Research Article Lrai from Lactococcus Raffinolactis BGTRK10-1, an Isoschizomer of Ecori, Exhibits Ion Concentration-Dependent Specific Star Activity

Hindawi BioMed Research International Volume 2018, Article ID 5657085, 10 pages https://doi.org/10.1155/2018/5657085

Research Article LraI from Lactococcus raffinolactis BGTRK10-1, an Isoschizomer of EcoRI, Exhibits Ion Concentration-Dependent Specific Star Activity

Marija Miljkovic,1 Milka Malesevic,1 Brankica Filipic,1,2 Goran Vukotic,1,3 and Milan Kojic 1

1 Institute of Molecular Genetics and Genetic Engineering, University of Belgrade, Belgrade, Serbia 2Faculty of Pharmacy, University of Belgrade, Belgrade, Serbia 3Faculty of Biology, University of Belgrade, Belgrade, Serbia

Correspondence should be addressed to Milan Kojic; [email protected]

Received 22 November 2017; Accepted 2 January 2018; Published 29 January 2018

Academic Editor: Gamal Enan

Copyright © 2018 Marija Miljkovic et al. Tis is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Restriction enzymes are the main defence system against foreign DNA, in charge of preserving genome integrity. Lactococcus rafnolactis BGTRK10-1 expresses LraI Type II restriction-modifcation enzyme, whose activity is similar to that shown for EcoRI; LraI methyltransferase protects DNA from EcoRI cleavage. Te gene encoding LraI endonuclease was cloned and overexpressed ∘ ∘ in E. coli. Purifed enzyme showed the highest specifc activity at lower temperatures (between 13 Cand37C) and was stable afer ∘ storage at −20 C in 50% glycerol. Te concentration of monovalent ions in the reaction bufer required for optimal activity of LraI restriction enzyme was 100 mM or higher. Te recognition and cleavage sequence for LraI restriction enzyme was determined � � as 5 -G/AATTC-3 , indicating that LraI restriction enzyme is an isoschizomer of EcoRI. In the reaction bufer with a lower salt � � concentration, LraI exhibits star activity and specifcally recognizes and cuts another alternative sequence 5 -A/AATTC-3 ,leaving the same sticky ends on fragments as EcoRI, which makes them clonable into a linearized vector. Phylogenetic analysis based on sequence alignment pointed out the common origin of LraI restriction-modifcation system with previously described EcoRI-like restriction-modifcation systems.

1. Introduction their subunit composition, cofactor requirement, recognition site, cleavage site, and mode of action to defne the diferent Restriction endonucleases are generally accompanied by a cog- types (I, II, III, and IV). Restriction endonucleases Type II nate methyltransferase [1]. Both enzymes working together form are essential tools for recombinant DNA technology. It seems a restriction-modifcation system (RM system). RM systems unlikely that today’s modern molecular biology and the are important for the maintenance of the genome integrity biotechnologyindustrywouldhavedevelopedwithoutType of prokaryotic organisms. Te range of biological processes II restriction enzymes. Because of their great importance that utilize RM system also includes involvement in DNA in gene analysis and cloning there is a constant need to transposition [2] and recombination [3]. In addition, there is discover new ones. According to data from the REBASE evidence that the genes for restriction and modifcation en- [6, http://rebase.neb.com] which summarizes all information zymes may act together as selfsh elements [4, 5]. known about every restriction enzyme and any associated Restriction endonucleases exhibit high sequence speci- protein, there are more than 3945 biochemically or geneti- fcity in substrate binding and use versatile DNA cleavage cally characterized restriction enzymes and, out of 3834 Type mechanisms and thus are excellent model systems for under- II restriction enzymes, 299 distinct specifcities are known. By standing DNA recognition and phosphodiester bond hydrol- 2010, six hundred and forty-one restriction enzymes were ysis. Restriction endonucleases are classifed according to commercially available, including 235 distinct specifcities [7]. 2 BioMed Research International

∘ Because of the large number of sequenced genomes, rate of Montelieu-Vercieu, France), temperature of growth (30 C, ∘ ∘ discovery of new putative restriction and modifcation genes 37 C, and 45 C), growth in the presence of salt (4% and is rising rapidly. In contrast, the number of restriction en- 6.5%), and pH tolerance. Final taxonomic classifcation of zymes that are biochemically characterized has actually BGTRK10-1 was performed by sequencing of amplifed 16S dropped down to the level that was three decades ago. rDNA using primers previously described [18]. Te strain was Restriction endonucleases Type II are homodimeric or grown in M17 medium (Merck GmbH, Darmstadt, Germany) ∘ tetrameric enzymes that cleave DNA at defned sites of 4–8 bp supplemented with D-glucose (0.5% w/v) (GM17) at 30 C. 2+ Escherichia coli DH5�, HB101, and ER2523 strains were in length and require Mg ions for catalysis [8]. For many of ∘ restriction endonucleases Type II, it was found that modifed grown aerobically in Luria-Bertani (LB) broth at 37 C, unless conditions (lower ionic strength, higher pH, presence of otherwise specifed. Solid medium was made by adding diferent metallic cofactors, and organic solvents) could 1.75% (w/v) agar (Torlak, Belgrade, Serbia), to the liquid decrease their substrate specifcity [9–13]. Under nonoptimal media. Antibiotics were used at the following concentra- restriction conditions, these endonucleases can usually cleave tions: erythromycin 300 �g/ml and ampicillin 100 �g/ml for degenerate sequences, which difer from standard recogni- selection and maintaining of transformants. Te 5-bromo-4- tion sites at only one nucleotide. Tis alteration in digestion chloro-3-indolyl-�-D-galacto-pyranoside (X-Gal) (Fermen- specifcity causing cleavage of DNA at novel, similar but not tas, Vilnius, Lithuania) was added to LB medium plates identical sequences is defned as enzyme star activity. Mod- for blue/white colour screening of colonies with cloned ifed specifcity of restriction enzyme (star) activity could fragments at fnal concentration of 40 �g/ml. be exploited to facilitate recombinant DNA techniques since thesameenzymeincontrolledconditionscouldrecognize 2.2. Construction of Cosmid Library of L. rafnolactis diferent DNA sequences and cleave at additional positions BGTRK10-1. Total DNA isolated from the L. rafnolactis [9]. BGTRK10-1 was partially digested with XbaI restriction Restriction endonucleases with identical recognition sites enzyme. Incubation was carried out during 1 h and was isolated from diferent organisms are termed isoschizomers stopped in diferent time intervals by adding EDTA. Opti- mally digested DNA, giving fragments 30–40 kb, was purifed [7, 14]. Te RsrI endonuclease found in Rhodobacter sphae- ∘ roides is an isoschizomer of the EcoRI. Both enzymes recog- and ligated overnight at 16 CwiththepAZILcosvector[19] nizethesequenceGAATTCandcleaveitatthesameposition predigested with XbaI restriction enzyme and dephospho- (G/AATTC) and are sharing 50% amino acid sequence rylated. Ligation for formed concatemers of high molecular identity [15]. Interesting, MunIrecognizesthesequence weight was checked on agarose gel and encapsulated into CAATTG, which difers from the recognition sequence of phage particles using packaging kit (Agilent Technologies). EcoRI (and RsrI) only in the external base pairs. Comparison Encapsulated cosmids were transfected into E. coli HB101 of the MunI amino acid sequence with that of EcoRIand magnesium cells and selection of clones was done on LA RsrI revealed only a low level of overall similarity wherefore plates containing erythromycin 300 �g/ml. Constructed cosmid library in E. coli was stored in LB containing 15% (v/v) sequence homology between EcoRI and RsrIhasastronger ∘ signifcance [16]. glycerol at −80 C. Tis work describes for the frst time the occurrence of EcoRI-like restriction-modifcation genes in lactococci. Te 2.3. DNA Manipulations. Total DNA from L. rafnolactis objective was to clone, purify, and biochemically and genet- BGTRK10-1 was isolated by modifed method described by ically characterize novel lactococcal LraI restriction enzyme. Hopwood et al. [20]; the logarithmic phase cells were ∘ LraI restriction enzyme was overexpressed and purifed to pretreated with lysozyme (4 mg/ml, for 15 min at 37 C) prior the homogeneity from E. coli using pMAL expression and to treatment with SDS. For plasmid isolation from E. coli the purifcation system. Results demonstrate that LraI restriction QIAprep Spin Miniprep kit was used according to the manu- enzyme, although an isoschizomer of EcoRI, shows diferent facturer’s recommendations (Qiagen, Hilden, Germany). characteristics. One of characteristics that could be further Standard heat-shock transformation was used for plasmid exploited is star activity of LraIthatislimitedtoonevariant transfer into E. coli [21]. Digestion with restriction enzymes of the recognition site, which afer cleavage leaves identical was conducted according to the supplier’s instructions (Ter- cohesive ends as EcoRI and LraI restriction enzymes, so that mo Fisher Scientifc). Te DNA fragments from agarose gels the fragments obtained afer digestion could be cloned with- were purifed using QIAqick Gel extraction kit as described out additional processing. by the manufacturer (Qiagen, Hilden, Germany). DNA was ligated with T4 DNA ligase (Agilent technologies, USA) ac- 2. Material and Methods cording to the manufacturer’s recommendations. Platinum6 Taq DNA Polymerase High Fidelity (Termo Fisher Scien- 2.1. Bacterial Strains and Culture Conditions. Lactococcus tifc, Waltham, MA, USA) was used to amplify DNA rafnolactis BGTRK10-1 was isolated from autochthonous fragments by PCR in GeneAmp PCR system 2700 thermal sweet kajmak produced from sheep milk without the use of cycler (Applied Biosystems, Foster City, CA, USA). PCR starter cultures in a household of the Vlaˇsicmountainregion,´ products were purifed with QiAquick PCR purifcation kit central Bosnia and Herzegovina [17] (Table 1). Preliminary (Qiagen, Hilden, Germany) according to the manufacturer’s strain classifcation was done according to its fermentation recommendations. DNA sequencing was done by the Macro- ability using API 50CHL (Api System SA; Bio-Merieux, genSequencing Service (Macrogen Europe, Te Netherlands). BioMed Research International 3

Table 1: Bacterial strains and plasmids used in this study.

Strains or plasmids Relevant characteristics Source or reference Lactococcus rafnolactis BGTRK10-1 Natural isolate from autochthonous sweet kajmak [17] Escherichia coli DH5� supE44 ΔlacU169 (ø80 lacZΔM15) hsdR17 recA1 endA1 gyrA96 thi-1 relA1 [21] − − − R F hsdS20 (rB mB ) supE44 recA13 ara-14 proA2 lacY1 rpsL20(Sm ) xyl-5 HB101 − [24] mtl-1 galK2 lacY1 � fuA2 [lon] ompT gal sulA11 R(mcr- 73::miniTn10- -TetS)2[dcm] New England Biolabs, ER2523 R(zgb-210::Tn10- -TetS)endA1Δ(mcrC-mrr)114::IS10 Ltd. UK Competent cells obtained by transformation of ER2523 cells with ER2523/pAZIL-LraRM Tis study pAZIL-LraRM Plasmids r pAZIL 7109 bp, Em , shuttle cloning vector [19] PCR fragments of LraI operon from BGTRK10-1 cloned into pAZIL vector pAZIL-LraRM Tis study predigested with SmaI DNA fragment of 672 bp obtained afer digestion of pBluescipt SK+ with pAZIL-LraI∗672pBS Tis study LraI∗ activity cloned into pAZIL vector predigested with LraI r pAZILcos 8194 bp, Em , shuttle cosmid vector [19] pAZILcosLra Cosmid selected from total XbaI cosmid library of BGTRK10-1 Tis study r pBluescript SK+ 2958 bp, Amp , cloning vector Stratagene ClaI fragment of 4239 bp obtained from pAZILcosLra cloned into pBSLraCla Tis study pBluescript SK+ vector New England Biolabs, pMAL-c5X 5677 bp, pMB1 origin, lacI, malE, bla, Factor Xa cleavage site; Ltd. UK PCR fragment of LraI restriction endonuclease from pAZIL-LraRM cloned pMAL-cX5LraI-29 into pMAL-c5X vector predigested with XmnIandHindIII restriction Tis study enzymes PCR fragment of LraI restriction endonuclease from pAZIL-LraRM cloned pMAL-cX5LraI-31 into pMAL-c5X vector predigested with XmnIandHindIII restriction Tis study enzymes PCR fragment of LraI restriction endonuclease from pAZIL-LraRM cloned pMAL-cX5LraI-42 into pMAL-c5X vector predigested with XmnIandHindIII restriction Tis study enzymes

Te primers used in PCR for amplifcation of LraI operon 2.4.RecombinantLraIRestrictionEndonucleaseOverexpres- (lraIR and lraIM genes) were as follows: LraRM-Fw sion in E. coli and Purifcation. PCR fragment consisted of � � (5 -GTATAGAAAGAAGAATCG-3 ) and LraRM-Rev lraIR gene (from ATG to stop codon) obtained by LraI- � � (5 -GCAGGGTAATGTTCCTCAC-3 ), while following Fw/LraI-Rev primers and Platinum6 Taq DNA Polymerase primers were used for overexpression of LraI restriction High Fidelity was purifed, digested with HindIII and cloned � enzyme (lraIR gene) in pMALc5X vector: LraI-Fw (5 -ATG- into pMAL-c5X vector digested with XmnIandHindIII � � TCGAGAAAAAATCAGTCG-3 ) and LraI-Rev (5 -CTC- restriction enzymes and transformed into ER2523 competent � AAGCTTTCTAATTAATCCTTTTTTGC-3 ; HindIII restric- cells (New England Biolabs, Ltd. UK) previously transformed tion site is underlined). Total DNA (1 ng) was mixed with with pAZIL-LraRM construct (Table 1). Transformants were 17.9 �lofbidistilledwater,2.5�l of 10x PCR bufer (Termo selected on LA Petri dishes containing 2% glucose, ampicillin ∘ Fisher Scientifc), 1 �l dNTP mix (10 mM), 1.5 �l of MgCl2 100 �g/ml, and erythromycin 300 �g/ml at 23 C. Confrma- (25 mM), 1 �l(10pmol)ofeachprimer,and0.1�lof tion of fragment presence in adequate orientation was ob- Platinum6 Taq DNA Polymerase High Fidelity. Performed tained by restriction enzyme analysis (with SacIandHindIII using the GeneAmp 2700 PCR Cycler (Applied Biosystems), digestion) and sequencing. Expression of recombinant pro- ∘ the PCR programs consisted of initial denaturation (5 min teinwascarriedoutat23C by induction with 0.1 mM ∘ ∘ at 96 C), 30 cycles of denaturation (30 s at 96 C), annealing isopropyl �-D-1-thiogalactopyranoside (IPTG). Purifcation ∘ ∘ (30 s at 40 C) and polymerization (2 or 1 min at 68 C), and (cell lysis, afnity chromatography, and cleavage of fusion ∘ an additional extension step of 5 min at 68 C. PCR fragments protein with Xa protease) was performed according to man- of LraI operon amplifed using Platinum6 Taq DNA ufacturer instruction (pMAL Protein Fusion & Purifcation Polymerase High Fidelity were cloned into pAZIL vector System; New England Biolabs, Ltd., UK). Purifed recombi- ∘ predigested with SmaI. nant LraI restriction endonuclease was stored at −20 CinCM 4 BioMed Research International bufer (20 mM Tris-HCl pH7.4, 200 mM NaCl, 1 mM EDTA, by the maximum-likelihood (ML) method using a Tamura- and 1 mM DTT) containing 50% glycerol. Nei model. Bootstrapping of 1000 replicates was used to infer confdence levels of ML trees. 2.5. Endonuclease Assays. Endonuclease activity was assayed Te nucleotide sequences of DNA fragments carrying by incubating various amounts of purifed LraIenzyme genes encoding LraI restriction-modifcation system and 16S in bufer recommended for use with EcoRI (50 mM Tris- rRNA from L. rafnolactis BGTRK10-1 were submitted to HCl, pH 7.5, 10 mM magnesium chloride, 100 mM sodium ENA GenBank under accession numbers LT222052 and chloride, 0.02% Triton X-100, supplemented with 100 �g/ml LT854837, respectively. BSA; Termo Fisher Scientifc) containing 1 �gofpBluescipt � ∘ SK+ plasmid DNA per 50 l reaction mixture for 1 h at 37 C. 3. Results and Discussion Oneunitofenzymeactivitywasdefnedasamountofpurifed LraI enzyme, which was able to completely cut 1 �gofplasmid 3.1. Identifcation of LraI (EcoRI-Like) Methylase Activity in DNA for 1 h. L. rafnolactis BGTRK10-1. Te mesophilic lactic acid bac- Infuence of reaction bufer composition on LraIenzyme terium L. rafnolactis is prevalent in dairy foods, such as raw activity was assayed in diferent commercial bufers (Bufer B milks, natural dairy starter cultures, and a great variety of (blue; 10 mM Tris-HCl pH 7.5, 10 mM magnesium chlo- cheeses. L. rafnolactis BGTRK10-1 is a natural isolate from ride, 100 �g/ml BSA), Bufer G (green; 10 mM Tris-HCl pH autochthonous young sweet kajmak produced in the Vlaˇsic´ 7.5, 10 mM magnesium chloride, 50 mM sodium chloride, mountain region of central Bosnia and Herzegovina [17]. 100 �g/ml BSA), Bufer O (orange; 50 mM Tris-HCl pH Strain BGTRK10-1 was selected because of its strong autoag- 7.5, 10 mM magnesium chloride, 100 mM sodium chloride, gregation phenotype. In order to construct cosmid library of 100 �g/ml BSA), Bufer R (red: 10 mM Tris-HCl pH 8.5, strain BGTRK10-1 to clone aggregation ability coding gene(s), 10 mM magnesium chloride, 100 mM potassium chloride, total DNA of the strain was digested with several restriction 100 �g/ml BSA), Bufer Tango (yellow: 33 mM Tris–acetate enzymes (including EcoRI). It has been observed that the pH 7.9, 10 mM magnesium acetate, 66 mM potassium acetate, EcoRIdidnotcutisolatedDNA,inseveralattempts,unlike 100 �g/ml BSA), and bufer recommended for use with EcoRI; the other used restriction enzymes. It was suspected that the Termo Fisher Scientifc) used for reaction with 1 U of ∘ strain possesses RM system (named Lra L. rafnolactis)that purifed LraIenzymeand1�gofplasmidDNAfor1hat37 C. recognizes the same DNA sequence as EcoRI RM system. To measure the activity of purifed LraI enzyme at diferent Hence, the methylase activity of the strain L. rafnolactis temperatures 1 U of purifed LraIenzymewasincubated BGTRK10-1, which protects its DNA from the digestion by with 1 �g of plasmid DNA for 1 h at diferent temperatures ∘ ∘ ∘ ∘ ∘ ∘ ∘ EcoRI restriction enzyme, was quite accidentally discovered (13 C, 23 C, 30 C, 37 C, 45 C, 60 C, and 80 C). In all endo- during routine laboratory work. nuclease activity assays commercial EcoRI restriction enzyme Restriction endonucleases, commonly known as restric- (Termo Fisher Scientifc) was used as control. Reactions tion enzymes, are ubiquitously present in prokaryotes. Te were stopped by addition 1/10 volume of stop solution main function of restriction enzymes is the protection against (50mMEDTApH8,50%glycerol,0.02%orangeG)and foreign genetic material, especially against bacteriophage products were analyzed by electrophoresis in 1% agarose gels. DNA. Several restriction-modifcation systems have been identifed in lactococci. Most of them are plasmid encoded 2.6.DeterminationofLraICleavageSite. To determine the andfunctionasphage-resistancemechanism,whichisvery precisepositionsandnucleotidesequenceofcleavagesites important for the strains used in the dairy industry in terms within double stranded DNA for the LraI restriction enzyme, of preventing phage infection and cell lysis [25–29]. pBluescript SK+ was used as template. Plasmid was digested with recombinant enzyme LraI; complete digestion was 3.2. Selection of Clone Carrying LraI RM Operon from Cosmid confrmed by agarose gel electrophoresis and digest was Library. Cosmid DNA was isolated from total XbaI cosmid sequenced with M13F and M13R primers (Macrogen Europe, library in E. coli HB101 and 1 �gofDNAmixfromtotal Te Netherlands). Simultaneously as control, the whole cosmid clones was subjected to digestion with EcoRI restric- experiment was conducted with commercial EcoRI restriction enzyme and afer that directly transformed into DH5� tion enzyme (Termo Fisher Scientifc). competent cells. Cosmid DNA isolated from obtained transformants was rechecked for resistance to EcoRI restriction 2.7. Bioinformatic Analysis of LraI Homologs. Sequence enzyme digestion. One cosmid, named pAZILcosLra, pro- searches on the NCBI nucleotide and protein databases were viding resistance to EcoRI restriction enzyme digestion was conducted with BLAST [22] using lraIR/LraIR and lraIM/ selected for further analyses: subcloning and DNA sequenc- LraIM sequences. Te phylogenetic inferences between re- ing (Table 1). striction and methylase enzymes were obtained by MEGA version 6.0 (http://www.megasofware.net/). Te frst 30 protein 3.3. LraI Operon for RM System Provides Resistance to EcoRI reference sequences of EcoRI-like endonuclease or methyl- Restriction Enzyme Digestion. To localize the minimum transferase enzymes chosen according to results of BLASTP genetic unit on the cosmid pAZILcosLra that is responsible search and LraI restrictase and LraI methylase sequences sep- for the resistance to digestion with EcoRI restriction enzyme, arately were trimmed and aligned using Clustal W [23] with the cosmid pAZILcosLra was digested with several restric- default parameters. Te phylogenetic trees were constructed tion enzymes (XbaI-generated four fragments, HindIII-three BioMed Research International 5 fragments, ClaI-four fragments, and EcoRV-three fragments) was successfully overexpressed in all three clones by over- ∘ andthensubclonedintopBluescriptSK+vectordigested night induction with 0.1 mM IPTG at 23 C and purifed using with corresponding restriction enzymes. Only one construct, amylose resins and cleaved by Xa protease (which cleaves pBSLraCla (obtained with ClaI), was able to reestablish the fusion protein between maltose binding protein and clone resistance to EcoRI restriction enzyme digestion (Table 1). providing release of exactly the same protein as natural). Te Te ClaIDNAfragmentof4239bpcarryingcompleteinfor- overexpression of LraI restriction enzyme under aforemen- mation for resistance to EcoRI digestion was completely tioned conditions (overnight induction with 0.1 mM IPTG at ∘ sequencedbyprimerwalking.Fourcomplete(EcoRI-like 23 C) represents the result that is similar to results observed endonuclease, EcoRI-like methylase, hypothetical protein, by other researchers [30]. Te possible explanation for this and site specifc integrase), one truncated (pentapeptide re- could be the expression of restriction enzymes is toxic at peat containing protein), and one partial (N(5)-(carboxyeth- higher temperatures. yl) ornithine synthase) open reading frame (ORFs) were Purifed LraI restriction enzymes from all three clones ∘ revealed on ClaI DNA fragment (Figure 1). Position of LraI were stored at −20 CinCMbuferwith50%glycerol. RM operon in genome of strain BGTRK10-1 indicates the possibility that the operon was acquired by horizontal gene 3.5. Functional Analysis, Determination of Ionic Strength, transfer; the conserved lactococcal gene for pentapeptide and Temperature Optimum of the Purifed LraI Endonuclease repeat containing protein is interrupted in the middle by LraI Activity. Considering that LraIRMsystemprovidedcom- RM operon and immediately afer methylase gene is located plete protection against digestion of EcoRI endonuclease, gene for site specifc integrase. Tis event that occurred in the it was assumed that it recognizes and cleaves the identical distantpastisindicatedbythefactthatadditionalmutations nucleotide sequence. Since plasmid pBluescipt SK+ contains wereaccumulatedwithinthefrstpartofthegenefor one EcoRI restriction site in polycloning region it was used pentapeptide repeat containing protein, most probably due for functional analysis of purifed LraI restriction enzyme. to its nonfunctionality. Te distance between the restrictase Specifc activity (1 U) of purifed LraI restriction enzyme and the methylase genes is 10 nucleotides without promoter was determined in EcoRI reaction bufer (Termo Fisher ∘ and ribosomal binding site and, in other EcoRI-like oper- Scientifc) at 37 C. Diferent levels of LraI restriction enzyme ons, strongly indicates polycistronic RNA transcription from expression were observed in selected clones, but specifc upstream promoter and translation from consensus RBS activities (U/�g of purifed proteins) were almost the same (AGGAGA) 4 nucleotides distant from ATG codon of restric- (1 U/50 ± 5 ng) among the clones pMAL-cX5LraI-29, pMAL- tase gene. cX5LraI-31, and pMAL-cX5LraI-42 (Figure 2). To confrm the functionality of LraI restriction-modi- To determine optimal temperature for LraIactivity, fcation operon, a region that includes both (lraIR and lraIM) purifedenzymewasincubatedwithpBluesciptSK+vector ∘ ∘ genes was amplifed using LraRM-Fwand LraRM-Rev prim- at temperatures ranging from 13 Cto80C. LraIenzyme ers (for details see Section 2.2) and cloned into pAZIL vectors showed the highest activity at lower temperatures (between ∘ ∘ ∘ giving construct pAZIL-LraRM. Construct carrying only 13 Cand37C), while at 45 C and higher temperatures it par- these two genes was completely sequenced while resistance to tially cut DNA (Figure 3). However, this is in agreement with ∘ EcoRI restriction enzyme digestion was confrmed in vitro. the optimal growth temperature of strain BGTRK1-10 (30 C). Briefy, since the frst description of EcoRI restriction enzyme in 1970 [31], more than 500 isoschizomers have been reported 3.4. Cloning, Overexpression, and Purifcation of LraI Restric- or predicted with very high levels of identity (50–70%) point- tion Endonuclease. Plasmid clone pAZIL-LraRM was used as ing to the widespread distribution among species of diferent matrix for amplifcation of the open reading frame encoding Phyla and indicating possible common origin. It seems that LraI restriction endonuclease with primers LraI-Fw and some specifc characteristics, such as optimum working tem- LraI-Rev. Since HindIII restriction site has been integrated perature, diverged depending on the optimum growth tem- into LraI-Rev primer, obtained amplifed fragment was frst peratureoftheenzymeproducingbacteria,whichiswhywe treated with HindIII to provide directed cloning of PCR frag- think that LraI exhibits better activity at lower temperatures. ment into expression vector pMAL-c5X, which was digested It was found that commercial EcoRI (used as control) showed ∘ with XmnIandHindIII restriction enzymes. Ligation mix high activity at 45 CincontrasttoLraIenzymepointingto was transformed into ER2523 cells which were previously the diference between these two enzymes. transformed with a pAZIL-LraRM vector expressing LraI In addition, stability of LraIenzymewastestedafer ∘ methylase, in order to protect transformed cells from the diferent period of storage at −20 C; LraIenzymedidnotlose ∘ nuclease activity of LraI towards their own. Transformants activity afer storage for more than six months at −20 Cin of ER2523/pAZIL-LraRM with pMAL-cX5LraI were success- CM bufer with 50% glycerol. ∘ fully obtained when selection was carried out at 23 Con To establish the optimal salt concentration in the reaction LA selective plates (erythromycin 300 �g/ml and ampicillin bufer for LraI enzyme activity diferent commercial bufers, 100 �g/ml) containing 2% glucose in order to minimise Bufer B, Bufer G, Bufer O, Bufer R, Bufer Tango, and bufer expression of enzymes. Tree clones (named pMAL-cX5LraI- recommended for use with EcoRI (Termo Fisher Scientifc) 29, pMAL-cX5LraI-31, and pMAL-cX5LraI-42, Table 1) were were used. LraI enzyme exhibited high and specifc activity in selected for restriction enzyme analysis, complete sequenc- bufers with 100 mM and higher salt concentrations (Figure 4, ing, and overexpression of enzyme. LraI restriction nuclease bufer recommended for use with EcoRI, Bufer 2x Tango 6 BioMed Research International

HincII 2001 HindIII 2814 ScaI 3845 HincII 2110 XmnI 3069 EcoRI 3908 XmnI 2282 EcoRV 3275 XhoI 4168 ClaI 1 SpeI 1474 XmnI 2400 HincII 3284 ClaI4239

Δorf1 lraIR lraIM hyp1 intSS par ceo

Figure 1: Schematic presentation of ClaI DNA fragment of 4239 bp carrying complete information for providing resistance to EcoRI digestion. ClaI DNA fragment containing following ORFs: truncated gene for pentapeptide repeat containing protein (Δorf1), EcoRI-like endonuclease (lraIR), EcoRI-like methylase (lraIM),hypotheticalprotein(hyp1), site specifc integrase (intSS), and partial gene for N(5)-(carboxyethyl) ornithine synthase (par ceo).

Bufer EcoRI 1x Tango 2x Tango Bufer R Bufer B Bufer G Bufer O Undigested I 29 I 31 I 42 I I I I I I I Lra Lra Lra RI Eco Ladder RI Eco RI Eco RI Eco RI Eco RI Eco RI Eco RI Eco Ladder Lra Lra Lra Lra Lra Lra Lra Ladder

10000

3000 2500 3000 (bp) 2000 1500 1000

(bp) 800 1200 1000 500

500 100 Figure 4: Determination of infuence of ionic strength in diferent 100 reaction bufers on the LraI restriction enzyme activity. Commercial EcoRI restriction enzyme was used in control reactions. L: ladder (GeneRuler DNA Ladder Mix, Termo Fisher Scientifc). Black Figure 2: LraI activity assay. Digestion of pBluescipt SK+ by puri- arrows present fragment obtained by LraI∗ activity; white arrows fed LraI restriction enzyme LraI29,LraI31,andLraI42from present undigested plasmid DNA in EcoRI (Termo Fisher Scien- clones pMAL-cX5LraI-29, pMAL-cX5LraI-31, and pMAL-cX5LraI- tifc) digestion. 42, respectively.

∘ ∘ ∘ ∘ ∘ ∘ ∘ 13 C 23 C 30 C 37 C 45 C 60 C 80 C It is interesting that in Bufer B and Bufer G commercial

I I I I I I I EcoRI restriction enzyme exhibited weaker activity, partial

Ladder RI Eco Lra RI Eco Lra RI Eco Lra RI Eco Lra RI Eco Lra RI Eco Lra RI Eco Lra digestion.

10000 3000 3.6. LraI Is an Isoschizomer of EcoRI. Sequencing of double stranded cleaved DNA by the LraIenzymehasshownthat the LraIenzymerecognizestheidenticalnucleotidesequence

(bp) 1000 � � 500 (5 -G/AATTC-3 ), as expected, and cuts it at the same position (between G and A) like EcoRI enzyme (Figure 5) 100 leaving identical sticky ends. Te same cleavage results were obtained with LraI enzymes purifed from all three clones Figure 3: Determination of temperature optimum of the purifed which supported our conclusion that LraIenzymeisan LraI restriction enzyme activity. Commercial EcoRI restriction isoschizomer of EcoRI. enzyme was used in control reactions. 3.7. Determination of the Cleavage Site of LraI∗ Activity. One of the important characteristics of restriction enzymes is their high sequence specifcity in order to adequately provide and Bufer O), except in Bufer R (red) (10 mM Tris-HCl pH the function of protecting the genome integrity. In addition, 8.5, 10 mM magnesium chloride, 100 mM potassium chloride, it was established that restriction enzymes in nonoptimal and 100 �g/ml BSA) (Figure 4; Bufer R). It was noticed conditions could exhibit a modifed specifcity so that the that, in bufers with lower ionic strengths, the LraIenzyme same restriction enzyme could recognize and cleave DNA at exhibited a specifc star activity, cutting the vector at another additional positions to canonical one [32]. For EcoRI restric- position (Figure 4; Bufer 1x Tango, Bufer B, Bufer G). tion enzyme, it was detected that in at low ionic strength BioMed Research International 7

BamHI SmaI PstI Dig EcoRI sequences GAATTG, at position 647; CAATTC, at position 100 110 850; TAATTC, at position 2824 were found), but were not TGGATCCCCGGGCTGCAGGAATTA cleaved, we conclude that LraI∗ activity specifcally recognizes and cleaves only one variant of degenerate recognition � � sequence (5 -A/AATTC-3 ). To further test the conclusion obtained on pBluescipt SK+, the plasmid pAZIL sequence was analyzed and subjected to digestion by LraIenzyme (a) underconditionsthatinducestaractivity.Teobtaineddiges-

BamHI SmaI PstI Dig EcoRI tion results were completely in correlation with the predicted 100 110 expectations (nine positions/fragments) (Figure 6(b)), so we TGGATCCCCGGGCTGCAGGAATTA could conclude that LraI∗ activity is limited to only one variant of the recognition sequence giving identical cohesive ends as in optimal conditions making the resulting fragments afer LraI∗ activity clonable without further processing into LraIorEcoRI treated vectors. (b) LraI restriction enzyme star activity meets all the given

� � requirements: it recognizes only one variant of the sequence Figure 5: Determination of the LraIcleavagesite5-G/AATTC-3 which can enable more precise restriction mapping and of pBluescipt SK+ by DNA sequencing. (a) Sequence of pBluescipt cloning, provides the same cohesive ends compatible with SK+ predigested with LraI restriction enzyme and (b) with EcoRI obtained using M13R primer. Te colour-coded sequence traces EcoRI (contained by most cloning vectors), and is completely are A (green), T (red), C (blue), and G (black). Te extra A controlled by low ion concentration and/or high pH. Both base was added at the end of the cleaved template by the Taq factors which induce star activity of LraI restriction enzyme, DNA polymerase used for sequencing due to template-independent low ionic strength (Bufer 1x Tango) and bufer with higher terminal nucleotide transferase activity of Taq DNA polymerase. pH (Bufer R, pH 8.5), also infuence on EcoRI, but, in contrast, LraI∗ recognizes only one additional sequence expressing more specifc star activity. and high pH enzyme is transformed so that it recognizes and � � digests the shortened tetranucleotide sequence 5 -/AATT-3 3.8. Phylogenetic Similarity of LraI Restriction-Modifcation [32]. Tis activity is termed star activity and is usually labeled Enzymes with Others Belonging to EcoRI-Like Group. A ∗ � as “ ” adjacent to the enzyme name and was also detected for searchfornumberofrestrictionenzymesrecognizing5- � otherrestrictionenzymesandcouldbeusedtocleaveDNA GAATTC-3 sequence present in REBASE revealed 526 at additional sites for cloning purposes. In order to be used putative EcoRI-like proteins. Protein BLAST analysis showed for cloning star restriction enzyme activity should (i) be that196restrictionenzymesinNCBIdatabase(fromvarious restricted to limited number of sequence variants, (ii) provide microorganisms) share more than 50% identity on at least the same sticky ends for ligation into the vector, and (iii) be 50% protein coverage with LraI enzyme. Highest identity was controlled by changeable conditions. observed with restriction endonucleases from streptococci To determine the cleavage site of LraI∗ activity, the (Streptococcus suis 68%, Streptococcus dysgalactiae 64%, and fragment of 672 bp obtained afer digestion of pBluescipt SK+ in bufer with low ionic strength (1x Tango; Termo Streptococcus mutans 64%). It is interesting that similar but Fisher Scientifc) (Figure 6(a)) was cloned into pAZIL vector higher identity was observed for LraImethylase,againwith predigested with LraI. Isolated plasmids (named pAZIL- streptococci (Streptococcus pseudopneumoniae 74%, Strepto- LraI∗672pBS; Table 1) from selected white colonies were frst coccus suis 73%, Streptococcus mutans 73%, and Streptococ- checked for the presence of DNA fragment of 672 bp by cus dysgalactiae 68%). Similar percentage of identity was restriction analysis with LraIenzymeandthensequenced. observed also at nucleotide level (about 70%) for both LraI Te sequence of the entire fragment as well as the adjacent restrictase and methylase genes. Te fact that most EcoRI regions of the vector showed that the cloned 672 bp fragment isoschizomers, unlike other restriction enzymes, share a high originating from pBluescipt SK+ was cut out by LraI∗ enzyme level of identity, indicates their common origin [7]. activity at positions (701 EcoRI) and at additional position Phylogenetic trees were constructed for both LraIrestric- � � (29) in which the 5 -AAATTC-3 sequence is present. Te tase (Figure 7(a)) and methylase (Figure 7(b)) enzymes. same sequencing results were obtained for three independent Phylogenetic analysis showed that LraIhomologs(restriction clones confrming that additional recognition and cleavage endonucleases and methylases) can be divided into two main � � site for LraI∗ activity is 5 -A/AATTC-3 sequence. To be branches, one (that could be additionally subdivided, com- sure that only AAATTC sequence is recognized and cleaved prising close homologs (Gram-negative bacteria and Cyano- by LraI∗ activity, but not other sequences with alternative phyta) and the other comprising homologs from species changes within the GAATTC site, a search analysis for the belonging to Firmicutes phylum. Te position of genus Fibro- presence of other alternatives in plasmid sequences was bacter (phylum: Fibrobacteres) which consists of only two performed. Since all alternatives with one nucleotide change species is interesting; its restrictase enzyme belongs to one of recognition sequence exist in pBluescipt SK+ (in addi- branch, while methylase protein belongs to the other (Fig- tion to AAATTC, at position 29, the following recognition ure 7). 8 BioMed Research International

L1234567L L1234567L

(a) (b)

Figure 6: Determination of the cleavage site of LraI∗ activity. (a) Digestion of pBluescipt SK+ vector by LraI29(1and4),LraI31(2and5), and LraI 42 (3 and 6) in bufer recommended for use with EcoRI (1, 2, and 3) and in 1x Tango Bufer (4, 5, and 6); 7: undigested pBluescipt SK+; digestion of pAZIL vector by LraI29(1and4),LraI31(2and5),andLraI 42 (3 and 6) in bufer recommended for use with EcoRI (1, 2, and 3) and in 1x Tango Bufer (4, 5, and 6); 7: undigested pAZIL vector; L: ladder (GeneRuler DNA Ladder Mix, Termo Fisher Scientifc).

92 Acinetobacter baumannii 46 Dolichospermum compactum 89 Salmonella enterica 99 Dolichospermum circinale 92 Escherichia coli 9 Anabaena sp. 90 16 28 Enterobacter timonensis Arcobacter sp. L Pseudomonas mendocina Cycloclasticus sp. symbiont of Bathymodiolus hecke... 79 25 43 Vibrio cholerae 28 Candidatus Achromatium palustre 21 Pseudomonas sp. Irchel s3a18 Desulfobacteraceae bacterium IS3 35 Bacteroidetes bacterium 37-13 67 Microcystis aeruginosa Riemerella anatipestife 20 78 14 76 Microcystis panniformis FACHB-1757 25 Termofexibacter ruber Candidatus Woesebacteria bacterium GW2011 GWA1 39.. Polaribacter sp. SA4-10 Bacteroidetes bacterium 37-13 39 Flavobacterium psychrophilum DSM 3660 68 Flavobacterium columnare 30 99 Anabaena Polaribacter sp. SA4-10 19 37 Dolichospermum circinale 70 Riemerella anatipestifer 38 Microcystis aeruginosa 21 Termofexibacter ruber Candidatus Levybacteria bacterium RIFCSPLOWO2 12 F... Vibrio cholerae 38 35 99 Candidatus Staskawiczbacteria bacterium RIFOXYC1 F... Pseudomonas 36 56 Capnocytophaga sp. oral taxon 863 Enterobacter timonensis 39 Porphyromonas gingivalis Acinetobacter baumannii 24 86 98 Prevotella amnii 99 Salmonella enterica 52 99 Prevotella pleuritidis Capnocytophaga sp. oral taxon 863 Parabacteroides distasonis Prevotella sp. oral taxon 317 48 Helicobacter japonicus 99 Porphyromonas gingivalis Fibrobacter sp. UWB4 60 Prevotella amnii 22 49 Clostridioides difcile Fibrobacter sp. UWOS 99 Pseudobutyrivibrio sp. ACV-2 97 Listeria innocua 83 Streptococcus pseudopneumoniae 99 Streptococcus dysgalactiae Lactococcus raﬃnolactis Streptococcus suis 79 Streptococcus dysgalactiae Streptococcus mutans 95 Lactococcus raﬃnolactis Streptococcus pseudopneumoniae 51 75 88 Streptococcus mutans 95 Streptococcus suis

0.05 0.05 (a) (b)

Figure 7: Phylogenetic similarity of LraI RM system with other belonging to EcoRI-like group constructed using a Tamura-Nei model. (a) Phylogenetic tree for LraI restrictase; (b) phylogenetic tree for LraI methylase enzymes. BioMed Research International 9

4. Conclusions [11] M. Nasri and D. Tomas, “Alteration of the specifcity of pvuII restriction endonuclease,” Nucleic Acids Research,vol.15,no.19, We identifed a potent Type II restriction endonuclease in L. pp. 7677–7687, 1987. rafnolactis BGTRK10-1, named LraI. Te recognition and [12] F. Barany, “Te TaqI ’star’ reaction: strand preferences reveal cleavage sequence for LraI restriction enzyme was deter- hydrogen-bond donor and acceptor sites in canonical sequence � � mined as 5 -G/AATTC-3 , indicating that LraI restriction recognition,” Gene, vol. 65, no. 2, pp. 149–165, 1988. enzyme is an isoschizomer of EcoRI but with diferent char- [13] J. Bitinaite and I. Schildkraut, “Self-generated DNA termini acteristics. One of characteristics that has been thoroughly relax the specifcity of SgrAl restriction endonuclease,” Proceed- studied is star activity of LraI restriction enzyme that is ings of the National Acadamy of Sciences of the United States of limited to one variant of the recognition site and cuts another America,vol.99,no.3,pp.1164–1169,2002. � � alternative sequence 5 -A/AATTC-3 leaving the same sticky [14] R. J. Roberts and K. Murray, “Restriction endonuclease,” Critical ends on fragments as EcoRI, making the fragments obtained Reviews in Biochemistry and Molecular Biology,vol.4,no.2,pp. afer digestion easy to clone without additional processing. 123–164, 1976. [15] F. H. Stephenson, B. T. Ballard, H. W. Boyer, J. M. Rosenberg, and P.J. Greene, “Comparison of the nucleotide and amino acid Conflicts of Interest sequences of the RsrI and EcoRI restriction endonucleases,” Gene,vol.85,no.1,pp.1–13,1989. Te authors declare no conficts of interest. [16] T.Chuluunbaatar, T.Ivanenko-Johnston, M. Fuxreiter et al., “An EcoRI-RsrI chimeric restriction endonuclease retains parental Acknowledgments sequence specifcity,” Biochimica et Biophysica Acta (BBA) - Proteins and Proteomics,vol.1774,no.5,pp.583–594,2007. Te Ministry of Education, Science and Technological Devel- [17] A. Terzic-Vidojevic, S. Mihajlovic, G. Uzelac et al., “Character- opment of the Republic of Serbia, Serbia, supported this work ization of lactic acid bacteria isolated from artisanal Travnik (Grant No. 173019). young cheeses, sweet creams and sweet kajmaks over four seasons,” Food Microbiology,vol.39,pp.27–38,2014. [18] B. Jovciˇ c,´ J. Begovic,´ J. Lozo, L. Topisirovic,´ and M. Kojic,´ “Dy- References namics of sodium dodecyl sulfate utilization and antibiotic susceptibility of strain Pseudomonas sp. ATCC19151,” Archives [1] T. A. Bickle and D. H. Kruger, “Biology of DNA restriction,” Mi- of Biological Sciences,vol.61,no.2,pp.159–164,2009. crobiology and Molecular Biology Reviews,vol.57,no.2,pp.434– [19] M. Kojic, B. Jovcic, I. Strahinic et al., “Cloning and expression of 450, 1993. a novel lactococcal aggregation factor from Lactococcus lactis [2] A.B.Hickman,Y.Li,S.V.Mathew,E.W.May,N.L.Craig,andF. subsp. lactis BGKP1,” BMC Microbiology,vol.11,article265, Dyda, “Unexpected structural diversity in DNA recombination: 2011. Te restriction endonuclease connection,” Molecular Cell,vol.5, [20]D.A.Hopwood,J.M.Bib,J.F.Chateretal.,Genetic Manipula- no. 6, pp. 1025–1034, 2000. tion of Streptomyces:ALaboratoryManual,1985. [3] M. Mucke,G.Grelle,J.Behlke,R.Kraf,D.H.Kr¨ uger,¨ and M. [21] D. Hanahan, “Studies on transformation of Escherichia coli with Reuter, “EcoRII: A restriction enzyme evolving recombination plasmids,” JournalofMolecularBiology,vol.166,no.4,pp.557– functions?” EMBO Journal,vol.21,no.19,pp.5262–5268,2002. 580, 1983. [4]T.Naito,K.Kusano,andI.Kobayashi,“Selfshbehaviorofre- [22] S. F. Altschul, T. L. Madden, A. A. Schafer¨ et al., “Gapped striction-modifcation systems,” Science,vol.267,no.5199,pp. BLAST and PSI-BLAST: a new generation of protein database 897–899, 1995. search programs,” Nucleic Acids Research,vol.25,no.17,pp. [5] I. Kobayashi, “Behavior of restriction-modifcation systems as 3389–3402, 1997. selfsh mobile elements and their impact on genome evolution,” [23] M. A. Larkin, G. Blackshields, N. P.Brown et al., “Clustal W and Nucleic Acids Research,vol.29,no.18,pp.3742–3756,2001. clustal X version 2.0,” Bioinformatics,vol.23,no.21,pp.2947- 2948, 2007. [6]R.J.Roberts,T.Vincze,J.Posfai,andD.Macelis,“REBASE—a database for DNA restriction and modifcation: enzymes, genes [24] H. W. Boyer and D. Roulland-dussoix, “A complementation and genomes,” Nucleic Acids Research,vol.38,pp.D234–D236, analysis of the restriction and modifcation of DNA in Escheri- 2010. chia coli,” Journal of Molecular Biology,vol.41,no.3,pp.459– 472, 1969. [7] A. Pingoud, G. G. Wilson, and W. Wende, “Type II restriction [25] C. Hill, K. Pierce, and T. R. Klaenhammer, “Te conjugative endonucleases - A historical perspective and more,” Nucleic plasmid pTR2030 encodes two bacteriophage defense mech- Acids Research,vol.42,no.12,pp.7489–7527,2014. anisms in lactococci, restriction modifcation (R+/M+) and [8] A. Pingoud and A. Jeltsch, “Structure and function of type II re- abortive infection (Hsp+),” AppliedandEnvironmentalMicro- striction endonucleases,” Nucleic Acids Research,vol.29,no.18, biology,vol.55,no.9,pp.2416–2419,1989. pp. 3705–3727, 2001. [26] S. Moineau, S. Pandian, and T. R. Klaenhammer, “Restric- [9]T.I.Tikchonenko,E.V.Karamov,B.A.Zavizion,andB.S.Nar- tion/modifcation systems and restriction endonucleases are oditsky, “EcoRI* activity: Enzyme modifcation or activation of more efective on lactococcal bacteriophages that have emerged accompanying endonuclease?” Gene,vol.4,no.3,pp.195–212, recently in the dairy industry,” Applied and Environmental 1978. Microbiology,vol.59,no.1,pp.197–202,1993. [10] M. Nasri and D. Tomas, “Relaxation of recognition sequence [27] D. J. O’Sullivan, K. Zagula, and T. R. Klaenhammer, “In vivo of specifc endonuclease HlndIII,” Nucleic Acids Research,vol. restriction by LlaI is encoded by three genes, arranged in an 14,no.2,pp.811–821,1986. operon with llaIM, on the conjugative Lactococcus plasmid 10 BioMed Research International

pTR2030,” Journal of Bacteriology,vol.177,no.1,pp.134–143, 1995. [28] N. Nyengaard, F. K. Vogensen, and J. Josephsen, “Restriction- modifcation systems in lactococcus lactis,” Gene,vol.157,no. 1-2, pp. 13–18, 1995. [29] A. Madsen and J. Josephsen, “Cloning and characterization of the lactococcal plasmid-encoded type II restriction/modifcation system, LlaDII,” AppliedandEnvironmentalMicrobiology, vol. 64, no. 7, pp. 2424–2431, 1998. [30]D.-H.Chung,J.R.Huddleston,J.Farkas,andJ.Westpheling, “Identifcation and characterization of CbeI, a novel ther- mostable restriction enzyme from Caldicellulosiruptor bescii DSM 6725 and a member of a new subfamily of HaeIII-like enzymes,” Journal of Industrial Microbiology and Biotechnology, vol.38,no.11,pp.1867–1877,2011. [31] R. J. Roberts, “How restriction enzymes became the workhorses of molecular biology,” Proceedings of the National Acadamy of Sciences of the United States of America,vol.102,no.17,pp.5905– 5908, 2005. [32]B.Polisky,P.Greene,D.E.Garfn,B.J.McCarthy,H.M.Good- man, and H. W. Boyer, “Specifcity of substrate recognition by the EcoRI restriction endonuclease,” Proceedings of the National Acadamy of Sciences of the United States of America,vol.72,no. 9, pp. 3310–3314, 1975. International Journal of Journal of Peptides Nucleic Acids

The Scientifc International Journal of International Journal of World Journal Cell Biology Microbiology Hindawi Publishing Corporation Hindawi Hindawi Hindawi Hindawi http://www.hindawi.comwww.hindawi.com Volume 20182013 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018

Anatomy Biochemistry Research International Research International

Hindawi Hindawi www.hindawi.com Volume 2018 www.hindawi.com Volume 2018

Submit your manuscripts at www.hindawi.com

Advances in Genetics Bioinformatics Research International Hindawi Hindawi www.hindawi.com Volume 2018 www.hindawi.com Volume 2018

Advances in International Journal of International Journal of Stem Cells BioMed Genomics Zoology International Research International Hindawi Hindawi Hindawi Hindawi Hindawi www.hindawi.com Volume 2018 Virology www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018

Neuroscience Journal

Enzyme Journal of Journal of Research Parasitology Research Marine Biology Archaea Hindawi Hindawi Hindawi Hindawi Hindawi www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018 www.hindawi.com Volume 2018