DOCSLIB.ORG

The Role of Cdx Genes in Normal and Malignant Hematopoiesis

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
The Role of Cdx Genes in Normal and Malignant Hematopoiesis The Role of Cdx Genes in Normal and Malignant Hematopoiesis Silvia Thöne Munich 2011 Clinical Cooperative Group Leukemia Helmholtz Center Munich – German Research Center for Environmental Health and University Hospital Grosshadern, Department of Internal Medicine III Ludwig-Maximilian-University, Munich T HE R OLE OF C DX G ENES IN NOR MAL AND MALIGNANT HE MATOPOIE S IS Thesis Submitted for the Doctoral Degree in Natural Sciences at the Faculty of Biology Ludwig-Maximilian-University, Munich, Germany By Silvia Thöne Munich, 24.01.2011 Klinische Kooperationsgruppe “Leukämie” Helmholtz Zentrum München – Deutsches Forschungszentrum für Umwelt und Gesundheit und Klinikum der Universität München - Großhadern, Medizinische Klinik und Poliklinik III Ludwig-Maximilians-Universität, München DIE R OLLE VON C DX G ENEN IN DE R NORMALEN UND MALIGNEN HÄMATOPOESE Dissertation eingereicht zum Erwerb des Doktorgrades der Naturwissenschaften an der Fakultät für Biologie Ludwig-Maximilians-Universität, München Vorgelegt von Silvia Thöne München, 24.01.2011 Date of Submission: 24.01.2011 First Examiner: Prof. Dr. Dirk Eick Second Examiner: PD Dr. Josef Mautner Date of oral examination: 19.05.2011 Declaration I hereby declare to have written this thesis myself and without any sources other than indicated herein. This work has not been submitted to any other examining body in this or any other form. Munich, 24.01.2011 …………………………………………… (Silvia Thöne) The results of this study were partly published in the following publications: Thoene S, Rawat VPS, Heilmeier B, Hoster E, Metzeler KH, Herold T, Hiddemann W, Goekbuget N, Hoelzer D, Bohlander SK, Feuring-Buske M, Buske C (2009) The homeobox gene CDX2 is aberrantly expressed and associated with an inferior prognosis in patients with acute lymphoblastic leukemia. Leukemia; 23(4):649-55. Rawat VP, Thoene S, Naidu VM, Arseni N, Heilmeier B, Metzeler K, Petropoulos K, Deshpande A, Quintanilla-Martinez L, Bohlander SK, Spiekermann K, Hiddemann W, Feuring-Buske M, Buske C (2008) Overexpression of CDX2 perturbs HOX gene expression in murine progenitors depending on its N-terminal domain and is closely correlated with deregulated HOX gene expression in human acute myeloid leukemia. Blood; 111(1):309-19. Table of Contents I TABLE OF CONTENTS TABLE OF CONTENTS ............................................................................ I ABBREVIATIONS & NOMENCLATURE ...................................................... V 1. INTRODUCTION ............................................................................. 1 1.1 Hematopoiesis ............................................................................. 1 1.1.1 Blood Formation in the Embryo ...................................................... 1 1.1.2 Adult Hematopoiesis ...................................................................... 4 1.1.3 Hematopoietic Stem Cells .............................................................. 8 1.2 Leukemia .................................................................................... 11 1.2.1 Acute Myeloid Leukemia .............................................................. 11 1.2.2 Acute Erythroid Leukemia ............................................................ 15 1.2.3 Acute Lymphoblastic Leukemia ................................................... 16 1.2.4 Cancer Stem Cells and the Leukemic Stem Cell Model ............... 17 1.3 Homeobox Genes ....................................................................... 21 1.3.1 Hox Genes ................................................................................... 22 1.3.2 Cdx Genes ................................................................................... 23 2. AIM OF THE STUDY ..................................................................... 30 3. MATERIAL .................................................................................. 31 3.1 Reagents ..................................................................................... 31 3.2 Consumables ............................................................................. 32 3.3 Media and Supplements for Cell Culture ................................. 33 3.4 Enzymes ..................................................................................... 33 3.5 FACS α-Mouse Antibodies ........................................................ 34 3.6 Kits .............................................................................................. 34 3.7 Kits, Material and Reagents for Microarray ............................. 35 3.8 Oligonucleotides ........................................................................ 35 3.9 Buffers and Stock Solutions ..................................................... 39 3.10 Technical Equipment ................................................................. 41 3.11 Bacteria Strains .......................................................................... 41 II Table of Contents 3.12 Cell Lines ................................................................................... 42 4. METHODS .................................................................................. 43 4.1 Molecular Biology Methods ...................................................... 43 4.1.1 RNA Extraction ............................................................................ 43 4.1.2 DNA Extraction ............................................................................ 43 4.1.3 Quantification of RNA and DNA................................................... 43 4.1.4 Polymerase Chain Reaction (PCR) ............................................. 44 4.1.5 Agarose Gel Electrophoresis ....................................................... 51 4.1.6 Purification of PCR Products out of Agarose Gel ........................ 51 4.1.7 Cloning of DNA Fragments .......................................................... 51 4.1.8 Restriction Analysis ..................................................................... 52 4.1.9 Southern Blot ............................................................................... 52 4.1.10 Sequencing ................................................................................. 53 4.2 Bacteria ...................................................................................... 53 4.2.1 Preparation of Competent Cells .................................................. 53 4.2.2 Transformation of E.coli ............................................................... 54 4.2.3 Isolation of Plasmid DNA (Miniprep, Maxiprep) ........................... 54 4.3 Culture of Eukaryotic Cell Lines .............................................. 54 4.3.1 General Culture Conditions ......................................................... 54 4.3.2 Freezing and Thawing of Cells .................................................... 55 4.3.3 Determination of Cell Number and Vitality ................................... 55 4.3.4 Generation of Packaging Cell Line .............................................. 55 4.4 Mice and Murine Primary Cells ................................................ 56 4.4.1 Mouse Strains and Progenitor Enrichment by 5-FU Injection ...... 56 4.4.2 Collection of Murine BM .............................................................. 56 4.4.3 Cultivation of Murine BM ............................................................. 57 4.4.4 Retroviral Transduction ............................................................... 57 4.4.5 Establishment of a Retroviral Packaging Cell Line for Cdx4 ........ 58 4.4.6 shRNA-Mediated Knock Down .................................................... 59 4.4.7 Immunophenotyping by Fluorescence Activated Cell Sorting ...... 60 4.4.8 Proliferation Assay ....................................................................... 60 4.4.9 Colony Forming Cell Assay ......................................................... 60 4.4.10 Delta CFC Assay ......................................................................... 61 4.4.11 BM Transplantation of Mice ......................................................... 61 4.4.12 Retroviral BM Transplantation Model .......................................... 62 4.4.13 Peripheral Blood Analysis ............................................................ 62 4.4.14 Preparation and Staining of Cytospins ........................................ 62 4.4.15 Histopathology ............................................................................. 63 4.4.16 Analysis of Sacrificed Experimental Mice .................................... 63 4.5 Patient Samples ......................................................................... 63 4.6 Microarray Analyzes .................................................................. 64 Table of Contents III 4.6.1 Preparation of Microarrays ........................................................... 64 4.6.2 Evaluation of Microarray Data ...................................................... 64 4.7 Statistical Analyzes .................................................................... 65 5. RESULTS ................................................................................... 66 5.1 CDX2 in Human AML ................................................................. 66 5.1.1 CDX2 is the Only CDX Member Aberrantly Expressed in Patients with Normal Karyotype AML ......................................................... 66 5.1.2 CDX2 Is Expressed in 64% of AML with Abnormal Karyotype ..... 67 5.1.3 CDX2 Is Higher Expressed in AML with Normal Karyotype Compared to Abnormal Karyotype ..............................................
Load more

Recommended publications
  • ATRX Induction by Mutant Huntingtin Via Cdx2 Modulates Heterochromatin Condensation and Pathology in Huntington’S Disease
    Cell Death and Differentiation (2012) 19, 1109–1116 & 2012 Macmillan Publishers Limited All rights reserved 1350-9047/12 www.nature.com/cdd ATRX induction by mutant huntingtin via Cdx2 modulates heterochromatin condensation and pathology in Huntington’s disease J Lee1,2, YK Hong3, GS Jeon4, YJ Hwang4, KY Kim4, KH Seong4, M-K Jung4, DJ Picketts5, NW Kowall1,2, KS Cho3 and H Ryu*,1,2,4 Aberrant chromatin remodeling is involved in the pathogenesis of Huntington’s disease (HD) but the mechanism is not known. Herein, we report that mutant huntingtin (mtHtt) induces the transcription of alpha thalassemia/mental retardation X linked (ATRX), an ATPase/helicase and SWI/SNF-like chromatin remodeling protein via Cdx-2 activation. ATRX expression was elevated in both a cell line model and transgenic model of HD, and Cdx-2 occupancy of the ATRX promoter was increased in HD. Induction of ATRX expanded the size of promyelocytic leukemia nuclear body (PML-NB) and increased trimethylation of H3K9 (H3K9me3) and condensation of pericentromeric heterochromatin, while knockdown of ATRX decreased PML-NB and H3K9me3 levels. Knockdown of ATRX/dXNP improved the hatch rate of fly embryos expressing mtHtt (Q127). ATRX/dXNP overexpression exacerbated eye degeneration of eye-specific mtHtt (Q127) expressing flies. Our findings suggest that transcriptional alteration of ATRX by mtHtt is involved in pericentromeric heterochromatin condensation and contributes to the pathogenesis of HD. Cell Death and Differentiation (2012) 19, 1109–1116; doi:10.1038/cdd.2011.196; published
    [Show full text]
  • Pancreatic Fibroblast Heterogeneity: from Development to Cancer
    cells Review Pancreatic Fibroblast Heterogeneity: From Development to Cancer 1, 2, 2,3 Paloma E. Garcia y, Michael K. Scales y, Benjamin L. Allen and Marina Pasca di Magliano 2,3,4,* 1 Program in Molecular and Cellular Pathology, University of Michigan Medical School, University of Michigan, Ann Arbor, MI 48105, USA; [email protected] 2 Department of Cell and Developmental Biology, University of Michigan Medical School, University of Michigan, Ann Arbor, MI 48109, USA; [email protected] (M.K.S.); [email protected] (B.L.A.) 3 Rogel Cancer Center, Michigan Medicine, University of Michigan, Ann Arbor, MI 48109, USA 4 Department of Surgery, Michigan Medicine, University of Michigan, Ann Arbor, MI 48109, USA * Correspondence: [email protected]; Tel.: +1-734-276-7104 Authors contributed equally to this work. y Received: 22 October 2020; Accepted: 10 November 2020; Published: 12 November 2020 Abstract: Pancreatic ductal adenocarcinoma (PDA) is characterized by an extensive fibroinflammatory microenvironment that accumulates from the onset of disease progression. Cancer-associated fibroblasts (CAFs) are a prominent cellular component of the stroma, but their role during carcinogenesis remains controversial, with both tumor-supporting and tumor-restraining functions reported in different studies. One explanation for these contradictory findings is the heterogeneous nature of the fibroblast populations, and the different roles each subset might play in carcinogenesis. Here, we review the current literature on the origin and function of pancreatic fibroblasts, from the developing organ to the healthy adult pancreas, and throughout the initiation and progression of PDA. We also discuss clinical approaches to targeting fibroblasts in PDA. Keywords: fibroblasts; pancreas; cancer-associated fibroblasts; pancreas development; pancreatic cancer; tumor microenvironment; hedgehog; transforming growth factor Beta 1.
    [Show full text]
  • Detailed Review Paper on Retinoid Pathway Signalling
    1 1 Detailed Review Paper on Retinoid Pathway Signalling 2 December 2020 3 2 4 Foreword 5 1. Project 4.97 to develop a Detailed Review Paper (DRP) on the Retinoid System 6 was added to the Test Guidelines Programme work plan in 2015. The project was 7 originally proposed by Sweden and the European Commission later joined the project as 8 a co-lead. In 2019, the OECD Secretariat was added to coordinate input from expert 9 consultants. The initial objectives of the project were to: 10 draft a review of the biology of retinoid signalling pathway, 11 describe retinoid-mediated effects on various organ systems, 12 identify relevant retinoid in vitro and ex vivo assays that measure mechanistic 13 effects of chemicals for development, and 14 Identify in vivo endpoints that could be added to existing test guidelines to 15 identify chemical effects on retinoid pathway signalling. 16 2. This DRP is intended to expand the recommendations for the retinoid pathway 17 included in the OECD Detailed Review Paper on the State of the Science on Novel In 18 vitro and In vivo Screening and Testing Methods and Endpoints for Evaluating 19 Endocrine Disruptors (DRP No 178). The retinoid signalling pathway was one of seven 20 endocrine pathways considered to be susceptible to environmental endocrine disruption 21 and for which relevant endpoints could be measured in new or existing OECD Test 22 Guidelines for evaluating endocrine disruption. Due to the complexity of retinoid 23 signalling across multiple organ systems, this effort was foreseen as a multi-step process.
    [Show full text]
  • Genetic Variability in the Italian Heavy Draught Horse from Pedigree Data and Genomic Information
    Supplementary material for manuscript: Genetic variability in the Italian Heavy Draught Horse from pedigree data and genomic information. Enrico Mancin†, Michela Ablondi†, Roberto Mantovani*, Giuseppe Pigozzi, Alberto Sabbioni and Cristina Sartori ** Correspondence: [email protected] † These two Authors equally contributed to the work Supplementary Figure S1. Mares and foal of Italian Heavy Draught Horse (IHDH; courtesy of Cinzia Stoppa) Supplementary Figure S2. Number of Equivalent Generations (EqGen; above) and pedigree completeness (PC; below) over years in Italian Heavy Draught Horse population. Supplementary Table S1. Descriptive statistics of homozygosity (observed: Ho_obs; expected: Ho_exp; total: Ho_tot) in 267 genotyped individuals of Italian Heavy Draught Horse based on the number of homozygous genotypes. Parameter Mean SD Min Max Ho_obs 35,630.3 500.7 34,291 38,013 Ho_exp 35,707.8 64.0 35,010 35,740 Ho_tot 50,674.5 93.8 49,638 50,714 1 Definitions of the methods for inbreeding are in the text. Supplementary Figure S3. Values of BIC obtained by analyzing values of K from 1 to 10, corresponding on the same amount of clusters defining the proportion of ancestry in the 267 genotyped individuals. Supplementary Table S2. Estimation of genomic effective population size (Ne) traced back to 18 generations ago (Gen. ago). The linkage disequilibrium estimation, adjusted for sampling bias was also included (LD_r2), as well as the relative standard deviation (SD(LD_r2)). Gen. ago Ne LD_r2 SD(LD_r2) 1 100 0.009 0.014 2 108 0.011 0.018 3 118 0.015 0.024 4 126 0.017 0.028 5 134 0.019 0.031 6 143 0.021 0.034 7 156 0.023 0.038 9 173 0.026 0.041 11 189 0.029 0.046 14 213 0.032 0.052 18 241 0.036 0.058 Supplementary Table S3.
    [Show full text]
  • Supplemental Materials ZNF281 Enhances Cardiac Reprogramming
    Supplemental Materials ZNF281 enhances cardiac reprogramming by modulating cardiac and inflammatory gene expression Huanyu Zhou, Maria Gabriela Morales, Hisayuki Hashimoto, Matthew E. Dickson, Kunhua Song, Wenduo Ye, Min S. Kim, Hanspeter Niederstrasser, Zhaoning Wang, Beibei Chen, Bruce A. Posner, Rhonda Bassel-Duby and Eric N. Olson Supplemental Table 1; related to Figure 1. Supplemental Table 2; related to Figure 1. Supplemental Table 3; related to the “quantitative mRNA measurement” in Materials and Methods section. Supplemental Table 4; related to the “ChIP-seq, gene ontology and pathway analysis” and “RNA-seq” and gene ontology analysis” in Materials and Methods section. Supplemental Figure S1; related to Figure 1. Supplemental Figure S2; related to Figure 2. Supplemental Figure S3; related to Figure 3. Supplemental Figure S4; related to Figure 4. Supplemental Figure S5; related to Figure 6. Supplemental Table S1. Genes included in human retroviral ORF cDNA library. Gene Gene Gene Gene Gene Gene Gene Gene Symbol Symbol Symbol Symbol Symbol Symbol Symbol Symbol AATF BMP8A CEBPE CTNNB1 ESR2 GDF3 HOXA5 IL17D ADIPOQ BRPF1 CEBPG CUX1 ESRRA GDF6 HOXA6 IL17F ADNP BRPF3 CERS1 CX3CL1 ETS1 GIN1 HOXA7 IL18 AEBP1 BUD31 CERS2 CXCL10 ETS2 GLIS3 HOXB1 IL19 AFF4 C17ORF77 CERS4 CXCL11 ETV3 GMEB1 HOXB13 IL1A AHR C1QTNF4 CFL2 CXCL12 ETV7 GPBP1 HOXB5 IL1B AIMP1 C21ORF66 CHIA CXCL13 FAM3B GPER HOXB6 IL1F3 ALS2CR8 CBFA2T2 CIR1 CXCL14 FAM3D GPI HOXB7 IL1F5 ALX1 CBFA2T3 CITED1 CXCL16 FASLG GREM1 HOXB9 IL1F6 ARGFX CBFB CITED2 CXCL3 FBLN1 GREM2 HOXC4 IL1F7
    [Show full text]
  • Cells Using Gene Expression Profiling and Insulin Gene Methylation
    RESEARCH ARTICLE Comparison of enteroendocrine cells and pancreatic β-cells using gene expression profiling and insulin gene methylation ☯ ☯ Gyeong Ryul Ryu , Esder Lee , Jong Jin Kim, Sung-Dae MoonID, Seung-Hyun Ko, Yu- Bae Ahn, Ki-Ho SongID* Division of Endocrinology & Metabolism, Department of Internal Medicine, College of Medicine, The Catholic University of Korea, Seoul, Korea ☯ These authors contributed equally to this work. a1111111111 * [email protected] a1111111111 a1111111111 a1111111111 a1111111111 Abstract Various subtypes of enteroendocrine cells (EECs) are present in the gut epithelium. EECs and pancreatic β-cells share similar pathways of differentiation during embryonic develop- ment and after birth. In this study, similarities between EECs and β-cells were evaluated in OPEN ACCESS detail. To obtain specific subtypes of EECs, cell sorting by flow cytometry was conducted Citation: Ryu GR, Lee E, Kim JJ, Moon S-D, Ko S- from STC-1 cells (a heterogenous EEC line), and each single cell was cultured and pas- H, Ahn Y-B, et al. (2018) Comparison of saged. Five EEC subtypes were established according to hormone expression, measured enteroendocrine cells and pancreatic β-cells using by quantitative RT-PCR and immunostaining: L, K, I, G and S cells expressing glucagon-like gene expression profiling and insulin gene methylation. PLoS ONE 13(10): e0206401. https:// peptide-1, glucose-dependent insulinotropic polypeptide, cholecystokinin, gastrin and doi.org/10.1371/journal.pone.0206401 secretin, respectively. Each EEC subtype was found to express not only the corresponding Editor: Wataru Nishimura, International University gut hormone but also other gut hormones. Global microarray gene expression profiles of Health and Welfare School of Medicine, JAPAN revealed a higher similarity between each EEC subtype and MIN6 cells (a β-cell line) than Received: March 29, 2018 between C2C12 cells (a myoblast cell line) and MIN6 cells, and all EEC subtypes were highly similar to each other.
    [Show full text]
  • Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K
    www.nature.com/scientificreports OPEN Genome-wide DNA methylation analysis of KRAS mutant cell lines Ben Yi Tew1,5, Joel K. Durand2,5, Kirsten L. Bryant2, Tikvah K. Hayes2, Sen Peng3, Nhan L. Tran4, Gerald C. Gooden1, David N. Buckley1, Channing J. Der2, Albert S. Baldwin2 ✉ & Bodour Salhia1 ✉ Oncogenic RAS mutations are associated with DNA methylation changes that alter gene expression to drive cancer. Recent studies suggest that DNA methylation changes may be stochastic in nature, while other groups propose distinct signaling pathways responsible for aberrant methylation. Better understanding of DNA methylation events associated with oncogenic KRAS expression could enhance therapeutic approaches. Here we analyzed the basal CpG methylation of 11 KRAS-mutant and dependent pancreatic cancer cell lines and observed strikingly similar methylation patterns. KRAS knockdown resulted in unique methylation changes with limited overlap between each cell line. In KRAS-mutant Pa16C pancreatic cancer cells, while KRAS knockdown resulted in over 8,000 diferentially methylated (DM) CpGs, treatment with the ERK1/2-selective inhibitor SCH772984 showed less than 40 DM CpGs, suggesting that ERK is not a broadly active driver of KRAS-associated DNA methylation. KRAS G12V overexpression in an isogenic lung model reveals >50,600 DM CpGs compared to non-transformed controls. In lung and pancreatic cells, gene ontology analyses of DM promoters show an enrichment for genes involved in diferentiation and development. Taken all together, KRAS-mediated DNA methylation are stochastic and independent of canonical downstream efector signaling. These epigenetically altered genes associated with KRAS expression could represent potential therapeutic targets in KRAS-driven cancer. Activating KRAS mutations can be found in nearly 25 percent of all cancers1.
    [Show full text]
  • Ten Commandments for a Good Scientist
    Unravelling the mechanism of differential biological responses induced by food-borne xeno- and phyto-estrogenic compounds Ana María Sotoca Covaleda Wageningen 2010 Thesis committee Thesis supervisors Prof. dr. ir. Ivonne M.C.M. Rietjens Professor of Toxicology Wageningen University Prof. dr. Albertinka J. Murk Personal chair at the sub-department of Toxicology Wageningen University Thesis co-supervisor Dr. ir. Jacques J.M. Vervoort Associate professor at the Laboratory of Biochemistry Wageningen University Other members Prof. dr. Michael R. Muller, Wageningen University Prof. dr. ir. Huub F.J. Savelkoul, Wageningen University Prof. dr. Everardus J. van Zoelen, Radboud University Nijmegen Dr. ir. Toine F.H. Bovee, RIKILT, Wageningen This research was conducted under the auspices of the Graduate School VLAG Unravelling the mechanism of differential biological responses induced by food-borne xeno- and phyto-estrogenic compounds Ana María Sotoca Covaleda Thesis submitted in fulfillment of the requirements for the degree of doctor at Wageningen University by the authority of the Rector Magnificus Prof. dr. M.J. Kropff, in the presence of the Thesis Committee appointed by the Academic Board to be defended in public on Tuesday 14 September 2010 at 4 p.m. in the Aula Unravelling the mechanism of differential biological responses induced by food-borne xeno- and phyto-estrogenic compounds. Ana María Sotoca Covaleda Thesis Wageningen University, Wageningen, The Netherlands, 2010, With references, and with summary in Dutch. ISBN: 978-90-8585-707-5 “Caminante no hay camino, se hace camino al andar. Al andar se hace camino, y al volver la vista atrás se ve la senda que nunca se ha de volver a pisar” - Antonio Machado – A mi madre.
    [Show full text]
  • The Cytokine FAM3B/PANDER Is an FGFR Ligand That Promotes Posterior Development in Xenopus
    The cytokine FAM3B/PANDER is an FGFR ligand that promotes posterior development in Xenopus Fangfang Zhanga,b,1, Xuechen Zhuc,d,1, Pan Wange,f,1, Qing Hea,b, Huimei Huangg, Tianrui Zhengf, Yongyu Lif, Hong Jiab, Linping Xub, Huaxiang Zhaoh, Gabriele Colozzai, Qinghua Taod,f,2, Edward M. De Robertisi,2, and Yi Dinga,b,2 aInstitute of Neuroscience, Translational Medicine Institute, Health Science Center, Xi’an Jiaotong University, 710061 Xi’an, China; bDepartment of Physiology and Pathophysiology, School of Basic Medical Sciences, Health Science Center, Xi’an Jiaotong University, 710061 Xi’an, China; cKey Laboratory of Structural Biology of Zhejiang Province, School of Life Sciences, Westlake University, 310024 Hangzhou, China; dBeijing Advanced Innovation Center for Structural Biology, 100084 Beijing, China; eTsinghua University-Peking University Joint Center for Life Sciences, School of Life Sciences, Tsinghua University, 100084 Beijing, China; fMinistry of Education (MOE) Key Laboratory of Protein Sciences, School of Life Sciences, Tsinghua University, 100084 Beijing, China; gDepartment of Nephrology, Xi’an Children’s Hospital, The Affiliated Children’s Hospital of Xi’an Jiaotong University, 710061 Xi’an, China; hDepartment of Orthodontics, College of Stomatology, Xi’an Jiaotong University, 710061 Xi’an, China; and iDepartment of Biological Chemistry, University of California, Los Angeles, CA 90095-1662 Contributed by Edward M. De Robertis, April 8, 2021 (sent for review January 7, 2021; reviewed by Enrique Amaya, Makoto Asashima, and Edgar M. Pera) Fibroblast growth factor (FGF)/extracellular signal-regulated ki- processes during vertebrate early embryogenesis, including gas- nase (ERK) signaling plays a crucial role in anterior–posterior trulation, mesoderm formation, and A–P axis specification (6).
    [Show full text]
  • Impact of the Transcription Factor Hoxa9 on Toll-Like Receptor-Mediated Innate Immune Responses and Development of Dendritic Cells and Macrophages
    From the Institut for Immunology Center for Infection, Inflammation, and Immunity Executive Director: Prof. Dr. Stefan Bauer of the Faculty of Medicine of the Philipps-Universität Marburg Impact of the Transcription Factor HoxA9 on Toll-like Receptor-Mediated Innate Immune Responses and Development of Dendritic Cells and Macrophages Inaugural-Dissertation For the Degree Doctor of Medicine Submitted to the Faculty of Medicine of the Philipps-Universität Marburg by Tobias Mischa Bleyl from Erlabrunn Marburg, 2018 Aus dem Institut für Immunologie Zentrum für Infektion, Entzündung und Immunität Geschäftsführender Direktor: Prof. Dr. Stefan Bauer des Fachbereichs Medizin der Philipps-Universität Marburg Einfluss des Transkriptionsfaktors HoxA9 auf Toll-like Rezeptor-vermittelte Reaktionen des angeborenen Immunsystems und die Entwicklung von dendritischen Zellen und Makrophagen Inaugural-Dissertation zur Erlangung des Doktorgrades der Humanmedizin dem Fachbereich Medizin der Philipps-Universität Marburg vorgelegt von Tobias Mischa Bleyl aus Erlabrunn Marburg, 2018 Angenommen vom Fachbereich Medizin der Philipps-Universität Marburg am: 10.07.2018 Gedruckt mit Genehmigung des Fachbereichs Dekan: Prof. Dr. Helmut Schäfer Referent: Prof. Dr. Stefan Bauer 1. Korreferentin: Prof. Dr. Adriana del Rey Dedicated to my beloved parents Karla & Fritz Bleyl and my wonderful wife Jessica Bleyl ABSTRACT Purpose of this work: Toll-like receptors (TLRs) are sensors of the innate immune system that perceive evolutionary conserved microbial structures and act as first line defense mechanisms against bacteria, viruses, fungi, and parasites. As a subset of the TLR family, intracellular TLRs reside in endosomal compartments to encounter their ligands comprising different types of nucleic acids. Important members are TLR3, 7, 8, and 9 recognizing double-stranded RNA (dsRNA), single-stranded RNA (ssRNA), again ssRNA, and unmethylated CpG-motif containing DNA, respectively.
    [Show full text]
  • Investigation of the Underlying Hub Genes and Molexular Pathogensis in Gastric Cancer by Integrated Bioinformatic Analyses
    bioRxiv preprint doi: https://doi.org/10.1101/2020.12.20.423656; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Investigation of the underlying hub genes and molexular pathogensis in gastric cancer by integrated bioinformatic analyses Basavaraj Vastrad1, Chanabasayya Vastrad*2 1. Department of Biochemistry, Basaveshwar College of Pharmacy, Gadag, Karnataka 582103, India. 2. Biostatistics and Bioinformatics, Chanabasava Nilaya, Bharthinagar, Dharwad 580001, Karanataka, India. * Chanabasayya Vastrad [email protected] Ph: +919480073398 Chanabasava Nilaya, Bharthinagar, Dharwad 580001 , Karanataka, India bioRxiv preprint doi: https://doi.org/10.1101/2020.12.20.423656; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract The high mortality rate of gastric cancer (GC) is in part due to the absence of initial disclosure of its biomarkers. The recognition of important genes associated in GC is therefore recommended to advance clinical prognosis, diagnosis and and treatment outcomes. The current investigation used the microarray dataset GSE113255 RNA seq data from the Gene Expression Omnibus database to diagnose differentially expressed genes (DEGs). Pathway and gene ontology enrichment analyses were performed, and a proteinprotein interaction network, modules, target genes - miRNA regulatory network and target genes - TF regulatory network were constructed and analyzed. Finally, validation of hub genes was performed. The 1008 DEGs identified consisted of 505 up regulated genes and 503 down regulated genes.
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]