DOCSLIB.ORG

Impact of the Transcription Factor Hoxa9 on Toll-Like Receptor-Mediated Innate Immune Responses and Development of Dendritic Cells and Macrophages

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Impact of the Transcription Factor Hoxa9 on Toll-Like Receptor-Mediated Innate Immune Responses and Development of Dendritic Cells and Macrophages From the Institut for Immunology Center for Infection, Inflammation, and Immunity Executive Director: Prof. Dr. Stefan Bauer of the Faculty of Medicine of the Philipps-Universität Marburg Impact of the Transcription Factor HoxA9 on Toll-like Receptor-Mediated Innate Immune Responses and Development of Dendritic Cells and Macrophages Inaugural-Dissertation For the Degree Doctor of Medicine Submitted to the Faculty of Medicine of the Philipps-Universität Marburg by Tobias Mischa Bleyl from Erlabrunn Marburg, 2018 Aus dem Institut für Immunologie Zentrum für Infektion, Entzündung und Immunität Geschäftsführender Direktor: Prof. Dr. Stefan Bauer des Fachbereichs Medizin der Philipps-Universität Marburg Einfluss des Transkriptionsfaktors HoxA9 auf Toll-like Rezeptor-vermittelte Reaktionen des angeborenen Immunsystems und die Entwicklung von dendritischen Zellen und Makrophagen Inaugural-Dissertation zur Erlangung des Doktorgrades der Humanmedizin dem Fachbereich Medizin der Philipps-Universität Marburg vorgelegt von Tobias Mischa Bleyl aus Erlabrunn Marburg, 2018 Angenommen vom Fachbereich Medizin der Philipps-Universität Marburg am: 10.07.2018 Gedruckt mit Genehmigung des Fachbereichs Dekan: Prof. Dr. Helmut Schäfer Referent: Prof. Dr. Stefan Bauer 1. Korreferentin: Prof. Dr. Adriana del Rey Dedicated to my beloved parents Karla & Fritz Bleyl and my wonderful wife Jessica Bleyl ABSTRACT Purpose of this work: Toll-like receptors (TLRs) are sensors of the innate immune system that perceive evolutionary conserved microbial structures and act as first line defense mechanisms against bacteria, viruses, fungi, and parasites. As a subset of the TLR family, intracellular TLRs reside in endosomal compartments to encounter their ligands comprising different types of nucleic acids. Important members are TLR3, 7, 8, and 9 recognizing double-stranded RNA (dsRNA), single-stranded RNA (ssRNA), again ssRNA, and unmethylated CpG-motif containing DNA, respectively. Innate immune cells including dendritic cells (DCs) and macrophages (MΦs) show different expression profiles and varying functions of intracellular TLRs. In mice, conventional dendritic cells (cDCs) and MΦs express TLR3, 7, and 9, which predominantly induce secretion of proinflammatory cytokines such as IL-6 after activation, whereas type I interferons (IFNs) are only upregulated upon ligation of TLR3 in these cell types. A rare subset of DCs referred to as plasmacytoid dendritic cells (pDCs) uniquely possesses the ability to massively induce Interferon-α and -β (IFN-α/-β; type I IFNs) upon stimulation of TLR7 and 9. Furthermore, murine pDCs have been shown to sense DNA via TLR9 in a CpG- motif independent way. However, the molecular mechanisms of cell type-dependent functional variations of intracellular TLRs are not fully understood and mostly remain elusive. Besides involvement in embryonic tissue patterning, the homeodomain- containing transcription factor HoxA9 is known to play essential roles in normal and malignant hematopoietic processes such as maintaining the stem cell status, leukemogenesis, and the generation of B cell progenitors. The latter circumstance has been partly linked to transcriptional regulation of the cytokine receptor fms-like tyrosine kinase 3 (Flt3) in hematopoietic progenitors. However, Flt3 and its ligand Flt3L are also crucial signals for the development and homeostasis of DCs. Moreover, prominent mRNA expression levels of hoxa9 upon stimulation of TLR9 in murine pDCs (unpublished data) suggest participation of this transcription factor in TLR9 biology particularly in pDCs. The impact of HoxA9 on the function of intracellular TLRs as well as development of DCs and MΦs was therefore investigated in this study using HoxA9 knockout (KO) mice. Hypothesis: Upregulation of HoxA9 upon activation of TLR9 in pDCs and involvement in B cell differentiation via Flt3 suggests a prominent role of this gene in TLR-mediated i immune responses as well as development of DCs and MΦs. Results: HoxA9-/- mice displayed an insignificant hypocellularity of total nucleated bone marrow (BM) cells, which was reported before by several other groups. FACS analyses of total BM cells ex vivo revealed significantly reduced B cell counts but normal quantities of mature DC subsets in HoxA9-deficient mice, again confirming previous studies. TLR stimulation experiments of HoxA9-/- total BM cells as well as FACS-sorted pDC fractions ex vivo exhibited statistically significant impaired IFN-α responses upon TLR7 and 9 activation, whereas FACS-sorted cDCs did not show significant alterations in TLR function. Moreover, in vitro generated HoxA9-deficient Flt3L-induced DC cultures, which contain pDCs and cDCs, displayed almost completely abolished IFN-α levels and clearly reduced IL-6 levels upon TLR7/9 stimulation compared to wild type (WT). Importantly, Flt3L-induced DC cultures generated from BM cells of HoxA9- deficient animals presented notably reduced amounts of differentiated cells after the maturation period, a higher rate of dead cells, and a shifted pDC/cDC ratio in comparison to WT littermates. Conversely, in vitro generated GM-CSF-induced cDCs and M-CSF- induced MΦs demonstrated no significant differences in surface marker expression and TLR-mediated cytokine responses in the KO cultures. Primary splenocytes of HoxA9- deficient and WT animals showed equal quantities of both DC subsets regarding surface markers measured by FACS. Nonetheless, TLR7/9-mediated IFN-α levels of HoxA9-/- splenic pDCs displayed reductions similarly to those found in the BM. Finally, genome- wide microarray expression profiling of FACS-sorted BM-derived pDCs revealed differential expression of several genes between KO and WT including the HoxA9 co- factor Meis1. Conclusions: Collectively, these results implicate a pivotal role for HoxA9 in TLR7/9- mediated pDC-specific immunity especially impacting on IFN-α responses. TLR biology of cDCs and MΦs is apparently not affected by the HoxA9 knockout. DC development among HoxA9-/- BM cells is partly impaired in vitro. However, this effect is compensated in vivo. The emerging evidence that pDCs play central roles in the pathogenesis of numerous human disorders such as viral infections, autoimmune diseases, and the tumorigenesis of various types of cancer underlines the importance of these cells and emphasizes the fact that HoxA9 could serve as a potential therapeutic target. ii ZUSAMMENFASSUNG Ziel dieser Arbeit: Toll-like Rezeptoren (TLRs) sind Sensoren des angeborenen Immunsystems, welche durch die Evolution konservierte mikrobielle Strukturen erkennen und als Mechanismen der ersten Verteidigungslinie gegen Bakterien, Viren, Pilze und Parasiten zu betrachten sind. Eine Subfamilie stellen die intrazellulären TLRs dar, welche sich in unterschiedlichen endosomalen Kompartimenten befinden, um dort ihre Liganden, bestehend aus verschiedenen Typen von Nukleinsäuren, zu erkennen. Zu den intrazellulären TLRs gehören TLR3, 7, 8 und 9. TLR3 erkennt doppelsträngige RNA (dsRNA), TLR7 und 8 erkennen einzelsträngige RNA (ssRNA) und TLR9 wird durch DNA aktiviert, welche unmethylierte CpG-Sequenzen enthält. Zellen des angeborenen Immunsystems, wie dendritische Zellen (DCs) und Makrophagen, zeigen unterschiedliche Expressionsprofile intrazellulärer TLRs. Zudem kann die Funktion der einzelnen TLRs je nach Zelltyp variieren. Konventionelle dendritische Zellen (cDCs) und Makrophagen in Mäusen exprimieren TLR3, 7 und 9. Nach Aktivierung der TLRs mit dem jeweiligen Ligand kommt es zur Bildung und Sekretion von proinflammatorischen Zytokinen wie IL-6. Zusätzlich wird bei der Aktivierung von TLR3 die Freisetzung von Typ I Interferonen, wie Interferon-α und -β (IFN-α/-β), induziert. Eine selten vorkommende Subpopulation von dendritischen Zellen, genannt plasmazytoide dendritische Zellen (pDCs), hat die außergewöhnliche Fähigkeit, eine enorme Menge an IFN-α und -β nach Aktivierung von TLR7 und 9 freizusetzen. Zudem konnte an murinen pDCs gezeigt werden, dass TLR9 in diesem Zelltyp auch DNA ohne unmethylierte CpG- Sequenzen erkennen kann. Die molekularen Mechanismen zelltypabhängiger funktioneller Unterschiede von intrazellulären TLRs werden bisher noch nicht gut verstanden. Der Transkriptionsfaktor HoxA9, welcher eine Homöodomäne besitzt, spielt verschiedene wichtige Rollen in der Embryogenese und bei diversen Prozessen im Rahmen der Hämatopoese, wie beispielsweise die Erhaltung des Stammzellenstatus, Bildung von Progenitor-Zellen der B-Zell Reihe und bei der Entstehung von Leukämien. Der Einfluss auf die Entwicklung von B-Zellen wurde teilweise auf die transkriptionelle Regulierung des Zytokinrezeptors fms-like tyrosinkinase 3 (Flt3) in hämatopoetischen Progenitor-Zellen zurückgeführt. Flt3 und der passende Ligand Flt3L spielen jedoch auch eine entscheidende Rolle im Rahmen der Entwicklung und Homöostase von DCs. Unveröffentlichte Daten zeigten eine deutliche Überexpression der hoxa9 mRNA in murinen pDCs nach Aktivierung von TLR9. Basierend auf diesen Daten wird in dieser iii Studie der Einfluss des Transkriptionsfaktors HoxA9 auf die Funktion intrazellulärer TLRs sowie die Entwicklung von DCs und Makrophagen untersucht. Hierfür wurden HoxA9 Knockout (KO) Mäuse verwendet. Hypothese: Die Hochregulierung von HoxA9 in pDCs unter Aktivierung von TLR9 lässt einen Einfluss dieses Gens auf die TLR-vermittelte Funktion von DCs und Makrophagen vermuten. Die bekannte transkriptionelle Regulierung des Zytokinrezeptors Flt3 in Progenitor-Zellen der B-Zell Reihe durch HoxA9 könnte ebenfalls im Rahmen
Load more

Recommended publications
  • Genetic Variability in the Italian Heavy Draught Horse from Pedigree Data and Genomic Information
    Supplementary material for manuscript: Genetic variability in the Italian Heavy Draught Horse from pedigree data and genomic information. Enrico Mancin†, Michela Ablondi†, Roberto Mantovani*, Giuseppe Pigozzi, Alberto Sabbioni and Cristina Sartori ** Correspondence: [email protected] † These two Authors equally contributed to the work Supplementary Figure S1. Mares and foal of Italian Heavy Draught Horse (IHDH; courtesy of Cinzia Stoppa) Supplementary Figure S2. Number of Equivalent Generations (EqGen; above) and pedigree completeness (PC; below) over years in Italian Heavy Draught Horse population. Supplementary Table S1. Descriptive statistics of homozygosity (observed: Ho_obs; expected: Ho_exp; total: Ho_tot) in 267 genotyped individuals of Italian Heavy Draught Horse based on the number of homozygous genotypes. Parameter Mean SD Min Max Ho_obs 35,630.3 500.7 34,291 38,013 Ho_exp 35,707.8 64.0 35,010 35,740 Ho_tot 50,674.5 93.8 49,638 50,714 1 Definitions of the methods for inbreeding are in the text. Supplementary Figure S3. Values of BIC obtained by analyzing values of K from 1 to 10, corresponding on the same amount of clusters defining the proportion of ancestry in the 267 genotyped individuals. Supplementary Table S2. Estimation of genomic effective population size (Ne) traced back to 18 generations ago (Gen. ago). The linkage disequilibrium estimation, adjusted for sampling bias was also included (LD_r2), as well as the relative standard deviation (SD(LD_r2)). Gen. ago Ne LD_r2 SD(LD_r2) 1 100 0.009 0.014 2 108 0.011 0.018 3 118 0.015 0.024 4 126 0.017 0.028 5 134 0.019 0.031 6 143 0.021 0.034 7 156 0.023 0.038 9 173 0.026 0.041 11 189 0.029 0.046 14 213 0.032 0.052 18 241 0.036 0.058 Supplementary Table S3.
    [Show full text]
  • Supplemental Materials ZNF281 Enhances Cardiac Reprogramming
    Supplemental Materials ZNF281 enhances cardiac reprogramming by modulating cardiac and inflammatory gene expression Huanyu Zhou, Maria Gabriela Morales, Hisayuki Hashimoto, Matthew E. Dickson, Kunhua Song, Wenduo Ye, Min S. Kim, Hanspeter Niederstrasser, Zhaoning Wang, Beibei Chen, Bruce A. Posner, Rhonda Bassel-Duby and Eric N. Olson Supplemental Table 1; related to Figure 1. Supplemental Table 2; related to Figure 1. Supplemental Table 3; related to the “quantitative mRNA measurement” in Materials and Methods section. Supplemental Table 4; related to the “ChIP-seq, gene ontology and pathway analysis” and “RNA-seq” and gene ontology analysis” in Materials and Methods section. Supplemental Figure S1; related to Figure 1. Supplemental Figure S2; related to Figure 2. Supplemental Figure S3; related to Figure 3. Supplemental Figure S4; related to Figure 4. Supplemental Figure S5; related to Figure 6. Supplemental Table S1. Genes included in human retroviral ORF cDNA library. Gene Gene Gene Gene Gene Gene Gene Gene Symbol Symbol Symbol Symbol Symbol Symbol Symbol Symbol AATF BMP8A CEBPE CTNNB1 ESR2 GDF3 HOXA5 IL17D ADIPOQ BRPF1 CEBPG CUX1 ESRRA GDF6 HOXA6 IL17F ADNP BRPF3 CERS1 CX3CL1 ETS1 GIN1 HOXA7 IL18 AEBP1 BUD31 CERS2 CXCL10 ETS2 GLIS3 HOXB1 IL19 AFF4 C17ORF77 CERS4 CXCL11 ETV3 GMEB1 HOXB13 IL1A AHR C1QTNF4 CFL2 CXCL12 ETV7 GPBP1 HOXB5 IL1B AIMP1 C21ORF66 CHIA CXCL13 FAM3B GPER HOXB6 IL1F3 ALS2CR8 CBFA2T2 CIR1 CXCL14 FAM3D GPI HOXB7 IL1F5 ALX1 CBFA2T3 CITED1 CXCL16 FASLG GREM1 HOXB9 IL1F6 ARGFX CBFB CITED2 CXCL3 FBLN1 GREM2 HOXC4 IL1F7
    [Show full text]
  • The Cytokine FAM3B/PANDER Is an FGFR Ligand That Promotes Posterior Development in Xenopus
    The cytokine FAM3B/PANDER is an FGFR ligand that promotes posterior development in Xenopus Fangfang Zhanga,b,1, Xuechen Zhuc,d,1, Pan Wange,f,1, Qing Hea,b, Huimei Huangg, Tianrui Zhengf, Yongyu Lif, Hong Jiab, Linping Xub, Huaxiang Zhaoh, Gabriele Colozzai, Qinghua Taod,f,2, Edward M. De Robertisi,2, and Yi Dinga,b,2 aInstitute of Neuroscience, Translational Medicine Institute, Health Science Center, Xi’an Jiaotong University, 710061 Xi’an, China; bDepartment of Physiology and Pathophysiology, School of Basic Medical Sciences, Health Science Center, Xi’an Jiaotong University, 710061 Xi’an, China; cKey Laboratory of Structural Biology of Zhejiang Province, School of Life Sciences, Westlake University, 310024 Hangzhou, China; dBeijing Advanced Innovation Center for Structural Biology, 100084 Beijing, China; eTsinghua University-Peking University Joint Center for Life Sciences, School of Life Sciences, Tsinghua University, 100084 Beijing, China; fMinistry of Education (MOE) Key Laboratory of Protein Sciences, School of Life Sciences, Tsinghua University, 100084 Beijing, China; gDepartment of Nephrology, Xi’an Children’s Hospital, The Affiliated Children’s Hospital of Xi’an Jiaotong University, 710061 Xi’an, China; hDepartment of Orthodontics, College of Stomatology, Xi’an Jiaotong University, 710061 Xi’an, China; and iDepartment of Biological Chemistry, University of California, Los Angeles, CA 90095-1662 Contributed by Edward M. De Robertis, April 8, 2021 (sent for review January 7, 2021; reviewed by Enrique Amaya, Makoto Asashima, and Edgar M. Pera) Fibroblast growth factor (FGF)/extracellular signal-regulated ki- processes during vertebrate early embryogenesis, including gas- nase (ERK) signaling plays a crucial role in anterior–posterior trulation, mesoderm formation, and A–P axis specification (6).
    [Show full text]
  • Investigation of the Underlying Hub Genes and Molexular Pathogensis in Gastric Cancer by Integrated Bioinformatic Analyses
    bioRxiv preprint doi: https://doi.org/10.1101/2020.12.20.423656; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Investigation of the underlying hub genes and molexular pathogensis in gastric cancer by integrated bioinformatic analyses Basavaraj Vastrad1, Chanabasayya Vastrad*2 1. Department of Biochemistry, Basaveshwar College of Pharmacy, Gadag, Karnataka 582103, India. 2. Biostatistics and Bioinformatics, Chanabasava Nilaya, Bharthinagar, Dharwad 580001, Karanataka, India. * Chanabasayya Vastrad [email protected] Ph: +919480073398 Chanabasava Nilaya, Bharthinagar, Dharwad 580001 , Karanataka, India bioRxiv preprint doi: https://doi.org/10.1101/2020.12.20.423656; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract The high mortality rate of gastric cancer (GC) is in part due to the absence of initial disclosure of its biomarkers. The recognition of important genes associated in GC is therefore recommended to advance clinical prognosis, diagnosis and and treatment outcomes. The current investigation used the microarray dataset GSE113255 RNA seq data from the Gene Expression Omnibus database to diagnose differentially expressed genes (DEGs). Pathway and gene ontology enrichment analyses were performed, and a proteinprotein interaction network, modules, target genes - miRNA regulatory network and target genes - TF regulatory network were constructed and analyzed. Finally, validation of hub genes was performed. The 1008 DEGs identified consisted of 505 up regulated genes and 503 down regulated genes.
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]
  • A Propeller for Metastasis in Dormant Prostate Cancer Progenitor Cells
    British Journal of Cancer www.nature.com/bjc ARTICLE OPEN Cellular and Molecular Biology Insights into homeobox B9: a propeller for metastasis in dormant prostate cancer progenitor cells 1,8 2,8 3,8 4 5 5 2 2 6 7 Yi Sui , Wei Hu , Wei Zhang , Dejian✉ Li , Hongbo Zhu , Qinghua You , Rujian Zhu , Qingtong Yi , Tao Tang , Lili Gao , Shengjuan Zhu7 and Tao Yang 7 © The Author(s) 2021 BACKGROUND: Metastasis is the major cause of treatment failure and cancer-related deaths in prostate cancer (PCa) patients. Our previous study demonstrated that a CD44+ subpopulation isolated from PCa cells or tumours possesses both stem cell properties and metastatic potential, serving as metastatic prostate cancer stem cells (mPCSCs) in PCa metastasis. However, the underlying mechanisms remain unknown. METHODS: In this study, we established PCa models via the orthotopic and subcutaneous implantation of different human PCa cancer cell lines, and compared the metastatic efficacy, after which process function analysis of target genes was pinpointed. RESULTS: Several novel differentially expressed genes (DEGs) between orthotopic and ectopic tumours were identified. Among them, human homeobox B9 (HOXB9) transcription factor was found to be essential for PCa metastasis, as evidenced by the diminished number of lung metastatic foci derived from orthotopic implantation with HOXB9-deficient CWR22 cells, compared with the control. In addition, HOXB9 protein expression was upregulated in PCa tissues, compared with paracancer and benign prostate hyperplasia tissues. It was also positively correlated with Gleason scores. Gain- and loss-of-function assays showed that HOXB9 altered the expression of various tumour metastasis- and cancer stem cell (CSC) growth-related genes in a transforming growth factor beta (TGFβ)-dependent manner.
    [Show full text]
  • Supporting Information Targeting Antioxidant Pathways with Ferrocenylated N-Heterocyclic Carbene Supported Gold(I)
    Electronic Supplementary Material (ESI) for Chemical Science. This journal is © The Royal Society of Chemistry 2015 Supporting Information Targeting Antioxidant Pathways with Ferrocenylated N-Heterocyclic Carbene Supported Gold(I) Complexes in A549 Lung Cancer Cells J. F. Arambula,a* R. McCall,a K. J. Sidoran,b D. Magda,c N. A. Mitchell,d C. W. e,f g g b Bielawski, V. M. Lynch, J. L. Sessler , and K. Arumugam * a Department of Chemistry, Georgia Southern University, Statesboro, Georgia, 30460, USA. b Department of Chemistry, Wright State University, 3640 Colonel Glenn Hwy, Dayton, Ohio, 45435, USA. c Lumiphore, Inc., Berkeley, California, 94710, USA. dDepartment of Health Sciences, Gettysburg College, Gettysburg, PA 17325-1400 e Center for Multidimensional Carbon Materials, Institute for Basic Science, Ulsan 689-798, Republic of Korea. fDepartment of Chemistry and Department of Energy Engineering, Ulsan National Institute of Science and Technology (UNIST), Ulsan 689-798, Republic of Korea g Department of Chemistry, University of Texas at Austin, Austin, Texas, 78712, USA. *E-mail: [email protected]; [email protected] Table of Contents Synthesis S2-S2 X-ray Crystallography S2-S2 Electrochemical Data S3-S4 1H and 13C NMR Spectra S5-S10 UV-Vis Absorption Spectra S11-S11 Biological Assays S12-S13 RNA Microarray Heat Map and Differential Gene Expression S14-S26 References S26-S26 S1 Synthesis An 8 mL screw cap vial equipped with a stir bar was charged with compound 5 (40 mg, 0.039 mmol) and AgBF4. (5.5 mg, 0.084 mmol). Dry CH2Cl2 was added to the vial and the resulting mixture was stirred at 25 °C for 4 h.
    [Show full text]
  • Epigenetic Mechanisms Are Involved in the Oncogenic Properties of ZNF518B in Colorectal Cancer
    Epigenetic mechanisms are involved in the oncogenic properties of ZNF518B in colorectal cancer Francisco Gimeno-Valiente, Ángela L. Riffo-Campos, Luis Torres, Noelia Tarazona, Valentina Gambardella, Andrés Cervantes, Gerardo López-Rodas, Luis Franco and Josefa Castillo SUPPLEMENTARY METHODS 1. Selection of genomic sequences for ChIP analysis To select the sequences for ChIP analysis in the five putative target genes, namely, PADI3, ZDHHC2, RGS4, EFNA5 and KAT2B, the genomic region corresponding to the gene was downloaded from Ensembl. Then, zoom was applied to see in detail the promoter, enhancers and regulatory sequences. The details for HCT116 cells were then recovered and the target sequences for factor binding examined. Obviously, there are not data for ZNF518B, but special attention was paid to the target sequences of other zinc-finger containing factors. Finally, the regions that may putatively bind ZNF518B were selected and primers defining amplicons spanning such sequences were searched out. Supplementary Figure S3 gives the location of the amplicons used in each gene. 2. Obtaining the raw data and generating the BAM files for in silico analysis of the effects of EHMT2 and EZH2 silencing The data of siEZH2 (SRR6384524), siG9a (SRR6384526) and siNon-target (SRR6384521) in HCT116 cell line, were downloaded from SRA (Bioproject PRJNA422822, https://www.ncbi. nlm.nih.gov/bioproject/), using SRA-tolkit (https://ncbi.github.io/sra-tools/). All data correspond to RNAseq single end. doBasics = TRUE doAll = FALSE $ fastq-dump -I --split-files SRR6384524 Data quality was checked using the software fastqc (https://www.bioinformatics.babraham. ac.uk /projects/fastqc/). The first low quality removing nucleotides were removed using FASTX- Toolkit (http://hannonlab.cshl.edu/fastxtoolkit/).
    [Show full text]
  • Engineered Type 1 Regulatory T Cells Designed for Clinical Use Kill Primary
    ARTICLE Acute Myeloid Leukemia Engineered type 1 regulatory T cells designed Ferrata Storti Foundation for clinical use kill primary pediatric acute myeloid leukemia cells Brandon Cieniewicz,1* Molly Javier Uyeda,1,2* Ping (Pauline) Chen,1 Ece Canan Sayitoglu,1 Jeffrey Mao-Hwa Liu,1 Grazia Andolfi,3 Katharine Greenthal,1 Alice Bertaina,1,4 Silvia Gregori,3 Rosa Bacchetta,1,4 Norman James Lacayo,1 Alma-Martina Cepika1,4# and Maria Grazia Roncarolo1,2,4# Haematologica 2021 Volume 106(10):2588-2597 1Department of Pediatrics, Division of Stem Cell Transplantation and Regenerative Medicine, Stanford School of Medicine, Stanford, CA, USA; 2Stanford Institute for Stem Cell Biology and Regenerative Medicine, Stanford School of Medicine, Stanford, CA, USA; 3San Raffaele Telethon Institute for Gene Therapy, Milan, Italy and 4Center for Definitive and Curative Medicine, Stanford School of Medicine, Stanford, CA, USA *BC and MJU contributed equally as co-first authors #AMC and MGR contributed equally as co-senior authors ABSTRACT ype 1 regulatory (Tr1) T cells induced by enforced expression of interleukin-10 (LV-10) are being developed as a novel treatment for Tchemotherapy-resistant myeloid leukemias. In vivo, LV-10 cells do not cause graft-versus-host disease while mediating graft-versus-leukemia effect against adult acute myeloid leukemia (AML). Since pediatric AML (pAML) and adult AML are different on a genetic and epigenetic level, we investigate herein whether LV-10 cells also efficiently kill pAML cells. We show that the majority of primary pAML are killed by LV-10 cells, with different levels of sensitivity to killing. Transcriptionally, pAML sensitive to LV-10 killing expressed a myeloid maturation signature.
    [Show full text]
  • Bifunctional Enzyme JMJD6 Contributes to Multiple Disease Pathogenesis: New Twist on the Old Story
    biomolecules Review Bifunctional Enzyme JMJD6 Contributes to Multiple Disease Pathogenesis: New Twist on the Old Story Shiva Shankar Vangimalla 1,2, Murali Ganesan 1,2, Kusum K. Kharbanda 1,2 and Natalia A. Osna 1,2,* 1 Research Service, Veterans Affairs Nebraska-Western Iowa Health Care System, 4101 Woolworth Avenue, Omaha, NE 68105, USA; [email protected] (S.S.V.); [email protected] (M.G.); [email protected] (K.K.K.) 2 Department of Internal Medicine, University of Nebraska Medical Center, Omaha, NE 68198, USA * Correspondence: [email protected]; Tel.: +1-402-995-3735; Fax: +1-402-995-4600 Academic Editor: Jürg Bähler Received: 11 May 2017; Accepted: 26 May 2017; Published: 1 June 2017 Abstract: Jumonji domain-containing protein 6 (JMJD6) is a non-heme Fe(II) 2-oxoglutarate (2OG)-dependent oxygenase with arginine demethylase and lysyl hydroxylase activities. Its initial discovery as a dispensable phosphatidylserine receptor (PSR) in the cell membrane of macrophages for phagocytosis was squashed by newer studies which revealed its nuclear localization and bifunctional enzymatic activity. Though its interaction with several nuclear and cytoplasmic target proteins has been demonstrated, the exact mechanisms and clinical significance of these various biologic interplays are not yet well established. Recent investigations have shed the light on the multiple pathways by which JMJD6 can regulate cell proliferation and cause tumorigenesis. Clinically, JMJD6 has been associated with more aggressive and metastatic disease, poorer prognosis, and lower overall survival rates—particularly in lung colon and oral cancers. JMJD6 is a novel biomarker for predicting future disease outcomes and is a target for new therapeutic treatments in future studies.
    [Show full text]
  • BMC Biology Biomed Central
    BMC Biology BioMed Central Research article Open Access Classification and nomenclature of all human homeobox genes PeterWHHolland*†1, H Anne F Booth†1 and Elspeth A Bruford2 Address: 1Department of Zoology, University of Oxford, South Parks Road, Oxford, OX1 3PS, UK and 2HUGO Gene Nomenclature Committee, European Bioinformatics Institute (EMBL-EBI), Wellcome Trust Genome Campus, Hinxton, Cambridgeshire, CB10 1SA, UK Email: Peter WH Holland* - [email protected]; H Anne F Booth - [email protected]; Elspeth A Bruford - [email protected] * Corresponding author †Equal contributors Published: 26 October 2007 Received: 30 March 2007 Accepted: 26 October 2007 BMC Biology 2007, 5:47 doi:10.1186/1741-7007-5-47 This article is available from: http://www.biomedcentral.com/1741-7007/5/47 © 2007 Holland et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Abstract Background: The homeobox genes are a large and diverse group of genes, many of which play important roles in the embryonic development of animals. Increasingly, homeobox genes are being compared between genomes in an attempt to understand the evolution of animal development. Despite their importance, the full diversity of human homeobox genes has not previously been described. Results: We have identified all homeobox genes and pseudogenes in the euchromatic regions of the human genome, finding many unannotated, incorrectly annotated, unnamed, misnamed or misclassified genes and pseudogenes.
    [Show full text]
  • Identification and Functional Validation of Novel Foxp2 Regulatory Transcription Factors in Human Cell Lines
    IDENTIFICATION AND FUNCTIONAL VALIDATION OF NOVEL FOXP2 REGULATORY TRANSCRIPTION FACTORS IN HUMAN CELL LINES Quimbaya, Mauricio1 and España, Jina Marcela1 1Pontificia Universidad Javeriana Cali, Colombia ABSTRACT Different types of genetic analyzes based on individuals with different hereditary forms of speech disorders, such as verbal dyspraxia and some types of autism, have allowed the identification of specific genes closely associated with the disorders mentioned above. In humans, the transcription factor FOXP2 has been widely studied. Mutations in FOXP2 are directly associated with inherited verbal dyspraxia and speech disorders. However, there is little experimental evidence on which genes or transcription factors directly regulate FOXP2, from this point of view, it is essential to determine the transcriptional regulators that act upstream of FOXP2. The identification of new transcription factors associated with FOXP2 regulation will allow the construction of more holistic and inclusive networks, providing an important advance in the identification of molecular pathways involved in the establishment of neural circuit associated with the evolution of vertebrate communication skills. In the same way, the identification of specific regulatory elements that control FOXP2 expression could be of great importance for the appearance of new therapies to prevent or control nervous system development pathologies, specifically those related to speech and language. Here, four transcription factors were chose to evaluate their regulation function with FOXP2. POU3F2 and TBR1 showed great significance in the study since both confirmed a positive FOXP2 regulation and have special roles in the nervous system development. INTRODUCTION Language and communication are inherent characteristics of the human brain with great importance in the establishment of social relations.
    [Show full text]