Molecular Biology 2016
Assignment 1 Dilutions and Concentrations Only submit the answers to one digit after the decimal, you do not need to show your calculations (1 point/question) 1. You add water to 125 mL of 1.6 M LiCl to obtain 1.0 L of solution, what is the new concentration of LiCl? 2. In the previous problem, the solution contains how many parts of solute and of solvent?
3. You start with 2.5L of a KNO3 stock solution and wish to prepare 10.0 L of 1.5 M KNO3. What molarity would the potassium nitrate stock solution need to be if you were to use it all? 4. How many milliliters of 5.0 M copper sulfate solution must be added to 228 mL of water to achieve a 0.25 M copper sulfate solution?
5. 40.0 mL of 2.0 M Fe(NO3)3 is mixed with 2 mL of 5 M Fe(NO3) and 48 mL of water. What is the final molar concentration of Fe(NO3)? 6. You add 3.5 L of an HCl solution of unknown concentration to 2.0 L of 0.5 M HCl and obtain a solution with a final concentration of 1.5 M. What was the unknown concentration of the initial HCl solution? 7. You have a solution representing 126g/L of NaF (MW: 42g/mole). 180 mL of this solution is added to water to obtain a final volume of 1080 mL. What is the molarity of the resulting solution? 8. What is the molar concentration of chloride ions in a solution prepared by mixing 100.0 mL of 2.0 M KCl with 50.0 mL of a 1.50 M CaCl2 solution?
9. A solution is prepared by dissolving 54 g of AgNO3 in 156 mL of water. What is the percent concentration (m/m) of AgNO3 of this solution?
10. The A260nm of a DNA solution is 0.12. How much of this DNA solution and a 5.5X loading dye should you add to 15µL of water to obtain a sample which contains 30ng of DNA in 0.5X loading dye? (A260nm of 1.0 = 50 µg/mL DNA)
Molecular Biology 2016
Restriction Enzymes & Restriction Mapping (3 points/question)
11. The nomenclature of restriction enzymes can provide useful information about the source of the enzyme. For example, EcoRI indicates that this enzyme was the first enzyme isolated from an E.coli strain “R”. From which bacteria was PvuII isolated from? 12. Define the following terms: Isoschizomer, neoschizomer, and isocaudomer. 13. Amongst the enzymes listed below, which if any, generate compatible ends to each other? (Ex. A and B)
Enzyme Recognition Sequence Cut EcoRI 5'GAATTC 5'---G AATTC---3' BamHI 5'GGATCC 5'---G GATCC---3' HindIII 5'AAGCTT 5'---A AGCTT---3' TaqI 5'TCGA 5'---T CGA---3' NotI 5'GCGGCCGC 5'---GC GGCCGC---3' Sau3AI 5'GATC 5'--- GATC---3' PvuII 5'CAGCTG 5'---CAG CTG---3' KpnI 5'GGTACC 5'---GGTAC C---3' PstI 5'CTGCAG 5'---CTGCA G---3' SacI 5'GAGCTC 5'---GAGCT C---3' SalI 5'GTCGAC 5'---G TCGAC---3' ScaI 5'AGTACT 5'---AGT ACT---3' SpeI 5'ACTAGT 5'---A CTAGT---3' SphI 5'GCATGC 5'---GCATG C---3' StuI 5'AGGCCT 5'---AGG CCT---3' XbaI 5'TCTAGA 5'---T CTAGA---3'
Molecular Biology 2016
14. The linear 12 Kbp DNA fragment shown below has cleavage sites for BamHI and EcoRI. The numbers indicate the distance in kilobases. Complete the table to indicate the fragment sizes which would be observed on an agarose gel following each of the indicated digests. Note, if different fragments of the same size are generated, the size should only be indicated once. (For example do not indicate 2Kbp and 2Kbp)
B E B E 1 4 6 10 Enzyme digest Fragment sizes BamHI
EcoRI
BamHI + EcoRI
15. What fragment sizes could be generated from a BamHI partial digest? Only indicate the sizes of intermediate fragments which would not be obtained following a complete digest. (Fragments which contain one or more BamHI site which remains undigested) 16. Consider the results of the BamHI digest you indicated in the above table. Draw all possible maps, (including the one illusrated above) which could correspond to the results indicated for the BamHI digest alone. 17. It was determined that the enzyme XhoI cuts at 2.0Kbp on the map shown above. Indicate which BamHI fragment would be cut by XhoI and what sizes would be generated in each of the maps provided for question 16. (Ex. 4Kbp BamHI → 3 + 1 Kbp). 18. A complete digest with EcoRI + BamHI of 12µg of the above fragment was performed. Indicate the amount in µg of each of the fragments which would be obtained.
Molecular Biology 2016
19. The circular 10Kbp DNA molecule shown below has cleavage sites for BamHI and EcoRI. Complete the table to indicate the fragment sizes which would be observed on an agarose gel following each of the indicated digests. Note, if different fragments of the same size are generated, the size should only be indicated once. (For example do not indicate 2Kbp and 2Kbp) 10/0 Kbp EcoRI
BamHI 3 Kbp
6 Kbp BamHI
Enzyme digest Fragment sizes BamHI
EcoRI
BamHI + EcoRI
20. What fragment sizes could be generated from a BamHI partial digest? Only indicate the sizes of intermediate fragments which would not be obtained following a complete digest. (Fragments which contain one or more BamHI site which remains undigested) 21. Consider that the EcoRI site is invariable. Is this the only possible map according to the results presented in the above table? If not draw another possible map. 22. It was determined that the enzyme XhoI cuts at 9Kbp on the map shown above. Indicate which BamHI fragment would be cut by XhoI and what sizes would be generated in each of the maps provided for questions 19 and 21. (Ex. 4Kbp BamHI → 3 + 1 Kbp).
Molecular Biology 2016
23. An 8.9 kb circular plasmid is digested with three restriction enzymes, EcoRI, BamHI and HindIII, individually and in combination, and the resulting fragment sizes are determined by means of electrophoresis. The results are as follows:
EcoRI 8.9 kb BamHI 6 kb. 2.9 kb HindIII 8.9 kb EcoRI + BamHI 6 kb, 2.4 kb, 0.5 kb EcoRI + HindIII 7.4 kb, 1.5 kb BamHI + HindIII 5 kb, 2.9 kb, 1 kb BamHI + EcoRI + HindIII 5 kb, 2.4 kb, 1 kb, 0.5 kb
Draw a possible restriction map based on these results. Set the EcoRI site as the origin.
24. Obtain the picture of the agarose gel electrophoresis of digests of the plasmid pBR322. (The file can be found on the course’s web site under the rubric “Sequences>pBR322”. Based on the results obtained, answer the following questions: a. How many times did PvuII cut within the plasmid? b. How many times did HincII cut within the plasmid? c. How many times did HincII cut within the PvuII fragment? d. What are the distances between the PvuII and the HincII sites?
Molecular Biology 2016
Lab exercise (4 points/question)
Dilutions exercise with micropipettors (Pg. 13)
1. Indicate the absorbance readings obtained for each of the following solutions which you prepared in the first lab exercise. If you are submitting the assignment as a group of 2, indicate the average absorbance for both samples.
a. A 1.5mM solution of compound “A”. b. A 0.36% (m/v) solution of compound “B”. c. A 6% (v/v) solution of solution I. d. A solution containing 0.5mg of compound “A” and 0.1% (v/v) of compound “B”. e. A solution representing the following ratio: solution I: solution II : water : 2:1:2
Determining DNA concentration: (Pg. 14)
2. Submit a table of the DNA concentration determinations experiment performed on page 14 of the lab manual. Your table should include the following information: Standard DNA concentrations (µg/mL), corresponding A260 readings, and A260 readings of each of the unknown diluted solutions of DNA you prepared.
3. Submit a graph representing the A260 readings Vs standard DNA concentrations. Include a line of best fit, the R coefficient, and the formula of the line.
4. Determine from your graph, what DNA concentration in µg/mL corresponds to an A260 of 1.0.
5. According to the constant determined in the previous question, what was the DNA concentration of the undiluted unknown DNA solution provided?
Restriction digests & agarose gel electrophoresis (Pg. 15-17)
6. Submit a figure and an appropriate figure legend of the agarose gel described on page 17 of the lab manual.
7. Submit a standard curve of the molecular weight ladder (Migration distance Vs. Size in Kbp)
8. Submit a table of the restriction digests of the recombinant plasmid which includes the following information: Enzyme used, number of cuts, fragment sizes observed.
9. In a caption accompanying the table submitted, indicate the total size of the plasmid, the size of the vector, the size of the insert, and the restriction site (s) in which the insert was introduced in the vector.
10. Provide a figure which represents a possible restriction map of the insert within the multiple cloning site of pUC9. Your map should be linear and only include the insert within the multiple cloning site. (See directives on this course’s web site)
Molecular Biology 2016
Bioinformatics 1
11. Submit a table with the following information with regards to each of the unknown genes from the first bioinformatics exercise. (4 points)
The accession number (#2) Coverage Max Ident. E value The definition (#1) The organism from which this sequence was obtained (#3) The product of the gene (#4) The protein id. This is the protein’s accession number (#5)
12. Submit a printout of a FASTA sequence of one of the unknown genes. Include the name of the gene as a heading to the printout. (1 point)
Molecular Biology 2016
Assignment #2
Restriction digests and mapping (4 points/question) The table below presents the results of different digests of a plasmid. HindIII 3.82, 0.18 BamHI 4.0, 2.35, 1.65 EcoRI 3.0, 1.0 HindIII + BamHI 3.55, 2.35, 1.2, 0.27, 0.18 HindIII + EcoRI 1.87, 1.0, 0.95, 0.18 BamHI + EcoRI 1.6, 1.4, 1.0, 0.75, 0.25 1. What is the total plasmid size? 2. Which of the digests is (are) inconsistent with the other results? Give a possible explanation for the inconsistency indicating which fragment size (s) is (are) in disagreement. 3. Draw a circular map which is in agreement with the results presented. 4. Given that 1µg of DNA was used for the EcoRI digest, what are the approximate quantities in µg of each of the fragments? 5. The restriction enzyme ApoI cleaves the sequence R/AATTY (R= A or G and Y = C or T). How many different palindromes does ApoI recognize? 6. A DNA fragment generated with the restriction enzyme XbaI (T/CTAGA) was inserted into the unique NheI (G/CTAGC) site of a vector. Indicate the new 6 base sequence generated following ligation of the XbaI site to the NheI site. 7. Could the new recombinant plasmid described in the previous question be digested with XbaI, NheI, or both enzymes to release the insert?
Molecular Biology 2016
You performed restriction digests and agarose gel electrophoresis of a plasmid using 3 different restriction enzymes. The gel is shown below. Unfortunately, you forgot to label your tubes. The only things you remember is that your standards are in Lane 5 and your uncut control is in Lane 1. Also, you loaded the same amount of total DNA in all the sample wells (1-4). 1 2 3 4 5
16Kb *
8 Kb
2.5 Kb 2.0 Kb 2
1.0 Kb
0.5 Kb
8. What is the approximate size of the plasmid? 20 kb 16 kb 6.5 kb 5.0 kb 9. How many restriction sites are there in the plasmid for the enzyme used in Lane 2? 10. How many restriction sites are there in the plasmid for the enzyme used in Lane 4? 11. What is the most probable size of the band labelled with a star in lane 4?
Molecular Biology 2016
PCR Consider the following information to answer questions 12-16: (4 points/question) You wish to amplify a 1 Kbp single copy sequence from 1 µg of a single stranded genome which is 109 Kbp using a pair of primers “A” and “B”.
12. What is the minimum number of cycles required to obtain a double stranded amplification product delimited by primers “A” and “B”? 13. What mass of the double stranded PCR product (in µg) delimited by primers “A” and “B” would you have after the number of cycles indicated in the previous question? 14. What mass of the double stranded PCR product (in µg) delimited by primers “A” and “B” would you have after a total of 30? 15. How many additional PCR cycles would be required to attain the same yield of product which was obtained with 1 µg of genomic DNA if you had started with 1 ng of genomic DNA? Consider the following information to answer questions 16-19: (4 points/question) Below is the partial sequence of a 2Kbp region of DNA you wish to amplify and clone in the vector pST18. Below the sequence is indicated the restriction information for the sequence you wish to amplify as determined from a bioinformatics analysis as well as the MCS of pST18.
Number Restriction enz. Position of cuts BamHI 2 26 & (G/GATCC) 1615 BclI 0 (T/GATCA) EcoRI 0
(G/AATTC) pST18 SfaA1 1 540 3.0 Kbp (GCGAT/CGC) XbaI 2 500 & (T/CTAGA) 1500
16. The following sequence represents that of one of the primers designed to amplify and clone the desired sequence: 5'-GAATTCAGGGTCGGCTAT-3'. The underlined sequence represents an EcoRI restriction site. Indicate the sequence of the first 20 bases of the PCR product which would be synthesized from this primer (including the primer sequence)
Molecular Biology 2016
17. Design a second 15 bases primer, which in combination with the one described in the previous question would allow the amplification of the desired region. Include in your primer sequence a restriction site which would allow the directional cloning of the sequence of interest. (Note, the restriction site must be additional to the 15 bases. Underline the sequence of the restriction site and indicate its identity. 18. Your primers allowed you to amplify a 2 Kbp sequence. You digest the amplicon and 100ng of the vector with the appropriate enzymes in order to clone the sequence of interest. How much of the digested amplicon should be added to the ligation mix in order to have an insert to vector ration of 3:1? 19. Following the ligation, you isolate plasmid DNA from a potential recombinant. What digest could be used to verify the presence and the orientation of the desired insert. Indicate the enzyme (s) and the fragment size (s) expected if this is the desired recombinant.
Molecular Biology 2016
Lab exercise
Project I: Verifying the restriction map of a DNA insert (4 points/question) 1. Submit a figure representing the agarose gel electrophoresis of your single digests. Make sure to include an appropriate legend. Follow the directives for figures on the web page of this course. Make sure to include all the required information in the legend for the understanding and interpretation of the figure. 2. Submit a figure representing the agarose gel electrophoresis of your double digests. Make sure to include an appropriate legend. Follow the directives for figures on the web page of this course. Make sure to include all the required information in the legend for the understanding and interpretation of the figure. 3. Submit a table presenting the analysis of the restriction digests. Your table should include: Enzyme (s) used, Total number of cuts, Number of cuts in the vector, Number of cuts in the insert, and Fragments sizes generated. 4. Submit a figure of the restriction map of the insert. Your map must be linear, include the multiple cloning site, indicate the insertion site, the size of the insert, the positions in the multiple cloning site or the insert of all the enzymes tested. Your figure must be to scale. Follow the directives for generating such a figure under the heading Graphs/Figures on this course's web site.
Bioinformatics 2 (1 point/question)
Restriction mapping 5. Present theoretical maps of all unknown genes. Indicate below each map the name of the gene and list the enzymes which do not cut. 6. Compare the theoretical maps generated above to the experimental map of the unknown insert you analyzed in Project I. The unknown insert corresponds most closely to which gene? 7. Submit a printout of the FASTA sequence of the gene corresponding to the unknown insert. 8. Indicate how many times each of the following enzymes cut within the unknown insert identified in question 6: AccI, BglII, MboI, NcoI, and NotI. 9. Amongst the enzymes indicated in the previous question, which one cuts the most often within the DNA insert? Give a reason which would explain why this enzyme cuts more often than the others. Molecular Biology 2016
Bioinformatics 3 (1 point/question) 10. What is the predicted size of the GFP product amplified with the primers used in lab exercise 2? 11. Submit a figure showing the positions and directions of each of the following primers on the pUC19 sequence. A. TGCGGTGTGAAATACCCT B. GCCATTCAGGCTGCGCAA C. GGGTTATTGTCTCATGAG D. GAGACAATAACCCTGATA Indicate in a legend to your figure all primer pairs, if any, would give an amplification product of at least 200bp.
12. Present the complement, inverse, inverse complement and the complement of the inverse of the following sequence:
5’- GAATGCGGCTTAGACTGGTACGATGGAAC-3’
Molecular Biology 2016
Assignment #3 (3 points/question)
1. You decide to clone your favorite gene (yfg) into a 6000bp target plasmid that contains an inducible promoter. To achieve high expression of yfg, you must clone yfg in the same orientation as the promoter in the target vector (arrowheads must point in the same direction). You have already mapped the plasmid for three sticky-end restriction enzymes as shown (assume a negligible distance between the sites in the target vector’s multiple cloning site within lacZ). You also note that yfg has a HindIII site that cuts yfg into a 200bp fragment and an 800bp fragment in your TetR vector when double digested with HindIII and EcoRI. What enzyme(s) would you use to cut the target vector to clone yfg into it? 2. Using your strategy, will yfg insert into the target vector in the same orientation as the promoter always, sometimes, or never?
3. Which single restriction enzyme can be used to conclusively confirm that yfg is cloned in the correct orientation in the target vector? Indicate what results you expect to obtain if yfg is in the correct and in the incorrect orientation.
4. Shown below is a restriction map for the beta-globin gene from mouse. You digest mouse genomic DNA with EcoRI (GAATTC) and resolve the digestion products on an agarose gel. The DNA is then denatured and probed with different labelled fragments for a Southern analysis.
1.0Kb 1.0Kb 4.0Kb 0.8Kb Beta globin gene
Probe 2 Probe 1
5. What fragment size (s) would you expect to see if you perform a Southern blot on the agarose gel using the labelled DNA probe 1 indicated on the figure?
6. What fragment size (s) would you expect to see if you perform a Southern blot on the agarose gel using the labelled DNA probe 2 indicated on the figure? Give the most accurate estimate if a precise size cannot be determined.
Molecular Biology 2016
7. You cloned a genomic DNA fragment generated from an EcoRI digest into a unique EcoRI site of a vector. You identify a recombinant vector that you believe has the DNA of interest. Suppose you find that the gene of interest is in the vector, but now you want to generate a restriction map of the recombinant plasmid. You take three individual samples of the plasmid and digest them with EcoRI, HindIII, and with both EcoRI and HindIII. You then run the digested DNA on an agarose gel to see the fragments. The gel is then subjected to a Southern hybridization using the genomic EcoRI fragment as a probe. Assuming the genomic fragment is smaller than the vector, which fragments on the gel would hybridize to the probe? EcoRI HindIII EcoRI + HindIII
5.3
4.1 3.0 2.7
2.3 1.5 1.1
0.4
8. Draw the restriction map of this recombinant plasmid.
Molecular Biology 2016
Refer to the following description to answer questions 9-12
You designed an experiment to clone a 0.8Kb fragment digested with EcoRI and HindIII into the unique EcoRI and HindIII restriction sites of a vector. A double digest of the vector generates two fragments of 7.2 Kb and 0.016Kb. In order to minimize reassembly of the vector, the 0.016Kb fragment was removed from the double digest preparation of the vector. Transformations of the following samples were then performed:
a. 5pg of undigested vector b. 30ng of EcoRI digested vector which was treated with DNA ligase c. 30ng of EcoRI + HindIII digested vector which was treated with DNA ligase d. 30ng of EcoRI + HindIII digested vector mixed with 10ng of the digested DNA fragment and then treated with DNA ligase
Below is indicated the number of colonies obtained for the different samples. Unfortunately, the plates representing transformations b-d were not labelled.
Undigested vector I II III
50 45 350 0
9. What was the ratio between insert : vector in reaction “d”? 10. What was the transformation efficiency with the undigested vector? (transformants/µg) 11. Which plate has the highest probability of containing colonies representing plasmid recombinants? 12. Which plate illustrates intramolecular ligation events?
Molecular Biology 2016
13. Fred is married to Helen, who was previously married to George, now deceased. George and Helen conceived one child together and adopted one child. Fred and Helen have also conceived one child. All members of Helen’s current family have had DNA fingerprinting done at a single VNTR locus. Unfortunately, the sheet that identified each child has been misplaced. Identify which fingerprint in each lane (in lanes 5, 6, and 7) correspond to each child.
Fred and Helen’s conceived child Child ____ George and Helen’s conceived child Child ____ George and Helen’s adopted child Child ____
14. Considering all the individuals tested on the gel in the previous question, what is the minimum number of different alleles which were observed of the VNTR? 15. If Fred was the father of the adopted child, what would be a possible profile for the VNTR of the mother?
16. The following diagram shows a Southern blot of restriction digested genomic DNA from an elf Mother (M) and elf Father (F) and four potential elf children (C1 to C4) probed with a VNTR DNA sequence. The restriction enzyme used was Not I. Another elf (F2) is claiming to be the father of child C4. Assume the mother, M, is the real mother of these four children. Which children are biologically related to the elf Father (F)? 17. Which children if any, could be elf F2's children? 18. Consider the data in the lane labelled “markers”. According to this lane only, what is the minimum number of loci which are being examined? 19. If the number of loci indicated in the previous question represents the total number of loci being examined, the profile of C4 must include a minimum of how many heterozygous loci?
Molecular Biology 2016
Lab Exercises (4 points/question) Genomic DNA fingerprinting 1. Submit a figure of the agarose gel representing the analysis of the ApoC2 gene. Include an appropriate legend indicating the sizes observed. 2. Submit a figure of the agarose gel representing the analysis of the ApoB gene. Include an appropriate legend indicating the sizes observed. 3. Provide an analysis of the genomic fingerprints obtained overall in the class. Your analysis should include the following information: Number of different alleles observed Frequency of occurrence of each allele Number of individuals homozygous and heterozygous for each of the alleles
Project II: Amplification and mutagenesis of GFP 4. Submit a figure representing your PCR of the GFP gene. Include an appropriate legend indicating the expected size as determined by bioinformatics and the experimental size, determined from your gel.
Transformation and screening of GFP recombinants 5. Indicate the number of transformants obtained following the transformation of the ligation mixtures with and without the GFP amplicon. Submit your data as colony counts/mL 6. Submit a figure of the digestions performed on the amplicons obtained by colony PCR. 7. Submit a table which presents the following information for each of the 4 clones you screened:
Indicate fragment sizes obtained before and after SalI digests
Molecular Biology 2016
Bioinformatics 4 (1.5 points/question) 8. Submit a table indicating the following information: Human alpha 1 nucleotide accession number Human alpha 2 nucleotide accession number Human alpha 1 protein accession number Human alpha 2 protein accession number Baboon nucleotide accession number Baboon protein accession number The percentage identity between each pair of nucleotide homologues and each pair of protein homologues.
9. Between the two most closely related proteins, indicate the percentage conserved, semi conserved or not conserved amino acid substitutions with respect to the total number of substitutions? 10. Submit a table indicating the following information: The source organism of each of the protein homologues examined in part II of the bioinfo exercise Their accession numbers The percentage identity between each pair of protein homologues.
11. With respect to the first protein homologue, what type of homologue is each of the other protein homologues?
Bioinformatics 5: (1.5 points/question) 12. Submit the annotated sequence (nucleotides with corresponding amino acids) of the longest ORF found for the viral1 sequence. 13. Does the sequence submitted in the previous question represent the genome sequence of the virus, the mRNA sequence or both? 14. Does the original sequence on which the analysis was performed represent the genome sequence of the virus, the mRNA sequence or both? 15. Submit the following information for the longest ORF from the viral1 and viral2 sequences: The definition The organism this gene comes from The name of the gene (Not the gene product) The name of the gene product
Molecular Biology 2016
16. Submit the following information for the viral3 sequences: What SNPs (single nucleotide polymorphisms) has the viral3 sequence acquired? What is the percentage identity at the nucleotide level between the viral1 and viral3 sequences? What is the percentage identity at the protein level between the two sequences? Indicate the number of conserved, semi-conserved and non-conserved amino acid changes.
17. What three conserved protein domains are present in the unknown human sequence?
Molecular Biology 2016
Assignment #4 (3 points/question)
1. Indicate how each of the following conditions would affect stringency: increase, decrease or no effect.
Condition Effect
Increased temperature
Increased NaCl concentration
Higher G:C content
Higher urea concentration
Higher probe concentration
2. Below are the sequences of portions of the yfg1 mRNA and three non-yfg1 mRNAs found in zebrafish embryos (A, B, and C). 5’...GAUGAAAGAUCAGGUCUGAAUGUAU...3’ yfg1 mRNA 5’...UUUGAAAGAUCAGGUCUGAAUGUAU...3’ A 5’...CUACUUUCUAGUGGUCUGAAUGUAU...3’ B 5’...CUACUUUCUAGUCCUCUGAAUGUAU...3’ C You’ve created a probe which is 100% complementary to the sequence of the yfg1 mRNA: 5’...TTCAGACCTGATCTTT...3’. You hybridize the probe to a blot of total zebra fish RNA at room temperature (20˚C), and then want to adjust the stringency of your washes by increasing the temperature of the buffer. You perform your highest stringency wash at a temperature of 50˚C. Which of the four mRNA(s) will you “see” as bands on film when you develop your northern blot? A. yfg1 alone B. yfg1 and A C. yfg1 and B D. yfg1 and C E. all of the above F. none of the above
Molecular Biology 2016
3. Starting with a single molecule of an mRNA template and sufficient primers, enzyme and all other co-factors for successful gene specific RT-PCR, how may PCR cycles are required to have 8 molecules of products with ends defined by both primers? By this I mean that you count only double stranded molecules that begin and end at the primer binding sites but lack any other sequence. 4. One strand of the extremely tiny gene Liliputian is shown below, with its start and stop codons underlined.
5’-TGAGGCATCATCGGTATGGCACCCTTAATGGGCATTGCACCCATAGTACGATAAGCATGTCCTGAA-3’
Is this the template or the non-template strand?
5. I want to use RT-PCR to make a copy of the entire Liliputian gene. Indicate, the sequence of a primer of 6 nucleotides that could be used for the first strand synthesis of cDNA.
Refer to the following description to answer questions 6-10
Below are 210 consecutive base pairs of DNA that includes only the beginning of the sequence of gene X. The underlined sequence (from position 20-54) represents the promoter for gene X and the underlined and italicized sequence (from position 71-90) encodes the gene X ribosome binding (RBS) site. Transcription begins at and includes the T/A base pair at position 60 (underlined).
1 10 20 30 40 50 60 70 I------I------I------I------I------I------I------I 5’ ATCGGTCTCGGCTACTACATAAACGCGCGCATATATCGATATCTAGCTAGCTATCGGTCTAGGCTACTAC 3’ TAGCCAGAGCCGATGATGTATTTGCGCGCGTATATAGCTATAGATCGATCGATAGCCAGATCCGATGATG Promoter 80 90 100 110 120 130 140 I------I------I------I------I------I------I 5’ CAGGTATCGGTCTGATCTAGCTAGATGCTCTTCTCTCTCTCCCCCGCGGGGGCTGTACTATCATGCGTCG 3’ GTCCATAGCCAGACTAGATCGATCTACGAGAAGAGAGAGAGGGGGCGCCCCCGACATGATAGTACGCAGC RBS 150 160 170 180 190 200 210 ------I------I------I------I------I------I------I 5’ TCTCGGCTACTACGTAAACGCGCGCATATATCGATATCTAGCTAGCTATCGGTCTCGGCTACTACGTAAA 3’ AGAGCCGATGATGCATTTGCGCGCGTATATAGCTATAGATCGATCGATAGCCAGAGCCGATGATGCATTT
6. What are the first 6 nucleotides of the mRNA from gene X? 7. What are the first 4 amino acids encoded by gene X? 8. You have found a mutant of gene X. The mutation represents an SNP which changes the T/A base pair at position 110 (underlined) to A/T. Would the mRNA expressed from this version of gene X be longer, shorter, or the same as that produced from the normal gene X? 9. If the mRNA can be translated, would you expect the protein to be longer, shorter, or the same as that produced from the normal gene X? 10. Do you expect that the protein produced will have the same function as the normal protein X?
Molecular Biology 2016
11. You have been asked to PCR amplify a specific sequence from cDNA that was synthesized from mRNA isolated from brain tissue. After you run your potential PCR product on an agarose gel containing ethidium bromide, you observe no bands when you visualize the gel using ultraviolet light. Why might this be the case?
A. The gene you are interested in is not expressed in brain tissue. B. An oligo dT was used instead of a oligo dA to prime the first strand cDNA synthesis. C. A specific primer whose sequence was that of the non-coding strand of the gene was used to prime the first strand cDNA synthesis. D. You used reverse transcriptase instead of Taq polymerase to synthesize the first strand of cDNA.
Choose all possible answers.
12. The following schematic represents a yeast gene and it's various elements:
(1) (200) ATG (510) (1060) (1600) (1850) (2110) TAG (2510) (2890)
Promoter
Transcription terminator
Exon
Intron Coding DNA
Indicate the predicted sizes of each of the following: A. Pre-mRNA (non processed) B. mRNA C. Protein D. mRNA from a mutant gene with a point mutation creating a stop codon at position 1698 E. Protein from a mutant gene with a point mutation creating a stop codon at position 1698
Molecular Biology 2016
13. The gene described in the previous question is known to be repressed 5 fold when cells are grown in glucose as compared to growth in glycerol. To study the expression of this gene, a northern analysis was performed for a wild type strain as well as various mutants grown in glycerol. Blots were simultaneously probed for the gene shown above, as well as a house keeping gene; GAPDH. A densitometric analysis was then performed. Some of the results obtained are presented in the table below:
Densitometric data Strain and growth condition Yeast GAPDH gene 1 Wild type grown in glucose 500 500 2 Wild type grown in glycerol 100 3 Mutant strain with a 1 base insertion at position 515 grown in glycerol 250 4 Mutant strain with an snp at position 515 creating a neutral amino acid 250 change grown in glycerol 5 Mutant strain with an snp at position 515 creating non-synonymous - 500 non conserved amino acid change grown in glycerol 6 Mutant strain with a mutation which enhances the promoter's activity 2 500 fold grown in glycerol Complete the table to indicate the approximate densitometric values expected for the yeast gene's mRNA.
14. Which of the above strains grown in glycerol would you expect to have the highest level of specific activity (activity per protein molecule)? 15. Which of the above strains grown in glycerol would you expect to have the lowest level of specific activity (activity per protein molecule)? 16. Which of the above strains under which growth condition would you expect to synthesize the highest level of protein per cell (whether active or inactive)
Molecular Biology 2016
Lab Exercises (4 points/question)
RT-PCR 1. Submit a figure of your RT-PCR gel with an appropriate figure legend. Your figure legend must include the sizes of the products observed in each lane. 2. What was the purpose of the DNAse treatment? 3. What was the purpose of the PCR reaction of the PCR reaction of RNA NOT treated with either DNAse or RT? 4. Did the the sizes of RT specific PCR products correspond to that of the PCR using genomic DNA as template? If it did, indicate what that tells you about this RNA. If it didn’t, indicate what that tells you about this RNA.
Project IV: Control of GFP (northern analysis/enzyme activity) 5. Submit a figure of your RNA gel and corresponding northern hybridization with an appropriate figure legend. 6. Obtain densitometric data for the GFP and bla mRNA signals obtained from the E.coli recombinant cultures grown under the different growth conditions. Submit a table of the raw data obtained with Image J. (See tutorial on this course's web site under the heading "Bioinfo links") Your table must include the raw data (the values for each of the areas), the normalized values (GFP reading/bla reading) for each of the growth conditions and the relative expression as compared to growth of the wild type GFP recombinant grown in glucose. 7. Submit a table of the data and corresponding analysis of the GFP activity assays. Your table should include: The growth condition and the type of mutation of each strain assayed. Absorbencies and OD600 values for each of the strains under each of the growth conditions assayed. Normalized activity units (GFP absorbance/1 OD600 value) for each of the strains under each of the growth conditions assayed. The relative activity levels as compared to growth of the wild type GFP recombinant grown in glucose. A caption indicating which mutant showed the greatest relative reduction in activity.
Molecular Biology 2016
Bioinformatics: (2 points/question) You should now be quite familiar with the NCBI site and be able to complete the following exercise with relatively few directives. Consider this as a practice run for the bioinformatics section on the final exam.
CAGGCTCCAGAACACCACCATTGGGTTAACTGTGTTTGCCATCAAGAAATACGTGGCTTTCCTGAAGCT GTTCCTGGAGACGGCGGAGAAGCACTTCATGGTGGGCCACCGTGTCCACTACTATGTCTTCACCGACCAG CCGGCCGCGGTGCCCCGCGTGACGCTGGGGACCGGTCGGCAGCTGTCAGTGCTGGAGGTGCGCGCCTACA AGCGCTGGCAGGACGTGTCCATGCGCCGCATGGAGATGATCAGTGACTTCTGCGAGCGGCGCTTCCTCAG CGAGGTGGATTACCTGGTGTGCGTGGACGTGGACATGGAGTTCCGCGACCACGTGGGCGTGGAGATCCTG ACTCCGCTGTTCGGCACCCTGCACCCCGGCTTCTACGGAAGCAGCCGGGAGGCCTTCACCTACGAGCGCC GGCCCCAGTCCCAGGCCTACATCCCCAAGGACGAGGGCGATTTCTACTACCTGGGGGGGTTCTTCGGGGG GTCGGTGCAAGAGGTGCAGCGGCTCACCAGGGCCTGCCACCAGGCCATGATGGTCGACCAGGCCAACGGC ATCGAGGCCGTGTGGCACGACGAGAGCCACCTGAACAAGTACCTGCTGCGCCACAAACCCACCA
8. What is the name of the gene from which this sequence was obtained? 9. What is the probability that the gene found in question 8 is a true match? 10. Is the source sequence RNA or genomic DNA? 11. What is the accession number of the gene found in question 8? 12. What is the accession number of the protein corresponding to the gene found in question 8? 13. Give the accession number of the chimpanzee (Pan troglodytes) protein orthologue of the protein found in question 12. 14. What is the percent identity between the protein for question 12 and the baboon protein orthologue obtained for question 13? 15. How many times do BamHI and HincII cut within the gene obtained in question 8? 16. Which of the following primers would hybridize to the mRNA of the gene obtained in question 1 which would allow you to perform a reverse transcriptase reaction? A. CCGCAACACCTCGGC B. CAAGAACCACCAGGC C. CCGCAACACCTCGAA D. GTGCCCAGCAGCTGC
Molecular Biology 2016
17. The sequence at the bottom of this page represents a different allele of the gene discussed in question 1. Does it contain one or more SNPs as compared to the sequence corresponding to that obtained from the NCBI site? If so, what are they? Indicate the position as well as the base change (Ex. G218 to C) 18. Do these SNPs change the reading frame of the gene? 19. How long is the protein encoded by the gene sequence obtained in question 8? GGAGGCCGAGACCAGACGCGGAGCCATGGCCGAGGTGTTGCGGACGCTGGCCGGGAAAACCAAAATGCCA CGCACTTCGACCTATGATCCTTTTCCTAATAATGCTTGTCTTGGTCTTGTTTGGTTACGGGGTCCTAAGC CCCAGAAGTCTAATGCCAGGAAGCCTGGAACGGGGGTTCTGCATGGCTGTTAGGGAACCTGACCATCTGC AGCGCGTCTCGTTGCCAAGGATGGTCTACCCCCAGCCAAAGGTGCTGACACCGTGTAGGAAGGATGTCCT CGTGGTGACCCCTTGGCTAGCTCCCATTGTCTGGGAGGGCACATTCAACATCGACATCCTCAACGAGCAG TTCAGGCTCCAGAACACCACCATTGGGTTAACTGTGTTTGCCATCAAGAAATACGTGGCTTTCCTGAAGC TGTTCCTGGAGACGGCGGAGAAGCACTTCATGGTGGGCCACCGTGTCCACTACTATGTCTTCACCGACCA GCCGGCCGCGGTGCCCCGCGTGACGCTGGGGACCGGTCGGCAGCTGTCAGTGCTGGAGGTGCGCGCCTAC AAGCGCTGGCAGGACGTGTCCATGCGCCGCATGGAGATGATCAGTGACTTCTGCGAGCGGCGCTTCCTCA GCGAGGTGGATTACCTGGTGTGCGTGGACGTGGACATGGAGTTCCGCGACCACGTGGGCGTGGAGATCCT GACTCCGCTGTTCGGCACCCTGCACCCCGGCTTCTACGGAAGCAGCCGGGAGGCCTTCACCTACGAGCGC CGGCCCCAGTCCCAGGCCTACATCCCCAAGGACGAGGCCGATTTCTACTACCTGGGGGGGTTCTTCGGGG GGTCGGTGCAAGAGGTGCAGCGGCTCACCAGGGCCTGCCACCAGGCCATGATGGTCGACCAGGCCAACGG CATCGAGGCCGTGTGGCACGACGAGAGCCACCTGAACAAGTACCTGCTGCGCCACAAACCCACCAAGGTG CTCTCCCCCGAGTACTTGTGGGACCAGCAGCTGCTGGGCTGGCCCGCCGTCCTGAGGAAGCTGAGGTTCA CTGCGGTGCCCAAGAACCACCAGGCGGTCCGGAACCCGTGAGCGGCTGCCAGGGGCTCTGGGAGGGCTGC CGGCAGCCCCGTCCCCCTCCCGCCCTTGGTTTTAGCAGAACGGGTAAACTCTGTTTCCTTTGTCCGTCCT GTTGTGAGTAACTGAAGCCTAGGCCCCGTCCCCACCTCAAATCACACACACCCCCTCCCCACCACAGAGA CACCATTACATACACAGACACACACAGAAAGACACACACAGACACAAAATCACACACACACCCTCCCCGC CACAGAGACACCATTACATACACAGACACACACAGAAAGACACAGACACAAAATCACACACACACCCTCC CCGCCACAGAGACACACCATTACATACACAGACACGCAATCGCAGATACGCCCTTCCGGCCACAGAAACA CACCATTACACACACATACACAGAAAGACACACACAGACACACAATCACACGCAGCCCCTCCCCGCCACA GAGACACACCATTACATACACAGACACACACAGAAAGACAC