Mixed Lineage Luekemia Histone Methyltransferases

Total Page:16

File Type:pdf, Size:1020Kb

Mixed Lineage Luekemia Histone Methyltransferases MIXED LINEAGE LUEKEMIA HISTONE METHYLTRANSFERASES IN HORMONAL REGULATION OF HOXB9 AND TARGET GENE REGULATION by BISHAKHA SHRESTHA Presented to the Faculty of the Graduate School of The University of Texas at Arlington in Partial Fulfillment of the Requirements for the Degree of DOCTOR OF PHILOSOPHY THE UNIVERSITY OF TEXAS AT ARLINGTON December 2011 ACKNOWLEDGEMENTS First and foremost, I would sincerely like to thank my graduate advisor Dr. Subhrangsu S. Mandal for his immense encouragement and support, for his patience and for his helpful guidance to develop my scientific knowledge without whom my pursuit of a Doctoral degree would have been almost impossible. I would also like to thank Dr. Jongyun Heo and Dr. Roshan Perera, my committee members for their encouragement, guidance and immense support. I would like to thank the Chemistry Department of University of Texas at Arlington for providing me the grounds to pursue my higher education. I am also thankful to all the faculty and staff at Chemistry Department who have helped me in my graduate student career in many different ways. I would like to thank Dr. Khairul Ansari, our postdoctoral associate for his help with the experiments and for sharing his scientific and technical knowledge. Also, sincere thanks to my former and current lab members: Dr. Getachew Woldemariam, Dr. Bibhu P. Mishra, Sahba Kasiri, Imran Hussain, Arunoday Bhan and all the other lab members for help with experiments and providing moral support. I would also like to thank all my friends in the DFW area and all those who lent out a helping hand and provided kind and encouraging words. ii My heartfelt thanks go out to my parents and my family who had immense faith in my capabilities and provided my support all along. Thank you so much for always being there and for your selfless and unconditional love. November 21, 2011 iii ABSTRACT MIXED LINEAGE LUEKEMIA HISTONE METHYLTRANSFERASES IN HORMONAL REGULATION OF HOXB9 AND TARGET GENE REGULATION Bishakha Shrestha, PhD The University of Texas at Arlington, 2011 Supervising Professor: Subhrangsu S. Mandal Homeobox gene (HOX) genes are evolutionary conserved genes that play important roles in cell differentiation, cell proliferation and embryogenesis. HOX genes bind to the DNA via their homeodomain and act as transcription factors. Of the 39 HOX genes present in human, HOXB9 is known to be a critical player in skeletal and mammary gland development. HOXB9 also regulates renin gene expression which is a critical player in Renin-Angiotensin system. Recent studies also demonstrate that HOXB9 is critical for angiogenesis. I have investigated transcriptional regulation of HOXB9 and its potential biochemical function during cell cycle progression and tumorigenesis. My studies demonstrate that HOXB9 is an estrogen responsive gene. HOXB9 promoter contains multiple estrogen response elements through which they interact with estrogen-receptors and regulate gene expression in presence of estrogen. Mixed lineage leukemia (MLL) family of histone methylases that are key players in iv gene activation and epigenetics, coordinate with estrogen-receptors during transcriptional activation of HOXB9 in presence of estrogen. Studies also demonstrate that HOXB9 is overexpressed in breast cancer. HOXB9 regulates various cell cycle regulatory genes that includes various Cyclins and p-proteins and regulates cell cycle progression. Overexpression of HOXB9 induces cell cycle arrest in G0/G1 phase and ultimately induces apoptosis. Homeodomain of HOXB9 plays critical roles in transcriptional regulation of cell cycle regulatory genes and cell cycle progression. Further studies demonstrated that HOXB9 overexpression stimulates three-dimensional growth of tumor in colony formation assay. HOXB9 controls the expression of various tumor growth and angiogenic factors via involvement of its homeodomain and thus influences tumor growth. In conclusion, HOXB9 is an estrogen responsive gene and is overexpressed in breast cancer. HOXB9 is a crucial player in cell cycle regulation and tumorigenesis. v TABLE OF CONTENTS ACKNOWLEDGEMENTS ........................................................................................ ……………..ii ABSTRACT.................................................................................................................................iv LIST OF ILLUSTRATIONS ..........................................................................................................ix LIST OF TABLES ....................................................................................................................... xii LIST OF ABBREVIATIONS ...................................................................................................... xiii Chapter Page 1. MIXED LINEAGE LEUKEMIAS IN HISTONE METHYLATION, GENE EXPRESSION, AND HORMONE SIGNALLING …………………..………..….. ..... .1 1.1 Introduction .................................................................................................. 1 1.2 Histone modification and histone code hypothesis ....................................... .2 1.3 MLLs are H3K4 specific histone methyl transferases ................................... .4 1.4 MLLs contain various functional domains..................................................... .6 1.5 MLL1 is rearranged in leukemia ................................................................... .9 1.6 MLLs exist as multi-subunit complexes ...................................................... .10 1.7 MLLs are master regulator of HOX genes .................................................. .12 1.7.1 HOX gene structure and function ................................................ 12 1.7.2 HOX genes and its interacting partners ....................................... 14 1.7.3 Specificity in HOX target gene regulation .................................... 15 1.7.4 HOX gene and its downstream target genes ............................... 16 1.8 Endocrine regulation of HOX genes and its downstream target genes ....... .18 1.8.1 Retinoic acid and its influence on HOX gene expression ............. 18 vi 1.8.2 Estrogen and its influence on HOX gene expression .................. 19 1.8.3 Progesterone and its influence on HOX gene expression ............ 20 1.8.4 Testosterone and its influence on HOX gene expression ............. 21 1.9 Discussion ................................................................................................ .22 2. HISTONE METHYLASE MLL1 AND MLL3 COORDINATE WITH ESTROGEN RECEPTORS IN ESTROGEN MEDIATED HOXB9 EXPRESSION ............................... 24 2.1 Introduction ................................................................................................ 24 2.2 Materials and methods ............................................................................... 26 2.2.1 Cell culture, estrogen treatment and antisense mediated knockdown experiments ...................................................................... 26 2.2.2 RNA Extraction, Reverse Transcription and Real Time PCR ....... 27 2.2.3 Protein extraction and Western blotting ....................................... 28 2.2.4 Chromatin Immuno-precipitation (ChIP) experiment .................... 28 2.2.5 Luciferase reporter assay ............................................................ 29 2.3 Results ....................................................................................................... 30 2.3.1 Effects of estrogen (E2) on HOXB9 gene expression .................. 30 2.3.2 HOXB9 promoter contains potential estrogen response elements ...................................................... 32 2.3.3 Estrogen receptors play critical roles in E2-mediated transcriptional activation ............................................................. 37 2.3.4 ER α and ER β bind to HOXB9 promoter in presence of E2........... 39 2.3.5 Roles of MLLs in E2 mediated regulation of HOXB9 .................... 42 2.3.6 MLL histone methylases bind to HOXB9 promoter in presence of E2 ........................................................ 44 2.4 Discussion ................................................................................................. 47 3. HOMEODOMAIN CONTAINING PROTEIN HOXB9 PLAYS CRITICAL ROLES IN CELL CYCLE PROGRESSION, TUMORIGENESIS, AND IS OVEREXPRESSED IN BREAST CANCER ................................................................................................... 52 3.1 Introduction ................................................................................................ 52 vii 3.2 Experimental section .................................................................................. 53 3.2.1 Cell culture and cell synchronization ........................................... 53 3.2.2 Immuno-histological analysis of breast cancer tissue microarray. ............................................. 54 3.2.3 Establishment of HOXB9 (full length) and HOXB9 homeodomain stably transfected cell line. ..................... 55 3.2.4 Antisense mediated knockdown experiments .............................. 55 3.2.5 RNA extraction, reverse transcription and real time PCR ...................................................................... 56 3.2.6 Protein extraction and western blotting ........................................ 57 3.2.7 Chromatin immuno-precipitation assay ........................................ 57 3.2.8 Immuno-fluorescence microscopy ............................................... 58 3.2.9 FACS analysis ............................................................................ 58 3.2.10
Recommended publications
  • Table S1 the Four Gene Sets Derived from Gene Expression Profiles of Escs and Differentiated Cells
    Table S1 The four gene sets derived from gene expression profiles of ESCs and differentiated cells Uniform High Uniform Low ES Up ES Down EntrezID GeneSymbol EntrezID GeneSymbol EntrezID GeneSymbol EntrezID GeneSymbol 269261 Rpl12 11354 Abpa 68239 Krt42 15132 Hbb-bh1 67891 Rpl4 11537 Cfd 26380 Esrrb 15126 Hba-x 55949 Eef1b2 11698 Ambn 73703 Dppa2 15111 Hand2 18148 Npm1 11730 Ang3 67374 Jam2 65255 Asb4 67427 Rps20 11731 Ang2 22702 Zfp42 17292 Mesp1 15481 Hspa8 11807 Apoa2 58865 Tdh 19737 Rgs5 100041686 LOC100041686 11814 Apoc3 26388 Ifi202b 225518 Prdm6 11983 Atpif1 11945 Atp4b 11614 Nr0b1 20378 Frzb 19241 Tmsb4x 12007 Azgp1 76815 Calcoco2 12767 Cxcr4 20116 Rps8 12044 Bcl2a1a 219132 D14Ertd668e 103889 Hoxb2 20103 Rps5 12047 Bcl2a1d 381411 Gm1967 17701 Msx1 14694 Gnb2l1 12049 Bcl2l10 20899 Stra8 23796 Aplnr 19941 Rpl26 12096 Bglap1 78625 1700061G19Rik 12627 Cfc1 12070 Ngfrap1 12097 Bglap2 21816 Tgm1 12622 Cer1 19989 Rpl7 12267 C3ar1 67405 Nts 21385 Tbx2 19896 Rpl10a 12279 C9 435337 EG435337 56720 Tdo2 20044 Rps14 12391 Cav3 545913 Zscan4d 16869 Lhx1 19175 Psmb6 12409 Cbr2 244448 Triml1 22253 Unc5c 22627 Ywhae 12477 Ctla4 69134 2200001I15Rik 14174 Fgf3 19951 Rpl32 12523 Cd84 66065 Hsd17b14 16542 Kdr 66152 1110020P15Rik 12524 Cd86 81879 Tcfcp2l1 15122 Hba-a1 66489 Rpl35 12640 Cga 17907 Mylpf 15414 Hoxb6 15519 Hsp90aa1 12642 Ch25h 26424 Nr5a2 210530 Leprel1 66483 Rpl36al 12655 Chi3l3 83560 Tex14 12338 Capn6 27370 Rps26 12796 Camp 17450 Morc1 20671 Sox17 66576 Uqcrh 12869 Cox8b 79455 Pdcl2 20613 Snai1 22154 Tubb5 12959 Cryba4 231821 Centa1 17897
    [Show full text]
  • Genetic Variability in the Italian Heavy Draught Horse from Pedigree Data and Genomic Information
    Supplementary material for manuscript: Genetic variability in the Italian Heavy Draught Horse from pedigree data and genomic information. Enrico Mancin†, Michela Ablondi†, Roberto Mantovani*, Giuseppe Pigozzi, Alberto Sabbioni and Cristina Sartori ** Correspondence: roberto.mantovani@unipd.it † These two Authors equally contributed to the work Supplementary Figure S1. Mares and foal of Italian Heavy Draught Horse (IHDH; courtesy of Cinzia Stoppa) Supplementary Figure S2. Number of Equivalent Generations (EqGen; above) and pedigree completeness (PC; below) over years in Italian Heavy Draught Horse population. Supplementary Table S1. Descriptive statistics of homozygosity (observed: Ho_obs; expected: Ho_exp; total: Ho_tot) in 267 genotyped individuals of Italian Heavy Draught Horse based on the number of homozygous genotypes. Parameter Mean SD Min Max Ho_obs 35,630.3 500.7 34,291 38,013 Ho_exp 35,707.8 64.0 35,010 35,740 Ho_tot 50,674.5 93.8 49,638 50,714 1 Definitions of the methods for inbreeding are in the text. Supplementary Figure S3. Values of BIC obtained by analyzing values of K from 1 to 10, corresponding on the same amount of clusters defining the proportion of ancestry in the 267 genotyped individuals. Supplementary Table S2. Estimation of genomic effective population size (Ne) traced back to 18 generations ago (Gen. ago). The linkage disequilibrium estimation, adjusted for sampling bias was also included (LD_r2), as well as the relative standard deviation (SD(LD_r2)). Gen. ago Ne LD_r2 SD(LD_r2) 1 100 0.009 0.014 2 108 0.011 0.018 3 118 0.015 0.024 4 126 0.017 0.028 5 134 0.019 0.031 6 143 0.021 0.034 7 156 0.023 0.038 9 173 0.026 0.041 11 189 0.029 0.046 14 213 0.032 0.052 18 241 0.036 0.058 Supplementary Table S3.
    [Show full text]
  • Hoxb1 Controls Anteroposterior Identity of Vestibular Projection Neurons
    Hoxb1 Controls Anteroposterior Identity of Vestibular Projection Neurons Yiju Chen1, Masumi Takano-Maruyama1, Bernd Fritzsch2, Gary O. Gaufo1* 1 Department of Biology, University of Texas at San Antonio, San Antonio, Texas, United States of America, 2 Department of Biology, University of Iowa, Iowa City, Iowa, United States of America Abstract The vestibular nuclear complex (VNC) consists of a collection of sensory relay nuclei that integrates and relays information essential for coordination of eye movements, balance, and posture. Spanning the majority of the hindbrain alar plate, the rhombomere (r) origin and projection pattern of the VNC have been characterized in descriptive works using neuroanatomical tracing. However, neither the molecular identity nor developmental regulation of individual nucleus of the VNC has been determined. To begin to address this issue, we found that Hoxb1 is required for the anterior-posterior (AP) identity of precursors that contribute to the lateral vestibular nucleus (LVN). Using a gene-targeted Hoxb1-GFP reporter in the mouse, we show that the LVN precursors originate exclusively from r4 and project to the spinal cord in the stereotypic pattern of the lateral vestibulospinal tract that provides input into spinal motoneurons driving extensor muscles of the limb. The r4-derived LVN precursors express the transcription factors Phox2a and Lbx1, and the glutamatergic marker Vglut2, which together defines them as dB2 neurons. Loss of Hoxb1 function does not alter the glutamatergic phenotype of dB2 neurons, but alters their stereotyped spinal cord projection. Moreover, at the expense of Phox2a, the glutamatergic determinants Lmx1b and Tlx3 were ectopically expressed by dB2 neurons. Our study suggests that the Hox genes determine the AP identity and diversity of vestibular precursors, including their output target, by coordinating the expression of neurotransmitter determinant and target selection properties along the AP axis.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD (cevansmo@iu.edu) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Figure S1. Representative Report Generated by the Ion Torrent System Server for Each of the KCC71 Panel Analysis and Pcafusion Analysis
    Figure S1. Representative report generated by the Ion Torrent system server for each of the KCC71 panel analysis and PCaFusion analysis. (A) Details of the run summary report followed by the alignment summary report for the KCC71 panel analysis sequencing. (B) Details of the run summary report for the PCaFusion panel analysis. A Figure S1. Continued. Representative report generated by the Ion Torrent system server for each of the KCC71 panel analysis and PCaFusion analysis. (A) Details of the run summary report followed by the alignment summary report for the KCC71 panel analysis sequencing. (B) Details of the run summary report for the PCaFusion panel analysis. B Figure S2. Comparative analysis of the variant frequency found by the KCC71 panel and calculated from publicly available cBioPortal datasets. For each of the 71 genes in the KCC71 panel, the frequency of variants was calculated as the variant number found in the examined cases. Datasets marked with different colors and sample numbers of prostate cancer are presented in the upper right. *Significantly high in the present study. Figure S3. Seven subnetworks extracted from each of seven public prostate cancer gene networks in TCNG (Table SVI). Blue dots represent genes that include initial seed genes (parent nodes), and parent‑child and child‑grandchild genes in the network. Graphical representation of node‑to‑node associations and subnetwork structures that differed among and were unique to each of the seven subnetworks. TCNG, The Cancer Network Galaxy. Figure S4. REVIGO tree map showing the predicted biological processes of prostate cancer in the Japanese. Each rectangle represents a biological function in terms of a Gene Ontology (GO) term, with the size adjusted to represent the P‑value of the GO term in the underlying GO term database.
    [Show full text]
  • Supplemental Materials ZNF281 Enhances Cardiac Reprogramming
    Supplemental Materials ZNF281 enhances cardiac reprogramming by modulating cardiac and inflammatory gene expression Huanyu Zhou, Maria Gabriela Morales, Hisayuki Hashimoto, Matthew E. Dickson, Kunhua Song, Wenduo Ye, Min S. Kim, Hanspeter Niederstrasser, Zhaoning Wang, Beibei Chen, Bruce A. Posner, Rhonda Bassel-Duby and Eric N. Olson Supplemental Table 1; related to Figure 1. Supplemental Table 2; related to Figure 1. Supplemental Table 3; related to the “quantitative mRNA measurement” in Materials and Methods section. Supplemental Table 4; related to the “ChIP-seq, gene ontology and pathway analysis” and “RNA-seq” and gene ontology analysis” in Materials and Methods section. Supplemental Figure S1; related to Figure 1. Supplemental Figure S2; related to Figure 2. Supplemental Figure S3; related to Figure 3. Supplemental Figure S4; related to Figure 4. Supplemental Figure S5; related to Figure 6. Supplemental Table S1. Genes included in human retroviral ORF cDNA library. Gene Gene Gene Gene Gene Gene Gene Gene Symbol Symbol Symbol Symbol Symbol Symbol Symbol Symbol AATF BMP8A CEBPE CTNNB1 ESR2 GDF3 HOXA5 IL17D ADIPOQ BRPF1 CEBPG CUX1 ESRRA GDF6 HOXA6 IL17F ADNP BRPF3 CERS1 CX3CL1 ETS1 GIN1 HOXA7 IL18 AEBP1 BUD31 CERS2 CXCL10 ETS2 GLIS3 HOXB1 IL19 AFF4 C17ORF77 CERS4 CXCL11 ETV3 GMEB1 HOXB13 IL1A AHR C1QTNF4 CFL2 CXCL12 ETV7 GPBP1 HOXB5 IL1B AIMP1 C21ORF66 CHIA CXCL13 FAM3B GPER HOXB6 IL1F3 ALS2CR8 CBFA2T2 CIR1 CXCL14 FAM3D GPI HOXB7 IL1F5 ALX1 CBFA2T3 CITED1 CXCL16 FASLG GREM1 HOXB9 IL1F6 ARGFX CBFB CITED2 CXCL3 FBLN1 GREM2 HOXC4 IL1F7
    [Show full text]
  • Large Scale Organization of Chromatin
    LARGE SCALE ORGANIZATION OF CHROMATIN MARIO Nicodemi Dip.to di Fisica, Uni.NA “Federico II”, INFN In the cell nucleus chromosomes have a complex architecture serving vital functional purposes. Problem: how is their 3D structure orchestrated? Our contribution: a model of the molecular mechanisms of their self- organization by use of classical polymer physics. (Mirò, Chiffres & Constellations 1941) Research collaborators MRC, Imperial College, London Ana Pombo,, Mita Chotalia, Ines de Santiago, Liron-Mark Lavitas, Sheila Xie, Kedar Natarajan, Carmelo Ferrai, Robert Beagrie, ... Biology, McGill, CA Josée Dostie, James Fraser Physics, Univ. di Napoli, Italy Mariano Barbieri, Ilaria Cataudella, Antonio Scialdone, Melania Barile, Paolo Casale, Valentino Bianco, Emanuela de Falco, Deborah Pallotti, Gaetano Pellegrino, Andrea Piccolo, ... Chromatin organization (I) (A) Linear expression units in compact genomes v.s. spatially assembled units in complex genomes. (B) Colocalization of coregulated genes. (C) ChromatinGene localization organizationat transcription factories (TFs). Example: the Xicʼs of the X Chromosome territories and map chrom.s colocalize at XCI (Heard et al.; Lee et al. ʻ07) Chromatin organizationNuclear scale (I) (A) Linear expression units in compact genomes v.s. spatially assembled units in complex genomes. (B) Colocalization of coregulated genes. (C) Gene localization at transcription factories (TFs). Colocalization of coregulated genes at transcription factories Example: the Xicʼs of the X Transcription chrom.s colocalize at XCI Factory (Heard et al.; Lee et al. ʻ07) (Pictures: Dekker et al. Science ʻ08) Distal regulatory elements Gene Gene Expression Units Assembly of expression units Gene scale (Pictures: Bolzer et al. PLoS Bio. ʼ05; Dekker et al. Science ʼ08) (Pictures: Dekker et al.
    [Show full text]
  • The Cytokine FAM3B/PANDER Is an FGFR Ligand That Promotes Posterior Development in Xenopus
    The cytokine FAM3B/PANDER is an FGFR ligand that promotes posterior development in Xenopus Fangfang Zhanga,b,1, Xuechen Zhuc,d,1, Pan Wange,f,1, Qing Hea,b, Huimei Huangg, Tianrui Zhengf, Yongyu Lif, Hong Jiab, Linping Xub, Huaxiang Zhaoh, Gabriele Colozzai, Qinghua Taod,f,2, Edward M. De Robertisi,2, and Yi Dinga,b,2 aInstitute of Neuroscience, Translational Medicine Institute, Health Science Center, Xi’an Jiaotong University, 710061 Xi’an, China; bDepartment of Physiology and Pathophysiology, School of Basic Medical Sciences, Health Science Center, Xi’an Jiaotong University, 710061 Xi’an, China; cKey Laboratory of Structural Biology of Zhejiang Province, School of Life Sciences, Westlake University, 310024 Hangzhou, China; dBeijing Advanced Innovation Center for Structural Biology, 100084 Beijing, China; eTsinghua University-Peking University Joint Center for Life Sciences, School of Life Sciences, Tsinghua University, 100084 Beijing, China; fMinistry of Education (MOE) Key Laboratory of Protein Sciences, School of Life Sciences, Tsinghua University, 100084 Beijing, China; gDepartment of Nephrology, Xi’an Children’s Hospital, The Affiliated Children’s Hospital of Xi’an Jiaotong University, 710061 Xi’an, China; hDepartment of Orthodontics, College of Stomatology, Xi’an Jiaotong University, 710061 Xi’an, China; and iDepartment of Biological Chemistry, University of California, Los Angeles, CA 90095-1662 Contributed by Edward M. De Robertis, April 8, 2021 (sent for review January 7, 2021; reviewed by Enrique Amaya, Makoto Asashima, and Edgar M. Pera) Fibroblast growth factor (FGF)/extracellular signal-regulated ki- processes during vertebrate early embryogenesis, including gas- nase (ERK) signaling plays a crucial role in anterior–posterior trulation, mesoderm formation, and A–P axis specification (6).
    [Show full text]
  • Impact of the Transcription Factor Hoxa9 on Toll-Like Receptor-Mediated Innate Immune Responses and Development of Dendritic Cells and Macrophages
    From the Institut for Immunology Center for Infection, Inflammation, and Immunity Executive Director: Prof. Dr. Stefan Bauer of the Faculty of Medicine of the Philipps-Universität Marburg Impact of the Transcription Factor HoxA9 on Toll-like Receptor-Mediated Innate Immune Responses and Development of Dendritic Cells and Macrophages Inaugural-Dissertation For the Degree Doctor of Medicine Submitted to the Faculty of Medicine of the Philipps-Universität Marburg by Tobias Mischa Bleyl from Erlabrunn Marburg, 2018 Aus dem Institut für Immunologie Zentrum für Infektion, Entzündung und Immunität Geschäftsführender Direktor: Prof. Dr. Stefan Bauer des Fachbereichs Medizin der Philipps-Universität Marburg Einfluss des Transkriptionsfaktors HoxA9 auf Toll-like Rezeptor-vermittelte Reaktionen des angeborenen Immunsystems und die Entwicklung von dendritischen Zellen und Makrophagen Inaugural-Dissertation zur Erlangung des Doktorgrades der Humanmedizin dem Fachbereich Medizin der Philipps-Universität Marburg vorgelegt von Tobias Mischa Bleyl aus Erlabrunn Marburg, 2018 Angenommen vom Fachbereich Medizin der Philipps-Universität Marburg am: 10.07.2018 Gedruckt mit Genehmigung des Fachbereichs Dekan: Prof. Dr. Helmut Schäfer Referent: Prof. Dr. Stefan Bauer 1. Korreferentin: Prof. Dr. Adriana del Rey Dedicated to my beloved parents Karla & Fritz Bleyl and my wonderful wife Jessica Bleyl ABSTRACT Purpose of this work: Toll-like receptors (TLRs) are sensors of the innate immune system that perceive evolutionary conserved microbial structures and act as first line defense mechanisms against bacteria, viruses, fungi, and parasites. As a subset of the TLR family, intracellular TLRs reside in endosomal compartments to encounter their ligands comprising different types of nucleic acids. Important members are TLR3, 7, 8, and 9 recognizing double-stranded RNA (dsRNA), single-stranded RNA (ssRNA), again ssRNA, and unmethylated CpG-motif containing DNA, respectively.
    [Show full text]
  • Association of Gene Ontology Categories with Decay Rate for Hepg2 Experiments These Tables Show Details for All Gene Ontology Categories
    Supplementary Table 1: Association of Gene Ontology Categories with Decay Rate for HepG2 Experiments These tables show details for all Gene Ontology categories. Inferences for manual classification scheme shown at the bottom. Those categories used in Figure 1A are highlighted in bold. Standard Deviations are shown in parentheses. P-values less than 1E-20 are indicated with a "0". Rate r (hour^-1) Half-life < 2hr. Decay % GO Number Category Name Probe Sets Group Non-Group Distribution p-value In-Group Non-Group Representation p-value GO:0006350 transcription 1523 0.221 (0.009) 0.127 (0.002) FASTER 0 13.1 (0.4) 4.5 (0.1) OVER 0 GO:0006351 transcription, DNA-dependent 1498 0.220 (0.009) 0.127 (0.002) FASTER 0 13.0 (0.4) 4.5 (0.1) OVER 0 GO:0006355 regulation of transcription, DNA-dependent 1163 0.230 (0.011) 0.128 (0.002) FASTER 5.00E-21 14.2 (0.5) 4.6 (0.1) OVER 0 GO:0006366 transcription from Pol II promoter 845 0.225 (0.012) 0.130 (0.002) FASTER 1.88E-14 13.0 (0.5) 4.8 (0.1) OVER 0 GO:0006139 nucleobase, nucleoside, nucleotide and nucleic acid metabolism3004 0.173 (0.006) 0.127 (0.002) FASTER 1.28E-12 8.4 (0.2) 4.5 (0.1) OVER 0 GO:0006357 regulation of transcription from Pol II promoter 487 0.231 (0.016) 0.132 (0.002) FASTER 6.05E-10 13.5 (0.6) 4.9 (0.1) OVER 0 GO:0008283 cell proliferation 625 0.189 (0.014) 0.132 (0.002) FASTER 1.95E-05 10.1 (0.6) 5.0 (0.1) OVER 1.50E-20 GO:0006513 monoubiquitination 36 0.305 (0.049) 0.134 (0.002) FASTER 2.69E-04 25.4 (4.4) 5.1 (0.1) OVER 2.04E-06 GO:0007050 cell cycle arrest 57 0.311 (0.054) 0.133 (0.002)
    [Show full text]
  • Investigation of the Underlying Hub Genes and Molexular Pathogensis in Gastric Cancer by Integrated Bioinformatic Analyses
    bioRxiv preprint doi: https://doi.org/10.1101/2020.12.20.423656; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Investigation of the underlying hub genes and molexular pathogensis in gastric cancer by integrated bioinformatic analyses Basavaraj Vastrad1, Chanabasayya Vastrad*2 1. Department of Biochemistry, Basaveshwar College of Pharmacy, Gadag, Karnataka 582103, India. 2. Biostatistics and Bioinformatics, Chanabasava Nilaya, Bharthinagar, Dharwad 580001, Karanataka, India. * Chanabasayya Vastrad channu.vastrad@gmail.com Ph: +919480073398 Chanabasava Nilaya, Bharthinagar, Dharwad 580001 , Karanataka, India bioRxiv preprint doi: https://doi.org/10.1101/2020.12.20.423656; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract The high mortality rate of gastric cancer (GC) is in part due to the absence of initial disclosure of its biomarkers. The recognition of important genes associated in GC is therefore recommended to advance clinical prognosis, diagnosis and and treatment outcomes. The current investigation used the microarray dataset GSE113255 RNA seq data from the Gene Expression Omnibus database to diagnose differentially expressed genes (DEGs). Pathway and gene ontology enrichment analyses were performed, and a proteinprotein interaction network, modules, target genes - miRNA regulatory network and target genes - TF regulatory network were constructed and analyzed. Finally, validation of hub genes was performed. The 1008 DEGs identified consisted of 505 up regulated genes and 503 down regulated genes.
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: mkfurue@nibiohn.go.jp Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]