DOCSLIB.ORG

Oncogenic Inhibition by a Deleted in Liver Cancer Gene Requires Cooperation Between Tensin Binding and Rho-Specific Gtpase-Activating Protein Activities

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Oncogenic Inhibition by a Deleted in Liver Cancer Gene Requires Cooperation Between Tensin Binding and Rho-Specific Gtpase-Activating Protein Activities Oncogenic inhibition by a deleted in liver cancer gene requires cooperation between tensin binding and Rho-specific GTPase-activating protein activities Xiaolan Qian*, Guorong Li*, Holly K. Asmussen*, Laura Asnaghi*, William C. Vass*, Richard Braverman*, Kenneth M. Yamada†, Nicholas C. Popescu‡, Alex G. Papageorge*, and Douglas R. Lowy*§ *Laboratory of Cellular Oncology and ‡Laboratory of Experimental Carcinogenesis, Center for Cancer Research, National Cancer Institute, National Institutes of Health, Bethesda, MD 20892; and †Laboratory of Cell and Developmental Biology, National Institute of Dental and Craniofacial Research, National Institutes of Health, Bethesda, MD 20892 Communicated by Ira Pastan, National Institutes of Health, Bethesda, MD, April 2, 2007 (received for review March 1, 2007) The three deleted in liver cancer genes (DLC1–3) encode Rho- The prototypic member, designated DLC1, is localized to GTPase-activating proteins (RhoGAPs) whose expression is fre- chromosome 8p21–22 in a region that is commonly deleted in quently down-regulated or silenced in a variety of human malig- hepatocellular carcinoma (5). Its expression is frequently down- nancies. The RhoGAP activity is required for full DLC-dependent regulated or silenced in various solid tumors and hematologic tumor suppressor activity. Here we report that DLC1 and DLC3 bind malignancies, predominantly by promoter methylation (6–13). to human tensin1 and its chicken homolog. The binding has been Ectopic reexpression in DLC1-deficient cancer cell lines can mapped to the tensin Src homology 2 (SH2) and phosphotyrosine suppress cell proliferation, induce apoptosis, and reduce tumor- binding (PTB) domains at the C terminus of tensin proteins. Distinct igenicity. The RhoGAP activity appears to be required for these DLC1 sequences are required for SH2 and PTB binding. DCL binding antioncogenic activities because RhoGAP-deficient mutants to both domains is constitutive under basal conditions. The SH2 have reduced biological activity. The DLC1 protein is reported binding depends on a tyrosine in DCL1 (Y442) but is phosphoty- to have a peripheral cellular location, and the rat homolog has rosine-independent, a highly unusual feature for SH2 binding. been localized to caveolae and focal adhesions (6, 14, 15). DLC1 competed with the binding of other proteins to the tensin C There are two other closely related genes, DLC2 (or terminus, including ␤3-integrin binding to the PTB domain. Point STARD13), located on chromosome 13q12 (16), and DLC3 (or mutation of a critical tyrosine residue (Y442F) in DLC1 rendered the KIAA0189 or STARD8), located on the X chromosome at q13 protein deficient for binding the tensin SH2 domain and binding (17). They have been less intensively examined, but their ex- full-length tensin. The Y442F protein was diffusely cytoplasmic, in pression is also down-regulated in a spectrum of tumors (11, 17). contrast to the localization of wild-type DLC1 to focal adhesions, All three DLC genes encode proteins that are Ϸ1,100 aa, with but it retained the ability to reduce the intracellular levels of three recognized motifs: (i) a sterile ␣ motif (SAM; other SAM Rho-GTP. The Y442F mutant displayed markedly reduced biological motifs are often implicated in protein–protein interactions), (ii) activity, as did a mutant that was RhoGAP-deficient. The results a RhoGAP catalytic domain, and (iii) a START (STAR-related suggest that DLC1 is a multifunctional protein whose biological lipid transfer) domain. Other START motifs are implicated in activity depends on cooperation between its tensin binding and the association with lipid-rich molecules. RhoGAP activities, although neither activity depends on the other. Although these studies establish the DLC family as tumor suppressor genes, there is relatively little insight into their DLC1 ͉ Src homology 2 and phosphotyrosine binding domains ͉ mechanism of action beyond the requirement for the RapGAP tumor suppressor gene activity. It seems unlikely that this activity by itself accounts for the frequent inactivation of DLC members in tumors because t is widely recognized that a combination of genetic and other RhoGAPs do not appear to be commonly down-regulated Iepigenetic changes in the target cell contribute to cancer in tumors. Furthermore, the three recognized motifs in DLC, development (1). These changes may include the activation of namely, SAM, RhoGAP, and START, together account for Ϸ oncogenes or antiapoptotic genes and the inactivation of tumor 500 of the 1,100 aa, which suggests that other putative key suppressor or proapoptotic genes. One feature of many advanced functions may be carried out by these uncharacterized regions. tumors is the activation of the Rho-GTPases RhoA and RhoC. To examine this possibility, we have carried out a yeast two- These small GTPases, which are Ras-related proteins, may hybrid screen with sequences located between the SAM and contribute to various parameters of abnormal cell growth, RhoGAP domains. One interacting protein identified in this including viability, migration, invasion, proliferation, and an- screen was tensin1, which is a peripheral protein implicated in chorage-independent growth (2–4). Although point mutation in Ras genes frequently accounts for their activation in cancer, such Author contributions: X.Q. and G.L. contributed equally to this work; X.Q., K.M.Y., N.C.P., mutations have not been reported for RhoA and RhoC, which A.G.P., and D.R.L. designed research; X.Q., G.L., H.K.A., L.A., and W.C.V. performed re- appear to be wild type in cancer. As with most other small search; X.Q., G.L., H.K.A., and R.B. contributed new reagents/analytic tools; X.Q., G.L., GTPases, the Rho-GTPases are active when bound to GTP and K.M.Y., and D.R.L. analyzed data; and X.Q. and D.R.L. wrote the paper. inactive when bound to GDP. They can be activated by stimu- The authors declare no conflict of interest. lation of Rho-specific guanine nucleotide exchange factors, Freely available online through the PNAS open access option. which increase the level of Rho-GTP and reduce the level of Abbreviations: SH2, Src homology 2; pY, phosphotyrosine; PTB, pY binding; RhoGAP, Rho-GDP, or inactivated by Rho-specific GTPase-activating Rho-specific GTPase-activating protein; FL, full-length; LPA, lysophosphatidic acid; SAM, ␣ proteins (RhoGAPs), which reduce the level of Rho-GTP and sterile motif; DLC, deleted in liver cancer. §To whom correspondence should be addressed at: Laboratory of Cellular Oncology, increase the level of Rho-GDP. By far the most common National Cancer Institute, National Institutes of Health, Building 37, Room 4106, alteration reported for Rho regulators in cancer is the inactiva- Bethesda, MD 20892. E-mail: [email protected]. tion of RhoGAPs that are members of the deleted in liver cancer This article contains supporting information online at www.pnas.org/cgi/content/full/ (DLC) family. 0703033104/DC1. 9012–9017 ͉ PNAS ͉ May 22, 2007 ͉ vol. 104 ͉ no. 21 www.pnas.org͞cgi͞doi͞10.1073͞pnas.0703033104 Downloaded by guest on September 25, 2021 those lacking amino acids 468–476 or 476–490 had binding activity similar to wild-type DLC1 (SI Fig. 8A). SH2 and PTB domains are docking sites for protein–protein interaction (19, 20). Although PTB stands for phosphotyrosine (pY) binding, many PTB domains can bind their ligands in a pY-independent manner, and the PTB domain in tensin is phylogenetically grouped with this latter class of PTB domains (20). By contrast, almost all SH2 domains require pY (19). We therefore initially assumed that the PTB domain of tensin would be primarily responsible for the interaction with DLC1 because the binding to tensin appeared to be pY-independent, given the positive yeast two-hybrid results, where pY is low, and data showing that DLC1 efficiently bound the tensin SH2-PTB region in nontransformed mammalian cells, bound with similar effi- ciently in v-Src-transformed cells, and did not contain detectable levels of pY even in v-Src-transformed cells (SI Fig. 9). However, when we analyzed DLC1 binding to premature termination mutants of the C-terminal tensin fragment that includes both domains, we unexpectedly found that a mutant Fig. 1. DLC1 and tensin form a complex in mammalian cells. (A) DLC1 was containing the tensin SH2 domain but lacking the PTB domain cotransfected with GFP or GFP-tensin into 293 cells, and specifically detected bound DLC1 with an efficiency that was only partially reduced DLC1 was coimmunoprecipitated in the anti-GFP immunopellet (Left). Recip- compared with the starting fragment that contained both do- rocally, GFP-tensin transfected into H1299 cells was specifically detected by coimmunoprecipitation of endogenous DLC1 with a DLC1 antibody (Right). mains (data not shown). We therefore inferred that DLC1 (B) Extracts from mel 1011 cells, which contain endogenous DLC1 and tensin, predominantly binds the SH2 domain, while the reduced binding were immunoprecipitated with control IgG or a tensin antibody. Coprecipi- suggested that DLC1 might also bind the PTB domain. To verify tated DLC1 was detected by a DLC1 antibody (Upper). The blot was reprobed these possibilities directly, we constructed plasmids encoding with the tensin antibody (Lower). isolated tensin-SH2 and tensin-PTB domains, fused to GST (Fig. 2B), and determined that both were bound FL DLC1 and DLC3 (Fig. 2A). The SH2 domain also bound endogenous DLC1 in several biological processes, including cell migration. Here we H1299 cells (Fig. 2C). Furthermore, the DLC1 sequences that demonstrate that this interaction is biologically significant and bind the tensin PTB domain are located N terminal to those show that two distinct regions of DLC1 bind two distinct domains required for binding the tensin SH2 domain because a DLC1 of tensin. fragment composed of amino acids 1–400 bound the PTB domain as efficiently as FL DLC1 but did not bind the SH2 Results domain (SI Fig.
Load more

Recommended publications
  • Downloaded from [266]
    Patterns of DNA methylation on the human X chromosome and use in analyzing X-chromosome inactivation by Allison Marie Cotton B.Sc., The University of Guelph, 2005 A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY in The Faculty of Graduate Studies (Medical Genetics) THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver) January 2012 © Allison Marie Cotton, 2012 Abstract The process of X-chromosome inactivation achieves dosage compensation between mammalian males and females. In females one X chromosome is transcriptionally silenced through a variety of epigenetic modifications including DNA methylation. Most X-linked genes are subject to X-chromosome inactivation and only expressed from the active X chromosome. On the inactive X chromosome, the CpG island promoters of genes subject to X-chromosome inactivation are methylated in their promoter regions, while genes which escape from X- chromosome inactivation have unmethylated CpG island promoters on both the active and inactive X chromosomes. The first objective of this thesis was to determine if the DNA methylation of CpG island promoters could be used to accurately predict X chromosome inactivation status. The second objective was to use DNA methylation to predict X-chromosome inactivation status in a variety of tissues. A comparison of blood, muscle, kidney and neural tissues revealed tissue-specific X-chromosome inactivation, in which 12% of genes escaped from X-chromosome inactivation in some, but not all, tissues. X-linked DNA methylation analysis of placental tissues predicted four times higher escape from X-chromosome inactivation than in any other tissue. Despite the hypomethylation of repetitive elements on both the X chromosome and the autosomes, no changes were detected in the frequency or intensity of placental Cot-1 holes.
    [Show full text]
  • Contributions of the Renin Angiotensin System to Fear Memory and Fear Conditioned Cardiovascular Responses
    Contributions of the Renin Angiotensin System to Fear Memory and Fear Conditioned Cardiovascular Responses by Adam Swiercz B.S. in Biology, May 2006, The George Washington University M.P.S. in Molecular Biotechnology, May 2009, The George Washington University M.S. in Physiology, May 2011, Georgetown University A Dissertation submitted to The Faculty of The Columbian College of Arts & Sciences of The George Washington University in partial fulfillment of the requirements for the degree of Doctor of Philosophy January 10, 2020 Dissertation co-directed by Paul J. Marvar Associate Professor of Pharmacology and Physiology and David Mendelowitz Professor of Pharmacology & Physiology The Columbian College of Arts and Sciences of The George Washington University certifies that Adam Swiercz has passed the Final Examination for the degree of Doctor of Philosophy as of October 2nd, 2019. This is the final and approved form of the dissertation. Contributions of the Renin Angiotensin System to Fear Memory and Fear Conditioned Cardiovascular Responses Adam Swiercz Dissertation Research Committee: Paul J. Marvar, Associate Professor of Pharmacology & Physiology, Dissertation Co-Director David Mendelowitz, Professor of Pharmacology & Physiology, Dissertation Co-Director Abigail Polter, Assistant Professor of Pharmacology & Physiology, Committee Member Colin Young, Assistant Professor of Pharmacology & Physiology, Committee Member ii © Copyright 2020 by Adam Swiercz All rights reserved iii Acknowledgements I would like to thank and acknowledge Dr. Paul Marvar, whose mentorship has made this dissertation possible. It has been a pleasure working in your lab, and I am truly grateful for your support and encouragement throughout the years. Thanks to the current and former members of the Marvar lab who have made my time at GW a rewarding and enjoyable experience.
    [Show full text]
  • Transcriptomic and Proteomic Profiling Provides Insight Into
    BASIC RESEARCH www.jasn.org Transcriptomic and Proteomic Profiling Provides Insight into Mesangial Cell Function in IgA Nephropathy † † ‡ Peidi Liu,* Emelie Lassén,* Viji Nair, Celine C. Berthier, Miyuki Suguro, Carina Sihlbom,§ † | † Matthias Kretzler, Christer Betsholtz, ¶ Börje Haraldsson,* Wenjun Ju, Kerstin Ebefors,* and Jenny Nyström* *Department of Physiology, Institute of Neuroscience and Physiology, §Proteomics Core Facility at University of Gothenburg, University of Gothenburg, Gothenburg, Sweden; †Division of Nephrology, Department of Internal Medicine and Department of Computational Medicine and Bioinformatics, University of Michigan, Ann Arbor, Michigan; ‡Division of Molecular Medicine, Aichi Cancer Center Research Institute, Nagoya, Japan; |Department of Immunology, Genetics and Pathology, Uppsala University, Uppsala, Sweden; and ¶Integrated Cardio Metabolic Centre, Karolinska Institutet Novum, Huddinge, Sweden ABSTRACT IgA nephropathy (IgAN), the most common GN worldwide, is characterized by circulating galactose-deficient IgA (gd-IgA) that forms immune complexes. The immune complexes are deposited in the glomerular mesangium, leading to inflammation and loss of renal function, but the complete pathophysiology of the disease is not understood. Using an integrated global transcriptomic and proteomic profiling approach, we investigated the role of the mesangium in the onset and progression of IgAN. Global gene expression was investigated by microarray analysis of the glomerular compartment of renal biopsy specimens from patients with IgAN (n=19) and controls (n=22). Using curated glomerular cell type–specific genes from the published literature, we found differential expression of a much higher percentage of mesangial cell–positive standard genes than podocyte-positive standard genes in IgAN. Principal coordinate analysis of expression data revealed clear separation of patient and control samples on the basis of mesangial but not podocyte cell–positive standard genes.
    [Show full text]
  • Genetic Alterations of Protein Tyrosine Phosphatases in Human Cancers
    Oncogene (2015) 34, 3885–3894 © 2015 Macmillan Publishers Limited All rights reserved 0950-9232/15 www.nature.com/onc REVIEW Genetic alterations of protein tyrosine phosphatases in human cancers S Zhao1,2,3, D Sedwick3,4 and Z Wang2,3 Protein tyrosine phosphatases (PTPs) are enzymes that remove phosphate from tyrosine residues in proteins. Recent whole-exome sequencing of human cancer genomes reveals that many PTPs are frequently mutated in a variety of cancers. Among these mutated PTPs, PTP receptor T (PTPRT) appears to be the most frequently mutated PTP in human cancers. Beside PTPN11, which functions as an oncogene in leukemia, genetic and functional studies indicate that most of mutant PTPs are tumor suppressor genes. Identification of the substrates and corresponding kinases of the mutant PTPs may provide novel therapeutic targets for cancers harboring these mutant PTPs. Oncogene (2015) 34, 3885–3894; doi:10.1038/onc.2014.326; published online 29 September 2014 INTRODUCTION tyrosine/threonine-specific phosphatases. (4) Class IV PTPs include Protein tyrosine phosphorylation has a critical role in virtually all four Drosophila Eya homologs (Eya1, Eya2, Eya3 and Eya4), which human cellular processes that are involved in oncogenesis.1 can dephosphorylate both tyrosine and serine residues. Protein tyrosine phosphorylation is coordinately regulated by protein tyrosine kinases (PTKs) and protein tyrosine phosphatases 1 THE THREE-DIMENSIONAL STRUCTURE AND CATALYTIC (PTPs). Although PTKs add phosphate to tyrosine residues in MECHANISM OF PTPS proteins, PTPs remove it. Many PTKs are well-documented oncogenes.1 Recent cancer genomic studies provided compelling The three-dimensional structures of the catalytic domains of evidence that many PTPs function as tumor suppressor genes, classical PTPs (RPTPs and non-RPTPs) are extremely well because a majority of PTP mutations that have been identified in conserved.5 Even the catalytic domain structures of the dual- human cancers are loss-of-function mutations.
    [Show full text]
  • In This Table Protein Name, Uniprot Code, Gene Name P-Value
    Supplementary Table S1: In this table protein name, uniprot code, gene name p-value and Fold change (FC) for each comparison are shown, for 299 of the 301 significantly regulated proteins found in both comparisons (p-value<0.01, fold change (FC) >+/-0.37) ALS versus control and FTLD-U versus control. Two uncharacterized proteins have been excluded from this list Protein name Uniprot Gene name p value FC FTLD-U p value FC ALS FTLD-U ALS Cytochrome b-c1 complex P14927 UQCRB 1.534E-03 -1.591E+00 6.005E-04 -1.639E+00 subunit 7 NADH dehydrogenase O95182 NDUFA7 4.127E-04 -9.471E-01 3.467E-05 -1.643E+00 [ubiquinone] 1 alpha subcomplex subunit 7 NADH dehydrogenase O43678 NDUFA2 3.230E-04 -9.145E-01 2.113E-04 -1.450E+00 [ubiquinone] 1 alpha subcomplex subunit 2 NADH dehydrogenase O43920 NDUFS5 1.769E-04 -8.829E-01 3.235E-05 -1.007E+00 [ubiquinone] iron-sulfur protein 5 ARF GTPase-activating A0A0C4DGN6 GIT1 1.306E-03 -8.810E-01 1.115E-03 -7.228E-01 protein GIT1 Methylglutaconyl-CoA Q13825 AUH 6.097E-04 -7.666E-01 5.619E-06 -1.178E+00 hydratase, mitochondrial ADP/ATP translocase 1 P12235 SLC25A4 6.068E-03 -6.095E-01 3.595E-04 -1.011E+00 MIC J3QTA6 CHCHD6 1.090E-04 -5.913E-01 2.124E-03 -5.948E-01 MIC J3QTA6 CHCHD6 1.090E-04 -5.913E-01 2.124E-03 -5.948E-01 Protein kinase C and casein Q9BY11 PACSIN1 3.837E-03 -5.863E-01 3.680E-06 -1.824E+00 kinase substrate in neurons protein 1 Tubulin polymerization- O94811 TPPP 6.466E-03 -5.755E-01 6.943E-06 -1.169E+00 promoting protein MIC C9JRZ6 CHCHD3 2.912E-02 -6.187E-01 2.195E-03 -9.781E-01 Mitochondrial 2-
    [Show full text]
  • WO 2012/174282 A2 20 December 2012 (20.12.2012) P O P C T
    (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (10) International Publication Number (43) International Publication Date WO 2012/174282 A2 20 December 2012 (20.12.2012) P O P C T (51) International Patent Classification: David [US/US]; 13539 N . 95th Way, Scottsdale, AZ C12Q 1/68 (2006.01) 85260 (US). (21) International Application Number: (74) Agent: AKHAVAN, Ramin; Caris Science, Inc., 6655 N . PCT/US20 12/0425 19 Macarthur Blvd., Irving, TX 75039 (US). (22) International Filing Date: (81) Designated States (unless otherwise indicated, for every 14 June 2012 (14.06.2012) kind of national protection available): AE, AG, AL, AM, AO, AT, AU, AZ, BA, BB, BG, BH, BR, BW, BY, BZ, English (25) Filing Language: CA, CH, CL, CN, CO, CR, CU, CZ, DE, DK, DM, DO, Publication Language: English DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, HN, HR, HU, ID, IL, IN, IS, JP, KE, KG, KM, KN, KP, KR, (30) Priority Data: KZ, LA, LC, LK, LR, LS, LT, LU, LY, MA, MD, ME, 61/497,895 16 June 201 1 (16.06.201 1) US MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, 61/499,138 20 June 201 1 (20.06.201 1) US OM, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SC, SD, 61/501,680 27 June 201 1 (27.06.201 1) u s SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, TN, TR, 61/506,019 8 July 201 1(08.07.201 1) u s TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW.
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name tensin 1 Gene Symbol TNS1 Organism Human Gene Summary The protein encoded by this gene localizes to focal adhesions regions of the plasma membrane where the cell attaches to the extracellular matrix. This protein crosslinks actin filaments and contains a Src homology 2 (SH2) domain which is often found in molecules involved in signal transduction. This protein is a substrate of calpain II. A second transcript from this gene has been described but its full length nature has not been determined. Gene Aliases DKFZp586K0617, MGC88584, MST091, MST122, MST127, MSTP122, MSTP127, MXRA6, TNS RefSeq Accession No. NC_000002.11, NT_005403.17 UniGene ID Hs.471381 Ensembl Gene ID ENSG00000079308 Entrez Gene ID 7145 Assay Information Unique Assay ID qHsaCED0056481 Assay Type SYBR® Green Detected Coding Transcript(s) ENST00000171887, ENST00000446688 Amplicon Context Sequence GGCAGAGCAGCAAGACTCAATCCCCAGCCCCCAAAAAGGCATCATGCAGGTAA GCAGGTCTGAGATAAGGCTGGTCCAGGGGCATGAAACCCAATAACAAGGCTGA G Amplicon Length (bp) 77 Chromosome Location 2:218668016-218668122 Assay Design Exonic Purification Desalted Validation Results Efficiency (%) 109 R2 0.9936 cDNA Cq 23.48 cDNA Tm (Celsius) 83 Page 1/5 PrimePCR™Assay Validation Report gDNA Cq 25.01 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 2/5 PrimePCR™Assay Validation Report TNS1, Human Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis
    [Show full text]
  • Males Mosaic for Mutations in the X-Linked EFNB1 Gene Are More Severely Affected Than True Hemizygotes
    Cellular Interference in Craniofrontonasal Syndrome: Males Mosaic for Mutations in the X-Linked EFNB1 Gene Are More Severely Affected than True Hemizygotes The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters Citation Twigg, Stephen R. F., Christian Babbs, Marijke E. P. van den Elzen, Anne Goriely, Stephen Taylor, Simon J. McGowan, Eleni Giannoulatou, et al. 2013. Cellular interference in craniofrontonasal syndrome: Males mosaic for mutations in the X-linked EFNB1 gene are more severely affected than true hemizygotes. Human Molecular Genetics 22(8): 1654-1662. Published Version doi:10.1093/hmg/ddt015 Citable link http://nrs.harvard.edu/urn-3:HUL.InstRepos:10622989 Terms of Use This article was downloaded from Harvard University’s DASH repository, and is made available under the terms and conditions applicable to Other Posted Material, as set forth at http:// nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of- use#LAA Human Molecular Genetics, 2013, Vol. 22, No. 8 1654–1662 doi:10.1093/hmg/ddt015 Advance Access published on January 17, 2013 Cellular interference in craniofrontonasal syndrome: males mosaic for mutations in the X-linked EFNB1 gene are more severely affected than true hemizygotes Stephen R.F. Twigg1, Christian Babbs1, Marijke E.P. van den Elzen3, Anne Goriely1, Stephen Taylor2, Simon J. McGowan2, Eleni Giannoulatou1,2, Lorne Lonie5, Jiannis Ragoussis5, Elham Sadighi Akha6, Samantha J.L. Knight6, Roseli M. Zechi-Ceide7, Jeannette A.M. Hoogeboom4, Barbara R. Pober8, Helga V. Toriello9, Steven A. Wall10, M. Rita Passos-Bueno11, Han G. Brunner12, Irene M.J.
    [Show full text]
  • Nº Ref Uniprot Proteína Péptidos Identificados Por MS/MS 1 P01024
    Document downloaded from http://www.elsevier.es, day 26/09/2021. This copy is for personal use. Any transmission of this document by any media or format is strictly prohibited. Nº Ref Uniprot Proteína Péptidos identificados 1 P01024 CO3_HUMAN Complement C3 OS=Homo sapiens GN=C3 PE=1 SV=2 por 162MS/MS 2 P02751 FINC_HUMAN Fibronectin OS=Homo sapiens GN=FN1 PE=1 SV=4 131 3 P01023 A2MG_HUMAN Alpha-2-macroglobulin OS=Homo sapiens GN=A2M PE=1 SV=3 128 4 P0C0L4 CO4A_HUMAN Complement C4-A OS=Homo sapiens GN=C4A PE=1 SV=1 95 5 P04275 VWF_HUMAN von Willebrand factor OS=Homo sapiens GN=VWF PE=1 SV=4 81 6 P02675 FIBB_HUMAN Fibrinogen beta chain OS=Homo sapiens GN=FGB PE=1 SV=2 78 7 P01031 CO5_HUMAN Complement C5 OS=Homo sapiens GN=C5 PE=1 SV=4 66 8 P02768 ALBU_HUMAN Serum albumin OS=Homo sapiens GN=ALB PE=1 SV=2 66 9 P00450 CERU_HUMAN Ceruloplasmin OS=Homo sapiens GN=CP PE=1 SV=1 64 10 P02671 FIBA_HUMAN Fibrinogen alpha chain OS=Homo sapiens GN=FGA PE=1 SV=2 58 11 P08603 CFAH_HUMAN Complement factor H OS=Homo sapiens GN=CFH PE=1 SV=4 56 12 P02787 TRFE_HUMAN Serotransferrin OS=Homo sapiens GN=TF PE=1 SV=3 54 13 P00747 PLMN_HUMAN Plasminogen OS=Homo sapiens GN=PLG PE=1 SV=2 48 14 P02679 FIBG_HUMAN Fibrinogen gamma chain OS=Homo sapiens GN=FGG PE=1 SV=3 47 15 P01871 IGHM_HUMAN Ig mu chain C region OS=Homo sapiens GN=IGHM PE=1 SV=3 41 16 P04003 C4BPA_HUMAN C4b-binding protein alpha chain OS=Homo sapiens GN=C4BPA PE=1 SV=2 37 17 Q9Y6R7 FCGBP_HUMAN IgGFc-binding protein OS=Homo sapiens GN=FCGBP PE=1 SV=3 30 18 O43866 CD5L_HUMAN CD5 antigen-like OS=Homo
    [Show full text]
  • Discovery and Systematic Characterization of Risk Variants and Genes For
    medRxiv preprint doi: https://doi.org/10.1101/2021.05.24.21257377; this version posted June 2, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. It is made available under a CC-BY 4.0 International license . 1 Discovery and systematic characterization of risk variants and genes for 2 coronary artery disease in over a million participants 3 4 Krishna G Aragam1,2,3,4*, Tao Jiang5*, Anuj Goel6,7*, Stavroula Kanoni8*, Brooke N Wolford9*, 5 Elle M Weeks4, Minxian Wang3,4, George Hindy10, Wei Zhou4,11,12,9, Christopher Grace6,7, 6 Carolina Roselli3, Nicholas A Marston13, Frederick K Kamanu13, Ida Surakka14, Loreto Muñoz 7 Venegas15,16, Paul Sherliker17, Satoshi Koyama18, Kazuyoshi Ishigaki19, Bjørn O Åsvold20,21,22, 8 Michael R Brown23, Ben Brumpton20,21, Paul S de Vries23, Olga Giannakopoulou8, Panagiota 9 Giardoglou24, Daniel F Gudbjartsson25,26, Ulrich Güldener27, Syed M. Ijlal Haider15, Anna 10 Helgadottir25, Maysson Ibrahim28, Adnan Kastrati27,29, Thorsten Kessler27,29, Ling Li27, Lijiang 11 Ma30,31, Thomas Meitinger32,33,29, Sören Mucha15, Matthias Munz15, Federico Murgia28, Jonas B 12 Nielsen34,20, Markus M Nöthen35, Shichao Pang27, Tobias Reinberger15, Gudmar Thorleifsson25, 13 Moritz von Scheidt27,29, Jacob K Ulirsch4,11,36, EPIC-CVD Consortium, Biobank Japan, David O 14 Arnar25,37,38, Deepak S Atri39,3, Noël P Burtt4, Maria C Costanzo4, Jason Flannick40, Rajat M 15 Gupta39,3,4, Kaoru Ito18, Dong-Keun Jang4,
    [Show full text]
  • Egfr Activates a Taz-Driven Oncogenic Program in Glioblastoma
    EGFR ACTIVATES A TAZ-DRIVEN ONCOGENIC PROGRAM IN GLIOBLASTOMA by Minling Gao A thesis submitted to Johns Hopkins University in conformity with the requirements for the degree of Doctor of Philosophy Baltimore, Maryland March 2020 ©2020 Minling Gao All rights reserved Abstract Hyperactivated EGFR signaling is associated with about 45% of Glioblastoma (GBM), the most aggressive and lethal primary brain tumor in humans. However, the oncogenic transcriptional events driven by EGFR are still incompletely understood. We studied the role of the transcription factor TAZ to better understand master transcriptional regulators in mediating the EGFR signaling pathway in GBM. The transcriptional coactivator with PDZ- binding motif (TAZ) and its paralog gene, the Yes-associated protein (YAP) are two transcriptional co-activators that play important roles in multiple cancer types and are regulated in a context-dependent manner by various upstream signaling pathways, e.g. the Hippo, WNT and GPCR signaling. In GBM cells, TAZ functions as an oncogene that drives mesenchymal transition and radioresistance. This thesis intends to broaden our understanding of EGFR signaling and TAZ regulation in GBM. In patient-derived GBM cell models, EGF induced TAZ and its known gene targets through EGFR and downstream tyrosine kinases (ERK1/2 and STAT3). In GBM cells with EGFRvIII, an EGF-independent and constitutively active mutation, TAZ showed EGF- independent hyperactivation when compared to EGFRvIII-negative cells. These results revealed a novel EGFR-TAZ signaling axis in GBM cells. The second contribution of this thesis is that we performed next-generation sequencing to establish the first genome-wide map of EGF-induced TAZ target genes.
    [Show full text]
  • Circrna Circ 102049 Implicates in Pancreatic Ductal Adenocarcinoma Progression Through Activating CD80 by Targeting Mir-455-3P
    Hindawi Mediators of Inflammation Volume 2021, Article ID 8819990, 30 pages https://doi.org/10.1155/2021/8819990 Research Article circRNA circ_102049 Implicates in Pancreatic Ductal Adenocarcinoma Progression through Activating CD80 by Targeting miR-455-3p Jie Zhu,1 Yong Zhou,1 Shanshan Zhu,1 Fei Li,1 Jiajia Xu,1 Liming Zhang,1 and Hairong Shu 2 1Medical Laboratory, Taizhou Central Hospital (Taizhou University Hospital), Taizhou, Zhejiang, China 2Department of Medical Service, Taizhou Central Hospital (Taizhou University Hospital), Taizhou, Zhejiang, China Correspondence should be addressed to Hairong Shu; [email protected] Received 30 September 2020; Revised 27 November 2020; Accepted 13 December 2020; Published 7 January 2021 Academic Editor: Xiaolu Jin Copyright © 2021 Jie Zhu et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Emerging evidence has shown that circular RNAs (circRNAs) and DNA methylation play important roles in the causation and progression of cancers. However, the roles of circRNAs and abnormal methylation genes in the tumorigenesis of pancreatic ductal adenocarcinoma (PDAC) are still largely unknown. Expression profiles of circRNA, gene methylation, and mRNA were downloaded from the GEO database, and differentially expressed genes were obtained via GEO2R, and a ceRNA network was constructed based on circRNA-miRNA pairs and miRNA-mRNA pairs. Inflammation-associated genes were collected from the GeneCards database. Then, functional enrichment analysis and protein-protein interaction (PPI) networks of inflammation- associated methylated expressed genes were investigated using Metascape and STRING databases, respectively, and visualized in Cytoscape.
    [Show full text]