseases today, afflicting more than 380 million people world- wide (Shi and Hu, 2014). The disease adopted the term “mellitus” or “from honey”, as a result of the “sweetness” of urine observed in these patients who urinated frequently, attracting ants (Ahmed, 2002).

1.1.1 Classification of Diabetes

The first recorded account of different forms of diabetes was by Indian physicians Sushruta and Charaka in 400 to 500 CE: the two associated one type of diabetes with youth, and the other with being overweight. Today, we acknowledge 3 types of diabetes: (i) Type 1 Diabetes, characterized by autoimmune destruction of the pancreatic β cell, (ii) Type 2 Diabetes, where β cells fail to compensate for severe insulin resistance, and finally (iii) gestational diabetes, a transient form of glucose intolerance which occurs in late pregnancy.

1.1.1a Type 1 Diabetes: Type 1 Diabetes Mellitus (T1D) is often referred to as “insulin- dependent diabetes” (IDDM) or “juvenile diabetes”. According to the American Diabetes Association (ADA) T1D accounts for approximately 5% of Diabetes cases, and results from autoimmune destruction of pancreatic β cells of the pancreas. β cells are endocrine cells responsible for producing insulin, an important hormone which lowers blood glucose. When β cells are incapable of producing insulin, patients are “insulin-dependant”, hence the name IDDM. T1D typically presents when 80-90% of β cell mass is lost, and can be diagnosed by measuring circulating C-peptide, a peptide cleaved from pro-insulin and co- secreted with insulin (See section 1.1.3a: Insulin). A T1D diagnosis can also be confirmed by detection of circulating autoantibodies targeting the β cell (van Belle et al., 2011). Prior to the discovery of insulin by scientists Fredrick Banting and Charles Best at the University of Toronto in 1921, T1D was a deadly disease. Today, insulin therapy—either by injection

or by pump—becomes an absolute necessity as patients have no endogenous source of this important hormone required to lower blood glucose. However, even with insulin therapy, constant monitoring of dietary carbohydrate intake as well as blood glucose are required.

1.1.1b Type 2 Diabetes: Type 2 Diabetes (T2D) is the most common form of diabetes, accounting for approximately 90% of diabetes cases. While T1D is characterized by an absolute lack of insulin-producing cells, T2D results from insufficient insulin action. T2D progression is more complex than T1D, involving multiple organ systems and not only the pancreatic islet. In disease progression, insulin resistance—inability of peripheral tissues to respond to insulin and increase glucose uptake—first causes a compensatory phase where the β cells attempt to account for this resistance and increase β cell mass and insulin secretion (Weir and Bonner Weir, 2004) (Figure 1). The main organs involved in insulin- sensitive glucose uptake are the liver, adipose tissue, and skeletal muscle. Insulin resistance in these organs may occur due to a number of factors including increasing adiposity, aging, ectopic lipid accumulation, and inflammation (Samuel and Shulman, 2012). As the disease progresses, patients then become “impaired glucose tolerant” (IGT), a stage also referred to as “prediabetes”. As β cell compensation fails, β cell mass and insulin secretion decline, resulting in overt diabetes: insufficient insulin action decreases the ability of tissues to adequately uptake glucose, resulting in hyperglycemia. Given this definition of T2D, the disease is also known as “Non-insulin dependent diabetes mellitus” (NIDDM) as there is no requirement for insulin, only inability of insulin to act appropriately. Importantly, this disease progression occurs at vastly different rates in different individuals. While some patients may maintain a state of IGT for years without developing overt T2D, what ultimately causes β cell decompensation and failure in other patients is unknown. This progression occurs independent of variables such as Body Mass Index (BMI) and insulin resistance, but always correlates with a sudden, drastic impairment in glucose-stimulated insulin secretion (GSIS) (Ferrannini et al., 2004; Weir and Bonner Weir, 2004). Increases in blood glucose levels occur when measurements of β cell function decline (i.e., the ISSI- 2, Insulin-Secretion Sensitivity Index-2) (Festa et al., 2013).

Figure 1: Representative Timeline showing compensation then decline in β cell mass and insulin secretion during T2D progression: In early disease progression, insulin secretion and β cell mass increase as the body attempts to compensate for insulin resistance, but eventually decompensation occurs with decreased mass and insulin secretion resulting in overt, severe T2D.

Diagnostic tools for T2D include fasting plasma glucose, glucose tolerance, and glycated hemoglobin (HbA1c). When hemoglobin is glycosylated by excess blood glucose, the glycosylation lasts the entire lifespan of an erythrocyte (approximately 120 days), making HbAlc a quantification of chronic glycemic state over a longer time period, and a valuable tool in T2D monitoring (Bennett et al., 2007). The Canadian standards for Diagnosis of IGT and T2D are listed in Table 1.

Table 1: Canadian Diabetes Association Criteria for the Diagnosis of IGT and T2D. FPG 2hPG HbAlc IGT 6.1-6.9 7.8-11.0 6.0-6.4% mM mM T2D ≥ 7.0 ≥ 11.1 ≥ 6.5% mM mM Adapted from the Canadian Diabetes Association (2013). FPG: Fasting Plasma Glucose; 2hPG: 2 hour Plasma Glucose during Oral Glucose Tolerance Test; HbAlc: Glycosylated Hemoglobin

1.1.1c Gestational Diabetes: Gestational Diabetes Mellitus (GDM)—a transient glucose intolerance during late pregnancy when there is severe insulin resistance—is the third and final form of diabetes. GDM afflicts 3 to 14% of pregnant women, and occurs when the pancreatic β cell fails to compensate for the increased metabolic demands of pregnancy (Buchanan and Xiang, 2005; Ferrara, 2007). A GDM pregnancy has many implications for both the pregnant mother and her unborn child (See section 1.1.2c: GDM Complications). Following parturition, the majority of GDM women will revert back to NGT, however despite the transient nature of GDM, it is not an isolated disorder. A GDM diagnosis during pregnancy is the strongest risk factor for future Type 2 Diabetes (T2D) in women: as many as 70% of GDM women develop T2D within 10 years postpartum (Buchanan and Xiang, 2005). Due to the acute nature of GDM, diagnosis cannot be based on HbA1c, and instead GDM diagnosis relies on Glucose Challenge Tests and Glucose Tolerance Tests (GTT). GDM diagnosis is given if 2 or more plasma glucose values are above National Diabetes Data Group criteria during 75 g Oral GTT: FPG ≥ 5.8 mM Fasting, 1hPG ≥ 10.6 mM, 2hPG ≥ 9.2 mM, and 3hPG ≥ 8.1 mM (Retnakaran et al., 2010).

1.1.2 Complications of Diabetes

Complications of Diabetes are associated with both increased morbidity and mortality. Acute complications which cause increased morbidity occur when blood glucose reaches exceptionally high (diabetic ketoacidosis) or dangerously low (diabetic coma) concentrations. However, given that T2D onset is insidious, and occurs both gradually and subtly, long-term vascular complications due to chronic elevations in blood glucose are extremely relevant. These complications occur in individuals with both T1D and T2D, and as the names suggest, are classified into complications of the large (“macro”) and small (“micro”) blood vessels.

1.1.2a Macrovascular Complications: Because a T2D diagnosis is often delayed to the point where disease has already progressed, 20% to 50% of T2D patients present with microvascular and/or macrovascular complications at diagnosis (Klein et al., 1984). The main macrovascular complication in T2D is cardiovascular disease which may manifest as premature atherosclerosis, myocardial infarction, and stroke. A diabetic patient has approximately 3-fold increased risk of myocardial infarction (Domanski et al., 2002).

1.1.2b Microvascular Complications: Microvascular diabetic complications include retinopathy, nephropathy, and neuropathy which occur due to damage of small blood vessels in the eye, kidney, and brain, respectively. The most relevant of these three complications for the purpose of this thesis is diabetic nephropathy—proteinuria with subsequent decline in glomerular filtration rate—due to progressive decline in renal function. Diabetic nephropathy is the major cause of end-stage renal failure in Western societies (Gilbertson et al., 2005). Given than differences in filtration are seen early in disease progression, it is possible that factors—including the furan fatty acid metabolite 3- carboxy-4-methyl-5-propyl-2-furanpropanoic acid (CMPF)—which are elevated in T2D and/or GDM are only secondary to T2D progression, due to their reliance on renal transport for elimination.

1.1.2c GDM Complications: Due to the transient nature of GDM, it is not associated with the same range of micro- and macrovascular complications as T2D. There are, however, GDM complications which result in significant morbidity for both the pregnant mother and developing fetus. Children born to GDM mothers are at risk of increased birth weight, delivery complications, fetal respiratory distress, jaundice, and fetal hypoglycemia, as well as future metabolic disorders including T2D (Mitanchez, 2010). GDM women are at risk of preeclampsia, and are at elevated risk of future T2D: in fact, a GDM diagnosis during pregnancy is the number 1 risk factor for future T2D in women, with as many as 70% of GDM women developing overt T2D within 10 years post-partum (Buchanan and Xiang, 2005).

1.1.2b Managing Diabetes: The first antihyperglycemic agent of choice is metformin—an oral medication that decreases hepatic glucose production. Table 2 lists some examples of medications in each class approved for the control of hyperglycemia in T2D.

Table 2: List of current antihyperglycemic agents approved for treatment of T2D.

Proprietary Drug Name Class Mechanism of Action ROA Names Metformin Supress hepatic p.o. Glucophage® gluconeogenesis

Sitagliptin, DPP-4 Inhibitor Prevents breakdown of s.c. Januvia® Linagliptin GLP-1, prolonging Tradjenta® incretin response Exenatide Incretin Mimetic GLP-1 receptor agonist s.c. Byetta® Pramlintide Amylin analogue Slows gastric emptying, s.c. Symlin® regulates food intake, supresses glucagon Canagliflozin, SGLT2 Inhibitor Inhibits glucose reuptake p.o. Invokana® Dapagliflozin, in renal proximal tubule Farxiga® Empaglifozin Jardiance® Rosiglitazone Thiazolidinedione Insulin sensitizer: binds p.o. Avandia® PPAR in adipose tissue Gliclazide Sulfonylurea Increase insulin release by p.o. Diamicron® binding and inhibiting KATP channels Glimepiride Long-acting Increase insulin release by p.o. Amaryl® Sulfonylurea binding and inhibiting KATP channels Acarbose α-glucosidase Inhibits pancreatic α- p.o. Prandase® inhibitor amylase and intestinal α- glucosidase Aspart Bolus insulin Rapid-acting insulin s.c. NovoRapid® analogue (quick absorption) Neutral Basal insulin Intermediate-acting insulin s.c. Humulin-N®, protamine analogue Novolin-N® hagedorn (NPH) Detemir Basal insulin Long-acting insulin s.c. Levemir analogue (albumin bound)

Although pharmaceutical interventions (i.e., insulin sensitizers or SGLT2 inhibitors) can help in T2D management, there is no cure for the disease. Given that no cure exists for T2D, many current therapies aim to manage diabetic complications. Today, researchers continue to focus on (i) early detection, (ii) finding new therapeutic targets to improve β cell function, or (iii) β cell replacement (Figure 1). Early detection involves the search for biomarkers which may predict future disease in an otherwise healthy, unaffected individual. Ideal therapeutic targets may prevent β cell dysfunction (perhaps in these high- risk patients identified through early detection) or restore β cell mass and function in those in early stages of disease. Finally, β cell replacement—either from human islet donors or β-

like cells derived from human embryonic stem cells—could serve as a last resort if β cell dysfunction is very severe.

1.1.3 The Pancreatic β Cell

The pancreatic islet is composed of two major cell types which act synergistically to control blood glucose. In response to high nutrient availability, the β cell produces the anabolic peptide hormone insulin, which acts on peripheral insulin-sensitive tissues to clear glucose from the circulation. When blood glucose levels are low, the α cell produces the counter-regulatory hormone glucagon, which in turn increases hepatic glucose production, increasing blood glucose. Here, we focus on the pancreatic β cell and its hormone, insulin.

1.1.3a Insulin: The field of diabetes was changed forever when in 1921, Drs. Frederick Banting and Charles Best discovered insulin at the University of Toronto. Recognizing that diabetes was a disease of the pancreas, Banting and Best imagined they could isolate what they called the “internal secretions of the pancreas” (Bliss, 1982). With success, Banting and Best isolated this extract—what would be purified and later named “insulin”—which could significantly extend the life of diabetic dogs (made diabetic by removal of the pancreas). In early 1922, a 14-year-old Toronto boy, Leonard Thompson, was the first person to receive insulin, and by 1923 insulin was widely available (Bliss, 1982).

Today, we recognize insulin as an anabolic peptide hormone produced in the pancreatic β cell absolutely necessary for control of carbohydrate metabolism and therefore control of blood glucose. The insulin biosynthetic pathway begins with preproinsulin, a 1150 Da prohormone containing 4 peptides: an amino-terminus, A- and B-chain, and carboxy terminus. Like other proteins destined for secretion, preproinsulin contains a signal peptide which directs it to the Endoplasmic Reticulum (ER) lumen. From preproinsulin, proinsulin is created by cleavage of the signal peptide and formation of two disulphite bridges between A-/B-chains (Qiao et al., 2006). Disulphite bridges allow two prohormone convertases, PC (pro-protein convertase) 2 and PC3 to cleave off a central portion of the peptide, and Carboxypeptidases to remove additional amino acids on the carboxy-terminus of the B chain. The portion cleaved by PC2 and PC3 is known as “C-peptide”, which is co- secreted with insulin at equimolar quantities. Insulin and C-peptide are packaged at the

level of the Trans Golgi Network into Clathrin-coated pits. These “insulin granules” are sensitive to intracellular calcium fluxes, and are secreted in response to stimuli such as glucose (See Section 1.1.3b: Glucose-Stimulated Insulin Secretion) (Ashcroft et al., 1994).

When insulin is released from the pancreas into the circulation it has many roles in insulin- sensitive tissues such as the liver, fat, and skeletal muscle. These roles include: (i) increasing uptake of glucose, amino acids, and fat, (ii) decreasing hepatic glucose production, (iii) decreasing adipose tissue lipolysis, (iii) decreasing protein breakdown, and (iv) decreasing ketogenesis (Sonksen and Sonksen, 2000). When pancreatic β cells are unable to produce insulin at all or when insulin action is insufficient, T1D and T2D ensue (See Section 1.1.1: Classification of Diabetes).

1.1.3b Glucose-Stimulated Insulin Secretion: A unique, important feature of the pancreatic β cell is its ability to sense availability of nutrients (such as glucose) and secrete insulin in response to nutrient availability. Factors which cause the islet to secrete insulin are referred to as “secretagogues”. Glucose is the main insulin secretagogue, with paramount importance: the major control of β cell insulin secretion comes from blood glucose levels, and glucose potentiates the response to all other non-glucose secretagogues.

The process of glucose-stimulated insulin secretion (GSIS) is often referred to as the “stimulus secretion coupling” pathway (Figure 2). As blood glucose rises, glucose enters the β cell and is phosphorylated by Glucokinase—the hexokinase isoform found in the islet—to create Glucose-6-Phosphate (G6P) (Kawai et al., 2005). Phosphorylated G6P cannot exit the islet, and enters glycolysis where it is converted to pyruvate. Pyruvate enters the mitochondria and feeds into the Tricarboxylic Acid Cycle, resulting in transfer of reducing equivalents to the Electron Transport Chain (ETC). This metabolism of glucose provides excess substrate for the ETC, ultimately leading to a change in potential across the mitochondrial membrane (ΔΨm) and ATP generation as Hydrogen ions are pumped back across the mitochondrial membrane through ATP synthase. As the intracellular ATP to ADP ratio rises, KATP channels—plasma membrane channels sensitive + to intracellular ATP—are closed. This closure of KATP channels halts K ion efflux, depolarizing the plasma membrane. Ultimately voltage-dependant Ca2+ channels on the

plasma membrane are opened, allowing influx of Ca2+, increasing cytosolic calcium levels, and triggering insulin exocytosis (Figure 2) (Ashcroft et al., 1994).

Figure 2: Glucose-Simulated Insulin Secretion Pathway. GLUT2: Glucose Transporter 2+ 2; G6P: Glucose-6-Phosphate; KATP: ATP-sensitive Potassium Channel; VD Ca : Voltage Dependant Calcium Channel

1.1.3c Other Receptors Regulating Insulin Secretion: While glucose is the main insulin secretagogue, many other nutrients regulate insulin secretion by binding cell surface receptors on the β cell. Most of these receptors are G-Protein Coupled Receptors (GPCRs) linked to either Gαs, Gαi, or Gαq subunits. In a typical Adenyl Cyclase-dependant signalling mechanism, Gαs-coupled GPCR stimulation causes an increase in cyclic adenosine monophosphate (cAMP), activation of Protein Kinase A, and increase in 2+ cytosolic Ca , ultimately resulting in granule release. Gαq-coupled GPCR stimulation also increases Ca2+ release from the ER when inositol trisphosphate binds its receptors on the ER membrane.

Free fatty acids are non-glucose secretagogues which bind GPR40 (a Gαq-coupled receptor) to stimulate insulin release, while fatty acid derivatives such as those produced from membranes bind GPR119 (a Gαs-coupled GPCR) to stimulate insulin secretion (Mancini and Poitout, 2013).

Insulin secretion is also under autonomic control. The sympathetic nervous system

decreases insulin secretion through adrenergic α2 receptor (Gαi-coupled GPCRs) activation, causing a decrease in cAMP, inhibiting insulin release. The parasympathetic

nervous system, however, increases insulin secretion through cholinergic M3 receptor

(Gαq-coupled) activation.

Perhaps the most important non-glucose secretagogues are the incretins. Enteroendocrine cells in the gut are sensitive to luminar contents (i.e., glucose and fatty acids) and secrete these “incretin” hormones in response to gut nutrient availability. The first incretin hormone, Glucagon-like Peptide 1 (GLP-1) is produced in the L-cell of the ileum and colon from post-translational modification of the pro-glucagon gene. The second incretin, Glucose-dependent Insulinotropic Peptide (GIP) is produced in the K-cell of the jejenum

and duodenum. Both GLP-1 and GIP bind their respective Gαs receptors to potentiate insulin secretion (Mudaliar and Henry, 2010). GLP-1 and GIP also have extra-pancreatic effects including to decrease gastric emptying, increase satiety, and decrease food intake (Drucker, Cell Metab 2006).

1.1.4 β Cell Dysfunction

Both GDM and T2D are complex, polygenic disorders with slow onset as the pancreatic β cells fail to compensate for increasing insulin resistance. There are, however, many factors which ultimately cause these β cells to fail, and therefore many areas of research which aim to define both common and novel factors. Genome-wide scans have successfully identified T2D risk loci, which include genes controlling β cell development/function, which indicate genetic susceptibility must, in fact, partially determine T2D risk (Sladek et al., 007; Saxena et al., 2007). Undoubtedly, while genetics influences T2D risk, environmental factors including diet and exercise are involved in its pathogenesis. Both genetics and environment are important in T2D, but a number of other factors which are thought to influence β cell decline in disease pathogenesis include Glucotoxicity, Lipotoxicity, Glucolipotoxicity, Oxidative and ER stress, mitochondrial dysfunction, islet inflammation (Figure 3).

Figure 3: Factors in the blood which may contribute to β cell dysfunction by decreasing cell mass, function, and insulin secretion.

1.1.4a Glucotoxicity, Lipotoxicity, Glucolipotoxicity: While genetic susceptibility and environmental factors may play a large role, there are likely factors secondary to these phenomenon which follow the primary pathogenesis of T2D to accelerate β cell dysfunction. Particularly, three factors which are hypothesized to influence β cell decline are chronic elevations in glucose (“glucotoxicity”), chronic dyslipidemia (“lipotoxicity”), and finally a combination of both (“glucolipotoxicity”) (Poitout and Robertson, 2008). While physiological glucose and lipid levels are imperative for β cell function, in the setting of hyperglycemia and hyperlipidemia in early T2D development, glucose and lipids become toxic to the β cell. While both nutrients alone can be detrimental to cell function, they act synergistically on the β cell to accelerate decline: the combination of excessive elevations fatty acids and glucose impairs insulin secretion, decreases insulin gene expression, impairs mitochondrial function, and causes β cell death by apoptosis (Robertson et al., 2004).

1.1.4b Oxidative Stress: Oxidative Stress—the imbalance of pro- and anti-oxidant systems in the cell—is known to be deleterious to the islet for many reasons. Reactive Oxygen Species (ROS) can cause β cell dysfunction and ultimately death by altering metabolic pathways, cellular membrane structure, DNA, or proteins (Newsholme et al., 2007; Boveris et al., 1972; Chandra et al., 2000). As oxidative phosphorylation increases

− with increased glycolytic flux in the β cell, superoxide (O2• ) is produced from the electron − transport chain (Schoonbroodt and Piette, 2000). O2• is then fed into a series of reactions

to produce other forms of ROS in the β cell, including H2O2 which is less reactive but longer-lasting (Newsholme et al., 2012). While excess ROS is detrimental to the islet, low, basal levels of ROS are necessary in islet to aid insulin release: for instance, ROS has been shown to acutely increase GSIS in mouse islets at low glucose (Pi et al., 2007), low Nitric

Oxide levels enhance granule exocytosis (Wiseman et al., 2011), and low H2O2 levels positively regulate mitochondrial Ca2+ influx to drive second phase insulin release (Leloup et al., 2009). Oxidative stress occurs in the islet due to either excess ROS or inadequate antioxidant systems in place in the islet: β cells have a relatively weak antioxidant system relying mainly on glutathione peroxidase and catalase, among other antioxidant enzymes and nonenzymatic cellular antioxidants including glutathione, a tripeptide cofactor for glutathione peroxidase (Newsholme et al., 2012). As excessive, uncontrolled oxidative stress contributes to β cell dysfunction, research looks at antioxidant therapies for T2D such as glutathione peroxidase mimetics (“ebselen”) (Mahadevan et al., 2013). Glutathione peroxidase mimetics can prevent islet apoptosis, double β cell mass, and prevent expression of oxidative stress markers, and ameliorate fasting hyperglycemia and insulin levels in the diabetic rat (Mahadevan et al., 2013).

1.1.5 Discovery-based Screening to Identify Factors Involved in T2D

The use of high-throughput “–omics” approaches is a popular tool to identify novel risk factors which predispose diverse populations to future disease or causal agents involved in disease progression. Multiple “–omics” platforms are available for researchers to achieve these aims including genomics, proteomics, and metabolomics. For those who argue that genetics play a large role in disease risk and progression, genomics is the tool of choice: genome-wide association studies identify genetic loci involved in disease risk. In the context of T2D, the majority of genes identified associated with disease risk regulate β cell function and insulin secretion (Florez, 2008). Beyond genomics is proteomics: high-throughput investigation of differential protein expression associated with disease. Proteomics has successfully been used to identify changes in protein expression as a result of T2D, but has failed to show any convincing markers of future disease.

1.1.5a: Metabolomics: The third available “–omics” approach lies at the cross section of genetics and the environment: “metabolomics” can quantitatively identify changes in known small molecule metabolites of biological processes in a given population. While environmental factors (i.e., food intake, pharmaceutical interventions) provide substrates for metabolic processes, our genetics dictates what enzymes and proteins are available to metabolize these substrates, creating metabolic fingerprints associated with disease. Many groups aim to apply metabolomics to discover unique metabolic fingerprints associated with chronic conditions including diabetes and obesity, and therefore gain insights into these disease states, with dozens of metabolomics studies in T2D published in recent years. In 2016, Guasch-Ferré et al performed a systemic review of 27 cross-sectional and 19 prospective peer-reviewed publications which used metabolomics in the context of T2D and prediabetes. Without surprise—as diabetes is a disease of hyperglycemia— carbohydrates (glucose and fructose) are consistently elevated in T2D populations (Guasch-Ferré et al., 2016). Metabolomic studies have also identified many amino acids associated with T2D incidence. In the Framingham Offspring Study—one of the largest prospective epidemiologic studies of young adults—Branched Chain Amino Acids (BCAAs) were first identified to be associated with future T2D incidence up to 12 years prior to diagnosis. Other groups have since confirmed relationships between BCAA and insulin resistance (Newgard et al., 2009). In their meta analysis, Guasch-Ferré et al found higher T2D risk with the BCAAs isoleucine (36% greater risk), leucine (36% greater risk) and valine (35% greater risk).

Recently, the Wheeler lab has been interested in using these discovery-based screening approaches to identify factors implicated in β cell dysfunction in both GDM and T2D. In 2014, Prentice et al used metabolomics to discover metabolites significantly elevated in a population of GDM women versus NGT pregnant women, then investigated the effect of identified metabolites on β cell function and insulin secretion. The lab continues to use this novel approach to successfully identify factors elevated in a GDM and T2D population, which have negative effects on insulin secretion, and therefore become candidate factors to explore and ultimately inhibit in the diabetic human.

In the beginning of this chapter, we have explored 3 types of diabetes, their complications, and current treatment regimens. Additionally, we took a closer look at the β cell and what factors cause its progressive decline in the setting of T2D. Next, we will introduce one particular factor known to cause β cell dysfunction in diabetes: the furan fatty acid metabolite 3-carboxy-4- methyl-5-propyl-2-furanpropanoic acid (CMPF).

1.2. 3-CARBOXY-4-METHYL-5-PROPYL-2-FURANPROPANOIC ACID

In Section 1.1 we introduce diabetes mellitus as well as factors which ultimately cause β cell failure during disease progression. Here, we introduce a novel factor elevated in diabetes, along with evidence of its direct deleterious action on the pancreatic β cell. First, we introduce the discovery of this novel metabolite’s association with diabetes using the metabolomics platform.

1.2.1 Discovery of CMPF in Diabetes

1.2.1a CMPF is elevated in populations with GDM and T2D: In 2014, Prentice et al aimed to use global metabolomics as a tool to discover novel factors involved in diabetes risk and pathogenesis, examining relative changes in 342 metabolites in plasma samples from two cohorts of GDM women versus NGT control pregnant women matched for age, race, family history of diabetes, and prepregnancy BMI. The metabolite with the largest fold-change in GDM was 3-carboxy-4-methyl-5-propyl-2-furanpropanoic acid (CMPF): in this population CMPF was elevated 7-fold in GDM women compared to NGT controls (confirmed by ELISA; p<0.001) (Prentice et al., 2014). Metabolomic profiling of a cohort of T2D patients versus NGT controls confirmed that metabolite fingerprints are similar in GDM and T2D patients, and importantly, CMPF was also significantly elevated in this populations of patients with T2D (confirmed by ELISA; p<0.001). In another recent study, however, Lankinen et al investigated increases in CMPF from dietary fish intake and associations with glucose metabolism (See Section 1.2.1b: What is CMPF for “dietary” source of CMPF). This group found CMPF did not associate with whole body impaired- glucose metabolism, but did however correlate with decreased 2h insulin during Oral Glucose Tolerance Test (OGTT). In this population, however, CMPF concentrations never reached those reported in other uremic or diabetic populations (Prentice et al., 2014; Liu et al., 2016; Meert et al., 2007; See Section 1.2.1b: What is CMPF for CMPF as a Uremic Toxin).

1.2.1b What is CMPF? CMPF is a product of furan fatty acid metabolism (Figure 4). Furans are compounds containing a heterocyclic, aromatic, 5-membered furan rings with 4

carbons and 1 oxygen. Furan fatty acids are furan derivatives with substitutions on carbons 1-4 of the furan ring: one α carbon (closest to oxygen) is substituted with a propyl or pentyl side chain, while the other α carbon is replaced by a long-chain, saturated fatty acid ending in a carboxylic acid moiety (Spiteller et al., 2005). As CMPF has an α propyl group, it has also been referred to as “5-propyl FFA” in the literature. Furan fatty acids are produced from poly unsaturated fatty acids, in a synthesis requiring multistep reactions (Batna et al., 1993). The precise precursor of CMPF remains unknown, but it is hypothesized CMPF arises from a dietary source. The richest source of dietary furan acids is fish (Vetter and Wendlinger, 2013), and Lankinen et al recently showed CMPF concentration was significantly increased after consumption of fatty fish three times per week for 12 weeks (Lankinen et al., 2015).

Furan acids—including CMPF—are excreted in the urine (Deguchi et al., 2005). Importantly, the only other disease state where CMPF is known to be elevated is in uremia: an elevation of plasma urea and other nitrogenous waste compounds due to decreased expression of kidney transporters responsible for their renal clearance (Sassa et al., 2000). Meert et al report that physiological concentrations of CMPF are approximately 40 μM and can pathologically reach 400 μM with decreased function of the transporters required for CMPF excretion in uremia (Meert et al., 2007). For more on the excretion of CMPF see section 1.3.4: Renal Elimination of Organic Anions. In human serum, CMPF (like other uremic toxins) is highly albumin-bound (99-100%) and can out-compete binding of other endogenous substrates to albumin (Niwa, 2013). This albumin binding also poses difficulties and identification in human serum by traditional methods, which may account for discrepancies in reported uremic toxin concentrations (Meert et al., 2007).

Figure 4: CMPF structure.

1.2.1c CMPF is Elevated Prior to Overt Diabetes Onset: Recently, Liu et al used a prospective cohort of patients in Shanghai, China to investigate whether CMPF is elevated as a consequence of T2D, or if it is elevated prior to disease onset. Plasma samples were obtained from 196 patients who were NGT, Prediabetic (Impaired Glucose Tolerant; IGT), or with overt T2D matched for age, gender, BMI at follow-up. While CMPF was significantly elevated in T2D individuals (p<0.001)—consistent with previous observations by Prentice and colleagues—CMPF was also significantly elevated in those with IGT (p<0.01) (Liu et al., 2016). This data indicates that CMPF may not be elevated as a consequence of T2D, but instead elevations in CMPF are seen before overt T2D onset.

1.2.1d Rapid Elevation in Circulating CMPF may Accelerate T2D progression: A paradoxical concept in the field of diabetes is the vast differences in rates of progression of IGT to T2D in different patients. Some patients can maintain a state of prediabetes for years without transitioning to overt T2D. This progression occurs independent of variables such as BMI and insulin resistance but always correlates with a sudden, drastic impairment in glucose-stimulated insulin secretion (GSIS) with β cell decompensation (Ferrannini et al., 2004; Weir and Bonner Weir, 2004) (See Section 1.1.1b: Type 2 Diabetes). Using the same prospective cohort in Shanghai, Liu et al. measured circulating CMPF in patients at a baseline visit (2007-2008) and at follow-up (2011-2012). At both baseline and follow-up, T2D status was confirmed by OGTT. Table 3 shows that patients whose disease did not “progress” (i.e., those who remained NGT) did not have significant changes in circulating CMPF, while those whose disease state did progress (i.e., those who were NGT at baseline and T2D at follow-up) had significant increases in plasma CMPF.

Table 3: Changes in circulating CMPF from baseline to follow-up in prospective cohort of T2D “progressors” and “non-progressors”. Baseline Follow-up Disease Change in (2007-2008) (2011-2012) Progression? CMPF NGT NGT Non-progressors No Change Prediabetes Prediabetes Non-progressors No Change NGT Prediabetes Progressors ↑ Prediabetes T2D Progressors ↑ NGT T2D Progressors ↑ NGT: Normal Glucose Tolerant; T2D: Type 2 Diabetes; ↑: Increase in circulating CMPF (adapted from Liu et al., Cell Reports 2016).

With this evidence from a prospective human cohort, Liu and colleagues conclude that a rapid elevation in CMPF may act as a tipping point in T2D development.

1.2.1e CMPF Predicts AUCglucose in GDM women: A recent study in Toronto by Retnakaran et al recruited NGT (n=290) and GDM (n=105) women (GDM status confirmed by OGTT; See Section 1.1.1c for Diagnostic Criteria) to investigate the relationship between circulating factors and glucose homeostasis and β cell function during pregnancy (Retnakaran et al., 2016). Although CMPF was not associated with GDM/NGT status in this population of pregnant women, the group explored the possibility that CMPF had effects on glucose homeostasis in GDM women. Interestingly, log CMPF concentration was significantly associated with hyperglycemia during OGTT in women

with GDM, emerging as an independent predictor of AUCglucose in GDM women (t=4.75, p<0.0001). Given than CMPF correlated with glucose tolerance in GDM women, Retnakaran et al evaluated associations between CMPF and physiologic determinants of glucose homeostasis including insulin sensitivity and β cell function. While CMPF did not associate with whole body insulin sensitivity, CMPF also emerged as an independent predictor of poorer β cell function, evaluated by ISSI-2 (t=-2.28, P=0.02). The ISSI-2 (Insulin Secretion-Sensitivity Index-2) is a measure of β cell function which is the product

of (i) insulin secretion during GTT (ratio of AUCinsulin to AUCglucose) and (ii) insulin sensitivity (Retnakaran et al., 2008; Retnakaran et al., 2009). Therefore, CMPF emerges as a circulating factor which determines hyperglycemia and β cell dysfunction in GDM (Retnakaran et al., 2016).

1.2.2 CMPF Directly Impairs β Cell Function

The human data from Prentice, Liu, Retnakaran, and colleagues provide compelling evidence that CMPF may be a novel metabolite involved in T2D progression, but further investigation with animal models were warranted to confirm a causal relationship between the metabolite and T2D.

1.2.2a CMPF Impairs Glucose Tolerance in vivo: To test the direct effect of CMPF on glucose tolerance, Prentice et al use a series of in vivo experiments where CMPF was elevated to diabetic concentrations in the mouse. Following 6 mg/kg intraperitoneal (i.p.)

CMPF injection, CMPF reached concentrations of ~200 μM which is consistent with the human diabetic concentrations they report. Mice which received CMPF for 7 days had elevated fasting blood glucose, hyperinsulinemia, and were significantly glucose intolerant with impaired in vivo insulin secretion compared to vehicle controls (Prentice et al., 2014). In vivo, CMPF also decreased whole body glucose utilization, measured using the hyperinsulinemic euglycemic clamp: CMPF-treated mice required a significantly lower glucose infusion rate compared to vehicle controls (Prentice et al., 2014).

1.2.2b CMPF Impairs Insulin Secretion: Consistent with impaired in vivo insulin secretion results, islets isolated from CMPF-treated mice had signiﬁcantly impaired GSIS: insulin secretion was elevated at sub-stimulatory glucose concentrations (2.8 mM), and signiﬁcantly reduced at high glucose (16.7 mM) concentrations. While there was no difference in islet size in CMPF-treated mice, histological insulin staining showed a decrease in total pancreatic insulin content in mice treated with CMPF. This in vivo data confirms a link between CMPF—a metabolite highly elevated in both GDM and T2D— and glucose intolerance, and indicates that CMPF likely has a direct effect on the pancreatic β cell.

1.2.2c CMPF Directly Impairs Insulin Biosynthesis and Secretion in vitro: To confirm a direct effect of CMPF on the islet, Prentice et al treated isolated mouse islets with varying concentrations of CMPF for 24 hours. After 24 hours treatment, diabetic CMPF concentrations significantly impaired GSIS in a dose-dependent manner compared to vehicle controls: treatment with 150 μM, 200 μM, and 250 μM CMPF all caused decreased GSIS in mouse islets (Prentice et al., 2014). Importantly, this effect was not specific to mouse islets, and was confirmed in both human islets and β cell lines (MIN6). CMPF treatment did not cause cell death or β cell dedifferentiation. Consistent with in vivo results, in vitro CMPF treatment significantly decreased total insulin content in isolated islets, but increased the ratio of proinsulin to insulin secreted, indicating CMPF may impair insulin processing. While CMPF does not increase markers of Endoplasmic Reticulum stress (which could account for these alterations in insulin processing), it does however increase Reactive Oxygen Species (ROS) accumulation in isolated islets treated with CMPF for 4 or 24 hours, and subsequent increase in antioxidant gene expression (Ucp2,

uncoupling protein 2; Cat, catalase) suggesting CMPF-treated islets are compensating for the oxidative stress.

Given that CMPF is present at high concentrations in GDM and T2D and has detrimental effects on both human and mouse β cell function by impairing insulin biosynthesis and secretion at these concentrations, this circulating factor may play a causal role in GDM and T2D pathogenesis by impairing β cell function.

1.2.3 Rapid Elevation in CMPF Accelerates Diabetes Progression in vivo

The transition from prediabetes to overt T2D is a gradual process which occurs at different rates in different individuals as β cell function declines gradually in response to severe insulin resistance. In Section 1.1.4 we highlight a number of factors which may be implicated in β cell decline, including glucotoxicity, glucolipotoxicity, and oxidative stress. In a recent article published in Cell Reports, Liu et al used prediabetic animal models to test whether CMPF is a factor which accelerates diabetes progression, “tipping” prediabetes to overt T2D in the rodent (Liu et al., 2016).

1.2.3a CMPF Accelerates T2D in Diet Induced Obesity Models: To test if CMPF accelerates T2D progression in a Diet-Induced Obesity (DIO) model of prediabetes, CD1 mice were rendered insulin resistant with a 60% kcal from fat diet (DIO) for 6 weeks, and received 6 mg/kg CMPF or vehicle daily for 2 weeks (Liu et al., 2016). DIO-CMPF mice were significantly more glucose intolerant than DIO-Control mice, with loss of in vivo insulin secretion during GTT, and fasting hyperglycemia. Additionally, islets isolated from DIO-CMPF mice (DIO-CMPF islets) had impaired insulin secretion in response to high glucose ex vivo compared to islets isolated from Control mice (DIO-Control islets). To assess the effect of CMPF on glucose metabolism—recall, glucose metabolism is critical in the glucose stimulus-secretion coupling pathway (See Section 1.1.3b)—Liu et al measured changes in mitochondrial membrane potential (MMP) in response to acute high (20 mM) glucose. While DIO-Control islets show a robust change in MMP (ΔΨm) in response to glucose, islets isolated form DIO-CMPF islets had a blunted response to glucose. Interestingly, while a blunted ΔΨm in response to glucose indicates that CMPF causes a decrease in glucose utilization, DIO-CMPF islets displayed an increase in ΔΨm in

response to an acute 400 μM palmitate load, indicating CMPF causes a change in preferential substrate utilization from glucose to fatty acids, owning to the competitive nature of the substrates (Randle et al., 1994). Liu et al confirmed this preferential substrate utilization in DIO-CMPF islets using Seahorse XF Metabolic Flux to measure Mitochondrial Metabolism: DIO-CMPF islets showed significantly reduced glucose oxidation and enhanced fatty acid oxidation indicated by changes in Oxygen Consumption Rate in response to glucose and palmitate, respectively (Liu et al., 2016).

1.2.3b CMPF Accelerates T2D in Genetic Prediabetes Models: The genetic Ob/Ob mouse model—mice which lack the leptin gene, developing obesity (Lindstrom, 2010)— was used as another model of prediabetes: Ob/Ob mice received CMPF or vehicle for 2 weeks (Liu et al., 2016). Similar to DIO-CMPF mice, Ob/Ob-CMPF mice were glucose intolerant beyond Ob/Ob-Control mice, with loss of in vivo insulin secretion during GTT. Islets isolated from Ob/Ob-CMPF mice (Ob/Ob-CMPF islets) also had impaired insulin secretion at high glucose, indicating a direct islet defect. Together, the DIO and Ob/Ob models of prediabetes indicate that rapid elevations of CMPF impairs β cell function in vivo to potentiate overt T2D development in the rodent (Liu et al., 2016).

1.2.4c CMPF Reduces Glycolysis and Increases Oxidative Stress: Liu et al further explored the mechanism by which CMPF reduces glucose utilization. Importantly, DIO- CMPF islets have decreased glycolytic activity, evidenced by decreased Extracellular Acidification Rate in response to acute glucose (using Seahorse XF). Changes in glycolysis, however, were not due to decreased glucose uptake: there were no changes in gene or protein expression of Glucose Transporter 2 (Glut2) in the islet, and CMPF treatment was actually associated with increased glucose uptake. Additionally, there were no changes in Glucokinase (Gck) expression—the rate limiting enzyme in glycolysis which converts glucose to glucose-6-phosphate—in islets. There were, however, decreases in the activity of Pyruvate Dehydrogenase (PDH), indicating CMPF enhances glucose uptake but reduces glycolysis and impairs glucose utilization in the islet. Interestingly, CMPF treatment was associated with increased Advanced Glycation End-product (AGE) formation in the islet. AGE occurs under pathological conditions including oxidative stress and hyperglycemia—both present in T2D—when protein and lipids become glycated as a

result of exposure to glucose (Brownlee, 2007). Importantly, AGE are involved in the pathogenesis of vascular complications of T2D (Yan et al., 2007). Consistent with increased AGE formation, DIO-CMPF and Ob/Ob-CMPF islets had significantly increased ROS presence compared to either Control. Together, the increase in AGE and ROS formation, as well as switch from preferential glucose to fatty acid metabolism acts in the islet to induce β cell dysfunction (Liu et al., 2016).

1.2.4 CMPF enters the β cell through OATs

CMPF is a dicarboxylic organic anion which cannot freely diffuse across cell membranes, and therefore relies on transporters for its movement between plasma and tissues. Deguchi et al originally identified 3 Organic Anion Transporters (OATs) for which CMPF is a substrate: OAT1 and OAT3 are influx transporters in the renal proximal tubule responsible for CMPF uptake, while OAT4 is an efflux transporter responsible for transporting CMPF from the proximal tubule into the kidney lumen (Deguchi et al., 2005). Importantly, in the context of CMPF and diabetes, use of the competitive OAT inhibitor, probenecid—which blocks both OAT1 and OAT3-mediated transport—can protect against the effects of CMPF on GSIS, indicating entrance of CMPF through an OAT in the β cell is necessary for its detrimental action on insulin secretion (Prentice et al., 2014).

1.2.4a OAT3 is Present in Insulin-Positive Cells: To determine which of these OATs were responsible for the uptake of CMPF into the β cell, Prentice et al first determined which OATs were present in the human islet. While these transporters are expressed in relatively low abundance in the majority of tissues (other than kidney), they showed by Microarray and qPCR that 3 OATs are present in the human islet: SLC22A6 (OAT1),

SLC22A8 (OAT3), and SLC22A11 (OAT4) as well as the NaDC3 co-transporter were all

expressed at levels comparable to KCNJ11 (the gene encoding a major subunit of KATP

channels). This KATP transporter subunit is inarguably important for β cell function, and the presence of OATs at comparable levels in the islet assures perhaps an important role for OAT transport in the islet as well. To determine localization of specific OATs in the islet, Prentice et al used immunofluorescence and showed that OAT3 is present in insulin- positive β cells (Prentice et al., 2014).

1.2.4b OAT3 Inhibition Protects against CMPF in vivo: The reliance on OAT3 for CMPF to enter the β cell was confirmed by specifically blocking Oat3-mediated transport in the mouse islet. Both (i) pharmacological inhibition of Oat3 (using co-treatment with benzylpenicillin which selectively inhibits Oat3 at concentrations of 300 μM), and (ii) genetic elimination of Oat3 (using islets from Oat3 knockout mice) protected against the effects of CMPF in vitro, confirming CMPF enters the β cell through OAT3, and that this entry is necessary for its action on the islet (Prentice et al., 2014).

Given that the acute, in vitro effects of CMPF can be inhibited by OAT blockade, this thesis aims to test whether the effects of CMPF treatment can be inhibited by in vivo OAT blockade. First, we introduce the OAT family in more depth.

1.3. ORGANIC ANION TRANSPORTERS

While some biomolecules are able to freely diffuse across membranes, others rely on transport through membrane proteins for distribution into tissues. Most plasma transporters are oligospecific—such as the Glucose Transporter 2 (GLUT2, SLC2A2) which mainly facilitates glucose transport across the membrane—but many are polyspecific and are capable of transporting a vast number of compounds of different molecular sizes and structures. Within the realm of polyspecific transporters, there is great variability in structure and function. Although we often refer to these as multispecific “drug transporters”, they often serve primary, physiological roles to transport endogenous substrates and metabolites such as sugars, amino acids, nucleotides, and vitamins (Nigam, 2015).

1.3.1. Classification of Drug Transporters

Disposition and elimination of endogenous and exogenous organic anions and cations relies on more than 400 different drug transporters (Roth et al., 2012). These multispecific transporters are categorised by a number of characteristics including (i) directionality, (ii) whether they are absorptive or secretory, (iii) whether they are active or passive, and (iv) whether they are uniporters, symporters, or antiporters. Based on these molecular and mechanistic characteristics, transporters are placed in a gene superfamily of transporters with similar structure and function.

1.3.1a Characteristics of Drug Transporters: The first method of classifying transporters is based on the direction which they transport molecules across a membrane. Transporter expression is highest in barrier tissues such as the liver, kidney, intestine, placenta, and brain. Cells along the borders of these tissues are generally polarized with apical and basolateral membranes, and a given transporter generally sits on one membrane in one orientation. This fixed localization and orientation allows for transporters to be either influx transporters which transport substrates into the cell, or efflux transporters, transporting substrates out of the cell.

Next, transporters may be classified as absorptive or secretory, an important classification in the pharmacokinetic and pharmacodynamic aspects of drug transporters. An absorptive

transporter moves a substrate into the systemic circulation, while secretory transporters eliminate substrates from the circulation into the bile, urine, or gut lumen.

Transporters may also be either passive or active: passive transporters, also known as “facilitated transporters” move substrates across a membrane along their electrochemical gradient, while active transporters move substrates against this gradient, relying on ATP hydrolysis for energy. Active transport may be primary, secondary, or tertiary. In both secondary and tertiary active transport, ATP hydrolysis by other transporters creates ion gradients which allow for exchange of a substrate against its concentration gradient.

Finally, while many passive and active transporters are “uniporters”—an integral membrane protein which moves a substrate in one direction across a phospholipid membrane—transporters often handle more than one substrate at a time, where movement of one substrate against its concentration gradient relies on transport of another with its concentration gradient. A “co-transporter” can either transport both substrates in the same direction (a “symporter”) or exchange them in opposite directions across the membrane (an “antiporter”).

1.3.1b Drug Transporter Gene Families: Based on these characteristics, most drug transporters fall into one of two gene superfamilies: ABC or SLC transporters (Figure 5). ABC (ATP-Binding Cassette) transporters are a superfamily of more than 100 primary active transporters which possess an ATP-binding domain and rely on ATP hydrolysis for transport of their substrates against their electrochemical gradient (Choi, 2005). The majority of transporters are members of the SLC (solute carrier) transporter superfamily. Unlike ABC transporters, SLC transporters do not possess ATP binding sites and may be either passive or active transporters. While ABC transporters are generally efflux transporters, SLC transporters typically mediate uptake of substrates into tissues (Roth et al., 2012). Here, we focus on the SLC superfamily of drug transporters: over 300 transporters categorized into 52 families (Hediger et al., 2004).

Figure 5: Classification of superfamilies of Multispecific Drug transporters which transport Organic Anions and Cations.

Within the SLC superfamily, there are two families of transporters: SLCO and SLC22A. Organic Anion Transporting Polypeptides (OATPs) are members of the SLCO (“Solute Carrier family of the OATPs”) family (Hagenbuch and Meier, 2004). Eleven human OATPs bidirectionally transport of a broad range of organic anion substrates, including bile acids, steroid conjugates, and xenobiotics (Svoboda et al., 2011). An important characteristic of OATP transporters is their Na+-independent mechanism of transport, unlike other transport mechanisms discussed below (See Section 3.1.3).

The SLC22A family is divided into subfamilies based on the nature of the substrates they transport, including: Organic Cation Transporters (OCTs), Organic Anion Transporters (OATs), and Organic Carnitine/Zwitterion Transporters (OCTNs) (Figure 5). As their names imply, OCTs transport organic cations while OATs transport organic anions. OCTNs are a recently discovered novel class of transporters which function as Na+/L- carnitine co-transporters, but also transport organic cations (Wright and Dantzler, 2004; Eraly et al., 2004a).

Transporters encoded by both the SLCO and SLC22A gene superfamilies are expressed in nearly every epithelium of the body, and therefore play a major role in the absorption, distribution, and elimination of endogenous and exogenous substrates. In all instances, it is therefore important to consider how an organic anion—whether it is endogenous or

exogenously delivered—can both enter tissues of interest and be eliminated from the central circulation. As CMPF is an organic anion, here we have a particular focus on OATs which are responsible for the handling of these substrates, explained in more detail below.

1.3.2 The Organic Anion Transporter Family

Seven members of the OAT family of transporters have been identified in humans (Table 4). Each transporter is multispecific with vast numbers of substrates. Specificity of an organic anion for a given OAT is based on physiochemical properties including charge, hydrophobicity, and hydrogen-bonding ability, rather than distinct molecular characteristics such as shape (Ullrich, 1997; Ullrich, 1999). Often, organic anions are substrates for more than one OAT. These transporters are generally expressed at very low abundances in cells, making it inherently difficult, if not impossible to over-express them.

1.3.2a OAT Nomenclature: These transporters are highly conserved throughout evolution, and orthologues of all OAT proteins have been identified in other species including rodents, other than OAT4 which is specific to humans (Cha et al., 2000). In general, OAT gene and protein nomenclature is simple: all human OATs (i.e., hOAT3) are numbered, while rodent orthologues receive the same number in lowercase (i.e., rOat3 for rat; mOat3 for mouse). Gene names do not share the same number, however, as OAT, OCT, and OCTN transporters are all members of the SlC22A family. For instance, SLC22A1-3 encode OCT1-3 while SLC22A6-8 encode OAT1-3, respectively. Rodent nomenclature follows with lowercase letters: mSlc22a6-8 encode mOat1-3.

Table 4 lists all 7 OATs known in humans, the identified tissue distribution, as well as the membrane localization (if known). It is important to note that this list is not exhaustive: other putative transporters exist which show remarkable similarity to known ones, but have yet to be characterized (Jacobsson et al., 2007). If orthologues have been discovered in other species, they are also listed in Table 4.

Table 4: List of identified Organic Anion Transporters. Table includes gene symbol, human tissue distribution, membrane localization, and orthologues identified in other species.

Human Tissue OAT Gene Distribution Species Reference Name Symbol (Membrane Identified Localization) OAT1 SLC22A6 Kidney (BL), Brain Human, mouse, Lopez-Nieto et al., J Biol (ND), Skeletal Muscle rat, pig, Chem 1997 (ND), Placenta (ND) flounder OAT2 SLC22A7 Kidney (BM), Liver Human, mouse, Simonson et al., J Cell Sci (SM) rat 1994 OAT3 SLC22A8 Kidney (BM), Brain Human, mouse Brady et al., Genomics (LM), Eyes (ND), rat, pig, rabbit 1999 Adrenal Glands (ND) OAT4 SLC22A11 Kidney (AM), Placenta Human Cha et al., J Biol Chem (BM), Adrenal Glands 2000 (ND) OAT5 SLC22A19 Kidney (ND), Liver *Human, Youngblood and Sweet, Am (ND) mouse, rat J Physiol Renal Physiol 2004 OAT6 SLC22A20 Mouse Monte et al., Biochem Biophys Res Commun 2004 URAT1 SLC22A12 Kidney (AM) Human, mouse Mori et al., FEBS Lett 1997 BM: Basolateral Membrane; AP: Apical Membrane; SM: Sinusoidal Membrane of Hepatocytes; LM: Luminal Membrane of Choroid Plexus; ND: Not Determined. *hOAT5 is likely not the orthologue of mOat5 or rOat5 (Youngblood and Sweet, 2004).

1.3.3 Organic Anion Transporter 3

Here, we focus on one of the most widely characterized OATs, Organic Anion Transporter 3 (OAT3). Murine Oat3 (mOat3) was originally identified by Brady et al when they discovered a novel transporter reduced in the oc/oc mouse, a murine model of osteosclerosis. While this novel transporter was abundant in normal kidney, both RNA and protein expression were markedly reduced in kidneys from oc/oc mice. This discovery gave Oat3 its first name: Roct, or “Reduced in Osteosclerosis Transporter” (Brady et al., 1999). Since then, OAT3 has been cloned in man, monkey, rat, pig, and mouse (Race et al., 1999; Tahara et al., 2005; Hagos et al., 2005; Zhang et al., 2004; Brady et al., 1999). OAT3 is a major player in the renal OAT system, believed to account for one-third to one-half the transport of most commonly prescribed pharmaceuticals (Eraly et al., 2004b). Like all OATs, OAT3 is a multispecific transporter which couples organic anion uptake into cells with dicarboxylate efflux (Sweet et al., 1997).

1.3.3a OAT3 Structure and Function: As membrane proteins, solute transporters are amphipathic: hydrophobic transmembrane domains (TMD) lie within membrane 28

phospholipids, while polar surfaces contact intra- and extracellular spaces. Like all members of the SLC22A transporter family, OAT3 has 12 α-helical TMD with intracellular amino- and carboxy-termini (Figure 6). Importantly, TMD 1-6 and 7-12 show weak sequence homology, suggesting that SLC22A transporters may have originated from the duplication of an ancestor with six TMD (Pao et al., 1998; Maiden et al., 1987).

Figure 6: Graphical representation of OAT3 Structure.

OATs range in size from 543 to 563 amino acids (OAT1 and OAT3, respectively). The exact three-dimensional crystal structure of OATs have not been elucidated, meaning their transport mechanism remains unclear. Although the exact structure of OAT3 remains unknown, information about the OAT3 structure-function relationship can be elucidated by studying (i) highly conserved regions of its primary structure, as well as (ii) the structure of other transporters which share common sequence motifs with OAT3.

Targeted mutagenesis of highly conserved amino acid residues on OAT3 have revealed specific residues which interact with moieties on its organic anion substrates. This technique has been used for many OAT family members, and has identified important cationic residues—which interact with anionic moieties of organic anion substrates—and aromatic residues—which interact with hydrophobic residues of substrates (Wolff et al., 2001). For instance, studies in Xenopus oocytes have identified aromatic residues in TMD7, 8 and basic residues in TMD1, 8, 11 of rOat3 (rat Oat3) which are required for transport (Feng et al., 2002).

Although the three-dimensional crystal structure of OAT3 is unknown, there are closely related transporters including the glycerol-3-phosphate (G3P) antiporter, the lactose permease symporter (LacY), and oxalate antiporter (Ox1T) whose crystal structures have been elucidated. Using homology modelling based on these other transporters, the three- dimensional structure of the closely-related hOAT1 has been predicted (Perry et al., 2006).

While the exact mechanism of renal substrate transport by OATs remains unknown, evidence indicates that transport of two of the most widely studied OATs (OAT1 and OAT3) is based on a tertiary active transport mechanism which relies on ion exchange across tubular membranes of the kidney (Figure 7). First, the Na+/K+ ATPase hydrolyses ATP to ADP and exchanges intracellular Na+ for K+. This creates an inwardly-directed Na+ gradient, which drives transport of a sodium-dicarboxylate co-transporter, NaDC3 + (SLC33A3). NaDC3 is driven by the movement of Na along its electrochemical gradient, while coupling symport of dicarboxylic organic anions against their concentration gradient. This results in an accumulation of intracellular dicarboxylates, which are then exchanged for OAT substrates (organic anions) through the transporter.

Figure 7: Graphical representation of tertiary active OAT transport. Na+/K+ ATPase: Sodium Potassium ATPase transporter; NaDC3: Sodium Dicarboxylate Co-transporter 3; OAT: Organic Anion Transporter; DC-: Dicarboxylic Organic Anion; OA-: Organic Anion.

Substrate translocation through OAT3 itself can also be predicted using homology modelling of transporters like G3P, LacY, and Ox1T. Like these other transporters, it is predicted that OATs use a single-binding-site alternating access mechanism where the

transporter switches between alternating confirmations: inward facing (Ci) and outward facing (Co) (Lemieux et al., 2004). When the transporter is unoccupied by substrates, the free energy required to change confirmations from Ci to Co is high. When a substrate binds to the single inward-facing binding site, the energy required to change confirmation is reduced, moving the two 6-TMD regions relative to each other, facilitating the transition between Ci and Co, and opening the pore in the opposite direction (Figure 8). Once the pore has opened in the opposite direction, energy state favours release of the substrate, leaving the pore open in the Co orientation. The binding site is comprised of two cationic residues located at the amino- and carboxy-termini, which form hydrogen bonds with the negatively charged, anionic substrate. In rOat3, binding sites are located at residues Lys370 (TMD8) and Arg454 (TMD11) (Feng et al., 2002), and when an organic anion binds, a bridge is formed between these residues (Lys370 --- Organic Anion --- Arg454), pulling the channel together (Figure 8).

Figure 8: Proposed “rocker switch” mechanism for translocation of substrates across the membrane through OAT3.

1.3.3b Renal Elimination of Organic Anions by OAT3: The renal elimination of many endogenous and exogenous organic anions relies on the concerted effort of multiple OAT transporters and other transporters of organic anions in the proximal tubule cells of the kidney. Proximal tubule cells are a polarized cell located at the proximal end of the kidney, with a basolateral membrane contacting peritubular capillaries and apical membrane at the tubular lumen (Figure 9). Based on the physiochemical properties of a given organic anion, it is a substrate for specific OATs. As substrates pass through peritubular capillaries,

uptake occurs into proximal tubule cells through influx OATs at the basolateral membrane such as OAT1 and OAT3. As these organic anions accumulate in the renal proximal tubule, they are secreted by a different set of OATs on the apical membrane and into the renal lumen (urine) for excretion. It is important to note that OATs are not solely responsible for influx and efflux of organic anions across renal proximal tubular cells. For instance, members of the ABC transporter family, MRP2 (ABCC2) and MRP4 (ABCC4) are other transporters of organic anions located on the apical membrane involved in efflux of the organic anions along with members of the OAT family, OAT4 and URAT1 (Urate transporter urate anion exchanger 1) (Miyazaki et al., 2005).

Figure 9: Renal elimination of organic anions through OATs at the level of the proximal tubule cells.

Deguchi et al used overexpression models to quantify uptake of isotopically labeled CMPF to determine which OATs were responsible for CMPF uptake in the kidney. While both OAT1 and OAT3 are responsible for the transport of CMPF from the plasma to the proximal tubule cells, use of inhibitors at concentrations which selectively inhibit OAT3 indicated that OAT3 is the primary renal transporter, accounting for 65% of CMPF transport (Deguchi et al., 2005). In the human kidney, hOAT4 is responsible for efflux of CMPF across the apical membrane and into the urine (Figure 9).

1.3.3c OAT3 Substrates: OAT3 is a major player in the distribution and renal elimination of organic anions. The prototypical OAT3 substrate is Estrone-3-Sulfate (ES), an organic anion exhibiting a high affinity (average Km = 8.8 μM for hOAT3) and is avidly transported (Burckhardt, 2012).

Generally, we can look to serum metabolomics data from whole body knockout mice to discover endogenous substrates for a given transporter. For instance, mice null for a given transporter have significant increases in plasma metabolites which are substrates for that transporter due to decreases in renal elimination. Wu et al. used untargeted metabolomics to find metabolites which were significantly altered in Oat3-/- mice compared to wild type (WT) controls. Metabolites with the largest fold change (Oat3-/- over WT) included Pongamoside A (fold change = 8.3; a flavoinoid metabolite of dietary origin) and 9-amino- nonanoic acid (fold change = 7.2; a modified nonanoic acid derived from soybeans). Many of the metabolites found were actually not purely endogenous, however, this work revealed an overall important role of mOat3 in handling a vast number of substrates including metabolites of bioenergetic pathways (i.e., tricarboxylic acid cycle intermediates), vitamins (i.e., folate), steroids, prostaglandins, products of the gut microbiome, uremic toxins, cyclic nucleotides, amino acids, and glycans (Wu et al., 2013).

Although few endogenous compounds are known substrates for OAT3, OAT3 is still a major player in the elimination of exogenous compounds. In fact, one-third to one-half of the most commonly prescribed drugs are substrates for the OAT3 transporter, including: penicillin, nonsteroidal anti-inflammatories, cephalosporins, angiotensin-converting enzyme inhibitors, diuretics, smallpox antivirals, HIV antivirals, methotrexate, and statins (Eraly et al., 2004b). Table 5 lists some of the known endogenous and exogenous substrates for the OAT3 transporter. In most cases, the “interaction” of OAT3 with a potential substrate is assessed by measuring the inhibition of the uptake of its prototypical radiolabeled substrate [3H]-ES. If [3H]-ES uptake is inhibited by an organic anion, it indicates competition for the transporter, and therefore that the organic anion is likely an OAT3 substrate (Burckhardt, 2012). Radiolabelling of test compounds themselves can confirm transport, however, often labelled compounds are not available.

Table 5: List of OAT3 Substrates

Substrate Class Substrate Reference Type Drug Antibiotic Penicillin Vanwert et al., Am J Physiol Renal Physiol 2007 Antibiotic Ciprofloxacin Vanwert et al., Am J Physiol Renal Physiol 2007 Antibiotic Gatifloxacin Vanwert et al., Mol Pharmacol 2008 β-lactam antibiotic Penicillin G Nagata et al., Mol Pharmacol 2002 β-lactam antibiotic Cephalosporin Yee et al., J Pharm Sci 2013 Vitamin Folate Diagnostic agent Para-aminohippuric acid (PAH) Antimetabolite (Anti-cancer) Methotrexate Kobayashi et al., Drug Metab Dipos 2004 Anti-cancer 6-thioguanine Kobayashi et al., Drug Metab Dipos 2004 Anti-cancer 6-mercaptopurine Kobayashi et al., Drug Metab Dipos 2004 Anti-cancer 5-fluorouracil Mori et al., J Neurochem 2004 Anti-cancer Topotecan Matsumoto et al., J Pharmacol Exp Ther 2007 Antiviral Ro 64-0802 (active metabolite of Ose et al., Drug Metab Dispos 2009 Oseltamivir) Antiviral Acyclovir Nagle et al., J Biol Chem 2011 Antiretroviral Lamivudine Nagle et al., J Biol Chem 2011 Antiretroviral Tenofovir Nagle et al., J Biol Chem 2011 Antiretroviral Zidovudine (aka Azidothymidine, Nagle et al., J Biol Chem 2011 AZT) Statin Pravastatin Statin Rosuvastatin Histamine (H2) Receptor Antagonist Cimetidine Tahara et al., J Pharmacol Exp Ther (Antihistamine) 2005

Histamine (H2) Receptor Antagonist Famotidine Tahara et al., J Pharmacol Exp Ther (Antihistamine) 2005 Histamine (H2) Receptor Antagonist Ranitidine Tahara et al., J Pharmacol Exp Ther (Antihistamine) 2005 Loop diuretic Furosemide Vallon et al., Am J Physiol Renal Physiol 2008 Loop diuretic Ethacrynate Hasannejad et al., J Pharmacol Exp Ther 2003 Loop diuretic Bumetanide Hasannejad et al., J Pharmacol Exp Ther 2003 Thiazide diuretic Bendroflumethiazide Vallon et al., Am J Physiol Renal Physiol 2008 Nonsteroidal Anti-inflammatory Salicylate Takeda et al., J Pharmacol Exp Ther 2002 Nonsteroidal Anti-inflammatory Ibuprofen Takeda et al., J Pharmacol Exp Ther 2002 Nonsteroidal Anti-inflammatory Ketoprofen Takeda et al., J Pharmacol Exp Ther 2002 Nonsteroidal Anti-inflammatory Phenylbutazone Takeda et al., J Pharmacol Exp Ther 2002 Nonsteroidal Anti-inflammatory Piroxicam Takeda et al., J Pharmacol Exp Ther 2002 Nonsteroidal Anti-inflammatory Indomethacin Takeda et al., J Pharmacol Exp Ther 2002 Angiotensin Converting Enzyme Captopril Yuan et al., J Pharmacol Exp Ther 2009 Inhibitor Angiotensin Converting Enzyme Quinapril Yuan et al., J Pharmacol Exp Ther 2009 Inhibitor DPP-4 Inhibitor Sitagliptin Chu et al., J Pharmacol Exp Ther 2007 Angiotensin II Receptor Blocker Candesartan Yamada et al., Drug Metab Dispos 2007 Angiotensin II Receptor Blocker Losartan Yamada et al., Drug Metab Dispos 2007 Angiotensin II Receptor Blocker Olmesartan Yamada et al., Drug Metab Dispos 2007 Angiotensin II Receptor Blocker Pratosartan Yamada et al., Drug Metab Dispos 2007 Angiotensin II Receptor Blocker Telmisartan Sato et al., Pharm Res 2008 Angiotensin II Receptor Blocker Valsartan Sato et al., Pharm Res 2008

Prolyl hydroxylase inhibitor 2-(1-chloro-4-hydroxyisoquinoline-3- Schulz et al., Nephron 2015 carboxamido) Acetic Acid (ICA) Toxin Mycotoxin Orchratoxin A Carcinogenic, mutagenic, nephrotoxin Aristolochic acid Xue et al., Mol Pharm 2011 Environmental Toxin Mercury DiGiusto et al., Arch Toxicol 2009 Uremic Toxin Indoxyl Sulfate Uremic Toxin Kynurenine Endogenous Product of furan fatty acid metabolism 3-carboxy-4-methyl-5-propyl-2- Deguchi et al., 2005; Prentice et al., Cell furanpropanoic acid (CMPF) Metab 2014 Flavoinoid metabolite (dietary origin) Pongamoside A Wu et al., Drug Metab Dispos 2013 Modified nonanoic acid derived from 9-amino-nonanoic acid Wu et al., Drug Metab Dispos 2013 soybeans Breakdown product of creatinine Creatinine Vallon et al., Am J Physiol Renal Physiol phosphate (muscle) 2012 Steroid Hormone Cortisol DHEA metabolite Dehydroepiandrosterone sulfate (DHEA-S) Sulfated estrone ester estrone-3-sulfate Byproduct of amino acid metabolism Glutaric Acid (Glutarate) Purine Metabolite Urate Eraly et al., Physiol Genomics 2008 Cyclic nucleotide cAMP Cha et al., Mol Pharmacol 2001 Cyclic nucleotide cGMP Chen et al., Am J Physiol Renal Physiol 2008 Prostaglandin E2 Kiruma et al., J Pharmacol Ext Ther 2002 Prostaglandin F2a Kobayashi et al., Drug Metab Dispos 2004 Bile Acid taurocholate Sweet at al., J Biol Chem 2002

1.3.3d OAT3 Inhibitors: Probenecid is a nonspecific, competitive OAT inhibitor clinically approved for the treatment of gout (Kydd et al., 2014) (Figure 10). Importantly, as a nonspecific inhibitor probenecid inhibits OAT3 and other transporters, including OAT1. In gout, probenecid works by blocking the reabsorption of uric acids in the kidney. Pathologically, renal OATs increase tubular reabsorption of uric acids from the urine into the plasma. Gout occurs when uric acid accumulates in the plasma and form crystals in joints. By competitively inhibiting OATs in the proximal tubular cells, probenecid prevents this tubular reabsorption of uric acids, preventing crystal formation in joints. Historically, probenecid was also used as an important drug in wartimes to extend supplies of valuable penicillin (Burnell and Kirby, 1951). Penicillin is eliminated renally through OAT3, so inhibition of the transporter by probenecid could prolong the half-life of penicillin, decreasing the doses required by soldiers. Similarly, probenecid was later used to increase the effect of penicillin in the treatment of systemic infections including gonorrhea (Lesinski et al., 1973).

Figure 10: Molecular Structure of OAT Inhibitor, probenecid.

The prototypical OAT3-specific inhibitor is penicillin G (PCG), also known as benzylpenicillin. At concentrations of 300 μM, PCG selectively inhibits the OAT3 transporter, without altering transport of similarly-related OATs such as OAT1.

Novobiocin, also known as albamycin or cathomycin—an aminocoumarin antibiotic that produced by the actinomycete Streptomyces niveus—also inhibits the OAT3 transporter (Duan and You, 2009).

Importantly, as with many transporters and enzymes, OAT3 transport can also be decreased when one or more substrate is competes for the same transporter. For instance, both the antimetabolite anti-cancer drug methotrexate and many commonly prescribed

nonsteroidal anti-inflammatories are substrates for the OAT3 transporter (Takeda et al., 2002). This competition for OAT3 can decrease the renal elimination of methotrexate, resulting in severe, life-threatening toxicities including bone marrow suppression (Thys et al., Lancet 1986).

1.3.3e Factors Influencing OAT3 Expression: Many things alter expression of OATs, including OAT3. In Human Embryonic Kidney (HEK) cells, hepatocyte nuclear factors (HNF)-1α transfection and HNF-1β transfection induces OAT3 expression (Kickuchi et al., 2006), and HNF-1α knockout decreases renal OAT3 expression (Maher et al., 2006). Treatment with OAT3 substrates can also decrease rOat3 expression: methotrexate, an anti-cancer drug and OAT3 substrate, decreases Oat3 expression in rats (Shibayama et al., 2006).

OAT3 is a female-dominant transporter, expressed in greater abundance in females than males. This difference in expression is a result of transporter expression regulation by sex hormones expression profiles. High levels of androgens decrease Oat3 expression, while androgens increase expression of other transporters such as Oat1 and Oatp1 (Breljak et al., 2013; VanWert et al., 2007).

In Chapter 1, we began in Section 1.1 by introducing diabetes mellitus: a complex disease whose pathogenesis occurs at vastly different rates in different people due to a number of factors from genetic to environmental risk. We also introduced factors which can cause decompensation and failure of the pancreatic β cell, including CMPF. In Section 1.2 we showed CMPF enters the β through OAT3 to cause decreases in insulin biosynthesis and secretion which manifests as severe β cell dysfunction, and that blockade of OAT3 can protect against the effects of CMPF in vitro. Finally, in Section 1.3 we introduced this OAT family of transporters in greater depth.

In Chapter 2, we will introduce our hypothesis which builds on this introduction, and outline our scientific aims to block OAT transport in vivo to improve β cell function in diabetes.

Chapter 2: Research Aims and Hypothesis

2.1 RATIONALE

Given that CMPF is present at high concentrations in GDM and T2D and has detrimental effects on both human and mouse β cell function at these concentrations, this circulating factor may play a causal role in GDM and T2D pathogenesis by impairing β cell function. The preliminary evidence demonstrating the negative effects of CMPF on β cell function (Prentice et al., 2014; Liu et al., 2016) warrants further investigation and prompts us to define strategies to block this effect, preventing β cell dysfunction in diabetes.

CMPF is transported into the β cell through an Organic Anion Transporter. Blocking transport of CMPF into the β cell in vitro by genetic elimination of Oat3 (using islets isolated from Oat3 knockout mice) or pharmacological inhibition (co-treating islets with probenecid, an OAT competitive inhibitor) ameliorates its negative effects on insulin biosynthesis and secretion in vitro. This evidence suggests blocking CMPF entry to the β cell in vivo may ameliorate the diabetic phenotype in CMPF-treated mice, highlighting the therapeutic potential of Organic Anion Transporter blockade in diabetes.

2.2 OBJECTIVE AND HYPOTHESIS

We aim to understand the role of CMPF in β cell dysfunction, and to investigate in vivo OAT blockade as a therapeutic strategy for the prevention of GDM/T2D. We predict blocking CMPF transport into the β cell will protect mice from CMPF-induced impaired glucose tolerance and β cell dysfunction.

2.3 SCIENTIFIC AIMS

2.3.1 OAT Blockade to improve β cell function in vivo

To test our hypothesis, 2 complementary experimental models are being used to block CMPF transport into the β cell. In all models, mice receive daily CMPF injections to reach serum concentrations typical in the GDM/T2D patient, and are monitored for changes in glucose

tolerance and in vivo insulin secretion during an intraperitoneal glucose tolerance test (GTT). Ultimately, mice are sacrificed and their isolated pancreatic islets are characterized.

2.3.1a Aim 1a: in vivo Genetic Oat3 Elimination: In our first aim we block CMPF entrance to metabolic tissue in vivo by genetic elimination of the OAT3 transporter. Here, we generate whole body OAT3 knockout mice and administer CMPF in vivo.

2.3.1b Aim 1b: in vivo Pharmacological Oat3 Inhibition: In the second part of our first aim, we block OAT3 using probenecid (PBN), a nonspecific competitive inhibitor of all OAT transporters including OAT3. Here, we inhibit CMPF transport in vivo by administering PBN to wild-type (WT) mice prior to CMPF, daily, to investigate use of OAT pharmacological blockade as a novel strategy for diabetes prevention.

2.3.2 Aim 2: Develop Method to Screen for Novel OAT3 Inhibitors

In our second aim, we will use what is known about CMPF to develop a method to screen for novel OAT3 inhibitors. Namely, we aim to use inhibition of CMPF-induced ROS to quantify blockade of OAT3 transport.

Chapter 3: OAT Blockade to improve β cell Function in vivo

3.1 Introduction

The furan fatty acid metabolite, 3-carboxy-4-methyl-5-propyl-2-furanpropanoic acid (CMPF) has recently emerged as a negative regulator of β cell function. CMPF was first discovered as a novel biomarker elevated in Gestational Diabetes (GDM) and Type 2 Diabetes (T2D) in 2014 by Prentice et al (Prentice et al., 2014). Importantly, evidence suggests that CMPF is elevated prior to overt T2D onset, rather than as a consequence (Liu et al., 2016). In fact, in prediabetic populations, rapid elevations in CMPF accelerate T2D disease progression, suggesting that CMPF may act as a tipping point in T2D by accelerating β cell failure. In GDM populations,

CMPF emerges as a novel determinant of β cell function, predicting AUCglucose and measurements of β cell function in these women (Retnakaran et al., 2016) (For more on CMPF See Section 1.2.1 Discovery of CMPF in Diabetes).

Consistent with human data, CMPF causes direct β cell dysfunction in the rodent. Delivery of CMPF by intraperitoneal injection for 7 days—reaching diabetic concentrations—causes glucose intolerance, elevated fasting blood glucose, and impaired in vivo insulin secretion (Prentice et al., 2014). This diabetic phenotype with CMPF treatment is due to a direct β cell defect: in vitro treatment of CMPF in isolated islets impairs Glucose-Stimulated Insulin Secretion (GSIS), increases Reactive Oxygen Species (ROS) accumulation, and impairs insulin biosynthesis, confirming a direct, deleterious effect of CMPF on the β cell (Prentice et al., 2014) (For more on the action of CMPF in the islet, see Section 1.2.2: CMPF Directly Impairs β cell Function).

Importantly, these in vitro effects of CMPF can be blocked by inhibition of its transport into the islet. Deguchi et al originally identified 3 different human Organic Anion Transporters (OATs) for which CMPF is a substrate: OAT1, OAT3, and OAT4 (Deguchi et al., 2005). Evidence suggests that in the islet, CMPF enters the β cell through OAT3, as islets isolated from mice lacking the Oat3 transporter (Oat3KO) mice are protected against the effect of CMPF on GSIS (Prentice et al., 2014). Pharmacologically, the OAT inhibitors probenecid—a non-specific, competitive OAT inhibitor—and benzylpenicillin (PCG)—an OAT3-specific inhibitor—are also protective against the effects of CMPF on the β cell.

Given the emergence of CMPF as a negative regulator of β cell function in the human (Prentice et al., 2014; Liu et al., 2016; Retnakaran et al., 2016), and the direct evidence of deleterious action of CMPF in the β cell, further investigation is warranted into blocking these effects in vivo. Here, we use two methods to block both the acute- and long-term actions of CMPF: genetic elimination and pharmacological inhibition of its transporter in the islet. We predict OAT blockade will emerge as a therapeutic strategy to prevent diabetes by blocking CMPF transport into the β cell, protecting mice from CMPF-induced impaired glucose tolerance and β cell dysfunction.

3.2 Materials and Methods

3.2.1 CMPF, Probenecid Preparation

CMPF was purchased from Cayman Chemical (ref#10007133) and dissolved to a stock concentration of 100 mM in 70% ethanol. Probenecid was purchased from Thermo Fisher Scientific (ref#P36400) and dissolved to a stock of 175 mM in ultrapure water. For in vitro treatment, CMPF was conjugated to Free Fatty Acid Free BSA (Sigma ref#A8806-5G) at a ratio of 3:1 (200 μM CMPF:66.6 μM BSA).

3.2.2 Human Islets

Human islets were obtained from review board-approved donors from the Islet Core and Clinical Islet Laboratory (University of Alberta). Islets were picked in low glucose DMEM media (Gibco, ref#11885-084) containing 10% FBS, 1% penicillin/streptomycin, and 1% L-glutamine and allowed to recover overnight (Prentice et al., 2014) prior to treatment and analysis.

3.2.3 Mitochondrial Membrane Potential Measurements

HEK293 cells were seeded on 22 mm glass coverslips for 24 hours then treated with CMPF for 24 hours prior to mitochondrial membrane potential (MMP) measurements in response to acute 20 mM Glucose or 400 μM Palmitate conjugated to BSA. Additionally, islets were isolated from WT and Oat3KO mice to measure changes in MMP in response to the acute addition of 200 μM CMPF. Both HEK293 cells and primary mouse islets were loaded with 25 μg/mL rhodamine 123 in imaging buffer for 10 minutes at 37 degrees Celsius in 0 mM Glucose. Following dye loading, cells were washed in fresh imaging buffer and placed in imaging chambers in 1 mL imaging buffer. Images were obtained at ex:511 nm by an Olympus IX70 inverted epi-fluorescence

microscope in combination with an Ultrapix camera and a computer with PTI imaging software at 10 second intervals, as previously described. Following a stable baseline fluorescence, either Glucose/Palmitate or CMPF/ethanol was acutely added to HEK293 cells or islets, respectively. 5 mM Sodium Azide was used to fully depolarize the MMP (Diao et al., 2008).

3.2.4 Generation of Oat3KO mice

3.2.4a Oat3KO mice: Slc22a8 Knockout-first Mutant allele mice—heterozygous for the Slc22a8 Tm1a Allele (Slc22a8Tm1a/+)—were obtained from Mary Lyon Co (Britain). This specific allele can be used to create both whole body Oat3KO and β cell-specific KO (Oat3BKO) from the same mice. Whole body Oat3 knockouts were generated by breeding Slc22a8Tm1a/+ mice with B6.C-Tg(CMV-cre)1Cgn/J (CMV-Cre) mice (JAX#006054) (See Breeding Paradigm and Floxed Allele, Figure 11).

Figure 11: Breeding program for the generation of whole body Oat3 KO (Oat3KO, Slc22a8Tm1b/Tm1b) mice from mice heterozygous for the knockout-first mutant allele (Slc22a8Tm1a/+) and mice with whole body Cre Recombinase Expression (CMV-Cre). KO: knockout; CMV: Cytomegalovirus.

3.2.4b Oat3BKO mice. Oat3 beta cell-specific (Oat3BKO) mice were also produced from Slc22a8Tm1a/+ mice. Briefly, mice were first bred with B6.Cg-Tg(Pgk1- FLPo)10Sykr/J (FlpO-10) mice which express Flp Recombinase under the Pgk1 promoter

(JAX#011065). Under this promoter, FlpR expression is ubiquitous in the whole body, with highest expression in the testes and ovaries. Whole body expression of FlpR (by crossing of Slc22a8Tm1a/+ mice with FlpO-10 mice) causes excision of the portion of the gene between FRT sites, creating mice with the Tm1c Allele. The Slc22a8Tm1c Allele has mOat3 exons 4-6 (the critical region) flanked by LoxP sites. RIP-Cre mice (B6.Cg- Tg(Ins2-cre)25Mgn/J) were then used for beta cell specific recombination of LoxP sites (JAX#003573). In the final steps of the breeding program, crossing Slc22a8Tm1c/Tm1c mice with Slc22a8Tm1c/Tm1c RIP-Cre creates Oat3BKO mice (Slc22a8Tm1c/Tm1c RIP-Cre) and littermate controls (Slc22a8Tm1c/Tm1c).

Figure 12: Breeding program for the generation of β cell-specific Oat3 KO (Oat3BKO, Slc22a8Tm1c/Tm1c RIP-Cre+) mice from mice heterozygous for the knockout- first mutant allele (Slc22a8Tm1a/+), mice expressing whole body Flp Recombinase (Pgk1- FlpO), and mice with β cell-specific Cre expression (RIP-Cre). KO: knockout; RIP-Cre: Rat Insulin Promoter-Cre; Pgk1: phosphoglycerate kinase 1; FlpO: Flp Recombinase; BKO: β cell-specific knockout.

3.2.4c Genotyping Slc22a8 floxed mice: Ear notches were taken from mice prior to 21 days age, according to University of Toronto Division of Comparative Medicine SOPs. DNA was extracted from ear notches using the Kapa Express Extract Genomic DNA Kit (ref#KK7100). DNA amplification of genotype-specific sequences was achieved using KAPA2G Fast Readymix (ref#KK5102) according to manufacturer’s protocols. Primer pairs were used according to Table 6 (See Table 8 for primer sequences) with expected results based on genotype presented in Table 7.

Table 6: Primer Pairs to Genotype Slc22a8 Floxed Mice. Primers are chosen based on expected genotype. To genotype a Tm1b mouse, 3 PCR reactions are run: (1) Mutant assay, (2) Tm1b assay, and (3) Cre assay. Tm1a Tm1b Tm1c Tm1d 1. Mutant Assay 1. Mutant Assay 1. Mutant Assay 1. Mutant Assay  Slc22a8-5-WTF  Slc22a8-5-WTF  Slc22a8-5-WTF  Slc22a8-5-WTF  Slc22a8-Crit-WTR  Slc22a8-Crit-WTR  Slc22a8-Crit-WTR  Slc22a8-Crit-WTR  5mut-R1  5mut-R1  5mut-R1  5mut-R1 2. Tm1b Assay 2. LacZ Assay 2. LacZ Assay  Cc_Tm1b_P_F  Cc_LacZ-F  Cc_LacZ-F  Cc_Floxed_PNF_R  Cc_LacZ-R  Cc_LacZ-R 3. Cre Assay 3. Tm1c Assay 3. Tm1c Assay  Cc_Cre_F  Cc_Tm1c_F  Cc_Tm1c_F  Cc_Cre_R  Cc_Tm1c_R  Cc_Tm1c_R 4. Flp Assay 4. Flp Assay  Jax_Flp_F  Jax_Flp_F  Jax_Flp_R  Jax_Flp_R  Jac_Con_F  Jac_Con_F  Jax_Con_R  Jax_Con_R 5. Cre Assay  Cc_Cre_F  Cc_Cre_R

Table 7: Results of PCR based on genotype for Slc22a8 floxed mice. Tm1a Tm1b Tm1c Tm1d 1. Mutant Assay 1. Mutant Assay 1. Mutant Assay 1. Mutant Assay WT band: 258 bp WT band: 258 bp WT band: 258 bp WT band: 258 bp Mutant band: 130 bp Mutant band: 130 bp Mutant band: 130 bp Mutant band: 130 bp 2. Tm1b Assay 2. LacZ Assay 2. LacZ Assay Tm1b band: 380 bp Tm1a band: 108 bp Tm1a band: 108 bp Tm1a: fail Tm1c: fail Tm1c: fail 3. Cre Assay 3. Tm1c Assay 3. Tm1c Assay Cre+ band: 233 bp Tm1c band: 218 bp Tm1c band: 218 bp Cre-: fail Tm1a: fail Tm1a: fail 4. Flp Assay 4. Flp Assay Flp+ band: 241 bp Flp+ band: 241 bp Flp- band: 324 bp Flp- band: 324 bp 5. Cre Assay Cre+ band: 233 bp Cre-: fail

Table 8: Primer sequences for genotyping Slc22a8 floxed mice. Primer Sequence Slc22a8-5-WTF TGGATAGAGCAGCTAAGCAGC Slc22a8-Crit-WTR GCTGCTTAGCTGCTCTATCCA 5mut-R1 GAACTTCGGAATAGGAACTTCG Cc_Tm1b_P_F CGGTCGCTACCATTACCAGT Cc_Floxed_PNF_R ATCCGGGGGTACCGCGTCGAG Cc_Cre_F CATTTGGGCCAGCTAAACAT Cc_Cre_R TAAGCAATCCCCAGAAATGC Cc_LacZ-F ATCACGACGCGCTGTATC Cc_LacZ-R ACATCGGGCAAATAATATCG Cc_Tm1c_F AAGGCGCATAACGATACCAC Cc_Tm1c_R CCGCCTACTGCGACTATAGAGA Jax_Flp_F ATAGCAGCTTTGCTCCTTCG Jax_Flp_R TGGCTCATCACCTTCCTCTT Jax_Con_F CTAGGCCACAGAATTGAAAGATCT Jax_Con_R GTAGGTGGAAATTCTAGCATCATCC Interpretation of correct genotype relies on results of each reaction. For example, when genotyping Slc22a8Tm1c/+ if you have a homozygous mutant based on the mutant Assay (1 band at 130 bp, no band at 258 bp), Tm1c band (at 218 bp), and no band in the LacZ assay, the genotype is Slc22a8Tm1c/Tm1c. If you have a homozygous mutant but both a Tm1c band (at 218 bp) and a LacZ band (at 108 bp), then the genotype is Slc22a8Tm1a/Tm1c.

3.2.5 Intraperitoneal Injection of CMPF, Probenecid

In all studies, mice were weaned at 21 days of age (if bred in house) and were allowed at least 1 week to acclimatize to the animal facilities (if purchased). Animals were housed in maximum 4 mice per cage, and fed standard Rodent Diet 2016. Animals had free access to food and water at all times unless otherwise noted. All experiments were approved by the Animal Care Committee (University of Toronto) and all animals handled according to the Canadian Council of Animal Care guidelines.

3.2.5a Oat3KO-CMPF experiments: To inhibit CMPF transport into the beta cell in vivo, CMPF was administered to WT and Oat3KO mice simultaneously. Oat3KO mice were bred from the Slc22a8 Knockout First Mutant Allele (See Section 3.7.1). 8 week old mice received 6 mg/kg CMPF once daily for seven days (Prepared according to section 3.1). CMPF was diluted in sterile saline for injection. See Figure 13 for treatment paradigm.

Figure 13: Treatment paradigm of CMPF delivery in WT and Oat3KO mice for 7 days. KO: Oat3KO mice; WT: Wild type mice.

3.2.5b Probenecid then CMPF Experiments: To pharmacologically inhibit CMPF transport into the β cell in vivo, the non-specific, competitive OAT inhibitor, probenecid (PBN), was used in WT mice. Seven-week-old WT C57Bl6/J mice were purchased from Charles River and allowed to acclimate for one week prior to the study. Mice were treated with twice daily with 30 mg/kg probenecid or vehicle (water) for 3 days prior to once daily 6 mg/kg CMPF or vehicle (ethanol) for 7 days with sustained probenecid treatment (Prepared according to section 3.1). Both probenecid and CMPF were diluted in sterile saline for injection. See Figure 14 for treatment paradigm.

Figure 14: Probenecid then CMPF Treatment paradigm. CMPF delivery in C57Bl6 mice pre-treated with PBN twice daily for 3 days prior to 7 days CMPF delivery with sustained PBN treatment. PBN: Probenecid; CON: Water (Vehicle).

3.2.5c Long-term CMPF Experiments In long-term CMPF experiments, mice received CMPF or vehicle for 1 week prior to a 6 week recovery period where they were fed a 60% kcal from fat High-Fat Diet (HFD; Research Diets, USA ref#D12492) or sucrose-matched Control Diet (CHOW; Research Diets, USA ref#D12450J). In subsequent experiments

evaluating OAT blockade to inhibit long-term CMPF action, Oat3KO and WT received CMPF for 7 days (Oat3KO vs. WT according to Section 3.2.5a, Figure 13) prior to 6 weeks HFD, Control and PBN pre-treated animals received CMPF for 7 days (Control vs. PBN according to section 3.2.5b, Figure 14) prior to 6 weeks HFD.

3.2.6 SRM/MS for the Quantification of CMPF

Mice received intraperitoneal 6 mg/kg CMPF (See Section 3.1). Following one injection, blood was collected after 10 minutes, 20 minutes, 1, 2, 4, 6, 8, 24, and 48 hours (a given mouse had no more than 4 blood samples taken, and never at consecutive time points). CMPF standards (1-500 ng) and samples were spiked with an internal standard of 25 ng CMPF-d5 (Cayman). 15 μL standard or sample was diluted in 485 μL ultrapure water, 20 μL phosphoric acid was added, then 1.5 mL ethyl acetate. Samples were cooled at 4 degrees, then centrifuged. Upper ethyl acetate layers were collected and dried using a speed vacuum, then resuspended in 500 μL acetonitrile and analyzed by LC-MS/MS using an Aligent 1200 HPLC with API 4000 Mass Spectrometer (AB Sciex).

3.2.7 Tolerance Tests

Following CMPF treatment, all mice underwent intraperitoneal glucose tolerance testing (i.p. GTT). Mice were fasted for 14 hours overnight with free access to water. Mice were injected with 2 g/kg 50% Dextrose at time 0, and ≤25 μL blood was collected from the tail vein at 0, 5, 10, and 15 minutes following injection to measure plasma insulin. Blood glucose measurements were also taken at 20, 30, 60, and 120 minutes following injection using One Touch Contour® Glucometers (Bayer). Plasma insulin was quantified using Ultrasensitive Mouse Insulin ELISA Jumbo Kit (Alpco) with a 10 μL sample volume, according to manufacturer’s protocol.

Intraperitoneal Insulin Tolerance Tests (i.p. ITT) were performed following a 4 hour fast. Mice received 0.75U/kg insulin, and blood glucose was measured at 0, 10, 20, 30, 45, 60, and 90 minutes following insulin injection.

3.2.8 Islet Isolation, Glucose-Stimulated Insulin Secretion, Insulin HTRF

At the end of CMPF treatment paradigms, mice were fasted for 14 hours overnight prior to sacrifice. Mice were anesthetized using isoflurane and bled following removal of the heart for collection of total blood volume using heparinized saline. Blood was then spun at 6,000 rpm for

10 minutes at 4 degrees, and the upper layer of plasma was collected. After animals were bled, tissues were removed and flash frozen in liquid nitrogen for future analysis or fixed for Histology in a 10% neutral buffered formalin solution. Pancreatic islets were isolated through pancreatic perfusion of the common bile duct with Collagenase Type V (Sigma ref#C9263- 500MG) and digestion at 37 degrees for 7-9 minutes as previously described (Luu et al., 2013). Islets were picked and allowed to recover overnight in RPMI-1640 (Sigma ref#8768) supplemented with 10% FBS and P/S. Glucose-stimulated insulin secretion assays were carried out in Kreb’s Ringer buffer (KRB) in 12-well plates for 20 minutes at each glucose concentration at 37°C as previously described (Luu et al., 2013). Insulin content in KRB was measured using Insulin Homogenous Time-Resolved Fluorescence according to manufacturer’s protocol (Cisbio ref# 62INSPEB). Insulin secretion was normalized to total intracellular DNA content.

3.2.9 Islet Oxygen Consumption Measurement

Seahorse XF24 was used to measure Oxygen Consumption Rates (OCR) in islets isolated from WT and Oat3KO mice treated with CMPF. 75 islets from each mouse were allowed to recover overnight then picked into XF24 islet plates (Seahorse Bioscience, USA ref #101122-100) and secured with a mesh cover. Islets were pre-incubated for 1 hour in low, 2 mM glucose KRB without bicarbonate or CO2 then loaded into the XF24 machine. OCR was measured at 2 mM glucose, then 20 mM glucose, 5uM oligomycin, 5uM FCCP + pyruvate, and finally 5uM rotenone + antimycin A. Raw data was normalized to basal OCR at baseline (low, 2 mM glucose) and presented as % basal OCR.

3.2.10 Gene Expression & Western Blotting

Total RNA was extracted from flash-frozen tissues using the RNeasy Mini Kit (Qiagen, Canada ref#74104), except for lipid tissues which were extracted using RNeasy Lipid Tissue Mini Kit (Qiagen, Canada ref#74804). Reverse transcription was carried out with dNTP (Invitrogen ref#10297-018), oligo dT (Invitrogen ref#18418012), and M-MLV Reverse Transcriptase (Sigma ref#M1302-40KU) according to manufacturer’s protocols. mRNA expression was analyzed by quantitative real time PCR (qPCR) using SYBR Green PCR Master Mix (Applied Biosystems, Carlsbad, California ref#4367659) and Viia 7 Real-Time PCR System (Life- Technology, Canada). Relative gene expression was calculated using genomic DNA standard

curves, and data was normalized to β-actin expression. PCR Primers were designed using Primer Blast according to NCBI Reference Sequences (NCBI).

Table 9: List of qPCR primer pairs. Primer Forward Primer Sequence Reverse Primer Sequence mβ-actin CTGAATGGCCCAGGTCTGA CCCTGGCTGCCTCAACAC mSlc22a8-KP TCTCCGAGATTCTGGACCGT CACTTCTCAGGCTTCCCGTT mSlc22a8-AE TCAATTCATTCTGCCTGGCCT AGCAGACACGGACAACTGTAG mSlc22a6 CATCTACGGTGCTGTTCCTGT TATATCCCTGCTTCTTTCTGAGTGG

3.2.11 Statistical Analysis

Statistical significance was measured using a student’s t-test or two-way ANOVA for repeated measures followed by post hoc analysis using Bonferroni when applicable. Significance was considered p<0.05, and data presented as Mean ± SEM.

3.3 Results

3.3.1 OAT Blockade to protect against CMPF in vitro

Wide evidence suggests that CMPF is a substrate for multiple members of the OAT family, including OAT3, and that CMPF entrance to the β cell in particular is through OAT3. Given this evidence, we first aimed to confirm whether CMPF transport through OATs, and/or OAT3 alone is necessary for its detrimental action in the β cell.

3.3.1a Human Islet ROS Accumulation: Human islets treated acutely with diabetic concentrations of CMPF (200 μM) show increases in oxidative stress. When this acute treatment is accompanied by treatment with the pan-OAT inhibitor, PBN, however, the increase in oxidative stress is lost (Figure 15). Therefore, this indicates OAT transport is necessary for CMPF to increase oxidative stress in the human islet.

Figure 15: CMPF increases ROS in Human Islets which can be inhibited by pharmacological OAT inhibition. Representative images and quantification of ROS relative to CON, CON. PBN: Probenecid; ROS: Reactive Oxygen Species measured using Relative Fluorescence CM-H2-DCFDA. *p<0.05, p<0.001.

3.3.1b Glucose-Stimulated Insulin Secretion: To test whether Oat3, specifically, is the transporter responsible for transporting CMPF into the mouse islet, islets were isolated from wild type (WT) and whole body Oat3 knockout (Oat3KO) mice and treated with CMPF for 24 hours. While CMPF impaired GSIS in WT islets, this effect was lost in Oat3KO islets, suggesting CMPF requires transport into the β cell by Oat3 to exert its action (Figure 16). Importantly, this effect is consistent with experiments done by Prentice et al in 2014, this time in our newly developed strain of Oat3KO mice.

Figure 16: Glucose-Stimulated Insulin Secretion in WT and Oat3KO islets treated with CMPF for 24 hours in vitro. WT: Wild type; KO: Oat3KO; LG: Low Glucose, 2 mM; HG: High Glucose 20 mM. p<0.05.

3.3.1c Islet CMPF Metabolism: Given that Oat3KO islets are protected against the ultimate detrimental action of CMPF on the β cell (impaired insulin secretion) following long-term treatments, we next questioned whether Oat3 loss could protect against the acute, direct action of CMPF in order to provide more evidence that block of CMPF transport was responsible for phenotypic rescue. When CMPF enters the islet, we hypothesize that CMPF is metabolized, causing an increase in ROS. Changes in metabolism following the addition of a substrate such as CMPF can be measured using Mitochondrial membrane potential (MMP): if CMPF is metabolised causing excess substrate for the electron transport chain, there will be an increase in proton motive force across the inner mitochondrial membrane which can be measured using commercially available dyes. While acute addition of CMPF to WT islets causes a robust change in MMP (ΔΨm) indicating and increase in metabolism, CMPF addition does not change ΔΨm in Oat3KO islets (Figure 17). Therefore, this lack of metabolism indicates CMPF likely does not enter Oat3KO islets, is not metabolized, and—by preventing CMPF entry—loss of the transporter protects against the observed action of CMPF on GSIS.

1.0

0.5

0.2 0.1

Substrate Utilization Substrate 0.0

 -0.1 Net -0.2 * CMPF NaN3 Substrate

Figure 17: MMP measurements in response to acute CMPF or Vehicle (EtOH) addition in WT or Oat3KO islets. MMP: Mitochondrial Membrane Potential; ΔΨm: Change in MMP (Fold-Change over Basal RFU-Rhodamine 123); WT: Wild type islets; KO: Oat3KO Islets; EtOH: Ethanol; NaN3: Sodium Azide. *p<0.05.

3.3.1d CMPF causes a Metabolic Switch in vitro: CMPF treatment is associated with a switch in preferential substrate utilization in vivo. Liu et al showed that islets isolated from mice treated with CMPF have blunted glucose metabolism, while they increase oxidation of fatty acids including palmitate (See Section 1.2.3: Rapid Elevation in CMPF Accelerates Diabetes Progression in vivo). We next aimed to recapitulate this metabolic switch in vitro in order to test whether we could also use OAT blockade to inhibit this preferential substrate utilization in vitro. To mimic this metabolic switch in vitro CMPF was administered to HEK cells pre- and co-treated with PBN. Acute palmitate treatment resulted in a larger ΔΨm in HEK cells treated with CMPF versus control, but this effect of CMPF was lost when HEK cells were pre- and co-treated with the OAT inhibitor, PBN (Figure 18).

Figure 18: MMP measurements in response to acute Palmitate addition in HEK293 Cells treated with CMPF. MMP: Mitochondrial Membrane Potential; ΔΨm: Change in MMP (Fold-Change over Basal RFU-Rhodamine 123); PBN: Probenecid.

3.3.2 Characterization of Oat3KO Mice

After confirming OAT-mediated transport is essential for CMPF action in the islet, and that inhibition of Oat3 transport is necessary and sufficient to protect against CMPF in vitro, we next aimed to block CMPF transport in vivo.

To accomplish this, we developed and used mice with whole body elimination of Oat3. Oat3KO mice were bred from the knockout-first mutant allele (Figure 19 A; See Section 3.2.4a). Oat3KO lose renal expression of Oat3 (Figure 19 B). Importantly, consistent with previous Oat3KO lines (VanWert et al., Am J Physiol Ren Physiol 2010), our line of Oat3KO mice also display decreased renal expression of the related OAT, Oat1 (Slc22a6) at the gene level (Figure 19 C). Although relative expression of Slc22a8 was low in WT mice, Oat3KO mice have relatively less expression of Slc22a8, indicating there is expression of Oat3 in the islet above background (Figure 19 D).

Figure 19: Oat3KO mice lose Oat3 expression. (A) Knockout-first mutant allele for the generation of Oat3KO mice. (B) Protein and (C) gene expression of Oat3 (Slc22a8) is lost in Oat3KO mice. (D) Relative expression of Slc22a8 in islets. WT: Wild type; KO: Oat3 knockout.

While there were no observable changes in fasting blood glucose in Oat3KO mice versus WT controls, Oat3KO mice had significantly reduced fasting plasma insulin (Figure 20 A-B).

Remarkably, when Oat3KO mice underwent glucose tolerance testing (2g/kg Dextrose), they displayed improved glucose tolerance with dramatically improved in vivo insulin secretion during GTT compared to WT controls (Figure 20 C-D). Ex vivo, Islets isolated from Oat3KO mice showed no difference in absolute insulin secretion at low, high, or high glucose plus KCl glucose concentrations (Figure 20 E). This corresponded with no difference in fold-change insulin secretion during ex vivo GSIS or differences in total intracellular insulin content (Figure 20 F-G). To test if the improvement in glucose tolerance and lowered fasting plasma insulin was, in part, due to an insulin sensitivity phenotype, we tested insulin tolerance in Oat3KO mice versus WT controls. Oat3KO mice displayed improved insulin sensitivity with increased glucose clearance following intraperitoneal insulin load (Figure 20 H).

Figure 20: Oat3KO mice have an improved metabolic phenotype. Fasting (A) blood glucose and (B) plasma insulin in Oat3KO mice. Plasma (C) glucose and (D) insulin during GTT (including AUCinsulin. (E) Ex vivo GSIS of islets isolated from WT and Oat3KO mice, including (F) fold change (HG/LG) and (G) total intracellular insulin content. (H) Insulin tolerance testing in WT and Oat3KO mice. *p<0.05, **p<0.01 Oat3KO vs. WT. Insulin Release: Fold Change over Fasting plasma insulin; GSIS: Glucose Stimulated Insulin Secretion; LG: Low glucose, 2.8 mM; HG: High glucose, 16.7 mM. n=11-12 for GTT; n=4-6 for GSIS; n=7-10 for ITT.

3.3.3 Genetic Elimination of Oat3 to protect against CMPF in vivo

To test if genetic elimination of Oat3 could protect against the diabetic phenotype as a result of CMPF treatment in vivo we delivered 6 mg/kg CMPF or vehicle to WT or Oat3KO mice for 7 days by intraperitoneal injection (Section 3.2.5a; Figure 13).

3.3.3a Measurement of CMPF in Oat3KO mice: Following intraperitoneal injection of 6 mg/kg CMPF, plasma concentrations reach significantly elevated levels in Oat3KO mice than WT controls (Figure 21). This difference in peak CMPF concentration is lost 20 minutes following injection. CMPF does, however, display reduced clearance over 24 hours in Oat3KO mice, as plasma concentrations remain significantly elevated 24 hours following injection (Figure 21).

Figure 21: CMPF injection kinetics in Oat3KO mice. *p<0.05, ***p<0.001 Oat3KO vs. WT. n=3.

3.3.3b Glucose Tolerance Testing: Consistent with previous results (Prentice et al., 2014), acute (7-day) treatment with CMPF causes fasting hyperglycemia (Figure 22 A) and

glucose intolerance in WT mice, indicated by decreased glucose clearance during GTT (WT-CON vs. WT-CMPF; Figure 22 B). In Oat3KO mice treated with CMPF (Oat3KO- CMPF), CMPF did not cause elevated fasting blood glucose or glucose intolerance (Figure 22 A,C). Importantly, while CMPF treatment was also associated with decreased in vivo insulin release during GTT (Figure 22 D), Oat3KO-CMPF mice did not exhibit impaired insulin secretion (Figure 22 E-F), indicating that whole body genetic elimination of the CMPF transporter in the islet is sufficient to protect against these deleterious effects of CMPF on the β cell.

Figure 22: Oat3KO-CMPF in vivo. (A) Fasting blood glucose and GTT testing in (B) WT and (C) Oat3KO mice treated with CMPF for 7 days. (D-F) in vivo insulin secretion during GTT

including AUCinsulin. (G) Absolute values of insulin secretion during GSIS assay (ng/mL insulin/μg DNA) in WT and Oat3KO mice, including (H) fold-change (HG/LG). GTT: Glucose tolerance test; Insulin Release: Fold change over fasting plasma insulin; AUCinsulin: Area Under the Insulin Release Curve; Fold Change: High Glucose (16.7mM) over Low Glucose (2.8 mM). *p<0.05, **p<0.01 WT-CON vs. WT-CMPF; *p<0.05, **p<0.01, ***p<0.001 HG vs. LG. n=8- 12.

3.3.3c Glucose-Stimulated Insulin Secretion: We next isolated islets from WT and Oat3KO mice treated with CMPF for 7 days to confirm if Oat3KO-CMPF islets were, indeed, protected against CMPF phenotypes. Analysis of GSIS confirmed that CMPF treatment in WT mice resulted in an inability of islets to respond to high glucose and significantly increase insulin secretion (Figure 22 G). Consistent with in vivo results, however, Oat3KO-CMPF mice were protected: islets isolated from Oat3KO-CMPF mice had robust fold-change increases in GSIS similar to WT-CON and Oat3KO-CON islets (Figure 22 H).

3.3.3d Islet Glucose Metabolism: Given evidence that CMPF decreases glucose utilization in the islet, we next used Seahorse XF Mitochondrial Stress analysis to determine if Oat3KO mice were also protected against this phenotype. While WT-CMPF islets trended to display blunted increases in Oxygen Consumption Rate (OCR) in response to the acute addition of high (20mM) glucose (Figure 23 A), Oat3KO-CMPF islets appear to be protected with no difference in OCR compared to Oat3KO-CON or WT-CON mice (Figure 23 B).

Figure 23: Oat3KO-CMPF Seahorse. OCR following Glucose, Oligomycin, FCCP+Pyruvate, and Antimycin+Rotenone addition in islets isolated from (A) WT and (B) Oat3KO mice treated with CMPF for 7 days. OCR: Oxygen Consumption Rate (% Basal OCR from measurements 1- 5). n=2

3.3.4 Pharmacological Oat Inhibition to protect against CMPF in vivo

Given that whole body genetic elimination of Oat3 protects against CMPF action, we next aimed to mimic this OAT blockade pharmacologically, in hopes of finding a new pharmacological method to protect against CMPF-induced β cell dysfunction. To block CMPF transport in vivo, we used probenecid (PBN), a non-specific, competitive OAT inhibitor clinically approved for the treatment of gout. To accomplish in vivo blockade, mice were treated twice daily with PBN prior to 7 days CMPF with sustained PBN treatment (See treatment paradigm Section 3.2.5b, Figure 14).

3.3.4a Measurement of CMPF in Probenecid-treated mice: To test if our pharmacological OAT blockade treatment paradigm influenced CMPF plasma kinetics—as in the Oat3KO mice—we delivered PBN twice daily for 4 days and on the fourth day administered one 6 mg/kg injection of CMPF. Consistent with plasma kinetic profiles in Oat3KO mice, CMPF reached significantly elevated concentrations in mice pre-treated with PBN than vehicle controls (Figure 24).

Figure 24: CMPF injection kinetics in PBN mice. Plasma CMPF concentration in mice pre-treated with PBN twice daily for 3 days prior to one 6 mg/kg injection CMPF. *p<0.05, Control vs. PBN. PBN: Probenecid.

Compared to Oat3KO mice where CMPF reached a peak of 197.4 ± 12.6 μM, CMPF seemed to reach even greater concentrations when mice were pre-treated with PBN (233.5 ± 4.2 μM). This difference could be accounted for the fact that CMPF transport via other renal OATs is transiently blocked by pharmacological inhibition, while in the KO situation, only Oat3 transport is inhibited.

3.3.4b Glucose Tolerance Testing: CMPF treatment caused glucose intolerance in control mice (non-PBN group) treated with CMPF (C-CMPF; Figure 25). Our pharmacological method of in vivo OAT blockade was successful at blocking this effect, as mice treated with PBN and CMPF were no more glucose intolerant than controls (PBN-CON vs. PBN- CMPF; Figure 25 C), and PBN treatment rescued in vivo insulin secretion during GTT (Figure 25 E-F).

Figure 25: PBN then CMPF in vivo. (A) Fasting blood glucose and GTT testing in mice pre- and co-treated with (B) Control or (C) PBN prior to 7 days CMPF. (D) AUCglucose during GTT. (E-F) in vivo insulin secretion during GTT including AUCinsulin. (G) Absolute values of insulin secretion during GSIS assay (ng/mL insulin/μg DNA) in Control and PBN mice, including (H) fold-change (HG/LG), and (I) total intracellular insulin content. PBN, “P-”: Probenecid; “C-”: Control; GTT: Glucose tolerance test; Insulin Release: Fold change over fasting plasma insulin; AUCinsulin: Area Under the Insulin Release Curve; GSIS: Glucose-Stimulated Insulin Secretion; Fold Change: High Glucose (16.7mM) over Low Glucose (2.8 mM). *p<0.05, **p<0.01 C-CON vs. C-CMPF; ***p<0.001 C-CMPF vs. P-CMPF.

3.3.4c Glucose-Stimulated Insulin Secretion: To test if the rescued glucose tolerance phenotype was inherent to the islet, we isolated islets from mice treated with PBN and CMPF. While CMPF significantly decreased fold-change insulin secretion (GSIS) in Control mice (C-CON vs. C-CMPF), PBN rescued islet GSIS (P-CON vs. P-CMPF; Figure 25 G-H). Perhaps most importantly, PBN emerged as a good candidate to improve CMPF- induced β cell dysfunction in vivo, as it had no detrimental effect on fasting blood glucose, glucose tolerance, insulin secretion, or insulin content (Figure 25 A-I).

3.3.4d Islet ROS Accumulation: Along with impaired GSIS, islets isolated from mice treated with CMPF alone exhibited significantly elevated ROS (Figure 26). This increase in ROS was lost, however, in islets isolated from mice pre- and co-treated with PBN (PBN- CMPF).

Figure 26: Islet ROS is increased with in vivo CMPF treatment. (A) Representative images and (B) quantification of ROS in islets isolated from mice which were treated with PBN and CMPF in vivo. *p<0.05 CON vs. CMPF. PBN: Probenecid; ROS: Reactive Oxygen Species; RFU-DCF: Relative Fluorescence Units CM-H2-DCFDA.

Therefore, here we have shown that pre- and co-treatment with the OAT inhibitor PBN successfully blocks against numerous mechanistic actions of CMPF in the islet, and should be considered as a valuable tool in inhibiting CMPF in vivo. 61

3.3.5 CMPF Causes Persistent Glucose Intolerance

While GDM is a transient disease which resolves post-partum, it is not an isolated disorder: a GDM diagnosis during pregnancy is the number 1 risk factor for future T2D in women, with as many as 50% of women developing T2D within 7 years following a GDM pregnancy. This transition to T2D is attributed to a sudden decline in β cell function, however, any cause of this sudden dysfunction is unknown. Given that CMPF is elevated in GDM populations (Prentice et al., 2016), has direct effects on measures of β cell function in these women (Retnakaran et al., 2016), and that a high percentage of these women will go on to develop overt T2D, we aimed to determine the effects of acute CMPF elevations (i.e., during a GDM pregnancy) on long-term islet function. In unpublished work, we have recently demonstrated that CMPF has persistent effects on glucose intolerance and islet function, inhibiting in vivo and ex vivo insulin secretion in islets from mice treated with CMPF prior to a 6-15 week recovery. To mimic the severe insulin resistance seen during a GDM pregnancy and during prediabetes, here we delivered CMPF or vehicle to WT C57Bl6 mice for 7 days, then ceased CMPF delivery and placed mice on a 60% kcal from fat High Fat Diet (HFD) or sucrose-matched Control Diet (CHOW) for 6 weeks. Following the 6 week HFD period, we assessed both glucose tolerance and in vivo and ex vivo insulin secretion in these mice.

3.3.5a CMPF is Eliminated from Circulation 24h Following Injection: To confirm initial indications that CMPF is elevated to diabetic concentrations in mouse plasma following 6 mg/kg intraperitoneal injection, we collected plasma from mice 10 minutes, 20 minutes, 1, 2, 3, 4, 8, 24, and 48 hours following injection and measured CMPF by Mass Spectrometry. Consistent with previous observations using ELISA to measure CMPF concentration, we see that CMPF reaches concentrations greater than 150 μM and is eliminated within 24 hours of injection (Figure 27). Importantly, CMPF does not accumulate following multiple injections.

Figure 27: CMPF is eliminated from the circulation 24 hours following injection. Plasma concentrations of CMPF in mouse plasma following one 6 mg/kg intraperitoneal CMPF injection. 3.3.5b CMPF has Long-term Action Glucose Tolerance with an Insulin Resistant Background: To determine if acute CMPF exposure had persistent effects on islet function, exacerbating HFD-induced insulin resistance and glucose intolerance, we studied mice treated with CMPF or vehicle prior to 6 weeks CHOW or HFD-feeding. While the HFD (vehicle) caused glucose intolerance compared to CHOW (vehicle) controls, CMPF treatment on top of the HFD caused glucose intolerance beyond HFD controls, indicated by increased AUCglucose during GTT (Figure 28 B). Additionally, CMPF impaired in vivo insulin secretion compared to HFD Controls (Figure 28 C).

Figure 28: CMPF causes persistent glucose intolerance beyond HFD-Controls. (A) Fasting Blood Glucose, (B) GTT Glucose including AUCglucose and (C) Insulin during GTT of mice treated with Vehicle or CMPF for 7 days prior to 6 weeks HFD-feeding. **p<0.01 HFD vs. HFD-CMPF; #p<0.05, ##p<0.01 CHOW vs. HFD. GTT: Glucose Tolerance Test; HFD: 60% kcal from fat High Fat Diet.

3.3.5c Long-term Action of CMPF is Inhibited by Oat3 Elimination: Given the long- term effects of CMPF on glucose tolerance, we next aimed to characterize the islet function following these long-term treatment models and use Oat3 blockade as a negative control. As before, WT and Oat3KO mice received CMPF for 7 days (See section 3.2.5a; Figure 13) but this time 24 hours following their last injection, all mice were placed on a HFD. While CMPF caused glucose tolerance beyond HFD controls in WT mice (WT-CON vs. WT-CMPF; Figure 29 B), Oat3KO mice treated with CMPF actually displayed improved glucose tolerance (KO-CON vs. KO-CMPF; Figure 29 C). We also discovered that in the long-term CMPF treatment situation, even up to 6 weeks following cessation of CMPF treatment, in vivo insulin secretion during GTT and ex vivo insulin secretion in isolated islets were impaired in WT mice treated with CMPF (WT-CON vs. WT-CMPF; Figure 29 D-F). This data suggests that the persistent effect of CMPF is inherent to the islet, and importantly, we show that Oat3 elimination can protect against this islet phenotype (KO- CON vs. KO-CMPF; Figure 29 D-F).

Figure 29: Genetic Elimination of Oat3 protects against persistent action of CMPF on islet function. (A) Fasting blood glucose and GTT of (B) WT and (C) Oat3KO mice treated with CMPF for 7 days prior to 6 weeks HFD-feeding. *p<0.05 WT-CON vs. WT-CMPF. KO: Oat3

Knockout; HG: High (20 mM) Glucose; LG: Low (2 mM) Glucose; GSIS: Glucose-stimulated insulin secretion (HG over LG).

3.3.5d Long-term Action of CMPF is Inhibited by Pharmacological OAT Inhibition: Our ultimate goal was to prevent against this persistent action of CMPF on islet function by pharmacological means: if CMPF emerges as a novel factor with persistent—if not permanent—action on β cell function, it becomes important to develop means to inhibit its action. To achieve this, we once again treated mice with PBN for 3 days twice daily prior to 7 days CMPF with sustained PBN treatment (See Section 3.2.5b Figure 14). This time, 24 hours following their last PBN/CMPF injection, all mice were placed on a 60% HFD. As before, CMPF caused glucose tolerance beyond HFD controls (C-CON vs. C-CMPF), but CMPF treatment could be blocked by pharmacological inhibition of its transporter in the islet (P-CON vs. P-CMPF; Figure 30 A-C).

Figure 30: Probenecid protects against long-term action of CMPF in vivo. (A) Fasting blood glucose and GTT of mice pre- and co-treated with (C) Control or (C) PBN prior to 7 days CMPF then 6 weeks HFD feeding. *p<0.05 C-CON vs. C-CMPF. PBN: Probenecid.

3.4 Discussion

CMPF continues to emerge as a negative regulator of β cell function in many forms of diabetes. Since the discovery of CMPF in the context of diabetes in 2014, more and more evidence confirms its detrimental effect on the β cell: the most important phenotypes seen with CMPF treatment following its elevation to T2D concentrations in vivo are its persistent alterations in glucose tolerance, an effect which is inherent to the islet as GSIS is impaired. Previous studies

have indicated that CMPF enters the β cell through Organic Anion Transporter 3 (OAT3), but for the first time we show direct evidence that elimination of the Oat3 transporter directly blocks CMPF entry into the islet. The main goal of this study was to investigate whether OAT blockade represents a therapeutic target for diabetes prevention by blocking CMPF action on the β cell. We showed for the first time using two methods (first, genetic elimination of the Oat3 transporter, then pharmacological Oat inhibition) that Oat3 inhibition can successfully block the effects of CMPF in vivo. Given these results, we present the pharmacological OAT inhibitor probenecid—clinically approved for the treatment of gout—in a new clinical context: as a potential drug to improve β cell dysfunction in diabetes. We show probenecid treatment protected against CMPF effects, rescuing glucose tolerance and islet function, and importantly, probenecid treatment alone had no negative effect on glucose homeostasis.

One limitation of these studies are that in vivo OAT inhibition would cause dramatic changes in the renal clearance of any endogenous or exogenous substrates for these transporters. We know that OAT3 is a major player in the renal clearance of many substrates from the systemic circulation: as a member of the renal OAT system, OAT3 accounts for one-third to one-half the transport of most commonly prescribed drugs (Eraly et al., 2004). Here, we even demonstrate that plasma kinetics of CMPF itself are changed in both Oat3KO mice and WT mice pre-treated with probenecid: CMPF reaches significantly elevated concentrations and exhibits decreased clearance from the plasma over 24 hours in these mice. Although probenecid presents as an ideal candidate for the purpose of blocking in vivo CMPF transport (given that it is already a commonly prescribed, clinically approved pharmaceutical), we acknowledge that other OAT inhibitors—particularly OAT3-specific inhibitors—may prove more efficacious than probenecid in blocking the acute action of CMPF. Particularly, an OAT3-specific inhibitor would not alter the renal clearance of OAT1 substrates, and any other OAT3 substrate which is also capable of being transported through OAT1. Future studies are warranted using inhibitors such as benzylpenicillin which can selectively inhibit the OAT3 transporter at target concentrations, or to identify novel OAT3 inhibitors which can block CMPF transport.

Overall, these novel studies demonstrate a requirement of OAT transport for CMPF to alter β cell function and whole body glucose metabolism both in vivo and in vitro, and highlight the potential for OAT inhibition to improve CMPF-induced diabetes.

Chapter 4: Screening Methods to Discover Novel OAT3 Inhibitors

4.1 Introduction

High throughput platforms are quickly being developed for global screening of large populations of people or molecules to reach a certain goal. For instance, large high throughput screens such as “—omics” platforms has allowed global screening of diverse human populations to identify risk factors for disease. In 2014, Prentice et al used a high-throughput metabolomics screen to identify the furan fatty acid metabolite 3-carboxy-4-methyl-5propyl-2-furanpropanoic acid (CMPF) as a biomarker of Gestational Diabetes (GDM).

Pharmaceutical companies aiming to develop novel drug targets and pharmaceutical agents can also employ high-throughput screens to identify molecules with a desired effect. For instance, an assay can be developed which can quickly screen a library of molecules in hopes of finding a handful with a desired effect. For this purpose, the assay must be simple—easily adaptable to a high-throughput method—and replicable.

Here, we aimed to develop a high-throughput screening method for novel inhibitors of the Organic Anion Transporter (OAT), OAT3. Like all other members of the OAT family, OAT3 is a multispecific drug transporter which couples organic anion uptake into cells with efflux of dicarboxylic anions (Sweet et al., 1997). OAT3 is a major player in the renal elimination of endogenous and exogenous substrates from the systemic circulation: as a member of the renal OAT system, OAT3 accounts for one-third to one-half the transport of most commonly prescribed pharmaceuticals (Eraly et al., 2004b).

HEK293 cells are a human embryonic kidney cell line which are relatively easy to culture compared to many β cell lines. For the purposes of screening novel inhibitors of OAT transporters, HEK293 cells are a good model as they express (i) many of the common OATs, and

(ii) co-transporters required for OAT-mediated transport including NaDC3.

In these models, we aimed to use HEK293 cells with CMPF-induced Reactive Oxygen Species (ROS) accumulation as a readout of OAT3 transport. CMPF is an organic anion—and OAT substrate—originally identified as a metabolite elevated in individuals with chronic kidney

disease and uremia (Niwa et al., 1988), where there is significant loss in the renal OAT system, resulting in the elevation of any factor which requires this system for its elimination. OAT1 (SLC22A6) and OAT3 (SLC22A8) are uptake transporters present on the basolateral membrane of renal proximal tubule cells responsible for transport of CMPF from plasma into the proximal tubule, while OAT4 (SLC22A11) is an efflux transporter which transports CMPF from proximal tubule cells into the kidney lumen (Deguchi et al., 2005). More recently, CMPF has emerged as a negative regulator of β cell function—CMPF enters the β cell through OAT3, is metabolized, and causes oxidative stress, decreasing insulin biosynthesis and secretion (Prentice et al., 2014; Liu et al., 2016). We have recently demonstrated a requirement of OAT transport for CMPF to alter β cell function both in vivo and in vitro, and highlighted the potential for OAT inhibition as a new therapeutic strategy to improve CMPF-induced diabetes, warranting investigation into novel compounds which can selectively inhibit the OAT3 transporter.

Given that CMPF is a substrate for multiple OATs—namely OAT1 and OAT3—we opted to over-express OAT3 in HEK293 cells (HEK293-OAT3 cells): if OAT3 is the dominant transporter present in the cell, CMPF will predominantly enter through OAT3, allowing us to block OAT3 and therefore block the majority of CMPF entry using OAT3-specific inhibitors. With the ultimate goal of screening for novel OAT3 inhibitors, we used two known inhibitors as benchmarks in this study. The first inhibitor, probenecid (PBN) is a nonspecific, competitive OAT inhibitor clinically approved for the treatment of gout (Kydd et al., 2014). As a nonspecific inhibitor, it blocks both OAT1- and OAT3-mediated transport. The second inhibitor is benzylpenicillin, also known as penicillin G (PCG), the prototypical OAT3-specific inhibitor: PCG selectively inhibits the OAT3 transporter at concentrations of 300 μM, without altering transport of similarly-related OATs, including OAT1.

4.2 Materials and Methods

4.2.1 CMPF, Probenecid Preparation

CMPF was purchased from Cayman Chemical (ref#10007133) and dissolved to a stock concentration of 100 mM in 70% ethanol. For in vitro treatment, CMPF was conjugated to Free Fatty Acid Free BSA (Sigma ref#A8806-5G) at a ratio of 3:1 (200 μM CMPF:66.6 μM BSA). Probenecid was purchased from Thermo Fisher Scientific (ref#P36400) and dissolved to a stock

of 175 mM in ultrapure water. Benzylpenicillin was purchased from Thermo Fischer and dissolved to a stock concentration of 300 mM.

4.2.2 HEK293 Cell Culture, Transfection

HEK293 cells were cultured in RPMI1640 (Sigma, ref#R8758) containing 10% FBS and 1% penicillin/streptomycin. Cells were passaged every 3 days, with all experiments were performed between passages 4 and 10. OAT3 plasmid was purchased from Vigene Biosciences. Transient transfections in HEK293 cells were performed using LipofectamineTM 2000 following the manufacturer’s instructions (Invitrogen, Carlsbad, California). Transfection efficiency was determined by transfection of GFP. cDNA of the human Slc22a8 gene (c-terminal HA-tagged) was constructed in the pcDNA3.1 vector. Plasmids were purified using the MidiPrep kit (Qiagen, Toronto, Canada).

4.2.3 Reactive Oxygen Species Measurement

Reaction oxygen species was measured in HEK293 cells with or without overexpression of hOAT3. Cells were treated with ± H2O2 and 200 μM CMPF or Control conjugated to BSA for 30 minutes at 37 degrees. Following treatment, cells were loaded with Dye containing 2 μM Hoestch and 5μM CellROX® Deep Red (Thermo Fisher ref#C10422). Cells were washed in PBS and imaged on the Cellomics ArrayScan® VTI (Thermo Fisher).

4.2.4 6-CF Measurement of OAT3 Transport

Blockade of OAT3 transport was measured in HEK293 cells by uptake of the OAT3 substrate, 6- carboxyflourescin (6-CF). Briefly, cells were pre-treated with OAT inhibitors probenecid and/or benzylpenicillin for 30 minutes at 37 degrees, then 6-CF was added to treatment wells to a final concentration of 5 μM. Cells were washed with PBS then lysed in 0.5 N NaOH. 6-CF fluorescence in lysates was measured using a spectrophotometer (Ex/Em: 492/512 nm).

4.2.5 Statistical Analysis

4.3 Results

4.3.1 Overexpression of OAT3 in HEK293 Cells

HEK293 cells were transiently transfected to overexpress OAT3. Overexpression was confirmed by Western Blot (Figure 31). Transfection of the vector in wells of HEK293 cells seeded at different densities resulted in different transfection efficiencies, and different relative expression of OAT3.

Figure 31: Cells transfected with hOAT3 increase expression of OAT3 and HA-tag protein. HEK293 Cells seeded at 4 different densities were transiently transfected with hOAT3 or pcDNA control. H: High Density seeding; M: Medium Density Seeding; L: Low Density Seeding; VL: Very Low Density Seeding. We also used immunofluorescence to confirm overexpression of OAT3 in HEK293 cells. While basal levels of OAT3 are present in pcDNA-transfected HEK293 cells (Figure 32, left), upon over-expression, levels are increased dramatically. Importantly, we see changes in localization of OAT3 upon overexpression (Figure 32, right). While it appears OAT3 remains near the outer surfaces of HEK293 cells, upon overexpression, OAT3 appears to be evenly distributed throughout the cell.

Figure 32: OAT3 protein expression is increased with transfection. HEK293 cells transiently transfected with hOAT3 show increased OAT3 protein expression by immunofluorescence. Image courtesy of B. Batchuluun (Wheeler Lab).

4.3.2 OAT inhibitor Screening Assays

After successful transfection of OAT3 in HEK293 cells, we aimed to develop a high-throughput method to screen for novel OAT3 inhibitors using CMPF-induced reactive oxygen species accumulation as a readout of OAT3-transport.

4.3.2a Using CMPF-induced ROS Accumulation in HEK293-OAT3 cells: The readout of OAT3 transport we chose for our first two assays was ROS accumulation. CMPF can

potentiate the ROS produced by H2O2. In the first Assay, we (i) transfected HEK293 cells

with pcDNA or OAT3, (ii) treated with H2O2 and then (iii) acutely stimulated cells with CMPF and measured ROS accumulation. While CMPF trended to increase ROS in un- transfected and pcDNA-transfected cells, CMPF actually decreased ROS in OAT3 transfected cells (Figure 33). For this reason, we opted to not use this assay (or OAT3- overexpressing cells whatsoever) and instead focussed the next assays on regular, un- transfected HEK293 cells.

Figure 33: Assay 1 to Screen for Novel OAT3 inhibitors: CMPF induced ROS in HEK293 Cells overexpressing OAT3. ROS accumulation in HEK293 cells (i) transfected with pcDNA or hOAT3, then (ii) treated with H2O2 then (iii) acutely with ± CMPF. ROS was measured using by RFU-CellROX Deep Red Reagent. RFU: Relative Fluorescent Units

4.3.2b Using CMPF-induced ROS Accumulation in HEK293 Cells: In the second

Assay Workflow, we grew HEK293 cells in 96 well plates, pre-treated with H2O2, then acutely stimulated with CMPF. CMPF successfully increased ROS accumulation in

HEK293 cells treated with H2O2. When we pre-treated with OAT inhibitors prior to CMPF addition, however, this increase in ROS could be blocked using PBN and PCG (Figure 34 A-B). Given these results, we present Assay Workflow 2 as a potential screening method for OAT3 inhibitors (Figure 34 C).

Figure 34: Assay 2 to Screen for Novel OAT3 inhibitors: CMPF increases ROS in HEK293 Cells. (A) Representative images and (B) quantification of ROS accumulation in HEK293 cells treated with H2O2 then acutely with ± CMPF. ROS was measured using by RFU-CellROX Deep Red Reagent. (C) Assay 2 workflow. RFU: Relative Fluorescent Units; PBN: Probenecid; PCG: Benzylpenicillin.

4.3.2c Using 6-CF Transport: Given that CMPF is a substrate for more than just OAT3, we decided to investigate a third and final Assay workflow which would be more specific to that transporter. 6-Carboxyflourescin (6-CF) is an OAT3-specific substrate which fluoresces at Ex/Em: 492/512 nm (See structure Figure 35 A). In this simple assay, we seeded HEK293 cells in a 24 well plate, pre-treated with our inhibitors, and acutely added 6-CF. Cells were then washed thoroughly—to remove any residual, extracellular 6-CF— then lysed. Lysate fluorescence was then measured and normalized to total protein content in each well. As we can see, the OAT3-specific inhibitor, PCG, successfully decreased lysate fluorescence, indicating that this assay is particularly good at identifying OAT3 inhibitors (Figure 35 B). One limitation is that a significant amount of cells are washed away during the washes (indicated by decreased protein content; Figure X C), but this does not impact results, as cells there is no significant difference in protein contents of

treatments compared. Therefore, we present Assay 3 as a method to screen for novel OAT3 inhibitors (Figure 35 D).

Figure 35: Assay 3 to Screen for Novel OAT3 inhibitors: 6-CF for Measurement of OAT3 Transport. (A) structure of 6-CF. (B) OAT3 transport (RFU-6-CF/ug protein) in HEK293 cells treated with ± OAT inhibitors PBN and PCG prior to the OAT3-specific fluorescent substrate, 6- CF (RFU expressed normalised to protein content in lysates). (C) Total Protein (μg/μL) in 6-CF lysates following washes. (D) Assay #3 Workflow. **p<0.01 vs. 6-CF. n = 3 in triplicate. ***p<0.005 NO WASH vs. NC. RFU 6-CF: Relative Fluorescence Units 6-Carboxyflourescin; NC: Negative Control; PCG: Benzylpenicillin; PBN: Probenecid.

4.4 Discussion

Here, we propose 3 different strategies for the high-throughput screening of novel OAT3 inhibitors and acknowledge the benefits and drawbacks of all 3 strategies. In the first model, we over-expressed hOAT3 in HEK293 cells. Surprisingly, this overexpression resulted in a protection against the effects of CMPF. While CMPF tended to increase oxidative stress in un- transfected or pcDNA-transfected cells, overexpression of OAT3 caused CMPF to decrease ROS. We accounted this protection to the fact that since these transporters are present at such low levels in many tissues in the body, they become inherently difficult—if not impossible—to overexpress. If the cell cannot properly process the transporter and orient it correctly on the membrane, this could account for the protective effect. Next, we attempted to use un-transfected

HEK cells, and as we established that CMPF could potentiate H2O2-induced ROS, we added in

the OAT inhibitors PBN and PCG. Both PBN and PCG could successfully inhibit CMPF- induced ROS in HEK293 cells. Finally, we developed a third and final method to screen for OAT3-specific inhibitors, this time using the OAT3-specific fluorescent substrate 6-CF.

These assays could be used to discover novel compounds which block the OAT3 transporter, which ultimately may also prove efficacious in blocking the effects of CMPF in vivo. In Chapter 3, we stress the need to block OAT3 transporters to inhibit the effects of CMPF in vivo, as well as the need of Oat3-spefiic inhibitors to block the islet phenotype of CMPF but minimize the secondary effects of OAT blockade (including decreased renal clearance of substrates of all OAT transporters).

Chapter 5: Discussion

5.1 Concluding Remarks and Future Directions

In this thesis, I have presented my work on the blockade of OAT3 to improve β cell dysfunction in diabetes. My work has focussed on the furan fatty acid metabolite, 3-carboxy-4-methyl-5- propyl-2-furanpropanoic acid (CMPF), which has recently emerged as a negative regulator of β cell function in both human populations and in the rodent (Prentice et al., 2014; Liu et al., 2016; Retnakaran et al., 2016). Here, we investigated whether OAT blockade represents a therapeutic target for diabetes prevention by blocking CMPF action on the β cell. To achieve this we blocked CMPF transport in vivo using two methods: first, we created Oat3KO mice lacking the transporter responsible for CMPF entry to the islet, then mimicked the genetic situation using pharmacological Oat inhibition. As expected, CMPF impaired glucose tolerance, and islets isolated from CMPF-treated mice showed impaired GSIS, decreased glucose utilization, and increased Reactive Oxygen Species (ROS) accumulation. Both loss of Oat3 and its inhibition protected against these effects, rescuing glucose tolerance and islet function.

These studies are important, demonstrating for the first time (i) that Oat3 blockade directly inhibits entry of CMPF to the islet (using changes in mitochondrial membrane potential to indicate CMPF metabolism as a read-out of CMPF entry) and (ii) the novel therapeutic potential of OAT inhibition to prevent against CMPF-induced diabetes.

In Chapter 3, I present data characterizing whole body Oat3KO mice, which I show have improved glucose tolerance and improved in vivo insulin secretion. Although I believe this data is strong to support the assertion that blockade of OAT3 could improve β cell function in diabetes, we must acknowledge that these studies to not prove a direct cause-effect of Oat3 loss in the islet and improved β cell function. Instead, the data I present on fasting plasma insulin secretion and insulin sensitivity (measured by insulin tolerance test) indicate that the improved insulin secretion during GTT may actually be secondary to alterations in whole body glucose metabolism. We can, however, hypothesize about why Oat3KO mice have altered metabolic phenotypes based on the substrates Oat3 transports (See Section 1.3.3c Table 5). For instance, cAMP is an Oat3 substrate, and as cAMP is a second messenger in many signalling pathways— including the insulin stimulus-secretion coupling pathway through Gαs-coupled receptors—

alterations in cellular cAMP could influence insulin secretion. Additionally, metabolomics analyses of Oat3KO versus WT mice have identified other endogenous substrates for Oat3: absence of this transporter leads to significant alterations in several cellular metabolic pathways including the tricarboxylic acid cycle (Wu et al., 2013). Alterations in TCA intermediates may also influence function of β cells and other metabolic tissues. Ultimately, the only way to assert whether alterations in metabolic homeostasis in Oat3KO mice are due to improved β cell function (by blocking Oat3 transport in the islet) or are secondary to other tissue types is to characterize the Oat3 β cell-specific KO (Oat3BKO) mice which I have created. If Oat3 is only eliminated from the islet and these mice are still more glucose tolerant than WT controls, it indicates blockade of islet Oat3 is, in fact, beneficial for islet function. Therefore, characterization of WT versus Oat3KO versus Oat3BKO is an important future direction of this thesis.

As I eluded to at the end of Chapter 3, although probenecid may be an ideal candidate in the drug discovery-development pipeline (as it is already clinically approved for the treatment of gout and has been used for decades without any documented detrimental effect on metabolic functioning), it may not be the most efficacious in this context. While probenecid has high affinity for the OAT3 transporter, which would ensure blockade of OAT3 in the islet, it is also a competitive inhibitor of other OATs. Use of probenecid would therefore result in decreased delivery and excretion of many OAT substrates, including CMPF. Future experiments should focus on the efficacy of OAT3-specific inhibitors (including PCG) to block CMPF-induced diabetic phenotypes. PCG can selectively inhibit OAT3 at concentrations of 300 μM, however, the compound becomes non-specific and ineffective at higher and lower concentrations, respectively. Therefore, novel compounds which can effectively block OAT3 at broader concentration ranges (which is relevant in vivo where it is difficult to maintain steady state concentrations of compounds) are needed. Perhaps the screening methods for novel OAT3 inhibitors presented in Chapter 4 may prove beneficial to identify inhibitors which selectively inhibit OAT3—and perhaps also identify concentrations of these inhibitors which selectively block CMPF entrance with minimal effect on other substrates.

In Chapter 3, I also present some work on the long-term, persistent action of CMPF on islet function. Given these long-term effects, I hypothesize CMPF may be a factor—which is elevated

in certain GDM populations—with persistent effects on islet function, linking GDM pregnancy to T2D: if this metabolic insult occurs in the islet during pregnancy, perhaps CMPF has predisposed the islet to decompensation, increasing the GDM to T2D pregnancy transition. I believe identifying this risk early on, and blocking CMPF transport into the islet as soon as elevations occur could prove beneficial.

Importantly, I have also dedicated a large deal of my Master’s work to uncovering the effect of CMPF on other metabolic tissues, including the liver. Although this work is not presented here, it is work mentioning that CMPF enters many other metabolic tissues, in addition to the islet, where it has pronounced effects. In the liver, for instance, CMPF acts similarly to in the islet, and causes a metabolic switch, causing hepatocytes to preferentially switch from glucose metabolism to fatty acid oxidation. In contrary to what I’ve shown here (that this metabolic substrate preference causes persistent β cell dysfunction) this effect presents as a beneficial one in the liver, decreasing hepatic lipid accumulation, and improving hepatic insulin sensitivity. Therefore, as studies continue in WT mice to uncover these effects in the liver, it is important to continue to consider OAT-mediated transport in these other tissues. OAT3 is not present in the liver, and preliminary studies indicate that whole body Oat3KO mice are still sensitive to the beneficial hepatic manifestations of CMPF: therefore selective inhibition of the OAT3 transporter in vivo may serve as a method to selectively target the beneficial actions of CMPF on insulin sensitivity while inhibiting its detrimental effects on insulin secretion.

Finally, future studies warrant investigation using β cell-specific Oat3 knockout (Oat3BKO) mice: the only way we can truly isolate the effect CMPF has on the islet separate from other tissues is to block its transport in the islet, while maintaining expression of Oat3 in all other tissues. This will also remove the confounding variable of decreased renal clearance of CMPF in whole body Oat3KO mice. Use of Oat3BKO mice in the setting of a high fat diet—where CMPF is known to have effects on other tissues, including the liver—will be the most elegant way of targeting CMPF away from the islet, and uncovering mechanistically the role of organ cross-talk in its effects on other tissues.

In conclusion, in this thesis I have presented a comprehensive analysis of in vivo OAT blockade to prevent against the effect of CMPF. I reveal pharmacological OAT blockade as a novel therapeutic strategy to prevent β cell dysfunction in diabetes. Additionally, I show the persistent,

detrimental action of CMPF on β cell function, and reveal these effects are also blocked by OAT inhibition. As CMPF continues to emerge as a negative regulator of β cell function in both the human and rodent, it will become more and more evident that blocking its deleterious effects of islet function are essential in populations with elevations in plasma CMPF.

REFERENCES Ahmed, A. M. (2002). History of diabetes mellitus. Saudi Medical Journal, 23(4), 373-378. Ashcroft, F. M., Proks, P., Smith, P. A., Ammala, C., Bokvist, K., & Rorsman, P. (1994). Stimulus-secretion coupling in pancreatic beta cells. Journal of Cellular Biochemistry, 55 Suppl, 54-65. Batna, A., Scheinkonig, J., & Spiteller, G. (1993). The occurrence of furan fatty acids in isochrysis sp. and phaeodactylum tricornutum. Biochimica Et Biophysica Acta, 1166(2-3), 171-176. Bennett, C. M., Guo, M., & Dharmage, S. C. (2007). HbA(1c) as a screening tool for detection of type 2 diabetes: A systematic review. Diabetic Medicine : A Journal of the British Diabetic Association, 24(4), 333-343. doi:DME2106 [pii] Boveris, A., Oshino, N., & Chance, B. (1972). The cellular production of hydrogen peroxide. The Biochemical Journal, 128(3), 617-630. Brady, K. P., Dushkin, H., Fornzler, D., Koike, T., Magner, F., Her, H., . . . Beier, D. R. (1999). A novel putative transporter maps to the osteosclerosis (oc) mutation and is not expressed in the oc mutant mouse. Genomics,56(3), 254-261. doi:S0888-7543(98)95722-6 [pii] Breljak, D., Brzica, H., Sweet, D. H., Anzai, N., & Sabolic, I. (2013). Sex-dependent expression of Oat3 (Slc22a8) and Oat1 (Slc22a6) proteins in murine kidneys. American Journal of Physiology.Renal Physiology, 304(8), F1114-26. doi:10.1152/ajprenal.00201.2012 [doi] Buchanan, T. A., & Xiang, A. H. (2005). Gestational diabetes mellitus. The Journal of Clinical Investigation, 115(3), 485-491. doi:10.1172/JCI24531 Burckhardt, G. (2012). Drug transport by organic anion transporters (OATs). Pharmacology & Therapeutics, 136(1), 106-130. doi:10.1016/j.pharmthera.2012.07.010 [doi] BURNELL, J. M., & KIRBY, W. M. (1951). Effectiveness of a new compound, benemid, in elevating serum penicillin concentrations. The Journal of Clinical Investigation, 30(7), 697-700. doi:10.1172/JCI102482 [doi] Cha, S. H., Sekine, T., Kusuhara, H., Yu, E., Kim, J. Y., Kim, D. K., . . . Endou, H. (2000). Molecular cloning and characterization of multispecific organic anion transporter 4 expressed in the placenta. The Journal of Biological Chemistry, 275(6), 4507-4512. Chandra, J., Samali, A., & Orrenius, S. (2000). Triggering and modulation of apoptosis by oxidative stress. Free Radical Biology & Medicine, 29(3-4), 323-333. doi:S0891-5849(00)00302-6 [pii] Choi, C. H. (2005). ABC transporters as multidrug resistance mechanisms and the development of chemosensitizers for their reversal. Cancer Cell International, 5, 30. doi:1475-2867-5-30 [pii] Deguchi, T., Kouno, Y., Terasaki, T., Takadate, A., & Otagiri, M. (2005). Differential contributions of rOat1 (Slc22a6) and rOat3 (Slc22a8) to the in vivo renal uptake of uremic toxins in rats. Pharmaceutical Research, 22(4), 619-627. doi:10.1007/s11095-005-2486-x [doi] Deguchi, T., Kouno, Y., Terasaki, T., Takadate, A., & Otagiri, M. (2005). Differential contributions of rOat1 (Slc22a6) and rOat3 (Slc22a8) to the in vivo renal uptake of uremic toxins in rats. Pharmaceutical Research, 22(4), 619-627. doi:10.1007/s11095-005-2486-x [doi] Deguchi, T., Takemoto, M., Uehara, N., Lindup, W. E., Suenaga, A., & Otagiri, M. (2005). Renal clearance of endogenous hippurate correlates with expression levels of renal organic anion transporters in uremic rats. The Journal of Pharmacology and Experimental Therapeutics, 314(2), 932-938. doi:jpet.105.085613 [pii] Diabetes Genetics Initiative of Broad Institute of Harvard and MIT, Lund University, and Novartis Institutes of BioMedical Research, Saxena, R., Voight, B. F., Lyssenko, V., Burtt, N. P., de Bakker, P. I., . . . Purcell, S. (2007). Genome-wide association analysis identifies loci for type 2 diabetes and triglyceride levels. Science (New York, N.Y.), 316(5829), 1331-1336. doi:1142358 [pii] Domanski, M., Mitchell, G., Pfeffer, M., Neaton, J. D., Norman, J., Svendsen, K., . . . MRFIT Research Group. (2002). Pulse pressure and cardiovascular disease-related mortality: Follow-up study of the multiple risk factor intervention trial (MRFIT). Jama, 287(20), 2677-2683. doi:joc11763 [pii]

Drucker, D. J. (2006). The biology of incretin hormones. Cell Metabolism, 3(3), 153-165. doi:S1550- 4131(06)00028-3 [pii] Duan, P., & You, G. (2009). Novobiocin is a potent inhibitor for human organic anion transporters. Drug Metabolism and Disposition: The Biological Fate of Chemicals, 37(6), 1203-1210. doi:10.1124/dmd.109.026880 [doi] Eraly, S. A., Bush, K. T., Sampogna, R. V., Bhatnagar, V., & Nigam, S. K. (2004). The molecular pharmacology of organic anion transporters: From DNA to FDA? Molecular Pharmacology, 65(3), 479-487. doi:10.1124/mol.65.3.479 [doi] Eraly, S. A., Monte, J. C., & Nigam, S. K. (2004). Novel slc22 transporter homologs in fly, worm, and human clarify the phylogeny of organic anion and cation transporters. Physiological Genomics, 18(1), 12-24. doi:10.1152/physiolgenomics.00014.2004 [doi] Feng, B., Shu, Y., & Giacomini, K. M. (2002). Role of aromatic transmembrane residues of the organic anion transporter, rOAT3, in substrate recognition. Biochemistry, 41(28), 8941-8947. doi:bi0200615 [pii] Ferrannini, E., Camastra, S., Gastaldelli, A., Maria Sironi, A., Natali, A., Muscelli, E., . . . Mari, A. (2004). Beta-cell function in obesity: Effects of weight loss. Diabetes, 53 Suppl 3, S26-33. doi:53/suppl_3/S26 [pii] Ferrara, A. (2007). Increasing prevalence of gestational diabetes mellitus: A public health perspective. Diabetes Care, 30 Suppl 2, S141-6. doi:10.2337/dc07-s206 Festa, A., Haffner, S. M., Wagenknecht, L. E., Lorenzo, C., & Hanley, A. J. (2013). Longitudinal decline of beta- cell function: Comparison of a direct method vs a fasting surrogate measure: The insulin resistance atherosclerosis study. The Journal of Clinical Endocrinology and Metabolism, 98(10), 4152-4159. doi:10.1210/jc.2013-1937 [doi] Florez, J. C. (2008). Newly identified loci highlight beta cell dysfunction as a key cause of type 2 diabetes: Where are the insulin resistance genes? Diabetologia, 51(7), 1100-1110. doi:10.1007/s00125-008-1025-9 [doi] Gilbertson, D. T., Liu, J., Xue, J. L., Louis, T. A., Solid, C. A., Ebben, J. P., & Collins, A. J. (2005). Projecting the number of patients with end-stage renal disease in the united states to the year 2015. Journal of the American Society of Nephrology : JASN, 16(12), 3736-3741. doi:ASN.2005010112 [pii] Guasch-Ferre, M., Hruby, A., Toledo, E., Clish, C. B., Martinez-Gonzalez, M. A., Salas-Salvado, J., & Hu, F. B. (2016). Metabolomics in prediabetes and diabetes: A systematic review and meta-analysis. Diabetes Care, 39(5), 833-846. doi:10.2337/dc15-2251 [doi] Hagenbuch, B., & Meier, P. J. (2004). Organic anion transporting polypeptides of the OATP/ SLC21 family: Phylogenetic classification as OATP/ SLCO superfamily, new nomenclature and molecular/functional properties.Pflugers Archiv : European Journal of Physiology, 447(5), 653-665. doi:10.1007/s00424-003-1168- y [doi] Hagos, Y., Braun, I. M., Krick, W., Burckhardt, G., & Bahn, A. (2005). Functional expression of pig renal organic anion transporter 3 (pOAT3). Biochimie, 87(5), 421-424. doi:S0300-9084(05)00012-X [pii] Hediger, M. A., Romero, M. F., Peng, J. B., Rolfs, A., Takanaga, H., & Bruford, E. A. (2004). The ABCs of solute carriers: Physiological, pathological and therapeutic implications of human membrane transport proteinsIntroduction. Pflugers Archiv : European Journal of Physiology, 447(5), 465-468. doi:10.1007/s00424-003-1192-y [doi] Jacobsson, J. A., Haitina, T., Lindblom, J., & Fredriksson, R. (2007). Identification of six putative human transporters with structural similarity to the drug transporter SLC22 family. Genomics, 90(5), 595-609. doi:S0888-7543(07)00075-4 [pii] Kawai, S., Mukai, T., Mori, S., Mikami, B., & Murata, K. (2005). Hypothesis: Structures, evolution, and ancestor of glucose kinases in the hexokinase family. Journal of Bioscience and Bioengineering, 99(4), 320-330. doi:S1389-1723(05)70374-1 [pii] Kikuchi, R., Kusuhara, H., Hattori, N., Shiota, K., Kim, I., Gonzalez, F. J., & Sugiyama, Y. (2006). Regulation of the expression of human organic anion transporter 3 by hepatocyte nuclear factor 1alpha/beta and DNA methylation. Molecular Pharmacology, 70(3), 887-896. doi:mol.106.025494 [pii] 79

Klein, R., Klein, B. E., Moss, S. E., Davis, M. D., & DeMets, D. L. (1984). The wisconsin epidemiologic study of diabetic retinopathy. III. prevalence and risk of diabetic retinopathy when age at diagnosis is 30 or more years.Archives of Ophthalmology (Chicago, Ill.: 1960), 102(4), 527-532. Kydd, A. S., Seth, R., Buchbinder, R., Edwards, C. J., & Bombardier, C. (2014). Uricosuric medications for chronic gout. The Cochrane Database of Systematic Reviews, 11, CD010457. doi:10.1002/14651858.CD010457.pub2 [doi] Lankinen, M. A., Hanhineva, K., Kolehmainen, M., Lehtonen, M., Auriola, S., Mykkanen, H., . . . Uusitupa, M. (2015). CMPF does not associate with impaired glucose metabolism in individuals with features of metabolic syndrome. PloS One, 10(4), e0124379. doi:10.1371/journal.pone.0124379 [doi] Leloup, C., Tourrel-Cuzin, C., Magnan, C., Karaca, M., Castel, J., Carneiro, L., . . . Penicaud, L. (2009). Mitochondrial reactive oxygen species are obligatory signals for glucose-induced insulin secretion. Diabetes, 58(3), 673-681. doi:10.2337/db07-1056 [doi] Lemieux, M. J., Huang, Y., & Wang, D. N. (2004). The structural basis of substrate translocation by the escherichia coli glycerol-3-phosphate transporter: A member of the major facilitator superfamily. Current Opinion in Structural Biology, 14(4), 405-412. doi:10.1016/j.sbi.2004.06.003 [doi] Lesinski, J., Dzierzanowska, D., Szymczak, M., Linda, H., Wisniewska, C., Nawara, A., & Winogrodzka, A. (1973). Treatment of gonorrhoea with procaine penicillin plus probenecid. The British Journal of Venereal Diseases,49(4), 358-361. Lindstrom, P. (2010). Beta-cell function in obese-hyperglycemic mice [ob/ob mice. Advances in Experimental Medicine and Biology, 654, 463-477. doi:10.1007/978-90-481-3271-3_20 [doi] Liu, Y., Prentice, K. J., Eversley, J. A., Hu, C., Batchuluun, B., Leavey, K., . . . Wheeler, M. B. (2016). Rapid elevation in CMPF may act as a tipping point in diabetes development. Cell Reports, 14(12), 2889-2900. doi:10.1016/j.celrep.2016.02.079 [doi] Luu, L., Dai, F. F., Prentice, K. J., Huang, X., Hardy, A. B., Hansen, J. B., . . . Wheeler, M. B. (2013). The loss of Sirt1 in mouse pancreatic beta cells impairs insulin secretion by disrupting glucose sensing. Diabetologia, 56(9), 2010-2020. doi:10.1007/s00125-013-2946-5 [doi] Mahadevan, J., Parazzoli, S., Oseid, E., Hertzel, A. V., Bernlohr, D. A., Vallerie, S. N., . . . Robertson, R. P. (2013). Ebselen treatment prevents islet apoptosis, maintains intranuclear pdx-1 and MafA levels, and preserves beta- cell mass and function in ZDF rats. Diabetes, 62(10), 3582-3588. doi:10.2337/db13-0357 [doi] Maher, J. M., Slitt, A. L., Callaghan, T. N., Cheng, X., Cheung, C., Gonzalez, F. J., & Klaassen, C. D. (2006). Alterations in transporter expression in liver, kidney, and duodenum after targeted disruption of the transcription factor HNF1alpha. Biochemical Pharmacology, 72(4), 512-522. doi:S0006-2952(06)00188-2 [pii] Maiden, M. C., Davis, E. O., Baldwin, S. A., Moore, D. C., & Henderson, P. J. (1987). Mammalian and bacterial sugar transport proteins are homologous. Nature, 325(6105), 641-643. doi:10.1038/325641a0 [doi] Mancini, A. D., & Poitout, V. (2013). The fatty acid receptor FFA1/GPR40 a decade later: How much do we know? Trends in Endocrinology and Metabolism: TEM, 24(8), 398-407. doi:10.1016/j.tem.2013.03.003 [doi] Meert, N., Schepers, E., De Smet, R., Argiles, A., Cohen, G., Deppisch, R., . . . Vanholder, R. (2007). Inconsistency of reported uremic toxin concentrations. Artificial Organs, 31(8), 600-611. doi:AOR434 [pii] Mitanchez, D. (2010). Foetal and neonatal complications in gestational diabetes: Perinatal mortality, congenital malformations, macrosomia, shoulder dystocia, birth injuries, neonatal complications. Diabetes & Metabolism,36(6 Pt 2), 617-627. doi:10.1016/j.diabet.2010.11.013 [doi] Miyazaki, H., Anzai, N., Ekaratanawong, S., Sakata, T., Shin, H. J., Jutabha, P., . . . Endou, H. (2005). Modulation of renal apical organic anion transporter 4 function by two PDZ domain-containing proteins. Journal of the American Society of Nephrology : JASN, 16(12), 3498-3506. doi:ASN.2005030306 [pii] Mudaliar, S., & Henry, R. R. (2010). Effects of incretin hormones on beta-cell mass and function, body weight, and hepatic and myocardial function. The American Journal of Medicine, 123(3 Suppl), S19-27. doi:10.1016/j.amjmed.2009.12.006 [doi] 80

Newgard, C. B., An, J., Bain, J. R., Muehlbauer, M. J., Stevens, R. D., Lien, L. F., . . . Svetkey, L. P. (2009). A branched-chain amino acid-related metabolic signature that differentiates obese and lean humans and contributes to insulin resistance. Cell Metabolism, 9(4), 311-326. doi:10.1016/j.cmet.2009.02.002 [doi] Newsholme, P., Haber, E. P., Hirabara, S. M., Rebelato, E. L., Procopio, J., Morgan, D., . . . Curi, R. (2007). Diabetes associated cell stress and dysfunction: Role of mitochondrial and non-mitochondrial ROS production and activity. The Journal of Physiology, 583(Pt 1), 9-24. doi:jphysiol.2007.135871 [pii] Newsholme, P., Rebelato, E., Abdulkader, F., Krause, M., Carpinelli, A., & Curi, R. (2012). Reactive oxygen and nitrogen species generation, antioxidant defenses, and beta-cell function: A critical role for amino acids. The Journal of Endocrinology, 214(1), 11-20. doi:10.1530/JOE-12-0072 [doi] Nigam, S. K. (2015). What do drug transporters really do? Nature Reviews.Drug Discovery, 14(1), 29-44. doi:10.1038/nrd4461 [doi] Niwa, T. (2013). Removal of protein-bound uraemic toxins by haemodialysis. Blood Purification, 35 Suppl 2, 20-25. doi:10.1159/000350843 [doi] Niwa, T., Takeda, N., Maeda, K., Shibata, M., & Tatematsu, A. (1988). Accumulation of furancarboxylic acids in uremic serum as inhibitors of drug binding. Clinica Chimica Acta; International Journal of Clinical Chemistry,173(2), 127-138. doi:0009-8981(88)90250-1 [pii] Pao, S. S., Paulsen, I. T., & Saier, M. H.,Jr. (1998). Major facilitator superfamily. Microbiology and Molecular Biology Reviews : MMBR, 62(1), 1-34. Perry, J. L., Dembla-Rajpal, N., Hall, L. A., & Pritchard, J. B. (2006). A three-dimensional model of human organic anion transporter 1: Aromatic amino acids required for substrate transport. The Journal of Biological Chemistry, 281(49), 38071-38079. doi:M608834200 [pii] Pi, J., Bai, Y., Zhang, Q., Wong, V., Floering, L. M., Daniel, K., . . . Collins, S. (2007). Reactive oxygen species as a signal in glucose-stimulated insulin secretion. Diabetes, 56(7), 1783-1791. doi:db06-1601 [pii] Poitout, V., & Robertson, R. P. (2008). Glucolipotoxicity: Fuel excess and beta-cell dysfunction. Endocrine Reviews, 29(3), 351-366. doi:er.2007-0023 [pii] Poitout, V., & Robertson, R. P. (2008). Glucolipotoxicity: Fuel excess and beta-cell dysfunction. Endocrine Reviews, 29(3), 351-366. doi:er.2007-0023 [pii] Prentice, K. J., Luu, L., Allister, E. M., Liu, Y., Jun, L. S., Sloop, K. W., . . . Wheeler, M. B. (2014). The furan fatty acid metabolite CMPF is elevated in diabetes and induces beta cell dysfunction. Cell Metabolism, 19(4), 653- 666. doi:10.1016/j.cmet.2014.03.008; 10.1016/j.cmet.2014.03.008 Qiao, Z. S., Guo, Z. Y., & Feng, Y. M. (2006). In vitro folding/unfolding of insulin/single-chain insulin. Protein and Peptide Letters, 13(5), 423-429. Race, J. E., Grassl, S. M., Williams, W. J., & Holtzman, E. J. (1999). Molecular cloning and characterization of two novel human renal organic anion transporters (hOAT1 and hOAT3). Biochemical and Biophysical Research Communications, 255(2), 508-514. doi:S0006-291X(98)99978-8 [pii] Randle, P. J., Priestman, D. A., Mistry, S. C., & Halsall, A. (1994). Glucose fatty acid interactions and the regulation of glucose disposal. Journal of Cellular Biochemistry, 55 Suppl, 1-11. Retnakaran, R., Qi, Y., Goran, M. I., & Hamilton, J. K. (2009). Evaluation of proposed oral disposition index measures in relation to the actual disposition index. Diabetic Medicine : A Journal of the British Diabetic Association,26(12), 1198-1203. doi:10.1111/j.1464-5491.2009.02841.x [doi] Retnakaran, R., Qi, Y., Sermer, M., Connelly, P. W., Hanley, A. J., & Zinman, B. (2010). Beta-cell function declines within the first year postpartum in women with recent glucose intolerance in pregnancy. Diabetes Care, 33(8), 1798-1804. doi:10.2337/dc10-0351 [doi] Retnakaran, R., Shen, S., Hanley, A. J., Vuksan, V., Hamilton, J. K., & Zinman, B. (2008). Hyperbolic relationship between insulin secretion and sensitivity on oral glucose tolerance test. Obesity (Silver Spring, Md.), 16(8), 1901-1907. doi:10.1038/oby.2008.307 [doi]

Retnakaran, R., Ye, C., Kramer, C. K., Connelly, P. W., Hanley, A. J., Sermer, M., & Zinman, B. (2016). Evaluation of circulating determinants of beta-cell function in women with and without gestational diabetes. The Journal of Clinical Endocrinology and Metabolism, , jc20161402. doi:10.1210/jc.2016-1402 [doi] Robertson, R. P., Harmon, J., Tran, P. O., & Poitout, V. (2004). Beta-cell glucose toxicity, lipotoxicity, and chronic oxidative stress in type 2 diabetes. Diabetes, 53 Suppl 1, S119-24. Roth, M., Obaidat, A., & Hagenbuch, B. (2012). OATPs, OATs and OCTs: The organic anion and cation transporters of the SLCO and SLC22A gene superfamilies. British Journal of Pharmacology, 165(5), 1260- 1287. doi:10.1111/j.1476-5381.2011.01724.x; 10.1111/j.1476-5381.2011.01724.x Samuel, V. T., & Shulman, G. I. (2012). Mechanisms for insulin resistance: Common threads and missing links. Cell, 148(5), 852-871. doi:10.1016/j.cell.2012.02.017 [doi] Sassa, T., Matsuno, H., Niwa, M., Kozawa, O., Takeda, N., Niwa, T., . . . Uematsu, T. (2000). Measurement of furancarboxylic acid, a candidate for uremic toxin, in human serum, hair, and sweat, and analysis of pharmacological actions in vitro. Archives of Toxicology, 73(12), 649-654. Schoonbroodt, S., & Piette, J. (2000). Oxidative stress interference with the nuclear factor-kappa B activation pathways. Biochemical Pharmacology, 60(8), 1075-1083. doi:S0006-2952(00)00371-3 [pii] Shi, Y., & Hu, F. B. (2014). The global implications of diabetes and cancer. Lancet (London, England), 383(9933), 1947-1948. doi:10.1016/S0140-6736(14)60886-2 [doi] Shibayama, Y., Ushinohama, K., Ikeda, R., Yoshikawa, Y., Motoya, T., Takeda, Y., & Yamada, K. (2006). Effect of methotrexate treatment on expression levels of multidrug resistance protein 2, breast cancer resistance protein and organic anion transporters Oat1, Oat2 and Oat3 in rats. Cancer Science, 97(11), 1260-1266. doi:CAS304 [pii] Sladek, R., Rocheleau, G., Rung, J., Dina, C., Shen, L., Serre, D., . . . Froguel, P. (2007). A genome-wide association study identifies novel risk loci for type 2 diabetes. Nature, 445(7130), 881-885. doi:nature05616 [pii] Sonksen, P., & Sonksen, J. (2000). Insulin: Understanding its action in health and disease. British Journal of Anaesthesia, 85(1), 69-79. Spiteller, G. (2005). Furan fatty acids: Occurrence, synthesis, and reactions. are furan fatty acids responsible for the cardioprotective effects of a fish diet? Lipids, 40(8), 755-771. Svoboda, M., Riha, J., Wlcek, K., Jaeger, W., & Thalhammer, T. (2011). Organic anion transporting polypeptides (OATPs): Regulation of expression and function. Current Drug Metabolism, 12(2), 139-153. doi:BSP/CDM/E-Pub/000124 [pii] Sweet, D. H., Wolff, N. A., & Pritchard, J. B. (1997). Expression cloning and characterization of ROAT1. the basolateral organic anion transporter in rat kidney. The Journal of Biological Chemistry, 272(48), 30088- 30095. Tahara, H., Shono, M., Kusuhara, H., Kinoshita, H., Fuse, E., Takadate, A., . . . Sugiyama, Y. (2005). Molecular cloning and functional analyses of OAT1 and OAT3 from cynomolgus monkey kidney. Pharmaceutical Research,22(4), 647-660. doi:10.1007/s11095-005-2503-0 [doi] Takeda, M., Khamdang, S., Narikawa, S., Kimura, H., Hosoyamada, M., Cha, S. H., . . . Endou, H. (2002). Characterization of methotrexate transport and its drug interactions with human organic anion transporters. The Journal of Pharmacology and Experimental Therapeutics, 302(2), 666-671. doi:10.1124/jpet.102.034330 [doi] Ullrich, K. J. (1997). Renal transporters for organic anions and organic cations. structural requirements for substrates. The Journal of Membrane Biology, 158(2), 95-107. Ullrich, K. J. (1999). Affinity of drugs to the different renal transporters for organic anions and organic cations. Pharmaceutical Biotechnology, 12, 159-179. van Belle, T. L., Coppieters, K. T., & von Herrath, M. G. (2011). Type 1 diabetes: Etiology, immunology, and therapeutic strategies. Physiological Reviews, 91(1), 79-118. doi:10.1152/physrev.00003.2010 [doi]

Vanwert, A. L., Bailey, R. M., & Sweet, D. H. (2007). Organic anion transporter 3 (Oat3/Slc22a8) knockout mice exhibit altered clearance and distribution of penicillin G. American Journal of Physiology.Renal Physiology,293(4), F1332-41. doi:00319.2007 [pii] Weir, G. C., & Bonner-Weir, S. (2004). Five stages of evolving beta-cell dysfunction during progression to diabetes. Diabetes, 53 Suppl 3, S16-21. doi:53/suppl_3/S16 [pii] Wiseman, D. A., Kalwat, M. A., & Thurmond, D. C. (2011). Stimulus-induced S-nitrosylation of syntaxin 4 impacts insulin granule exocytosis. The Journal of Biological Chemistry, 286(18), 16344-16354. doi:10.1074/jbc.M110.214031 [doi] Wolff, N. A., Grunwald, B., Friedrich, B., Lang, F., Godehardt, S., & Burckhardt, G. (2001). Cationic amino acids involved in dicarboxylate binding of the flounder renal organic anion transporter. Journal of the American Society of Nephrology : JASN, 12(10), 2012-2018. Wright, S. H., & Dantzler, W. H. (2004). Molecular and cellular physiology of renal organic cation and anion transport. Physiological Reviews, 84(3), 987-1049. doi:10.1152/physrev.00040.2003 [doi] Wu, W., Jamshidi, N., Eraly, S. A., Liu, H. C., Bush, K. T., Palsson, B. O., & Nigam, S. K. (2013). Multispecific drug transporter Slc22a8 (Oat3) regulates multiple metabolic and signaling pathways. Drug Metabolism and Disposition: The Biological Fate of Chemicals, 41(10), 1825-1834. doi:10.1124/dmd.113.052647 [doi] Yan, S. F., D'Agati, V., Schmidt, A. M., & Ramasamy, R. (2007). Receptor for advanced glycation endproducts (RAGE): A formidable force in the pathogenesis of the cardiovascular complications of diabetes & aging. Current Molecular Medicine, 7(8), 699-710. Youngblood, G. L., & Sweet, D. H. (2004). Identification and functional assessment of the novel murine organic anion transporter Oat5 (Slc22a19) expressed in kidney. American Journal of Physiology.Renal Physiology,287(2), F236-44. doi:10.1152/ajprenal.00012.2004 [doi] Zhang, X., Groves, C. E., Bahn, A., Barendt, W. M., Prado, M. D., Rodiger, M., . . . Wright, S. H. (2004). Relative contribution of OAT and OCT transporters to organic electrolyte transport in rabbit proximal tubule. American Journal of Physiology.Renal Physiology, 287(5), F999-1010. doi:10.1152/ajprenal.00156.2004 [doi]