Molecular Pharmacology Fast Forward. Published on October 7, 2011 as DOI: 10.1124/mol.111.073759 Molecular PharmacologyThis article has Fast not been Forward. copyedited Published and formatted. on The October final version 7, may 2011 differ as from doi:10.1124/mol.111.073759 this version. MOL #73759

Diflavin Oxidoreductases Activate the Bioreductive Prodrug PR-104A Under Hypoxia

Christopher P. Guise, Maria R. Abbattista, Smitha R. Tipparaju, Neil K Lambie, Jiechuang

Su, Dan Li, William R. Wilson, Gabi U. Dachs, and Adam V. Patterson.

Auckland Cancer Society Research Centre, School of Medical Sciences, The University of

Auckland, Private Bag 92019, Auckland, New Zealand (CPG, MRA, SRT, JS, DL, WRW, AVP);

Maurice Wilkins Centre for Molecular Biodiscovery, The University of Auckland, Private Bag Downloaded from

92019, Auckland, New Zealand (CPG, WRW, GUD, AVP); Department of Anatomical Pathology,

Prince of Wales Hospital, Barker Street, Randwick, NSW 2031, Australia (NKL); Department of molpharm.aspetjournals.org Pathology, University of Otago Christchurch, PO Box 4345, Christchurch 8140, New Zealand

(NKL, GUD). at ASPET Journals on September 25, 2021

1

Copyright 2011 by the American Society for Pharmacology and Experimental Therapeutics. Molecular Pharmacology Fast Forward. Published on October 7, 2011 as DOI: 10.1124/mol.111.073759 This article has not been copyedited and formatted. The final version may differ from this version. MOL #73759

Running title: PR-104A Activation by Diflavin Oxidoreductases

Address correspondence to: Dr Adam V. Patterson, Auckland Cancer Society Research

Centre, The University of Auckland, Private Bag 92019, Auckland, New Zealand. Phone

64-9-3737599, Ext 86941, Fax 64-9-3737577, E-mail [email protected]

Number of text pages: 20 Number of tables: 1 Downloaded from Number of figures: 6 Number of references: 40 Abstract word count: 222

Introduction word count: 732 molpharm.aspetjournals.org Discussion word count: 1452

Non-standard abbreviations: CAIX, carbonic anhydrase 9; CYB5R, cytochrome B5 reductase; DPI, diphenyliodonium;

FFPE, formalin fixed paraffin embedded; HIF-1, hypoxia-inducible factor 1; IHC, at ASPET Journals on September 25, 2021 immunohistochemistry; mAb, monoclonal antibody; MMC, mitomycin C; MTRR, methionine synthase reductase; NDOR1, novel diflavin oxidoreductase 1, NOS, nitric oxide synthase; ORF, open reading frame; PBS, phosphate buffered saline; PFA, paraformaldehyde; POR, cytochrome P450 reductase; RT, room temperature; SRB, sulforhodamine B; TMA, tissue microarray; TPZ, 3-amino-1,2,4-benzotriazine-1,4 dioxide, (tirapazamine); UPR, unfolded protein response; XD, xathine dehydrogenase.

2 Molecular Pharmacology Fast Forward. Published on October 7, 2011 as DOI: 10.1124/mol.111.073759 This article has not been copyedited and formatted. The final version may differ from this version. MOL #73759

Abstract

The clinical agent PR-104 is converted systemically to PR-104A, a nitrogen mustard prodrug designed to target tumour hypoxia. Reductive activation of PR-104A is initiated by one-electron oxidoreductases in a process reversed by oxygen. The identity of these oxidoreductases is unknown, with the exception of cytochrome P450 reductase (POR). To

identify other hypoxia-selective PR-104A reductases, nine candidate oxidoreductases were Downloaded from expressed in HCT116 cells. Increased PR-104A-cytotoxicity was observed in cells expressing methionine synthase reductase (MTRR), novel diflavin oxidoreductase 1 molpharm.aspetjournals.org (NDOR1) and inducible nitric oxide synthase (NOS2A), in addition to POR. Plasmid-based expression of these diflavin oxidoreductases also enhanced bioreductive metabolism of PR-

104A in an anoxia-specific manner. Diflavin oxidoreductase-dependent PR-104A metabolism was suppressed >90% by pan-flavoenzyme inhibition with diphenyliodonium at ASPET Journals on September 25, 2021 chloride. Antibodies were used to quantify endogenous POR, MTRR, NDOR1 and NOS2A expression in 23 human tumour cell lines; however only POR protein was detectable and its expression correlated with anoxic PR-104A reduction (r2 = 0.712). An anti-POR monoclonal antibody was used to probe expression using human tissue microarrays; 13 of

19 cancer types expressed detectable POR with 21% of cores (185 of 874) staining positive; this heterogeneity suggests POR as a useful biomarker for PR-104A activation.

Immunostaining for carbonic anhydrase 9 (CAIX), reportedly an endogenous marker of hypoxia, revealed only moderate co-expression (9.6%) of both CAIX and POR across a subset of five cancer types.

3 Molecular Pharmacology Fast Forward. Published on October 7, 2011 as DOI: 10.1124/mol.111.073759 This article has not been copyedited and formatted. The final version may differ from this version. MOL #73759

Introduction

Hypoxia is a common characteristic of solid tumours that is associated with poor patient prognosis and resistance to treatment (Vaupel and Mayer, 2007). A number of bioreductive prodrugs have been developed to exploit tumour hypoxia; examples which have advanced to clinical trial include the N-oxides tirapazamine (TPZ) (Rischin et al., 2010) and

banoxantrone (AQ4N) (Patterson and McKeown, 2000), and the nitroaromatics PR-104 Downloaded from

(Jameson et al., 2010) and TH-302 (Weiss et al., 2011). All share a common mechanism of activation, undergoing reductive metabolism by intracellular oxidoreductases to form molpharm.aspetjournals.org cytotoxic species. The capacity for prodrugs to act as exogenous electron acceptors is opposed by molecular oxygen, predominantly via redox cycling and consequently they function as direct oxygen sensors. While several mammalian enzymes have been implicated in prodrug reduction, the enzymology of hypoxic drug metabolism is poorly defined at ASPET Journals on September 25, 2021 (Wilson and Hay, 2011;Chen and Hu, 2009;Patterson et al., 1998).

PR-104 is a phosphate ester pre-prodrug that undergoes systemic hydrolysis in vivo to the

3,5-dinitrobenzamide-2-mustard prodrug, PR-104A. Nitroreduction of PR-104A leads to the formation of the cytotoxic hydroxylamine (PR-104H) and amine (PR-104M) metabolites (Patterson et al., 2007) which contribute to antitumour activity through the formation of DNA interstrand crosslinks (Singleton et al., 2009). Cellular sensitivity to PR-

104A is determined by hypoxia, the expression of relevant oxidoreductases and the functional status of DNA repair pathways in the cell (Gu et al., 2009). Only one-electron oxidoreductases will generate the initial PR-104A nitro-radical anion that is sensitive to back oxidation by molecular oxygen. Cytotoxicity of PR-104A is increased under hypoxia in vitro in all cell lines tested (Patterson et al., 2007), but with a wide range (5-120-fold)

4 Molecular Pharmacology Fast Forward. Published on October 7, 2011 as DOI: 10.1124/mol.111.073759 This article has not been copyedited and formatted. The final version may differ from this version. MOL #73759 because of variable expression of aldo-keto reductase 1C3 (AKR1C3), a two-electron PR-

104A oxidoreductase which fails to generate the oxygen-sensitive nitro-radical species

(Guise et al., 2010). To date only a single oxygen-sensitive PR-104A reductase, cytochrome

P450 oxidoreductase (POR), has been identified as catalysing the reduction of PR-104A via one-electron transfer under anoxia (Guise et al., 2007). However, quantitative knockdown of POR by antisense and RNA interference has shown that ~40% of anoxic PR-104A

reduction in SiHa cells is due to other enzymes (Guise et al., 2007). In order to understand Downloaded from the relative contribution of POR and other one-electron oxidoreductases to PR-104A metabolism in human tumours it is necessary to identify these oxidoreductases and to assess molpharm.aspetjournals.org their expression.

We previously observed that the irreversible flavoenzyme inhibitor diphenyliodonium chloride (DPI) suppresses 90% of anoxic PR-104A metabolism in SiHa cells (Guise et al., at ASPET Journals on September 25, 2021 2007); the remainder is likely attributable to oxygen-insensitive reduction by AKR1C3 which is expressed in this cell line (Guise et al., 2010). The essentially complete inhibition of PR-104A reduction by DPI under hypoxia suggests that the unidentified one-electron oxidoreductases in SiHa cells are flavoproteins. To date a number of flavoenzymes have been reported to have activity as xenobiotic nitroreductases including; adrenodoxin oxidoreductase (FDXR), cytochrome B5 reductase (CYB5R), inducible nitric oxide synthase (NOS2A), NAD(P)H quinone oxidoreductase 1 (NQO1), NAD(P)H quinone oxidoreductase 2 (NQO2) and xanthine dehydrogenase (XD). NOS2A has a high degree of homology to POR and both belong to a small family of proteins termed the diflavin oxidoreductases which employ the cofactors FAD and FMN for electron transfer from

NADPH to acceptors (Murataliev et al., 2004). The other human diflavin oxidoreductase family members are methionine synthase reductase (MTRR), novel diflavin oxidoreductase

5 Molecular Pharmacology Fast Forward. Published on October 7, 2011 as DOI: 10.1124/mol.111.073759 This article has not been copyedited and formatted. The final version may differ from this version. MOL #73759

1 (NDOR1) and the isoforms of nitric oxide synthase (NOS1 and NOS3). Thus the diflavin oxidoreductase family also represent potential candidates for anoxic PR-104A activation.

Details of the substrates known to be metabolically reduced by these enzymes are provided in suppl. Table S1.

We tested these ten candidate flavoenzymes and identified three diflavin oxidoreductases,

MTRR, NDOR1 and NOS2A, in addition to POR, as anoxic PR-104A reductases. Downloaded from

Following identification of specific antibodies against POR, MTRR, NDOR1 and NOS2A we examined expression in a panel of 23 human cancer cell lines and showed that POR is molpharm.aspetjournals.org the only diflavin oxidoreductase expressed at readily detectable levels. We demonstrated that POR, MTRR, NDOR1 and NOS2A overexpression elevated metabolism of PR-104A and that the flavoenzyme poison diphenyliodonium (DPI) ablated anoxic PR-104A metabolism across all diflavin oxdioreductase expressing cells. Next we critically tested the at ASPET Journals on September 25, 2021 available antibodies on formalin fixed paraffin embedded (FFPE) cell pellets and xenografts, confirming only the anti-POR monoclonal antibody to be suitable. Finally we examined POR expression in a set of surgical tumour samples in tissue microarrays from 19 common cancers and showed heterogeneous expression patterns.

6 Molecular Pharmacology Fast Forward. Published on October 7, 2011 as DOI: 10.1124/mol.111.073759 This article has not been copyedited and formatted. The final version may differ from this version. MOL #73759

Methods

Compounds PR-104A, PR-104H and tetradeuterated derivatives were synthesized, purified and stored as described previously (Guise et al., 2010). Diphenyliodonium (DPI;

100 mM) (Sigma Aldrich) was prepared as a DMSO stock and stored at -80°C. Downloaded from Cell lines, cytotoxicity assays and PR-104A metabolism. Cells were maintained in culture under humidified atmospheric conditions with 5% CO2 as described (Patterson et

al., 2007) with <6 months cumulative passage from sources (see suppl. Table S2). molpharm.aspetjournals.org

Antiproliferative assays were performed in alpha-minimal essential media under oxic or anoxic conditions, the latter employing a 5% H2/palladium catalyst scrubbed Bactron anaerobic chamber (Sheldon Labs) to achieve severe anoxia (< 10 ppm O2 gas phase)

during PR-104A exposure as previously described (Patterson et al., 2007). Total exposure at ASPET Journals on September 25, 2021 to anoxia did not exceed 6 hours and cells were allowed to regrow for 4 days under drug free aerobic conditions. Cellular metabolism of PR-104A (100 µM, 1 h, 5x105 cells/well in

24 well plates) to hydroxylamine PR-104H and amine PR-104M was measured by

LC/MS/MS as before (Singleton et al., 2009).

Candidate gene expression. Plasmids encoding sequence-confirmed ORFs for CYB5R,

FDXR, MTRR, NDOR1, NOS2A, NOS3, NQO1, NQO2, POR and XD were purchased

(suppl. Table S3). ORFs were cloned into the Gateway® compatible vector F527-V5 and transfected into HCT116 cells as described (Guise et al., 2010).

Western immunoblot analysis. Cell lysates were prepared in RIPA buffer (Guise et al.,

2010). 30µg protein was loaded on SDS-PAGE gels (4-12% gradient gels; Invitrogen), transferred, blocked and probed with primary antibodies against POR (Santa Cruz biotech,

7 Molecular Pharmacology Fast Forward. Published on October 7, 2011 as DOI: 10.1124/mol.111.073759 This article has not been copyedited and formatted. The final version may differ from this version. MOL #73759 sc25263), MTRR (Abnova, H00004552-M01), NDOR1 (Abnova, H000027158-M01) and

NOS2A (Santa Cruz Biotech, sc651). Full details of antibodies are listed in supplementary table S4. Bands were detected using chemiluminescent ECL detection (Supersignal,

Thermoscientific) and quantified using ImageJ (v1.42 of the public domain software).

Immunostaining of cell pellets, xenografts and human tumour tissue microarrays

(TMAs). For all diflavin oxidoreductase overexpressing cell lines a dense pellet was Downloaded from formed by centrifugation (107 cells), fixed in 4% PFA (30 h, RT), embedded, cut (5 μm) and mounted on glass. Antibodies were evaluated for antigen specificity across a dilution molpharm.aspetjournals.org range (10 - 0.5 μg/mL). For additional validation of POR mAb, xenografts were established in NIHIII nude mice (University of Auckland animal ethics committee approval number

C830) from parental HCT116 WT cells, HCT116 POR cells engineered to overexpress

POR as described (Guise et al., 2010), and HCT116 cells negative for POR protein due to at ASPET Journals on September 25, 2021 mutation of both POR alleles employing zinc finger nuclease technology (HCT116-PORnull; development of this cell line will be reported elsewhere). FFPE tissue of each xenograft was prepared for IHC as described (Guise et al., 2010). Commercial human tissue microarrays

(TMAs) were sourced as shown in suppl. Table S5. A total of 874 individual cores (685 cases) representing 19 cancer types and 135 cores (77 cases) representing 34 normal tissues were analyzed across 12 TMAs. Optimized antigen retrieval was performed in citrate buffer

(pH 6.0) (30min, 120ºC). Slides (3 μm) were immunostained for POR and CAIX (Novus

Biologicals, NB100-417) as for tumour xenografts and cores were scored for staining intensity and proportion of positive neoplastic cells by a certified pathologist (NKL). IHC for CAIX was performed using Cell and Tissue Staining Kits (R&D Systems, Minneapolis,

MN, USA) as described (Dachs et al., 2010). Intensity was scored using a semi-quantitative measure on a 4-point scale ranging from negative (score 0) to strong staining (score 3).

8 Molecular Pharmacology Fast Forward. Published on October 7, 2011 as DOI: 10.1124/mol.111.073759 This article has not been copyedited and formatted. The final version may differ from this version. MOL #73759

Histo-scores (H-score) for POR and CAIX were determined using the following equation;

(% of cells exhibiting intensity 1 staining x 1) + (% of cells exhibiting intensity 2 staining x

2) + (% of cells exhibiting intensity 3 staining x 3) = H-score (maximum = 300). This measure was applied to the neoplastic cell element of the tumours within the tissue microarrays and the epithelial elements within the normal tissue microarray.

Statistical tests. All data was tested for significance by unpaired t-test. Downloaded from molpharm.aspetjournals.org at ASPET Journals on September 25, 2021

9 Molecular Pharmacology Fast Forward. Published on October 7, 2011 as DOI: 10.1124/mol.111.073759 This article has not been copyedited and formatted. The final version may differ from this version. MOL #73759

Results

Identification of diflavin oxidoreductase enzymes as novel hypoxic PR-104A reductases

We have previously demonstrated the importance of DPI-sensitive flavoenzymes in general,

and POR in particular, in the activation of PR-104A by SiHa cells under anoxic conditions Downloaded from

(Guise et al., 2007). To identify other flavoenzymes that catalyse the conversion of PR-

104A to the cytotoxic para-nitro reduction products, PR-104H and PR-104M, ten molpharm.aspetjournals.org flavoenzymes were expressed from sequence-confirmed cDNAs following plasmid transfer in HCT116 cells to generate pooled populations. Use of a bicistronic expression cassette enforces homogeneous oxidoreductase expression in these puromycin resistant cells. The candidate enzymes selected for this study consisted of four enzymes with homology to POR at ASPET Journals on September 25, 2021 (MTRR, NDOR1, NOS2A and NOS3) and five enzymes previously implicated in bioreductive metabolism (CYB5R, FDXR, NQO1, NQO2 and XD). HCT116 cells overexpressing POR were also generated as a positive control. Flavoenzyme expression was confirmed by immunodetection of a common C-terminal V5-tag induced by TAG suppressor tRNA-mediated translation (tag-on-demand, Invitrogen) (Fig 1A). Expression was observed for all proteins, although only weak bands were observed for NOS3 and XD.

All V5-tagged proteins were of the expected molecular weight except for XD which showed a single band of approximately 100 kDa rather than the expected 150 kDa product.

In addition to the anticipated 130 kDa band for NOS2A a second band of approximately 75 kDa was observed. The ability of these enzymes to activate PR-104A under anoxic conditions was examined by monitoring formation of reduced PR-104A metabolites by a sensitive LC/MS/MS assay relative to HCT116 WT controls (Fig 1B). Significant increases

10 Molecular Pharmacology Fast Forward. Published on October 7, 2011 as DOI: 10.1124/mol.111.073759 This article has not been copyedited and formatted. The final version may differ from this version. MOL #73759 in PR-104A metabolism were detected in cells expressing POR, MTRR, NDOR1 and

NOS2A under anoxia (all p <0.05), but not aerobic conditions (suppl. Fig S1).

The four flavoenzymes able to activate PR-104A under anoxic conditions, namely POR,

MTRR, NDOR1 and NOS2A, all belong to the diflavin oxidoreductase protein family.

Figure 2A shows a schematic representation of these enzymes along with two additional

family members, NOS1 and NOS3, and highlights the structural homology of the diflavin Downloaded from oxidoreductase family. We sought to determine if the increases in anoxic PR-104A metabolism in HCT116 POR, MTRR, NDOR1 and NOS2A cells resulted in increased molpharm.aspetjournals.org anoxic sensitivity of these cells to PR-104A. The sensitivity to PR-104A of WT and overexpressing cell lines was determined under aerobic and anoxic conditions using a sulforhodamine B based anti-proliferative assay. As expected, no significant increases in sensitivity to PR-104A were observed in these cell lines under aerobic conditions (Fig. 2B). at ASPET Journals on September 25, 2021 Anoxic exposure resulted in significant increases in sensitivity to PR-104A in POR (p =

0.003), MTRR (p = 0.006), NDOR1 (p = 0.029) and NOS2A (p = 0.028) expressing cells as compared to WT (Fig. 2C). Increases in hypoxic cytotoxicity ratios (HCR = aerobic IC50 value divided by anoxic IC50 value) were also observed, ranging from 20-fold in the parental cell line to 158-fold (POR), 88-fold (MTRR), 64-fold (NDOR1) and 60-fold

(NOS2A) (Fig. 2). Consistent with the metabolism data (Fig. 1B), there was no significant change in anoxic PR-104A sensitivity in cells expressing NOS3 (p= 0.38) and this cell line exhibited a HCR similar to WT (30-fold) (Fig. 2).

Anoxic metabolism correlates with POR expression across a panel of 23 cancer cell lines.

11 Molecular Pharmacology Fast Forward. Published on October 7, 2011 as DOI: 10.1124/mol.111.073759 This article has not been copyedited and formatted. The final version may differ from this version. MOL #73759

To test for the presence of each diflavin oxidoreductase candidate in human neoplastic cultured cell lines, we first validated commercially sourced antibodies (suppl. Table S4) by western blotting using lysates obtained from parental and stably transfected HCT116 cell lines. We identified an anti-POR monoclonal antibody (mAb) which was more specific than the polyclonal antibody we used previously (Guise et al., 2007). Three NOS2A antibodies were analysed by western blot, only one of which showed NOS2A specific binding. We

also identified mAb targeting MTRR and NDOR1, which together with the POR and Downloaded from

NOS2A antibodies described above, were found specific for each of the four oxidoreductases (Fig. 3A). Background endogenous expression in parental HCT116 cells molpharm.aspetjournals.org was seen for POR, but not the other diflavin oxidoreductase candidates; despite this the

HCT116 POR cell line showed clear excess of the enzyme with an 8.5-fold increase

(POR/β-actin ratio) in protein levels by western blotting (Fig. 3A). We confirmed uniform expression of POR in the HCT116 WT cells during exposure to anoxia (suppl. Fig. S2). In at ASPET Journals on September 25, 2021 addition the maximum 6 h exposure time used in the IC50 assays yielded no change in plasmid-based expression levels of POR, MTRR, NDOR1 or NOS2A (suppl. Fig. S2)

We next examined the expression of the four diflavin oxidoreductases in a panel of 23 cancer cell lines (Fig. 3B). Only POR was found to be present at readily detectable levels across all 23 cell lines; expression varied considerably across the cell lines but POR mAb immunoreactivity was observed in all cases (Fig. 3B). No detectable bands were observed for MTRR, NDOR1 and NOS2A during initial analysis (Fig. 3B). A more aggressive analysis, where antibody concentrations higher than recommended were employed along with extended chemiluminescent substrate exposure times, showed modest expression of

NDOR1 in all 23 cell lines and weak bands corresponding to MTRR in several cell lines

(most apparent in Du145, A549, H69, MDA231 and PC3). No expression of NOS2A was

12 Molecular Pharmacology Fast Forward. Published on October 7, 2011 as DOI: 10.1124/mol.111.073759 This article has not been copyedited and formatted. The final version may differ from this version. MOL #73759 observed. A number of non-specific bands were observed for all three antibodies under these conditions (suppl. Fig. S3).

We have previously reported the rates of oxic metabolism of PR-104A in a 23 cell line panel (Guise et al., 2010). Here we measure the anoxia-specific (one electron) metabolism of PR-104A in each cell line by measuring the rates of metabolism under anoxic conditions

(suppl. Fig. S4A), and subtracting the paired rate of metabolism under oxic conditions Downloaded from

(Guise et al., 2010, reproduced in suppl. Fig. S4B). The calculated rates of anoxia-specific

PR-104A reduction across the 23 cell line panel are shown in Fig. 3C. The rate of anoxic molpharm.aspetjournals.org metabolism covered a 52-fold range, with a median value 17-fold higher than under oxic conditions. We next sought to determine if expression of POR correlated with levels of one electron reduction of PR-104A in the 23 cell line panel; analysis was based on the POR/β- actin ratios obtained from three independent western blots of the 23 cell line panel. The at ASPET Journals on September 25, 2021 hepatoma cell line HepG2 was a notable anomaly (Suppl. Fig. S5) and was excluded from the analysis whereupon the coefficient of determination for the remaining 22 cell lines was

0.712 (p < 0.001) (Fig 3D). The rate of PR-104A metabolism by the HCT116 POR cell line was consistent with this overall relationship (Suppl. Fig. S5).

PR-104A metabolism by diflavin oxidoreductases is sensitive to inhibition by the flavoenzyme inhibitor DPI

We have previously utilised DPI to show the dominant role of flavoenzymes in PR-104A metabolism in SiHa cells, with effective inhibition of reduced metabolite formation in both

WT and POR overexpressing anoxic cells (Guise et al., 2007). DPI is a mechanism-based irreversible inhibitor of POR that results in covalent phenylation of the active site

13 Molecular Pharmacology Fast Forward. Published on October 7, 2011 as DOI: 10.1124/mol.111.073759 This article has not been copyedited and formatted. The final version may differ from this version. MOL #73759

(O'Donnell et al., 1994). To determine the kinetics and magnitude of in vitro inhibition of

POR we measured the formation of PR-104H and PR-104M by LC/MS/MS in HCT116

POR cells as a function of DPI concentration and pre-incubation time (Fig. 4A). A unexpected finding was that addition of 100 μM DPI to PR-104A-containing medium without cells gave a 2.2-fold increase in the formation of reduced metabolites seen in the absence of DPI (Fig. 4A, dashed lines); this effect was not apparent with 3-10 μM DPI, but

the latter concentrations were less effective at inhibiting PR-104A reduction. Washing out Downloaded from

DPI prior to addition of PR-104A provided less effective inhibition of PR-104A metabolism

(Suppl. Fig. S6A). Based on these observations, subsequent experiments used 100 µM DPI molpharm.aspetjournals.org with a 60 minute pre-incubation time and DPI was maintained during PR-104A exposure.

DPI has previously been reported to inhibit POR (O'Donnell et al., 1994;Guise et al., 2007) and NOS2A (Mendes et al., 2001), but no data is available for MTRR or NDOR1. After at ASPET Journals on September 25, 2021 subtracting the cell-free values, DPI suppressed reduction of PR-104A by >95% for all four enzymes (Fig. 4B). DPI was without effect under aerobic conditions and no cell-free increase in the formation of reduced metabolites was evident (Suppl. Fig. S6B).

POR expression is heterogeneous in human tumour surgical samples and does not overlap with expression of the hypoxia marker CAIX.

Antigen authenticated antibodies against POR, MTRR, NDOR1 and NOS2A (Fig. 3A) were tested for utility on formalin fixed paraffin embedded (FFPE) cell pellets prepared from parental HCT116 cells and POR, MTRR, NDOR1 and NOS2A expressing cells. Only the anti-POR mAb showed clear increases in staining in the transfected cells as compared to

WT cells (Fig. 5). The MTRR, NDOR1 and NOS2A antibodies were thus not considered

14 Molecular Pharmacology Fast Forward. Published on October 7, 2011 as DOI: 10.1124/mol.111.073759 This article has not been copyedited and formatted. The final version may differ from this version. MOL #73759 sufficiently specific for use with FFPE processed tissues. The anti-POR mAb was further validated using FFPE tumour sections of HCT116 WT, POR overexpressing and POR null tumour xenografts, the latter using biallelic knockouts generated using a POR-specific zinc finger nuclease. IHC confirmed the excellent specificity of the antibody with no staining observed in the POR knockout xenograft, moderate staining in the WT xenograft and strong staining in the POR overexpressing xenograft (Fig. 6A). Use of the HCT116-PORnull FFPE

tissues confirmed the absence of false-positive staining and/or nonspecific background Downloaded from staining during antigen retrieval. In addition use of mouse IgG2A isotype control (R&D

Systems Inc.) confirmed the specificity of the staining procedure (data not shown). molpharm.aspetjournals.org

Four mixed cancer tissue microarrays (TMA) comprising 251 cases (251 cores) encompassing 19 common cancer types were stained for POR expression. POR expression was heterogeneous with no expression observed in six of the cancer types and a frequency at ASPET Journals on September 25, 2021 of expression ranging from 5% to 70% in the remaining thirteen cancers (Fig. 6B and Table

1). In total, 19% of the 251 cores in the mixed cancer array stained positive for POR; examples are shown in Fig. 6C. The most frequent expression was observed in ovarian and liver cancers. POR expression was generally not observed in prostate cancer cores, (2/17 positive), although striking expression was observed in a solitary core with a maximal H score of 300.

POR expression was next examined on six cancer specific arrays to obtain expanded data sets of disease types representative of high (ovary; liver), moderate (lung; pancreas) and low (prostate; endometrial) POR expression frequency. The additional array sets confirmed that the observed POR staining was consistent with the smaller samples from the mixed cancer arrays with the exception of endometrial cancer, which showed moderate to strong

15 Molecular Pharmacology Fast Forward. Published on October 7, 2011 as DOI: 10.1124/mol.111.073759 This article has not been copyedited and formatted. The final version may differ from this version. MOL #73759

POR expression in the expanded array versus no expression in the mixed cancer array (Fig.

6D and suppl. Table S6). Serial sections from these disease specific tissue arrays were also stained for the HIF1/UPR regulated carbonic anhydrase 9 (CAIX) protein, a reported biomarker of tissue hypoxia (Fig. 6D and suppl. Table S6; prostate TMAs excluded). The prostate cancer arrays were POR negative, with only 1 case out of 111 exhibiting weak

POR expression (H score of 20). In the TMAs stained for both POR and CAIX, 39% to

50% of disease-specific cores were negative for both these proteins. Remarkably, across the Downloaded from five TMA sets, individual cores which stained positive for POR typically stained negative for CAIX, and vice versa. Only a small percentage of cores were positive for both POR and molpharm.aspetjournals.org CAIX, in the order 12.6% in ovary, 9.4% endometrium, 9.3% lung, 8.2% in liver and 7.1% pancreas (see supplementary Table S6). Notably all five cancer types showed a high proportion of CAIX positive cores, in the order pancreas (50.0%), ovarian (42.1%), lung

(40.0%), endometrial (38.4%) and liver (29.9%). at ASPET Journals on September 25, 2021

Non-cancerous tissue cores were also present in the six expanded array sets, which were typically negative for both CAIX and POR although weak staining was observed in some pancreatic and ovarian cores and strong POR staining was observed in some normal and cirrhotic liver cores (see suppl. Table S6). A normal tissue TMA consisting of 33 cores identified seven normal tissues that stained positive for POR (suppl. Fig. S7 and suppl.

Table S7). With the exception of liver and thyroid, the intensity of normal tissue staining was less than the staining observed in positive tumour samples.

16 Molecular Pharmacology Fast Forward. Published on October 7, 2011 as DOI: 10.1124/mol.111.073759 This article has not been copyedited and formatted. The final version may differ from this version. MOL #73759

Discussion

Identification of the one-electron oxidoreductases responsible for metabolic activation of bioreductive prodrugs under hypoxic conditions is essential for their rational clinical development (Workman and Stratford, 1993). The observation that cytochrome P450 reductase (POR) is not the solitary hypoxic PR-104A reductase in SiHa cells (Guise et al.,

2007) prompted a search for additional candidates. Nine flavoenzymes were selected based Downloaded from on homology to POR or an established role in the activation of bioreductive drugs or other nitroaromatic compounds (suppl. Table S1). Amongst these, methionine synthase reductase molpharm.aspetjournals.org (MTRR), novel diflavin oxidoreductase 1 (NDOR1) and inducible nitric oxide synthase

(NOS2A) were identified as novel PR-104A oxidoreductases; all are diflavin oxidoreductases with homology to POR. Intracellular expression of these enzymes increased metabolism of PR-104A to its cytotoxic metabolites (Fig. 1B) and enhanced at ASPET Journals on September 25, 2021 sensitivity of the cells to PR-104A (Fig. 2C) in an anoxia-specific manner. Two of the enzymes, MTRR and NDOR1 represent novel bioreductive drug metabolising enzymes, whereas the POR-domain of NOS2A has previously been identified as catalysing the activation of the nitroaromatic compound CB1954 (Chandor et al., 2008), and the hypoxic cytotoxin tirapazamine (Chinje et al., 2003).

Having established the activity of these four PR-104A oxidoreductases by forced gene expression with detection by C-terminal V5-tag, commercial antibodies of confirmed specificity were used to probe a panel of 23 cell lines by western blotting. Endogenous expression levels of POR covered a 207-fold range (Fig. 3B) but only weak expression of

NDOR1 and MTRR was detected (Suppl. Fig S3) despite the role of these enzymes in maintaining biosynthesis of the essential amino acid methionine (Olteanu and Banerjee,

17 Molecular Pharmacology Fast Forward. Published on October 7, 2011 as DOI: 10.1124/mol.111.073759 This article has not been copyedited and formatted. The final version may differ from this version. MOL #73759

2003). These low endogenous expression levels, coupled with modest catalytic capacity for

PR-104A reduction despite robust stable expression, consistent with poor turnover rates with other non-physiological electron acceptors such as cytochrome c (Louerat-Oriou et al.,

1998), indicate a minor role for NDOR1 and MTRR in hypoxic PR-104A sensitivity in vitro. NOS2A expression was not observed in the cultured cancer cell lines (Fig. 3B and suppl. Fig. S3). The 75 kDa band observed for NOS2A in transfected HCT116 cells (Fig.

1D and 3A) has been documented previously (Ticconi et al., 2007). NOS3, was not shown Downloaded from to catalyse PR-104A reduction in transfected HCT116 cells, but weak expression prevented interpretation of this finding (Fig. 1A). molpharm.aspetjournals.org

Consistent with our findings, POR activity has been detected across the NCI 69 cell line panel although no correlation with bioreductive agent cytotoxicity was reported

(Fitzsimmons et al., 1996). In our 23 cell line panel, regression analysis showed a strong at ASPET Journals on September 25, 2021 correlation between POR expression and one-electron metabolism of PR-104A (Fig. 3D) but only when HepG2, a notable outlier, was excluded from the analysis (Suppl. Fig. S5).

The atypical properties of the hepatoma cell line HepG2 may reflect the presence of competing phase II pathways of biotransformation, such as PR-104A glucuronidation by

UGT2B7 (Gu et al., 2011b). Taken together, these data identify POR as a major PR-104A hypoxic oxidoreductase across human cell cultures in vitro and confirms the broad applicability of our earlier observation in a single cervical carcinoma cell line (SiHa) (Guise et al., 2007).

The PR-104A oxidoreductases identified in this study need to be considered as candidates for activation of PR-104A in human tumours, whether or not these enzymes are expressed in cultured cell lines. The available MTRR, NDOR1 and NOS2A antibodies failed to detect

18 Molecular Pharmacology Fast Forward. Published on October 7, 2011 as DOI: 10.1124/mol.111.073759 This article has not been copyedited and formatted. The final version may differ from this version. MOL #73759 expression in FFPE cells despite efficient detection by western blot of the relevant stable cell lines. In contrast, the POR monoclonal antibody exhibited suitably specific and robust characteristics for IHC of FFPE tissues. To confirm antibody sections of FFPE tissue from

HCT116 xenografts engineered to either over-express POR or null for POR expression were compared with parental (WT) samples at the optimal antibody concentration.

POR expression has previously been reported using polyclonal antibodies in normal human Downloaded from tissues (Hall et al., 1989), ovarian (Downie et al., 2005), hepatocellular (Philip et al., 1994), and bladder cancers (Gan et al., 2001), but to our knowledge this study represents the first molpharm.aspetjournals.org population level analysis of POR expression conducted utilising a fully validated monoclonal antibody, an essential but often overlooked requirement (Bordeaux et al.,

2010). Initial immunohistochemical analysis of 251 cores (251 cases) encompassing 19 common cancer types revealed a surprising variation in POR expression between tumours, at ASPET Journals on September 25, 2021 with heterogeneous low frequency expression, such that only 19.1% of tissue cores provided an H-score greater than zero (Fig. 6B). The highest frequency of positive cases was seen for hepatocellular carcinoma (66%) followed by ovarian carcinoma (50%).

POR expression is only relevant to PR-104A activation when it occurs in hypoxic tissue. As a first step towards testing whether this requirement is met, we compared staining of POR and the HIF/UPR regulated target gene carbonic anhydrase 9 (CAIX), a surrogate biomarker of tissue hypoxia (van den et al., 2009). Overall the frequency of CAIX staining was consistent with previous findings (Ivanov et al., 2001). Evaluation of 512 cores (358 cases) across five cancer types revealed POR to be low or absent in the majority of CAIX positive cores; out of 137 (26.6%) POR positive cores only 49 (9.6%) expressed any detectable CAIX (H-score > 0). Moreover, only five of these cores (1%) had H-scores of ≥

19 Molecular Pharmacology Fast Forward. Published on October 7, 2011 as DOI: 10.1124/mol.111.073759 This article has not been copyedited and formatted. The final version may differ from this version. MOL #73759

100 for both antigens. Some caution is warranted when interpreting these findings given that TMA cores are typically harvested from viable tumour regions (away from necrosis) and thus may not be representative of the most hypoxic tumour regions. Conversely not all

CAIX expression is a direct result of hypoxic induction via HIF/UPR regulation, due to the prevalence of alternate (oxygen-independent) mechanisms (Kaluz et al., 2009). Currently it is unclear whether the poor overlap between POR and CAIX expression is causal or

correlative. Whilst various mechanisms are possible, for example, suppression of POR Downloaded from mRNA translation by hypoxia/anoxia in an eIF2a/eIF4F dependent manner (Koumenis and

Wouters, 2006), loss of POR expression has also been associated more generally with molpharm.aspetjournals.org advancing stage (Philip et al., 1994). Detailed additional analysis of complete tumour sections will be required to fully elucidate the frequency and spatial relationship of these two markers, preferably in patients where hypoxia markers such as the 2-nitroimidazole

EF5 has been administered prior to surgery (Evans et al., 2006). at ASPET Journals on September 25, 2021

Cumulative scoring across both the mixed cancer arrays and the disease specific arrays showed only 21% of cores (185 of 874), encompassing 685 cases, were positive for POR expression (i.e. H-score > 0). Thus while POR has a well described role in the activation of

PR-104A and other bioreductive prodrugs in long term in vitro adapted cell cultures, its relatively low frequency in human surgical tumour samples raises important questions about the value of determining POR tumour expression in clinical trials of bioreductive prodrugs. Besides PR-104A, POR has been reported to metabolise other bioreductive prodrugs in development, such as TH-302 (Weiss et al., 2011), apaziquone (Bailey et al.,

2001), RH1 (Begleiter et al., 2007), NLCQ-1 (Papadopoulou et al., 2003) and tirapazamine

(Patterson et al., 1998). We hypothesise that other oxidoreductases, in addition to POR, are

20 Molecular Pharmacology Fast Forward. Published on October 7, 2011 as DOI: 10.1124/mol.111.073759 This article has not been copyedited and formatted. The final version may differ from this version. MOL #73759 likely to be clinically relevant and we are currently exploring an expanded library of flavoenzyme candidates.

The evidence for aerobic activation of PR-104A by human AKR1C3 (Guise et al., 2010) coupled with its oxygen-independent reductive activation in murine liver (Gu et al., 2011a) indicates that PR-104A has limited selectivity for hypoxic tissues. Nevertheless, PR-104A

possesses utility as a prototypic prodrug to aid the discovery of one-electron metabolism by Downloaded from novel one-electron oxidoreductases, the identity of which has broad applicability to bioreductive agents in general. For example, we have observed that MTRR-expressing molpharm.aspetjournals.org HCT116 cells are more sensitive than POR-expressing cells to TH-302 and tirapazamine under anoxia, suggesting more detailed evaluation of MTRR enzymology and tissue distribution is warranted in the context of these agents (Guise and Patterson, unpublished observations). Currently the lack of informative antibodies for detection of MTRR in FFPE at ASPET Journals on September 25, 2021 tissues is a limitation. Open access databases such as oncomine show that MTRR mRNA is widely (although variably) expressed in many human tumours, often at levels well above the median transcript. TH-302, a hypoxia-selective 2-nitroimidazole triggered isophosphoramidate mustard currently undergoing phase II/III clinical evaluation, shows considerable promise yet the identity of the activating oxidoreductases is unknown. An analogue of tirapazamine (SN30000, CEN-209) optimised for maximal tissue penetration is in late preclinical development (Hicks et al., 2010), but again the activating enzymes have not been elucidated.

The future clinical utility of hypoxia-activated cytotoxins will inevitably depend upon identifying the confluence of all key determinants of sensitivity including; the presence of therapy-limiting hypoxic cells, the complement of one-electron oxidoreductases necessary

21 Molecular Pharmacology Fast Forward. Published on October 7, 2011 as DOI: 10.1124/mol.111.073759 This article has not been copyedited and formatted. The final version may differ from this version. MOL #73759 for metabolic reduction of prodrugs in these cells, and the intrinsic sensitivity of these cells to the resulting prodrug-mediated DNA damage. Only when this individualisation of treatment is achieved will hypoxia-activated cytotoxins be well placed to improve treatment outcomes.

Downloaded from molpharm.aspetjournals.org at ASPET Journals on September 25, 2021

22 Molecular Pharmacology Fast Forward. Published on October 7, 2011 as DOI: 10.1124/mol.111.073759 This article has not been copyedited and formatted. The final version may differ from this version. MOL #73759

Acknowledgments

We thank Annika Foehrenbacher for assistance with tumour implantations and Graham

Atwell and Prof. William Denny for provision of PR-104A

Authorship contributions

Participated in research design: Patterson, Guise, Abbattista, Tipparaju, Wilson, Dachs

Conducted experiments: Guise, Abbattista, Tipparaju, Dachs Downloaded from Contributed new reagents or analytical tools: Guise, Abbattista, Li, Su, Wilson, Dachs

Performed data analysis: Guise, Patterson, Lambie, Dachs

Wrote or contributed to the writing of the manuscript: Patterson, Guise, Wilson, Dachs molpharm.aspetjournals.org at ASPET Journals on September 25, 2021

23 Molecular Pharmacology Fast Forward. Published on October 7, 2011 as DOI: 10.1124/mol.111.073759 This article has not been copyedited and formatted. The final version may differ from this version. MOL #73759

References

Bailey SM, Lewis A D, Patterson L H, Fisher G R, Knox R J and Workman P (2001)

Involvement of NADPH: Cytochrome P450 Reductase in the Activation of Indoloquinone

EO9 to Free Radical and DNA Damaging Species. Biochem Pharmacol 62: pp 461-468.

Begleiter A, Leith M K, Patel D and Hasinoff B B (2007) Role of NADPH Cytochrome Downloaded from P450 Reductase in Activation of RH1. Cancer Chemotherapy & Pharmacology 60: pp 713-

723.

Bordeaux J, Welsh A, Agarwal S, Killiam E, Baquero M , Hanna J, Anagnostou V and molpharm.aspetjournals.org

Rimm D (2010) Antibody Validation [Erratum Appears in Biotechniques. 2010

May;48(5):351]. Biotechniques 48: pp 197-209.

Chandor A, Dijols S, Ramassamy B, Frapart Y, Mansuy D, Stuehr D, Helsby N and at ASPET Journals on September 25, 2021

Boucher J L (2008) Metabolic Activation of the Antitumor Drug 5-(Aziridin-1-Yl)-2,4-

Dinitrobenzamide (CB1954) by NO Synthases. Chem Res Toxicol 21: pp 836-843.

Chen Y and Hu L (2009) Design of Anticancer Prodrugs for Reductive Activation. Med Res

Rev 29: pp 29-64.

Chinje EC, Cowen R L, Feng J, Sharma S P, Wind N S, Harris A L and Stratford I J (2003)

Non-Nuclear Localized Human NOSII Enhances the Bioactivation and Toxicity of

Tirapazamine (SR4233) in Vitro. Mol Pharmacol 63: pp 1248-1255.

Dachs GU, Kano M, Volkova E, Morrin H R, Davey V C, Harris G C, Cheale M, Frampton

C, Currie M J, Wells J E and Robinson B A (2010) A Profile of Prognostic and Molecular

Factors in European and Maori Breast Cancer Patients. BMC Cancer 10: pp 543.

24 Molecular Pharmacology Fast Forward. Published on October 7, 2011 as DOI: 10.1124/mol.111.073759 This article has not been copyedited and formatted. The final version may differ from this version. MOL #73759

Downie D, McFadyen M C, Rooney P H, Cruickshank M E, Parkin D E, Miller I D, Telfer

C, Melvin W T and Murray G I (2005) Profiling Cytochrome P450 Expression in Ovarian

Cancer: Identification of Prognostic Markers. Clin Cancer Res 11: pp 7369-7375.

Evans SM, Schrlau A E, Chalian A A, Zhang P and Koch C J (2006) Oxygen Levels in

Normal and Previously Irradiated Human Skin As Assessed by EF5 Binding. J Invest

Dermatol 126: pp 2596-2606. Downloaded from

Fitzsimmons SA, Workman P, Grever M, Paull K, Camalier R and Lewis A D (1996)

Reductase Enzyme Expression Across the National Cancer Institute Tumor Cell Line Panel:

Correlation With Sensitivity to Mitomycin C and EO9. J Natl Cancer Inst 88: pp 259-269. molpharm.aspetjournals.org

Gan Y, Mo Y, Kalns J E, Lu J, Danenberg K, Danenberg P, Wientjes M G and Au J L

(2001) Expression of DT-Diaphorase and Cytochrome P450 Reductase Correlates With

Mitomycin C Activity in Human Bladder Tumors. Clin Cancer Res 7: pp 1313-1319. at ASPET Journals on September 25, 2021

Gu Y, Guise C P, Patel K, Abbattista M R, Lie J, Sun X, Atwell G J, Boyd M, Patterson A

V and Wilson W R (2011a) Reductive Metabolism of the Dinitrobenzamide Mustard

Anticancer Prodrug PR-104 in Mice. Cancer Chemother Pharmacol 67: pp 543-555.

Gu Y, Tingle M D and Wilson W R (2011b) Glucuronidation of Anticancer Prodrug PR-

104A: Species differences, identification of human UDP-glucuronosyltransferases and implications for therapy. J Pharmacol Exp Ther 337: pp 692-702.

Gu Y, Patterson A V, Atwell G J, Chernikova S B, Brown J M, Thompson L H and Wilson

W R (2009) Roles of DNA Repair and Reductase Activity in the Cytotoxicity of the

Hypoxia-Activated Dinitrobenzamide Mustard PR-104A. Mol Cancer Ther 8: pp 1714-

1723.

25 Molecular Pharmacology Fast Forward. Published on October 7, 2011 as DOI: 10.1124/mol.111.073759 This article has not been copyedited and formatted. The final version may differ from this version. MOL #73759

Guise CP, Abbattista M, Singleton R S, Holford S D, Connolly J, Dachs G U, Fox S B,

Pollock R, Harvey J, Guilford P, Doñate F, Wilson W R and Patterson A V (2010) The

Bioreductive Prodrug PR-104A Is Activated Under Aerobic Conditions by Human Aldo-

Keto Reductase 1C3. Cancer Res 70: pp 1573-1584.

Guise CP, Wang A, Thiel A, Bridewell D, Wilson W R and Patterson A V (2007)

Identification of Human Reductases That Activate the Dinitrobenzamide Mustard Prodrug Downloaded from PR-104A: a Role for NADPH:Cytochrome P450 Oxidoreductase Under Hypoxia . Biochem

Pharmacol 74 : pp 810-820.

Hall PM, Stupans I, Burgess W, Birkett D J and McManus M E (1989) molpharm.aspetjournals.org

Immunohistochemical Localization of NADPH-Cytochrome P450 Reductase in Human

Tissues. Carcinogenesis 10: pp 521-530.

Hicks KO, Siim B G, Jaiswal J K, Pruijn F B, Fraser A M, Patel R, Hogg A, Liyanage H D at ASPET Journals on September 25, 2021

S, Dorie M J, Brown J M, Denny W A, Hay M P and Wilson W R (2010)

Pharmacokinetic/Pharmacodynamic Modeling Identifies SN30000 and SN29751 As

Tirapazamine Analogues With Improved Tissue Penetration and Hypoxic Cell Killing in

Tumors. Clin Cancer Res 16: pp 4946-4957.

Ivanov S, Liao S Y, Ivanova A, Danilkovitch-Miagkova A, Tarasova N, Weirich G, Merrill

M J, Proescholdt M A, Oldfield E H , Lee J, Zavada J, Waheed A, Sly W, Lerman M I and

Stanbridge E J (2001) Expression of Hypoxia-Inducible Cell-Surface Transmembrane

Carbonic Anhydrases in Human Cancer. Am J Pathol 158: pp 905-919.

Jameson MB, Rischin D, Pegram M, Gutheil J, Patterson A V, Denny W A and Wilson W

R (2010) A Phase I Trial of PR-104, a Nitrogen Mustard Prodrug Activated by Both

26 Molecular Pharmacology Fast Forward. Published on October 7, 2011 as DOI: 10.1124/mol.111.073759 This article has not been copyedited and formatted. The final version may differ from this version. MOL #73759

Hypoxia and Aldo-Keto Reductase 1C3, in Patients With Solid Tumors. Cancer Chemother

Pharmacol 65: pp 791-801.

Kaluz S, Kaluzova M, Liao S Y, Lerman M and Stanbridge E J (2009) Transcriptional

Control of the Tumor- and Hypoxia-Marker Carbonic Anhydrase 9: A One Transcription

Factor (HIF-1) Show?. Biochim Biophys Acta 1795: pp 162-172.

Koumenis C and Wouters B G (2006) "Translating" Tumor Hypoxia: Unfolded Protein Downloaded from

Response (UPR)-Dependent and UPR-Independent Pathways. Molecular Cancer Research:

MCR 4: pp 423-436. molpharm.aspetjournals.org Louerat-Oriou B, Perret A and Pompon D (1998) Differential Redox and Electron-Transfer

Properties of Purified Yeast, Plant and Human NADPH-Cytochrome P-450 Reductases

Highly Modulate Cytochrome P-450 Activities. Eur J Biochem 258: pp 1040-1049.

Mendes AF, Carvalho A P, Caramona M M and Lopes M C (2001) Diphenyleneiodonium at ASPET Journals on September 25, 2021

Inhibits NF-KappaB Activation and INOS Expression Induced by IL-1beta: Involvement of

Reactive Oxygen Species. Mediators of Inflammation 10: pp 209-215.

Murataliev, M. B., Feyereisen, R., and Walker, F. A (2004). Electron transfer by diflavin reductases. Biochim Biophys Acta 1698: pp 1-24.

O'Donnell VB, Smith G C and Jones O T (1994) Involvement of Phenyl Radicals in

Iodonium Inhibition of Flavoenzymes. Mol Pharmacol 46: pp 778-785.

Olteanu H and Banerjee R (2003) Redundancy in the Pathway for Redox Regulation of

Mammalian Methionine Synthase: Reductive Activation by the Dual Flavoprotein, Novel

Reductase 1. J Biol Chem 278: pp 38310-38314.

27 Molecular Pharmacology Fast Forward. Published on October 7, 2011 as DOI: 10.1124/mol.111.073759 This article has not been copyedited and formatted. The final version may differ from this version. MOL #73759

Papadopoulou, M. V., Ji, M., Rao, M. K., and Bloomer, W. D (2003). Reductive activation of the nitroimidazole-based hypoxia-selective cytotoxin NLCQ-1 (NSC 709257). Oncology

Research 14, 21-29.

Patterson AV, Ferry D M, Edmunds S J, Gu Y, Singleton R S, Patel K, Pullen S M, Hicks K

O, Syddall S P, Atwell G J, Yang S, Denny W A and Wilson W R (2007) Mechanism of

Action and Preclinical Antitumor Activity of the Novel Hypoxia-Activated DNA Downloaded from Crosslinking Agent PR-104. Clin Cancer Res 13: pp 3922-3932.

Patterson AV, Saunders M P, Chinje E C, Patterson L H and Stratford I J (1998)

Enzymology of Tirapazamine Metabolism: a Review. Anticancer Drug Des 13: pp 541-573. molpharm.aspetjournals.org

Patterson LH and McKeown S R (2000) AQ4N: a New Approach to Hypoxia-Activated

Cancer Chemotherapy. Br J Cancer 83: pp 1589-1593.

Philip PA, Kaklamanis L, Ryley N, Stratford I, Wolf R, Harris A and Carmichael J (1994) at ASPET Journals on September 25, 2021

Expression of Xenobiotic-Metabolizing Enzymes by Primary and Secondary Hepatic

Tumors in Man. Int J Radiat Oncol Biol Phys 29: pp 277-283.

Rischin D, Peters L J, O'Sullivan B, Giralt J, Fisher R, Yuen K, Trotti A, Bernier J,

Bourhis J, Ringash J, Henke M and Kenny L (2010) Tirapazamine, Cisplatin, and Radiation

Versus Cisplatin and Radiation for Advanced Squamous Cell Carcinoma of the Head and

Neck (TROG 02.02, HeadSTART): A Phase III Trial of the Trans-Tasman Radiation

Oncology Group. J Clin Oncol 28: pp 2989-2995.

Singleton RS, Guise C P, Ferry D M, Pullen S M, Dorie M J, Brown J M, Patterson A V and Wilson W R (2009) DNA Crosslinks in Human Tumor Cells Exposed to the Prodrug

PR-104A: Relationships to Hypoxia, Bioreductive Metabolism and Cytotoxicity. Cancer

Res 69: pp 3884-3891.

28 Molecular Pharmacology Fast Forward. Published on October 7, 2011 as DOI: 10.1124/mol.111.073759 This article has not been copyedited and formatted. The final version may differ from this version. MOL #73759

Ticconi C, Zicari A, Belmonte A, Realacci M, Rao C and Piccione E (2007) Pregnancy-

Promoting Actions of HCG in Human Myometrium and Fetal Membranes. Placenta 28

Suppl A: pp S137-S143. van den BT, Koritzinsky M, Niessen H, Dubois L, Savelkouls K, Mujcic H, Jutten B,

Kopacek J, Pastorekova S, van der Kogel A J, Lambin P, Voncken W, Rouschop K M and

Wouters B G (2009) Hypoxia-Induced Expression of Carbonic Anhydrase 9 Is Dependent Downloaded from on the Unfolded Protein Response. J Biol Chem 284: pp 24204-24212.

Vaupel P and Mayer A (2007) Hypoxia in Cancer: Significance and Impact on Clinical

Outcome. Cancer Metastasis Rev 26: pp 225-239. molpharm.aspetjournals.org

Weiss GJ, Infante J R, Chiorean E G, Borad M J, Bendell J C, Molina J R, Tibes R,

Ramanathan R K, Lewandowski K, Jones S F, Lacouture M E, Langmuir V K, Lee H, Kroll

S and Burris H A, III (2011) Phase 1 Study of the Safety, Tolerability and Pharmacokinetics at ASPET Journals on September 25, 2021 of TH-302, a Hypoxia-Activated Prodrug, in Patients With Advanced Solid Malignancies.

Clin Cancer Res 17: pp 2997-3004.

Wilson WR and Hay M P (2011) Targeting Hypoxia in Cancer Therapy. Nat Rev Cancer

11: pp 393-410.

Workman P and Stratford I J (1993) The Experimental Development of Bioreductive Drugs and Their Role in Cancer Therapy. Cancer Metastasis Rev 12: pp 73-82.

29 Molecular Pharmacology Fast Forward. Published on October 7, 2011 as DOI: 10.1124/mol.111.073759 This article has not been copyedited and formatted. The final version may differ from this version. MOL #73759

Footnotes

This research was supported by the Health Research Council of New Zealand [Grant 08/103]. Oncomine database: www.oncomine.org

Conflict of Interest Statement: WRW is a founding scientist, stockholder and consultant to

Proacta Inc, which is undertaking the clinical development of PR-104. AVP is a consultant to and has stock options in Proacta Inc. Downloaded from molpharm.aspetjournals.org at ASPET Journals on September 25, 2021

30 Molecular Pharmacology Fast Forward. Published on October 7, 2011 as DOI: 10.1124/mol.111.073759 This article has not been copyedited and formatted. The final version may differ from this version. MOL #73759

Legends for Figures.

Figure 1. PR-104A is activated under anoxic conditions by four diflavin oxidoreductase family members. (A) Detection of candidate reductase enzymes in overexpressing HCT116 cell lines by western blotting. COOH-terminal V5 tags were transiently expressed using an adenoviral TAG suppressor tRNA (Tag-on-demand, Invitrogen; multiplicity of infection 50,

24 h). (B) Formation of reduced metabolites of PR-104A (sum of PR-104H and PR-104M) Downloaded from under anoxic conditions in HCT116 WT cells and HCT116 cells overexpressing candidate mammalian reductases. Metabolite formation was calculated after addition of PR-104A

(100 µM, 1 hr), values are the mean changes in anoxic metabolism relative to HCT116 WT molpharm.aspetjournals.org controls (n=3). The average value for reduced PR-104H and PR-104M metabolites in

HCT116 WT cells under anoxic conditions was 406 ± 38 pmol/106 cells (mean ± SEM, n=12). Error bars represent the SEM; * p < 0.05, ** p < 0.01.

at ASPET Journals on September 25, 2021

Figure 2. Cells expressing diflavin oxidoreductases are sensitised to PR-104A under anoxic conditions. (A) Schematic representation of the six human diflavin oxidoreductase family members. (B and C) IC50 values of PR-104A following a 4 h oxic (B) or anoxic (C) exposure in HCT116 WT and overexpressing cell lines (n=5). Error bars represent the

SEM; * p < 0.05, ** p < 0.01.

Figure 3. Comparison between diflavin oxidoreductase expression profiles and anoxic- specific metabolism of PR-104A in a human cancer cell line panel. (A) Detection of diflavin oxidoreductases in overexpressing cell lines by western blotting using specific antibodies and V5 tag detection. COOH-terminal V5 tags were transiently expressed using and adenoviral TAG suppressor tRNA (Tag-on-demand, Invitrogen; multiplicity of infection 50, 24 h). (B) Detection of POR, MTRR, NDOR1 and NOS2A in a panel of

31 Molecular Pharmacology Fast Forward. Published on October 7, 2011 as DOI: 10.1124/mol.111.073759 This article has not been copyedited and formatted. The final version may differ from this version. MOL #73759 cancer cell lines by western blotting. Lysates of HCT116 cells overexpressing diflavin reductases were included in the control lanes (C) Anoxia-specific metabolism of PR-104A

(100 µM, 1 h) in the same panel of cell lines, by LC/MS/MS quantification of PR-104H and

PR-104M. Values are means and error bars show the SEM for total metabolites from two to eight experiments. (D) Correlation between Anoxia-specific PR-104A metabolism and POR expression (normalised to actin; values are means and SEM from three western blots).

Downloaded from

Figure 4. PR-104A activation by diflavin oxidoreductases is inhibited by the flavoenzyme inhibitor DPI. (A) Effect of increasing DPI concentrations and length of DPI pre-treatment molpharm.aspetjournals.org on the level of PR-104A metabolism in the HCT116 POR cell line under anoxic conditions.

The upper dashed line shows the level of PR-104A metabolites detected in the HCT116

POR cell line in the absence of DPI. The lower dashed line shows the level of PR-104A metabolites detected in the media only (no cells) control wells in the absence of DPI. The at ASPET Journals on September 25, 2021 middle dashed line shows the level of PR-104A metabolites detected in the media only (no cells) control wells in the presence of 100 µM DPI. Values are the mean of triplicate samples and the error bars show the SEM. (B) Effect of 100 µM DPI on the anoxic metabolism of PR-104A (100 µM, 1 h) in HCT116 WT and reductase overexpressing cell lines. Values are means of three independent experiments and the error bars show the SEM.

Figure 5. Validation of antibodies against POR (A), MTRR (B), NDOR1 (C) and NOS2A

(D) on formalin fixed paraffin embedded cell plugs.

Figure 6. Evaluation of POR and CAIX expression in human tumour surgical samples.

POR expression was determined using a 1:50 dilution of antibody and CAIX expression was determined using a 1:1000 dilution of antibody. (A) Validation of the POR antibody on

32 Molecular Pharmacology Fast Forward. Published on October 7, 2011 as DOI: 10.1124/mol.111.073759 This article has not been copyedited and formatted. The final version may differ from this version. MOL #73759 formalin fixed paraffin embedded sections of parental (WT), POR overexpressing and POR null (gene knockout) HCT116 tumour xenografts. (B) Immunohistochemical evaluation of

POR expression in four mixed cancer tissue microarrays. Frequencies of POR+ve cores (H score >0) are shown on the top axis. The plotted points show individual scores for the positive cores. (C) Examples of POR staining in a subset of tumour types. Numbers show the H score of each core. (D) Comparison of POR and CAIX staining in cancer-specific

tissue microarrays. The intensity of staining (H score) of serial sections of each core was Downloaded from graded from 0-300 for each antibody.

molpharm.aspetjournals.org at ASPET Journals on September 25, 2021

33 Molecular Pharmacology Fast Forward. Published on October 7, 2011 as DOI: 10.1124/mol.111.073759 This article has not been copyedited and formatted. The final version may differ from this version. MOL #73759

Table 1. Frequency and intensity of POR staining in the mixed cancer tumour microarrays a

Frequency and intensity of POR staining Max staining intensity b Total % positive positive H-scores of positive cores c 3 2 1 0 Cancer type cores cores Bladder 3 1 12 4/16 25 100, 40, 30, 16 Bowel 1 18 1/19 5 85 Brain 1 5 1/6 17 150 Breast 3 1 15 4/19 21 120, 90, 60, 8, Endometrium 1 9 1/10 10 15 Esophageal 1 9 1/10 10 12

Gall bladder 10 0/10 0 Downloaded from Kidney 18 0/18 0 Larynx 8 0/8 0 Liver 4 2 3 6/9 67 170, 140, 80, 50, 38, 20 Lung 1 3 1 15 5/20 25 110, 90, 40, 40, 10

Lymphoma (malignant) 10 0/10 0 molpharm.aspetjournals.org Melanoma (malignant) 12 0/12 0 Ovary d 3 6 1 10 10/20 50 255, 150, 135, 110, 80, 60, 16, 10, 4, 4 Pancreas 4 9 4/13 31 85, 60, 20, 5 Prostate 1 1 15 2/17 12 300, 10 Stomach 10 0/10 0 Thyroid 7 3 7/10 70 30, 20, 15, 10, 10, 10, 10 Uterine cervix 2 12 2/14 14 140, 70

at ASPET Journals on September 25, 2021 a Details of the mixed cancer arrays (MA2, MB3, MC2 and CSTB-01) are provided in suppl. Table S5. b POR staining within tumours was graded on a four point scale; 0 = no staining, 1 = weak staining, 2 = intermediate staining and 3 = strong staining. c The H score for each sample was generated from the staining intensities observed in each core, see methods for H-score calculation. d One ovarian core recorded POR staining in the stromal cells (grade 3 in 8%)

34 Molecular Pharmacology Fast Forward. Published on October 7, 2011 as DOI: 10.1124/mol.111.073759 This article has not been copyedited and formatted. The final version may differ from this version. Downloaded from molpharm.aspetjournals.org at ASPET Journals on September 25, 2021 Molecular Pharmacology Fast Forward. Published on October 7, 2011 as DOI: 10.1124/mol.111.073759 This article has not been copyedited and formatted. The final version may differ from this version. Downloaded from molpharm.aspetjournals.org at ASPET Journals on September 25, 2021 Molecular Pharmacology Fast Forward. Published on October 7, 2011 as DOI: 10.1124/mol.111.073759 This article has not been copyedited and formatted. The final version may differ from this version. Downloaded from molpharm.aspetjournals.org at ASPET Journals on September 25, 2021 Molecular Pharmacology Fast Forward. Published on October 7, 2011 as DOI: 10.1124/mol.111.073759 This article has not been copyedited and formatted. The final version may differ from this version. Downloaded from molpharm.aspetjournals.org at ASPET Journals on September 25, 2021 Molecular Pharmacology Fast Forward. Published on October 7, 2011 as DOI: 10.1124/mol.111.073759 This article has not been copyedited and formatted. The final version may differ from this version. Downloaded from molpharm.aspetjournals.org at ASPET Journals on September 25, 2021 Molecular Pharmacology Fast Forward. Published on October 7, 2011 as DOI: 10.1124/mol.111.073759 This article has not been copyedited and formatted. The final version may differ from this version. Downloaded from molpharm.aspetjournals.org at ASPET Journals on September 25, 2021 Supplementary Material

Journal: Molecular Pharmacology

Diflavin Oxidoreductases Activate the Bioreductive Prodrug PR-104A Under

Hypoxia.

Christopher P. Guise, Maria R. Abbattista, Smitha R. Tipparaju, Neil K Lambie, Jiechuang

Su, Dan Li, William R. Wilson, Gabi U. Dachs, and Adam V. Patterson.

Table of contents

Table S1: List of candidate PR-104A oxidoreductases 2 Table S2: Suppliers and types of human tumour cell lines 5 Table S3: Clone ID 6 Table S4: Antibodies used 7 Table S5: List of high density tumour microarrays (TMAs) 8 Figure S1: Aerobic PR-104A metabolism in reductase expressing cell lines 9 Figure S2: Diflavin reductase expression does not change under anoxia 10 Figure S3: Additional western blot exposures 11 Figure S4: Anoxic and aerobic metabolism of PR-104A in 23 cell lines 12 Figure S5: Correlation between POR expression and metabolism 13 Figure S6: Additional DPI controls 14 Table S6: Analysis of POR and CAIX in the expanded arrays 15 Table S7: Analysis of POR in the normal tissue array 16 Figure S7: POR staining in the normal tissue array 17

1

Supplementary table S1. Candidate enzymes involved in, or predicted to be involved in, metabolism of bioreductive drugs.

Common name Symbol Co- 1 or Substrates References (E.C.) factor 2- e § NADH: CYB5R3 FAD 1e MMC (Hodnick and Sartorelli, ferricytochrome (1.6.2.2) 2e RB90740 1993;Barham and Stratford, b reductase 5 1996;Seow et al., 2005) Cytochrome (c) POR FAD 1e Many (Meng et al., 2010;Bailey et al., P450 reductase (1.6.2.4) FMN 2001;Begleiter et al., 2007;Papadopoulou et al., 2003;Patterson et al., 1997;Hubbard et al., 2001;Munro et al., 2001) Adrenodoxin FDXR FAD 1e (Miskiniene et al., 1997;Jiang et al., reductase (1.18.1.2) 2001) Methionine MTRR FAD 1e (Olteanu and Banerjee, 2001;Olteanu synthase (1.16.1.8) FMN and Banerjee, 2001) reductase Diflavin NDOR1 FAD 1e (Jessop and Bulleid, 2004) oxidoreductase-1 (1.6.2) FMN Nitric oxide NOS2A FAD 1e Many (Stuehr, 1999;Chandor et al., synthase, (1.14.13.39) FMN 2008;Chinje et al., 2003;Nishida and inducible heme Ortiz de Montellano, 2008;Garner et al., 1999;Jiang et al., 2000;Matsuda et al., 2000) Nitric oxide NOS3 FAD 1e CB1954 (Stuehr, 1999;Chandor et al., synthase, (1.14.13.39) FMN 2008;Garner et al., 1999;Jiang et al., endothelial heme 2000;Matsuda et al., 2000) NAD(P)H: NQO1 FAD 2e Many (Knox et al., 1992;Patterson et al., quinone (1.6.5.2) 1998;Seow et al., 2004;Sharp et al., oxidoreductase 1 2000;Danson et al., 2004;Knox and Chen, 2004) NAD(P)H: NQO2 FAD 2e Many (Wu et al., 1997;Jamieson et al., quinone (1.10.99.2) 2006;Yan et al., 2008;Knox and oxidoreductase 2 Chen, 2004) Xanthine XDH FAD 1e Many (Stucker et al., 1991;Yan et al., dehydrogenase (1.17.1.4) FeS 2e 2008;Kutcher and McCalla, Xanthine XO# Molyb 1984;Hille and Nishino, oxidase# (1.17.3.2) 1995;Maliepaard et al., 1995;Pan et al., 1984)

# degraded enzyme form. §Abbreviations: TPZ = tirapazamine; AQ4N = banoxantrone; MMC = mitomycin C

Bailey SM, Lewis A D, Patterson L H, Fisher G R, Knox R J and Workman P (2001) Involvement of NADPH: Cytochrome P450 Reductase in the Activation of Indoloquinone EO9 to Free Radical and DNA Damaging Species. Biochem Pharmacol 62: pp 461-468.

Barham HM and Stratford I J (1996) Enzymology of the Reduction of the Novel Fused Pyrazine Mono-n-Oxide Bioreductive Drug, RB90740 Roles for P450 Reductase and Cytochrome B5 Reductase. Biochem Pharmacol 51: pp 829-837.

2

Begleiter A, Leith M K, Patel D and Hasinoff B B (2007) Role of NADPH Cytochrome P450 Reductase in Activation of RH1. Cancer Chemotherapy & Pharmacology 60: pp 713-723.

Chandor A, Dijols S, Ramassamy B, Frapart Y, Mansuy D, Stuehr D, Helsby N and Boucher J L (2008) Metabolic Activation of the Antitumor Drug 5-(Aziridin-1-Yl)-2,4-Dinitrobenzamide (CB1954) by NO Synthases. Chem Res Toxicol 21: pp 836-843.

Chinje EC, Cowen R L, Feng J, Sharma S P, Wind N S, Harris A L and Stratford I J (2003) Non-Nuclear Localized Human NOSII Enhances the Bioactivation and Toxicity of Tirapazamine (SR4233) in Vitro. Mol Pharmacol 63: pp 1248-1255.

Danson S, Ward T H, Butler J and Ranson M (2004) DT-Diaphorase: a Target for New Anticancer Drugs. Cancer Treat Rev 30: pp 437-449.

Hodnick WF and Sartorelli A C (1993) Reductive Activation of Mitomycin C by NADH:Cytochrome B5 Reductase. Cancer Res 53: pp 4907-4912.

Jamieson, D., Tung, A. T. Y., Knox, R. J., and Boddy, A. V. (2006) Reduction of mitomycin C is catalysed by human recombinant NRH:quinone oxidoreductase 2 using reduced nicotinamide adenine dinucleotide as an electron donating cofactor. British Journal of Cancer 95[9]: pp 1229-1233.

Knox RJ, Friedlos F, Sherwood R F, Melton R G and Anlezark G M (1992) The Bioactivation of 5-(Aziridin-1- Yl)-2,4-Dinitrobenzamide (CB1954) - II. A Comparison of an Eschericia Coli Nitroreductase and Walker DT Diaphorase. Biochem Pharmacol 44: pp 2297-2301.

Kutcher WW and McCalla D R (1984) Aerobic Reduction of 5-Nitro-2-Furaldehyde Semicarbazone by Rat Liver Xanthine Dehydrogenase. Biochem Pharmacol 33: pp 799-805.

Meng, F., Matteucci, J. V., Bhupathi, D., Jung, D., Hart, C. P., and Matteucci, M. V. (2010) NADPH- cytochrome P450 reductase reduction of TH-302, a hypoxia-activated prodrug. Abstract 2263. Proceedings of the 101st Annual Meeting of the American Association for Cancer Research.

Miskiniene V, Dickancaite E, Nemeikaite A and Cenas N (1997) Nitroaromatic Betulin Derivatives As Redox Cycling Agents. Biochem Mol Biol Int 42: pp 391-397.

Nishida CR and Ortiz de Montellano P R (2008) Reductive Heme-Dependent Activation of the N-Oxide Prodrug AQ4N by Nitric Oxide Synthase. J Med Chem 51: pp 5118-5120.

Olteanu H and Banerjee R (2001) Human Methionine Synthase Reductase, a Soluble P-450 Reductase-Like Dual Flavoprotein, Is Sufficient for NADPH-Dependent Methionine Synthase Activation. J Biol Chem 276: pp 35558-35563.

Paine MJ, Garner A P, Powell D, Sibbald J, Sales M, Pratt N, Smith T, Tew D G and Wolf C R (2000) Cloning and Characterization of a Novel Human Dual Flavin Reductase. J Biol Chem 275: pp 1471-1478.

Papadopoulou, M. V., Ji, M., Rao, M. K., and Bloomer, W. D. (2003) Reductive activation of the nitroimidazole-based hypoxia-selective cytotoxin NLCQ-1 (NSC 709257). Oncology Research 14, pp 21-29.

Patterson AV, Saunders M P, Chinje E C, Patterson L H and Stratford I J (1998) Enzymology of Tirapazamine Metabolism: a Review. Anticancer Drug Des 13: pp 541-573.

Patterson AV, Saunders M P, Chinje E C, Talbot D C, Harris A L and Stratford I J (1997) Overexpression of Human NADPH:Cytochrome c (P450) Reductase Confers Enhanced Sensitivity to Both Tirapazamine (SR 4233) and RSU 1069. Br J Cancer 76: pp 1338-1347.

Sebolt-Leopold JS (2004) MEK Inhibitors: a Therapeutic Approach to Targeting the Ras-MAP Kinase Pathway in Tumors. Curr Pharm Des 10: pp 1907-1914.

3

Seow HA, Penketh P G, Belcourt M F, Tomasz M, Rockwell S and Sartorelli A C (2004) Nuclear Overexpression of NAD(P)H:Quinone Oxidoreductase 1 in Chinese Hamster Ovary Cells Increases the Cytotoxicity of Mitomycin C Under Aerobic and Hypoxic Conditions. J Biol Chem 279: pp 31606-31612.

Sharp SY, Kelland L R, Valenti M R, Brunton L A, Hobbs S and Workman P (2000) Establishment of an Isogenic Human Colon Tumor Model for NQO1 Gene Expression: Application to Investigate the Role of DT- Diaphorase in Bioreductive Drug Activation in Vitro and in Vivo. Mol Pharmacol 58: pp 1146-1155.

Stucker O, Vicaut E and Teisseire B (1991) Hyper-Responsiveness to 5-HT{-2} Agonists by Tumour-Linked Arterioles in Mice: Consequences for Tumour Growth . Int J Radiat Biol 60: pp 237-241.

Stuehr DJ (1999) Mammalian Nitric Oxide Synthases. Biochim Biophys Acta 1411: pp 217-230.

Wu K, Knox R, Sun X Z, Joseph P, Jaiswal A K, Zhang D, Deng P S K and Chen S (1997) Catalytic Properties of NAD(P)H:Quinone Oxidoreductase-2 (NQO2), a Dihydronicotinamide Riboside Dependent Oxidoreductase . Arch Biochem Biophys 347: pp 221-228.

Yan C, Kepa J K, Siegel D, Stratford I J and Ross D (2008) Dissecting the Role of Multiple Reductases in Bioactivation and Cytotoxicity of the Antitumor Agent 2,5-Diaziridinyl-3-(Hydroxymethyl)-6-Methyl-1,4- Benzoquinone (RH1). Mol Pharmacol 74: pp 1657-1665.

4

Supplementary table S2: Suppliers and types of human tumour cell lines

Cell line Tumour type Supplier 22RV1 Prostate ATCC (American Type Culture Collection) A2780 Ovarian European Collection of Cell Cultures A431 Uterine ATCC A549 NSCLC Dr J. Martin Brown, Stanford University, USA. C33A Cervix Onyx Pharmaceuticals, CA DU145 Prostate ATCC FaDu H&N Dr Mark Dewhirst, Duke University, USA H1299 NSCLC Onyx Pharmaceuticals, CA, USA. H460 NSCLC ATCC H522 NSCLC ATCC H69 SCLC ATCC H82 SCLC ATCC HCT116 Colon ATCC HCT-8 sa Colon ATCC; adherent subclone of HCT-8 cells Hep3B Liver ATCC HepG2 Liver ATCC HT29 Colon Dr David Ross, U. Colorado, USA MDA-231 Breast Dr Adam Patterson, Univ Manchester, UK. Mia PaCa-2 Pancreas ATCC Panc-01 Pancreas ECACC PC3 Prostate Dr Ronnie Cohen, Perth SiHa Cervix Dr David Cowan, Ontario Cancer Institute SKOV-3 Ovarian Dr Martin Ford, Glaxo-Wellcome, UK.

5

Supplementary table S3. Clone ID.

Gene Source Catalogue number CYB5R3 Invitrogen IOH3023 POR Invitrogen IOH21456 FDXR Invitrogen IOH4868 MTRRa Origene TC109461 NDOR1 Invitrogen IOH13400 NOS2Ab pEF-iNOS NOS3 Invitrogen IOH61885 NQO1 Invitrogen IOH5917 NQO2 Invitrogen IOH6580 XDc Origene TC104635

a. The MTRR gene was amplified by PCR to allow for addition of gateway cloning regions using the following primers: 5’GGGGACAAGTTTGTACAAAAAAGCAGGCACCATGAGGAGGTTTCTGTTACTAT ATG 3’ and 5’GGGGACCACTTTGTACAAGAAAGCTGGGTCCTATGACCAAATATCCTGAAGGT AGC 3’.

b. NOS2A was obtained from pEF-iNOS (Chinje E. et al. Non-Nuclear Localized Human NOSII Enhances the Bioactivation and Toxicity of Tirapazamine (SR4233) in vitro. Mol Pharmacol 63:1248–1255, 2003) and was amplified by PCR to allow for addition of gateway cloning regions using the following primers: 5’GGGGACAAGTTTGTACAAAAAAGCAGGCACCATGGCCTGTCCTTGGAAATTTC TGTTC 3’ and 5’GGGGACCACTTTGTACAAGAAAGCTGGGTCCTAGAGCGCTGACATCTCCAGGC TGC 3’. c. The XD gene was amplified by PCR to allow for addition of gateway cloning regions using the following primers: 5’GGGGACAAGTTTGTACAAAAAAGCAGGCACCATGAGGAGGTTTCTGTTACTAT ATG 3’ and 5’GGGGACCACTTTGTACAAGAAAGCTGGGTCCTATGACCAAATATCCTGAAGGT AGC 3’.

6

Supplementary table S4: Antibodies used.

The following antibodies were used within the main figures of the paper.

Primary antibody Antibody type Dilution Secondary antibody. Secondary antibody dilution POR Mouse WB - 1:2000 WB - Goat anti-mouse 1:10000 (Santa Cruz Biotech, monoclonal HRP (Santa Cruz Biotech, sc25263) sc-2055) IHC – 1:50 IHC - Secondary Dilution: N/A (3 biotinylated anti-rabbit, drops from kit) and high sensitivity streptavidin-HRP conjugate. MTRR Mouse WB - 1:1000 WB - Goat anti-mouse 1:10000 (Abnova, H00004552- monoclonal HRP (Santa Cruz Biotech, M01) sc-2055) NDOR1 Mouse WB - 1:1000 WB - Goat anti-mouse 1:10000 (Abnova, H000027158- monoclonal HRP (Santa Cruz Biotech, M01) sc-2055) NOS2A Rabbit WB - 1:2000 WB - Goat anti-rabbit 1:10000 (Santa Cruz Biotech, polyclonal HRP (Santa Cruz Biotech, sc651) sc-2054) Actin Mouse WB - 1:10000 WB - Goat anti-mouse 1:10000 (Millipore, MAB1501R) monoclonal HRP (Santa Cruz Biotech, sc-2055) CAIX Rabbit IHC – 1:1000 IHC - Secondary Dilution: N/A (3 (Novus Biologicals, polyclonal biotinylated anti-rabbit, drops from kit) NB100-417) and high sensitivity streptavidin-HRP conjugate. Note: Isotype controls were used as further validation of the POR and CAIX antibodies in the IHC analysis. The isotype control used for POR was a mouse IgG2A antibody (R&D systems, MAB0031). The isotype control used for CAIX was a rabbit IgG fraction (Dako, X0936).

The following antibodies were tested but abandoned for the reasons stated below.

Primary antibody Antibody type Dilution Secondary antibody Secondary antibody dilution POR Goat polyclonal WB - 1:1000 WB - Rabbit anti-goat 1:10000 (Daichi, 299247) HRP (Santa Cruz Biotech, sc-2768) This polyclonal antibody against POR produced non-specific bands on western blots and was not tested for suitability on IHC applications. NOS2A Rabbit WB - 1µg/ml WB - Goat anti-rabbit 1:10000 (Abcam, ab15323) polyclonal HRP (Santa Cruz Biotech, sc-2054) This polyclonal antibody against NOS2A produced non-specific bands on western blots and was not tested for suitability on IHC applications. NOS2A Mouse WB - 1:1000 WB - Goat anti-mouse 1:10000 (Abcam, ab49999) monoclonal HRP (Santa Cruz Biotech, sc-2055) This monoclonal antibody against rat NOS2A did not recognize the human form of the protein on western blots despite being raised using a similar synthetic peptide to the polyclonal antibody above.

7

Supplementary table S5: List of high density tumour microarrays (TMAs)

Supplier TMA Type Description Pantomics Inc. LUC1501 Lung cancer 70 cancer cases, 5 normal/inflammatory. 1.1 mm cores; duplicates Pantomics Inc. PAC481 Pancreas cancer 21 cancer cases, 3 normal. 2.0 mm cores; duplicates Pantomics Inc. EMC1501 Endometrial cancer 70 cancer cases, 5 normal/hyperplasia. 1.1 mm cores; duplicates Pantomics Inc. MNO661 Normal tissues 33 types, FDA recommended (1.5 mm cores; duplicates) Pantomics Inc. LVC1021 Liver cancer 97 cancer cases, 5 normal/benign (1.5mm cores) Pantomics Inc. OVC1021 Ovarian cancer 97 cancer cases, 5 normal/benign (1.5mm cores) Pantomics Inc. PRC961 Prostate cancer 36 cancer cases, 12 hyperplasia (1.5mm cores; duplicates) Super Bio Chips CA3 Prostate cancer 40 cancer cases, 9 normal (2mm cores) Super Bio Chips MA2 Common cancers 59 cancer cases. 10 stomach; 10 esophagus; 10 lung; 10 colorectal; 10 thyroid; 9 kidney (2mm cores) Super Bio Chips MB3 Common cancers 59 cancer cases. 10 breast; 10 liver; 10 urinary bladder; 10 ovary; 10 pancreas; 9 prostate (2mm cores) Super Bio Chips MC2 Common cancers 59 cancer cases. 10 endometrium; 10 gallbladder; 10 larynx; 10 uterine cervix; 10 malignant lymphoma; 9 malignant melanoma (2mm cores) Cancer Society CSTB-01# Various 97 samples; pancreas (4), lung (10), bladder (8), of New Zealand cervix (7), metastatic melanoma (3), uterus (10), ovarian (10), Bowel (10), breast (10), neuronal (7), kidney tumor (8), prostate (10), xenograft (7), normal (10).

# Upper South B Regional Ethics Committee approval URB/05/08/104

8

Supplementary figure S1. Formation of reduced metabolites of PR-104A (sum of PR-104H and PR-104M) under oxic conditions in HCT116 WT cells and HCT116 cells overexpressing candidate mammalian reductases. Metabolite formation was calculated after addition of PR- 104A (100µM, 1 hr), values are the mean changes in oxic metabolism relative to HCT116 WT controls (n=3). Error bars represent the SEM.

9

Supplementary figure S2. Expression of diflavin reductases in HCT116 cells does not change following 2 or 6 hours exposure to anoxic conditions. HCT116 WT or HCT116 cells overexpressing POR, MTRR, NDOR1 or NOS2A were seeded in 6-well plates (500,000 cells/well) and incubated at 37C under oxic or anoxic conditions. Samples were lysed at time 0, 2 and 6 hours and analysed by western blot. No change in expression levels were observed under anoxic conditions for any of the diflavin reductases in HCT116 WT cells or the overexpressing control cells.

10

MTRR

NDOR1

NOS2A

Supplementary figure S3. Analysis of MTRR, NDOR1 and NOS2A in the cancer cell line panel using aggressive western blotting techniques to determine the presence of weak bands. Each blot used increased antibody concentrations which were 1:500 for MTRR (Abnova, H00004552-M01) and NDOR1 (Abnova, H000027158-M01) and 1:1000 for NOS2A (Santa Cruz biotech, sc651). Generous chemiluminescent substrate application and extended exposure times were also used to generate strong signals. Non-specific bands were observed for all antibodies under these conditions. In each case the control lane is lysate prepared from a HCT116 cell line expressing the appropriate diflavin reductase. The red band in the NOS2A blot is due to over-exposure of the image. Arrows indicate the expected sizes of the proteins, the small arrows on the NOS2A blot show the size of the additional 75 KDa band. The band observed in some lanes for the NOS2A antibody appears to be non-specific as it runs at 150KDa and is larger than the 130KDa NOS2A band.

11

Supplementary figure S4. Metabolism of PR-104A to PR-104H and PR-104M in a panel of human cancer cell lines. Metabolism of PR-104A (100µM/L, 1 h) was examined under anoxic (A) and oxic (B, reproduced from Guise et al., 2010) conditions by LC/MS/MS quantitation of PR-104H and PR- 104M. Anoxia-specific (one electron) metabolism was determined by subtracting the oxic metabolite levels from the anoxic metabolite levels (C, reproduced from Fig. 3C). Values are means and error bars show the SEM for total metabolites from two to eight experiments.

12

Supplementary figure S5. Correlation between anoxia-specific PR-104A metabolism and POR expression (normalised to actin; values are means and SEM from three western blots). The HCT116 POR cell line is included in the regression analysis. The notable outlier, HepG2, is excluded from the relationship.

13

Supplemental figure S6. Effect of DPI on PR-104A metabolism in HCT116 WT and diflavin oxidoreductase overexpressing cell lines. (A) Effect of increasing DPI concentrations and length of DPI pre-treatment on the level of PR-104A metabolism in the HCT116 POR cell line under anoxic conditions. Media was removed from the wells following DPI pre-treatment and replaced with DPI- free media during PR-104A exposure. The upper dashed line shows the level of PR-104A metabolites detected in the HCT116 POR cell line in the absence of DPI. The lower dashed line shows the level of PR-104A metabolites detected in the media only (no cells) control wells in the absence of DPI. The middle dashed line shows the level of PR-104A metabolites detected in the media only (no cells, DPI present during PR-104A incubation) control wells in the presence of 100 µM DPI. Values are the mean of triplicate samples and the error bars show the SEM. (B) Effect of 100µM DPI on the oxic metabolism of PR-104A in HCT116 WT and overexpressing cell lines. Values are means of three independent experiments and the error bars show the SEM. The Y axis has been scaled to 4000 pmol/106 cells for easy comparison with the anoxic samples (Fig. 4B)

14

Supplementary table S6. POR and CAIX analysis in tumor cores of expanded arrays.

Average Average # cores POR H CAIX Array (%) H scores (POR in bold, CAIX in italics) score H score Endometrial *1 POR -ve, CAIX -ve 59 (42.8) POR +ve, CAIX -ve 26 (18.8) 5; 9; 9; 10; 15; 18; 20; 30; 30; 30; 31; 31; 40; 45; 50; 60; 70; 58 75; 80; 90; 100; 120; 140; 150; 180; 210 POR –ve, CAIX +ve 40 (29) 9; 10; 10; 15; 24; 25; 30; 30; 30; 30; 36; 36; 36; 40; 40; 40; 113 45; 45; 50; 60; 60; 60; 90; 120; 120; 120; 130; 150; 150; 150; 150; 180; 210; 210; 210; 225; 225; 240; 240; 250 POR +ve, CAIX +ve 13 (9.4) 9,90; 10,30; 13,20; 24,60; 25,10; 30,30; 30,120; 50,30; 53,45; 63 72 100,36; 120,120; 120,180; 130,75 Liver *2 POR -ve, CAIX -ve 40 (41.2) POR +ve, CAIX -ve 28 (28.9) 9; 10; 10; 20; 40; 50; 60; 75; 90; 90; 90; 110; 125; 125; 140; 135 140; 140; 150; 150; 150; 160; 180; 250; 250; 260; 300; 300; 300 POR –ve, CAIX +ve 21 (21.7) 15; 15; 30; 30; 45; 45; 45; 60; 60; 60; 75; 105; 120; 120; 130; 105 40; 150; 150; 240; 270; 300 POR +ve, CAIX +ve 8 (8.2) 6,15; 10,150; 10,300; 24,150; 40,90; 80,9; 100,90; 100,210 41 127 Lung *3 POR -ve, CAIX -ve 70 (50) POR +ve, CAIX -ve 14 (10) 3; 5; 6; 15; 16; 24; 30; 30; 36; 60; 60; 90; 100; 100 41 POR –ve, CAIX +ve 43(30.7) 9; 10; 10; 15; 15; 20; 20; 25; 30; 30; 30; 30; 30; 45; 45; 45; 90 45; 50; 50; 60; 60; 60; 90; 90; 90; 100; 100; 100; 100; 105; 120; 150; 150; 150; 180; 180; 180; 180; 180; 180; 240; 240; 255 POR +ve, CAIX +ve 13 (9.3) 5,230; 6,45; 6,160; 9,255; 10,225; 24,120; 24,255; 25,30; 58 126 25,120; 62,30; 90,20; 210,75; 260,100 Ovarian *4 POR -ve, CAIX -ve 37 (39) POR +ve, CAIX -ve 18 (18.9) 10; 10; 10; 25; 30; 38; 40; 45; 50; 60; 100; 105; 120; 125; 79 130; 175; 215; 240 POR –ve, CAIX +ve 28 (29.5) 6; 9; 10; 12; 15; 45; 60; 60; 75; 75; 75; 80; 90; 120; 120; 135; 125 150; 150; 150; 150; 180; 180; 225; 240; 240; 270; 280; 300 POR +ve, CAIX +ve 12 (12.6) 3,60; 5,120; 12,9; 16,90; 20,20; 25,270; 30,160; 56,15; 60,75; 52 90 60,150; 125,120; 130,45; 135,36 Pancreas *5 POR -ve, CAIX -ve 19 (45.2) POR +ve, CAIX -ve 2 (4.8) 6; 12 9 POR –ve, CAIX +ve 18 (42.9) 15; 30; 30; 40; 60; 60; 75; 90; 150; 180; 210; 210; 225; 240; 147 240; 255; 270; 270 POR +ve, CAIX +ve 3(7.1) 10,110; 20,150; 90,60 40 107 Prostate *6 POR -ve 110 (99) POR +ve 1 (1) 20 20

*1. The endometrial array (EMC1501) also contained 10 normal/benign cores, all CAIX and POR negative. *2. The liver array (LVC1021) also contained 5 normal/viral related cirrhosis cores, all were negative for CAIX, 3 were positive for POR (H scores = 40, 110, 210). Six negative liver cancer cores recorded POR staining in adjacent normal liver cells (H scores = 100, 130, 200, 300, 300, 300). *3. The lung array (LUC1501) also contained 10 normal/inflammatory cores, all CAIX and POR negative. Two negative lung cancer cores showed positive gland contents. *4. The ovarian array (OVC1021) also contained 5 normal/benign cores, one showed weak CAIX staining (H score = 20), one showed weak POR staining (H score = 15) and one showed weak CAIX and POR staining (H scores of 30 and 10 respectively). Two negative ovarian cancer cores showed POR staining in stromal cells (H scores of 15 and 60) *5. The pancreatic array (PAC481) also contained 6 normal cores, all were POR negative and two showed weak CAIX staining (H scores of 30). *6. The prostate arrays (PRC961, CA3) also contained 33 normal/hyperplasia cores, all CAIX and POR negative. One prostate cancer core recorded POR staining in stromal cells (H score of 30)

15

Supplementary table S7. Pathology review of POR immunohistochemical staining in the normal tissue array (TMA MN0661, Pantomics Inc.).

Intensity of POR staining Specimen Core 1 Core 2 Pathologists comments Adrenal gland 40% grade 1 10% grade 2, 20% grade 1 Cytoplasmic Bladder 0 0 Bone marrow 0 0 Eye 0 0 Breast 0 0 Cerebellum 0 0 Cerebral cortex 0 0 Fallopian tube 0 0 GI - esophagus 0 0 GI - stomach 0 0 GI - small intestine 20% grade 2 30% grade 2 Cytoplasmic GI – colon 0 0 GI – rectum 0 0 Heart 0 0 Kidney 0 0 Liver 5% grade 1 5% grade 1 Cytoplasmic Lung 0 0 Ovary 0 0 Pancreas 0 0 Parathyroid 15% grade 1 1% grade 1 Cytoplasmic Pituitary gland 0 0 Placenta 50% grade 2, 50% grade 3 30% grade 2, 70% grade 3 Trophoblast cells, cytoplasmic Prostate 0 0 Skin 0 0 Spinal cord 0 0 Spleen 0 0 Striated muscle 0 0 Testis 0 0 Thymus 0 0 Thyroid 60% grade 2 40% grade 2 Cytoplasmic Tonsil 0 15% grade 2 Epithelial cells, cytoplasmic Uterus – cervix 0 0 Uterus - endometrium 0 0

16

Supplementary figure S7. Images of POR staining intensity in the normal tissue array (TMA MN0661, Pantomics Inc.) using a 1:50 dilution of the POR mAb (sc25263, Santa Cruz Biotech). POR staining was reported to be cytoplasmic in all tissues. The highest intensity of POR staining was observed in the trophoblast cells of placental tissue. Moderate staining was observed in the thyroid. Weak staining was observed in kidney, adrenal, parathyroid and the epithelial cells of the tonsil. A1 = Adrenal; A2 = Bladder; A3 = Bone marrow; A4 = Eye; A5 = Breast; A6 = Cerebellum; A7 = Cerebral cortex; A8 = Fallopian tube; A9 = GI-esophagus; C1 = GI-stomach; C2 = GI-small intestine; C3 = GI- colon; C4 = GI-rectum; C5 = Heart; C6 = Kidney; C7 = Liver; C8 = Lung; C9 = Ovary; E1 = Pancreas; E2 = Parathyroid; E3 = Pituitary gland; E4 = Placenta; E5 = Prostate; E6 = Skin; E7 = Spinal cord; E8 = Spleen; E9 = Striated muscle; G1 = Testis; G2 = Thymus; G3 = Thyroid; G4 = Tonsil; G5 = Uterus-cervix; G6 = Uterus-endometrial. Full details of staining intensity are provided in suppl. Table S7.

17