DOCSLIB.ORG

Exome Sequencing Reveals Novel and Recurrent Mutations with Clinical Impact in Blastic Plasmacytoid Dendritic Cell Neoplasm

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Exome Sequencing Reveals Novel and Recurrent Mutations with Clinical Impact in Blastic Plasmacytoid Dendritic Cell Neoplasm Leukemia (2014) 28, 823–829 & 2014 Macmillan Publishers Limited All rights reserved 0887-6924/14 www.nature.com/leu ORIGINAL ARTICLE Exome sequencing reveals novel and recurrent mutations with clinical impact in blastic plasmacytoid dendritic cell neoplasm J Menezes1, F Acquadro1,2, M Wiseman2,GGo´ mez-Lo´ pez3, RN Salgado1, JG Talavera-Casan˜as4, I Bun˜o5, JV Cervera6, S Montes-Moreno7, JM Herna´ndez-Rivas8, R Ayala9, MJ Calasanz10, MJ Larrayoz10, LF Brichs11, M Gonzalez-Vicent12, DG Pisano3, MA Piris7,SA´ lvarez1 and JC Cigudosa1 Blastic plasmacytoid dendritic cell neoplasm (BPDCN) is a very rare disease that currently lacks genomic and genetic biomarkers to assist in its clinical management. We performed whole-exome sequencing (WES) of three BPDCN cases. Based on these data, we designed a resequencing approach to identify mutations in 38 selected genes in 25 BPDCN samples. WES revealed 37–99 deleterious gene mutations per exome with no common affected genes between patients, but with clear overlap in terms of molecular and disease pathways (hematological and dermatological disease). We identified for the first time deleterious mutations in IKZF3, HOXB9, UBE2G2 and ZEB2 in human leukemia. Target sequencing identified 29 recurring genes, ranging in prevalence from 36% for previously known genes, such as TET2, to 12–16% for newly identified genes, such as IKZF3 or ZEB2. Half of the tumors had mutations affecting either the DNA methylation or chromatin remodeling pathways. The clinical analysis revealed that patients with mutations in DNA methylation pathway had a significantly reduced overall survival (P ¼ 0.047). We provide the first mutational profiling of BPDCN. The data support the current WHO classification of the disease as a myeloid disorder and provide a biological rationale for the incorporation of epigenetic therapies for its treatment. Leukemia (2014) 28, 823–829; doi:10.1038/leu.2013.283 Keywords: BPDCN; blastic NK-cell lymphoma; TET2; ASXL1; IKAROS family INTRODUCTION The overall prognosis for BPDCN is remarkably poor. Lymphoid- Blastic plasmacytoid dendritic cell neoplasm (BPDCN), previously like chemotherapy is the preferred treatment, however, most referred as ‘blastic NK-cell lymphoma/leukemia’ or ‘agranular patient relapse, resulting in a median overall survival (OS) of 12–14 16,17 CD4 þ /CD56 þ hematodermic neoplasm’, is a rare and aggressive months. Only high-dose therapy followed by allogeneic stem hematologic disease derived from precursors of a specialized subset cell transplantation can provide durable control in this otherwise 18,19 of dendritic cells, and hence, after some discussion, is considered a fatal condition. myeloid-related disease according to the 2008 WHO classification of We designed a study to discover BPDCN-associated mutations myeloid neoplasms.1–7 These tumor cells infiltrate skin, bone marrow, based on sequencing the complete exome of three tumors, peripheral blood and lymph nodes8–11 and mainly affect elderly matched with normal samples. The discovered mutations detected patients with the maximum incidence peaking at B65 years of age. were then further studied in an expanded cohort. These efforts led Diagnosis is based on the immunophenotype of the blast cells to the identification of several important disease-associated that are characterized by the expression of CD4, CD43, CD56, CD123, mutations, the reconstruction of the genetic pathways underlying BDCA-2/CD303, TCL1 and CTLA.12 In addition, immunohistochemical the BPDCN pathogenesis and revealed associations between genetic markers, such as SPIB, BDCA-4, IRF-8, BCL11A and CD2AP, have events and clinically important features of the disease. been recently reported as tools for BPDCN diagnosis.12,13 There are no established genetic biomarkers that assist in the clinical management of BPDCN. Preliminary results from molecular PATIENTS AND METHODS studies suggest that abnormalities of genes known to have a Patient samples putative role in the prognosis on other hematological malignancies, DNA samples for whole-exome sequencing (WES) were obtained from such as CDKN2A/CDKN2B, TET2 and TP53, are frequently seen in normal tissue (oral mucosa) and tumor bone marrow in three patients with BPDCN.14,15 BPDCN. Thirty-nine additional tumors were further included for the 1Molecular Cytogenetics Group, Human Cancer Genetics Program, Spanish National Cancer Research Centre—CNIO, Madrid, Spain; 2NIMGenetics, R&D Department, Tres Cantos, Madrid, Spain; 3Bioinformatic Unit, Structural Biology and Biocomputing Program, Spanish National Cancer Research Centre—CNIO, Madrid, Spain; 4Servicio de Hematologı´ay Hemoterapia, Complejo Hospitalario Ntra. Sra. de Candelaria, Santa Cruz de Tenerife, Spain; 5Laboratorio de Gene´tica Hematolo´ gica, Servicio de Hematologı´a, Hospital General Universitario Gregorio Maran˜o´n, Instituto de Investigacio´ n Sanitaria Gregorio Maran˜ o´n, Madrid, Spain; 6Hematology Department, Hospital Universitario La Fe, Valencia, Spain; 7Pathology Department, Hospital Universitario Marque´s de Valdecilla, Fundacio´n IFIMAV, Santander, Spain; 8IBSAL, IBMCC, Centro de Investigacio´n del Ca´ncer, Universidad de Salamanca-CSIC, Servicio de Hematologı´a, Hospital Universitario de Salamanca, Salamanca, Spain; 9Hematology Department, Hospital Universitario 12 de octubre, Madrid, Spain; 10Departamento de Gene´tica, Universidad de Navarra, Pamplona, Spain; 11Laboratori de Citologia Hematolo`gica, Laboratori de Citogene`tica Molecular, Servei de Patologia, Hospital del Mar, GRETNHE, IMIM (Hospital del Mar Research Institute), Barcelona, Spain and 12Unidad de Trasplante Hematopoye´tico, Hospital Nin˜o Jesus, Madrid, Spain. Correspondence: Dr JC Cigudosa, Molecular Cytogenetics Group, Human Cancer Genetics Program, Spanish National Cancer Research Centre—CNIO, Melchor Ferna´ndez Almagro, 3 28029, Madrid, Spain. E-mail: [email protected]. Received 27 June 2013; revised 26 August 2013; accepted 17 September 2013; accepted article preview online 27 September 2013; advance online publication, 18 October 2013 BPDCN coding genome J Menezes et al 824 targeted resequencing analysis: 11 tumor samples came from bone City, CA, USA). Data were analyzed with BioEdit Sequence Alignment marrow cells, and 28 samples from paraffin-embedded tissues. All samples Editor 7.0.5.3. were obtained at BPDCN diagnosis. The study was approved by the ethical research and animal care committee from the Institute of Health Carlos III Statistical analysis (CEI PI 32_2009). Clinical characteristics of the patients are summarized in Supplementary Table 1. DNA was extracted by the phenol–chloroform For survival analysis, only the 17 patients with complete follow-up clinical method and the quality and quantity of purified DNA was assessed by data were included. OS was calculated taking into account the first date of fluorometry (Qubit, Invitrogen, Life Technologies, Carlsbad, CA, USA) and diagnosis of BPDCN to death of disease or to last follow-up. Kaplan–Meier gel electrophoresis. method was used to estimate the distribution of OS and differences in survival between-groups were assessed using the log rank test with the SPSS v.19 software (SPSS, Chicago, IL, USA). A P-value of p0.05 was WES and bioinformatic analysis considered statistically significant. The preparation of shotgun libraries from the leukemic and non-leukemic genomic DNA obtained from the three patients followed the ‘SureSelect Human All Exon Kit’ protocol (Agilent Technologies, Santa Clara, CA, USA), RESULTS covering 50 Mb of coding exons (B1.60% of the genome). One to three Mutations in coding sequencing by WES micrograms of high molecular weight genomic DNA from each sample was To improve our understanding of the genes involved in the fragmented by acoustic shearing on a Covaris S2 instrument (Life pathogenesis and clinical evolution of BPDCN, WES was Technologies, Carlsbad, CA, USA). Fractions of 150–300 bp were ligated performed on matched tumor and normal samples from three to Illumina adapters and PCR-amplified for six cycles. For exon enrichment, 300 ng of library was hybridized to SureSelect Human All Exon Capture kit individuals with this disease. WES and bioinformatic analysis were for 24 h at 65 1C. Biotinylated hybrids were captured, and the enriched carried out according to the workflow in Figure 1a. In total, we libraries were completed by amplifying with 12 cycles of PCR. The resulting found 509, 590 and 1505 somatic alterations in case 1, case 2 and purified DNA library was applied to an Illumina flow cell for cluster case 3, respectively. Among them, 347 were intronic in case 1, 457 generation and sequenced using the Illumina Genome Analyzer IIx in case 2 and 961 in case 3, and therefore excluded from further (San Diego, CA, USA) generating 2 Â 76 bp, paired-end reads by following analysis. To gain insight into the genes affected by the the manufacturer protocols. transformation process in BPDCN, we focused our research on Exome variant analysis and biological impact predictions were 20 the mutations that passed our quality control and were predicted performed by RUbioSeq software using default parameters for somatic to result in protein-coding changes, identifying a total of 85 variation analysis. In detail, sequencing data were first checked by FastQC for quality control checks on raw sequence data and then aligned to the mutations in 81 affected genes: 28 mutations in case 1, 8 in case 2, human reference genome (GRCh37) using Burrows-Wheeler alignment.21 and 49 in case 3 (Table 1 and Supplementary Table
Load more

Recommended publications
  • Genetic Variability in the Italian Heavy Draught Horse from Pedigree Data and Genomic Information
    Supplementary material for manuscript: Genetic variability in the Italian Heavy Draught Horse from pedigree data and genomic information. Enrico Mancin†, Michela Ablondi†, Roberto Mantovani*, Giuseppe Pigozzi, Alberto Sabbioni and Cristina Sartori ** Correspondence: [email protected] † These two Authors equally contributed to the work Supplementary Figure S1. Mares and foal of Italian Heavy Draught Horse (IHDH; courtesy of Cinzia Stoppa) Supplementary Figure S2. Number of Equivalent Generations (EqGen; above) and pedigree completeness (PC; below) over years in Italian Heavy Draught Horse population. Supplementary Table S1. Descriptive statistics of homozygosity (observed: Ho_obs; expected: Ho_exp; total: Ho_tot) in 267 genotyped individuals of Italian Heavy Draught Horse based on the number of homozygous genotypes. Parameter Mean SD Min Max Ho_obs 35,630.3 500.7 34,291 38,013 Ho_exp 35,707.8 64.0 35,010 35,740 Ho_tot 50,674.5 93.8 49,638 50,714 1 Definitions of the methods for inbreeding are in the text. Supplementary Figure S3. Values of BIC obtained by analyzing values of K from 1 to 10, corresponding on the same amount of clusters defining the proportion of ancestry in the 267 genotyped individuals. Supplementary Table S2. Estimation of genomic effective population size (Ne) traced back to 18 generations ago (Gen. ago). The linkage disequilibrium estimation, adjusted for sampling bias was also included (LD_r2), as well as the relative standard deviation (SD(LD_r2)). Gen. ago Ne LD_r2 SD(LD_r2) 1 100 0.009 0.014 2 108 0.011 0.018 3 118 0.015 0.024 4 126 0.017 0.028 5 134 0.019 0.031 6 143 0.021 0.034 7 156 0.023 0.038 9 173 0.026 0.041 11 189 0.029 0.046 14 213 0.032 0.052 18 241 0.036 0.058 Supplementary Table S3.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Supplemental Materials ZNF281 Enhances Cardiac Reprogramming
    Supplemental Materials ZNF281 enhances cardiac reprogramming by modulating cardiac and inflammatory gene expression Huanyu Zhou, Maria Gabriela Morales, Hisayuki Hashimoto, Matthew E. Dickson, Kunhua Song, Wenduo Ye, Min S. Kim, Hanspeter Niederstrasser, Zhaoning Wang, Beibei Chen, Bruce A. Posner, Rhonda Bassel-Duby and Eric N. Olson Supplemental Table 1; related to Figure 1. Supplemental Table 2; related to Figure 1. Supplemental Table 3; related to the “quantitative mRNA measurement” in Materials and Methods section. Supplemental Table 4; related to the “ChIP-seq, gene ontology and pathway analysis” and “RNA-seq” and gene ontology analysis” in Materials and Methods section. Supplemental Figure S1; related to Figure 1. Supplemental Figure S2; related to Figure 2. Supplemental Figure S3; related to Figure 3. Supplemental Figure S4; related to Figure 4. Supplemental Figure S5; related to Figure 6. Supplemental Table S1. Genes included in human retroviral ORF cDNA library. Gene Gene Gene Gene Gene Gene Gene Gene Symbol Symbol Symbol Symbol Symbol Symbol Symbol Symbol AATF BMP8A CEBPE CTNNB1 ESR2 GDF3 HOXA5 IL17D ADIPOQ BRPF1 CEBPG CUX1 ESRRA GDF6 HOXA6 IL17F ADNP BRPF3 CERS1 CX3CL1 ETS1 GIN1 HOXA7 IL18 AEBP1 BUD31 CERS2 CXCL10 ETS2 GLIS3 HOXB1 IL19 AFF4 C17ORF77 CERS4 CXCL11 ETV3 GMEB1 HOXB13 IL1A AHR C1QTNF4 CFL2 CXCL12 ETV7 GPBP1 HOXB5 IL1B AIMP1 C21ORF66 CHIA CXCL13 FAM3B GPER HOXB6 IL1F3 ALS2CR8 CBFA2T2 CIR1 CXCL14 FAM3D GPI HOXB7 IL1F5 ALX1 CBFA2T3 CITED1 CXCL16 FASLG GREM1 HOXB9 IL1F6 ARGFX CBFB CITED2 CXCL3 FBLN1 GREM2 HOXC4 IL1F7
    [Show full text]
  • The Cytokine FAM3B/PANDER Is an FGFR Ligand That Promotes Posterior Development in Xenopus
    The cytokine FAM3B/PANDER is an FGFR ligand that promotes posterior development in Xenopus Fangfang Zhanga,b,1, Xuechen Zhuc,d,1, Pan Wange,f,1, Qing Hea,b, Huimei Huangg, Tianrui Zhengf, Yongyu Lif, Hong Jiab, Linping Xub, Huaxiang Zhaoh, Gabriele Colozzai, Qinghua Taod,f,2, Edward M. De Robertisi,2, and Yi Dinga,b,2 aInstitute of Neuroscience, Translational Medicine Institute, Health Science Center, Xi’an Jiaotong University, 710061 Xi’an, China; bDepartment of Physiology and Pathophysiology, School of Basic Medical Sciences, Health Science Center, Xi’an Jiaotong University, 710061 Xi’an, China; cKey Laboratory of Structural Biology of Zhejiang Province, School of Life Sciences, Westlake University, 310024 Hangzhou, China; dBeijing Advanced Innovation Center for Structural Biology, 100084 Beijing, China; eTsinghua University-Peking University Joint Center for Life Sciences, School of Life Sciences, Tsinghua University, 100084 Beijing, China; fMinistry of Education (MOE) Key Laboratory of Protein Sciences, School of Life Sciences, Tsinghua University, 100084 Beijing, China; gDepartment of Nephrology, Xi’an Children’s Hospital, The Affiliated Children’s Hospital of Xi’an Jiaotong University, 710061 Xi’an, China; hDepartment of Orthodontics, College of Stomatology, Xi’an Jiaotong University, 710061 Xi’an, China; and iDepartment of Biological Chemistry, University of California, Los Angeles, CA 90095-1662 Contributed by Edward M. De Robertis, April 8, 2021 (sent for review January 7, 2021; reviewed by Enrique Amaya, Makoto Asashima, and Edgar M. Pera) Fibroblast growth factor (FGF)/extracellular signal-regulated ki- processes during vertebrate early embryogenesis, including gas- nase (ERK) signaling plays a crucial role in anterior–posterior trulation, mesoderm formation, and A–P axis specification (6).
    [Show full text]
  • Spo22.Pdf (8.115Mb)
    DEVELOPING A UBIQUITIN-LIKE MODIFICATION REPORTER A Dissertation Presented to the Faculty of the Graduate School of Cornell University In Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy by Sean Patrick O’Brien May 2013 © 2013 Sean Patrick O’Brien DEVELOPING A UBIQUITIN-LIKE MODIFICATION REPORTER Sean Patrick O’Brien, Ph. D. Cornell University 2013 Ubiquitin-like (ubl) modification is an example of post-translational modification (PTM) that influences a number of cellular processes. Given difficulties in studying this system in its native eukaryotic context, several pathways have been reconstituted in Escherichia coli (E. coli) at varying levels of completeness. We developed the first E3-dependent SUMOylation pathway in E. coli. Because the E3 ligase increases efficiency of conjugation, we were able to lower expression of upstream elements – namely the E2 – and avoid non-physiological chain formation on target protein encountered in previously published work while maintaining high product yield. We additionally developed a ubquitination pathway in E. coli important in plant defense against bacterial colonization. In characterizing the system, we were the first to note that ubiquitination of the target protein may proceed in an E3-independent manner likely through auto-monoubiquitination involving a ubiquitin-binding domain (UBD). We believed these systems might serve as a scaffold to develop a reporter in E. coli for ubl modification of a target protein. Such a reporter would enable engineering new functionality into the pathways. For example, engineering the ubiquitin E3 ligase could achieve rapid knockdown of novel protein; small chemical inhibitors of modification could be identified; and substrates of a particular E2-E3 pair or the E2 in an E3-substrate pair could be found in a high- throughput fashion.
    [Show full text]
  • Multiple E2 Ubiquitin-Conjugating Enzymes Regulate Human Cytomegalovirus US2-Mediated Immunoreceptor Downregulation Michael L
    © 2017. Published by The Company of Biologists Ltd | Journal of Cell Science (2017) 130, 2883-2892 doi:10.1242/jcs.206839 RESEARCH ARTICLE Multiple E2 ubiquitin-conjugating enzymes regulate human cytomegalovirus US2-mediated immunoreceptor downregulation Michael L. van de Weijer1,*,‡, Anouk B. C. Schuren1,‡, Dick J. H. van den Boomen2, Arend Mulder3, Frans H. J. Claas3, Paul J. Lehner2, Robert Jan Lebbink1,§ and Emmanuel J. H. J. Wiertz1,§,¶ ABSTRACT Schuren et al., 2016). At least five unique short (US) regions in the Misfolded endoplasmic reticulum (ER) proteins are dislocated HCMV genome are known to encode proteins that specifically towards the cytosol and degraded by the ubiquitin–proteasome interfere with the expression of HLA-I molecules (van de Weijer system in a process called ER-associated protein degradation et al., 2015). US3 retains newly synthesized HLA-I proteins in the (ERAD). During infection with human cytomegalovirus (HCMV), the ER and blocks tapasin-dependent peptide loading (Jones et al., viral US2 protein targets HLA class I molecules (HLA-I) for 1996; Noriega et al., 2012a; Park et al., 2004). US6 interacts with degradation via ERAD to avoid elimination by the immune system. the transporter associated with antigen processing (TAP) complex US2-mediated degradation of HLA-I serves as a paradigm of ERAD and induces conformational changes of TAP that prevent ATP and has facilitated the identification of TRC8 (also known as RNF139) binding, thereby inhibiting TAP-mediated peptide translocation into as an E3 ubiquitin ligase. No specific E2 enzymes had previously the ER (Ahn et al., 1997; Hengel et al., 1997; Hewitt et al., 2001; been described for cooperation with TRC8.
    [Show full text]
  • RING-Type E3 Ligases: Master Manipulators of E2 Ubiquitin-Conjugating Enzymes and Ubiquitination☆
    Biochimica et Biophysica Acta 1843 (2014) 47–60 Contents lists available at ScienceDirect Biochimica et Biophysica Acta journal homepage: www.elsevier.com/locate/bbamcr Review RING-type E3 ligases: Master manipulators of E2 ubiquitin-conjugating enzymes and ubiquitination☆ Meredith B. Metzger a,1, Jonathan N. Pruneda b,1, Rachel E. Klevit b,⁎, Allan M. Weissman a,⁎⁎ a Laboratory of Protein Dynamics and Signaling, Center for Cancer Research, National Cancer Institute, 1050 Boyles Street, Frederick, MD 21702, USA b Department of Biochemistry, Box 357350, University of Washington, Seattle, WA 98195, USA article info abstract Article history: RING finger domain and RING finger-like ubiquitin ligases (E3s), such as U-box proteins, constitute the vast Received 5 March 2013 majority of known E3s. RING-type E3s function together with ubiquitin-conjugating enzymes (E2s) to medi- Received in revised form 23 May 2013 ate ubiquitination and are implicated in numerous cellular processes. In part because of their importance in Accepted 29 May 2013 human physiology and disease, these proteins and their cellular functions represent an intense area of study. Available online 6 June 2013 Here we review recent advances in RING-type E3 recognition of substrates, their cellular regulation, and their varied architecture. Additionally, recent structural insights into RING-type E3 function, with a focus on im- Keywords: RING finger portant interactions with E2s and ubiquitin, are reviewed. This article is part of a Special Issue entitled: U-box Ubiquitin–Proteasome System. Guest Editors: Thomas Sommer and Dieter H. Wolf. Ubiquitin ligase (E3) Published by Elsevier B.V. Ubiquitin-conjugating enzyme (E2) Protein degradation Catalysis 1.
    [Show full text]
  • Impact of the Transcription Factor Hoxa9 on Toll-Like Receptor-Mediated Innate Immune Responses and Development of Dendritic Cells and Macrophages
    From the Institut for Immunology Center for Infection, Inflammation, and Immunity Executive Director: Prof. Dr. Stefan Bauer of the Faculty of Medicine of the Philipps-Universität Marburg Impact of the Transcription Factor HoxA9 on Toll-like Receptor-Mediated Innate Immune Responses and Development of Dendritic Cells and Macrophages Inaugural-Dissertation For the Degree Doctor of Medicine Submitted to the Faculty of Medicine of the Philipps-Universität Marburg by Tobias Mischa Bleyl from Erlabrunn Marburg, 2018 Aus dem Institut für Immunologie Zentrum für Infektion, Entzündung und Immunität Geschäftsführender Direktor: Prof. Dr. Stefan Bauer des Fachbereichs Medizin der Philipps-Universität Marburg Einfluss des Transkriptionsfaktors HoxA9 auf Toll-like Rezeptor-vermittelte Reaktionen des angeborenen Immunsystems und die Entwicklung von dendritischen Zellen und Makrophagen Inaugural-Dissertation zur Erlangung des Doktorgrades der Humanmedizin dem Fachbereich Medizin der Philipps-Universität Marburg vorgelegt von Tobias Mischa Bleyl aus Erlabrunn Marburg, 2018 Angenommen vom Fachbereich Medizin der Philipps-Universität Marburg am: 10.07.2018 Gedruckt mit Genehmigung des Fachbereichs Dekan: Prof. Dr. Helmut Schäfer Referent: Prof. Dr. Stefan Bauer 1. Korreferentin: Prof. Dr. Adriana del Rey Dedicated to my beloved parents Karla & Fritz Bleyl and my wonderful wife Jessica Bleyl ABSTRACT Purpose of this work: Toll-like receptors (TLRs) are sensors of the innate immune system that perceive evolutionary conserved microbial structures and act as first line defense mechanisms against bacteria, viruses, fungi, and parasites. As a subset of the TLR family, intracellular TLRs reside in endosomal compartments to encounter their ligands comprising different types of nucleic acids. Important members are TLR3, 7, 8, and 9 recognizing double-stranded RNA (dsRNA), single-stranded RNA (ssRNA), again ssRNA, and unmethylated CpG-motif containing DNA, respectively.
    [Show full text]
  • Investigation of the Underlying Hub Genes and Molexular Pathogensis in Gastric Cancer by Integrated Bioinformatic Analyses
    bioRxiv preprint doi: https://doi.org/10.1101/2020.12.20.423656; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Investigation of the underlying hub genes and molexular pathogensis in gastric cancer by integrated bioinformatic analyses Basavaraj Vastrad1, Chanabasayya Vastrad*2 1. Department of Biochemistry, Basaveshwar College of Pharmacy, Gadag, Karnataka 582103, India. 2. Biostatistics and Bioinformatics, Chanabasava Nilaya, Bharthinagar, Dharwad 580001, Karanataka, India. * Chanabasayya Vastrad [email protected] Ph: +919480073398 Chanabasava Nilaya, Bharthinagar, Dharwad 580001 , Karanataka, India bioRxiv preprint doi: https://doi.org/10.1101/2020.12.20.423656; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract The high mortality rate of gastric cancer (GC) is in part due to the absence of initial disclosure of its biomarkers. The recognition of important genes associated in GC is therefore recommended to advance clinical prognosis, diagnosis and and treatment outcomes. The current investigation used the microarray dataset GSE113255 RNA seq data from the Gene Expression Omnibus database to diagnose differentially expressed genes (DEGs). Pathway and gene ontology enrichment analyses were performed, and a proteinprotein interaction network, modules, target genes - miRNA regulatory network and target genes - TF regulatory network were constructed and analyzed. Finally, validation of hub genes was performed. The 1008 DEGs identified consisted of 505 up regulated genes and 503 down regulated genes.
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]
  • Supplementary Material DNA Methylation in Inflammatory Pathways Modifies the Association Between BMI and Adult-Onset Non- Atopic
    Supplementary Material DNA Methylation in Inflammatory Pathways Modifies the Association between BMI and Adult-Onset Non- Atopic Asthma Ayoung Jeong 1,2, Medea Imboden 1,2, Akram Ghantous 3, Alexei Novoloaca 3, Anne-Elie Carsin 4,5,6, Manolis Kogevinas 4,5,6, Christian Schindler 1,2, Gianfranco Lovison 7, Zdenko Herceg 3, Cyrille Cuenin 3, Roel Vermeulen 8, Deborah Jarvis 9, André F. S. Amaral 9, Florian Kronenberg 10, Paolo Vineis 11,12 and Nicole Probst-Hensch 1,2,* 1 Swiss Tropical and Public Health Institute, 4051 Basel, Switzerland; [email protected] (A.J.); [email protected] (M.I.); [email protected] (C.S.) 2 Department of Public Health, University of Basel, 4001 Basel, Switzerland 3 International Agency for Research on Cancer, 69372 Lyon, France; [email protected] (A.G.); [email protected] (A.N.); [email protected] (Z.H.); [email protected] (C.C.) 4 ISGlobal, Barcelona Institute for Global Health, 08003 Barcelona, Spain; [email protected] (A.-E.C.); [email protected] (M.K.) 5 Universitat Pompeu Fabra (UPF), 08002 Barcelona, Spain 6 CIBER Epidemiología y Salud Pública (CIBERESP), 08005 Barcelona, Spain 7 Department of Economics, Business and Statistics, University of Palermo, 90128 Palermo, Italy; [email protected] 8 Environmental Epidemiology Division, Utrecht University, Institute for Risk Assessment Sciences, 3584CM Utrecht, Netherlands; [email protected] 9 Population Health and Occupational Disease, National Heart and Lung Institute, Imperial College, SW3 6LR London, UK; [email protected] (D.J.); [email protected] (A.F.S.A.) 10 Division of Genetic Epidemiology, Medical University of Innsbruck, 6020 Innsbruck, Austria; [email protected] 11 MRC-PHE Centre for Environment and Health, School of Public Health, Imperial College London, W2 1PG London, UK; [email protected] 12 Italian Institute for Genomic Medicine (IIGM), 10126 Turin, Italy * Correspondence: [email protected]; Tel.: +41-61-284-8378 Int.
    [Show full text]
  • A Propeller for Metastasis in Dormant Prostate Cancer Progenitor Cells
    British Journal of Cancer www.nature.com/bjc ARTICLE OPEN Cellular and Molecular Biology Insights into homeobox B9: a propeller for metastasis in dormant prostate cancer progenitor cells 1,8 2,8 3,8 4 5 5 2 2 6 7 Yi Sui , Wei Hu , Wei Zhang , Dejian✉ Li , Hongbo Zhu , Qinghua You , Rujian Zhu , Qingtong Yi , Tao Tang , Lili Gao , Shengjuan Zhu7 and Tao Yang 7 © The Author(s) 2021 BACKGROUND: Metastasis is the major cause of treatment failure and cancer-related deaths in prostate cancer (PCa) patients. Our previous study demonstrated that a CD44+ subpopulation isolated from PCa cells or tumours possesses both stem cell properties and metastatic potential, serving as metastatic prostate cancer stem cells (mPCSCs) in PCa metastasis. However, the underlying mechanisms remain unknown. METHODS: In this study, we established PCa models via the orthotopic and subcutaneous implantation of different human PCa cancer cell lines, and compared the metastatic efficacy, after which process function analysis of target genes was pinpointed. RESULTS: Several novel differentially expressed genes (DEGs) between orthotopic and ectopic tumours were identified. Among them, human homeobox B9 (HOXB9) transcription factor was found to be essential for PCa metastasis, as evidenced by the diminished number of lung metastatic foci derived from orthotopic implantation with HOXB9-deficient CWR22 cells, compared with the control. In addition, HOXB9 protein expression was upregulated in PCa tissues, compared with paracancer and benign prostate hyperplasia tissues. It was also positively correlated with Gleason scores. Gain- and loss-of-function assays showed that HOXB9 altered the expression of various tumour metastasis- and cancer stem cell (CSC) growth-related genes in a transforming growth factor beta (TGFβ)-dependent manner.
    [Show full text]