Supplement 1: Genetic Sequencing and Filtering Strategy of Whole Exome Sequencing Data Based on the Initial Differential Diagnos
Total Page：16
File Type：pdf, Size：1020Kb
Supplement 1: Genetic sequencing and filtering strategy of whole exome sequencing data Based on the initial differential diagnosis of Biotin-responsive basal ganglia disease (BBGD) due to the partly similar MRI features, mutations and copy number variants in the BBGD gene SLC19A3 [1] were first excluded by Sanger sequencing and qPCR, respectively. To search more widely for the cause of this cHSP presentation WES was subsequently initiated. Given the autosomal recessive pattern of inheritance, we first filtered the WES data-set for potential compound heterozygous or homozygous non-synonymous or canonical splice site variants common to all four affected sibs. We excluded variants with a minor allele frequency > 0.1% in 8,000 exomes of an in-house database and public databases (1000 Genomes, dbSNP 142, Exome Aggregation Consortium (ExAC) Server). This first analysis prioritized a single gene, MAP3K4, carrying a homozygous missense variant, which, however, is rated as likely benign in silico (PolyPhen 2 (benign), Sift (score 0.3), CADD (score 12.9)). In a second search, we also considered near-splice variants. This filtering step revealed one additional variant, c.91+6T>C, p.(?), in SERAC1 (NM_032861.3), present in a homozygous state. The variant c.91+6T>C is absent from 8,000 in- house exomes as well as public databases (1000 Genomes, dbSNP 142, ExAC Server (Cambridge, MA [02/2016]), and was observed in all four affected subjects that had received WES. Supplement 2: SERAC 1 cDNA Sequencing and Western Blotting SERAC1 reverse transcription Total RNA was isolated by means of the High Pure RNA Isolation Kit (Roche; according to the manufacturer´s protocol) from fibroblasts from (i) SERAC1 patient III.1 of the index family, (ii) SERAC1 MEGDEL #1 patient, and (iii) healthy controls. Concentration and purity were determined by the NanoDrop ND1000 spectrophotometer (Peqlab). 1µg RNA (for sequencing) and 250ng RNA (for qPCR) were used for reverse transcription with the Transcriptor High Fidelity cDNA Synthesis Kit (Roche) following the manufacturer’s instructions. SERAC1 cDNA Sequencing Specific primers amplifying SERAC1-cDNA exon1 to exon4 were used in a 25 µl GoTaq® G2 DNA Polymerase (Promega) PCR with an annealing temperature of 56°C. The resulting PCR products were analyzed on an agarose gel and distinct products were sequenced with the BigDye Terminator v3.1 Cycle Sequencing Kit and the automated sequencer ABI Prism 3100 Genetic Analyzer (Applied Biosystems). Sequences were visualized with Staden 2.0.0b10 software (Staden Sourceforge). Quantitative Real Time Polymerase Chain Reaction (qRT-PCR) For mRNA expression analysis, cDNA was diluted 1:10 and qRT-PCR was performed on a Light Cycler 480 using the Light Cycler 480 SYBR Green I Master Kit (Roche). Two primer pairs specifically amplifying SERAC1 cDNA were used with a Touchdown qPCR protocol. Primer-pair 1 (FW: GCTGGCCCAAGACATGGTTAG; RV: CAAACCACTGGCCTATCCCC) is amplifying SERAC1 exon 12-13, whereas primer-pair 2 (FW: CCAACCTACATTGGCAGCAT; RV: TTGGCTAAAGCTTCACGAATGA) amplifies SERAC1 exon 16-17. Runs were performed in technical triplicates, using a standard curve and three housekeeping genes (RNF10, RNF111, GAPDH) for an advanced relative quantification with the Light Cycler 480 Software 1.5.1.62 (Roche). Western Blotting Fibroblasts were lysed in RIPA Buffer (SIGMA) including protease inhibitor (cOmplete Mini, Roche). After centrifugation at 14,000 rmp for 15 minutes at 4°C protein amount was detected with the Pierce™ BCA Protein Assay Kit (Thermo Scientific) and 40 µg were mixed with PierceTM Lane Marker Reducing Sample Buffer (5X) and separated with a customized 10% Bis-Tris NuPAGE Gel. Proteins were transferred onto a PVDF membrane (Immobilon, Millipore) and probed with rabbit anti-SERAC1 (HPA025716; Sigma; 1:500) and mouse anti-GAPDH (H86504M; Meridian) antibodies in 5% skim milk TBS-T (50 mM Tris, 150mM NaCl, 0,1% Tween-20) at 4°C overnight. After an 1 hour incubation at room temperature with HRP-coupled secondary antibodies membranes were developed with ECL solution and the ChemiDOC MP Imaging System (Bio-Rad). Supplement 3: Phosphatidylglycerol analysis Fibroblasts were sampled from (1) the affected SERAC1 patient III.3 from the index family; (2) n=8 SERAC1 MEGDEL patients with the classic infantile MEGDEL phenotype (including patient SERAC MEGDEL #1) serving a positive disease controls, and (3) n=3 healthy controls. Phosphatidylglycerol analysis was performed as described previously [2]. Briefly, fibroblast cell lines were harvested by centrifugation at 200g for 5 min at room temperature, washed once with PBS, pelleted by centrifugation at 200g for 5 min at room temperature and snap frozen in liquid nitrogen. The concentrations of the phosphatidylglycerol species PG(34:1) and PG(36:1) were determined by normal phase HPLC tandem mass spectrometry using PG(28:0) as internal standard. The raw data was processed using a bioinformatics pipeline3 that yielded the relative abundances (to the internal standard) of the PG species. Supplement 4: Method of analysis of organic acids in urine Organic acids were determined in urine according to Hoffmann et al [3] and Sweetman [4][2]. Briefly a urine volume equivalent to 1 µmol creatinine was acidified with hydrochloric acid and extracted twice with ethylacetate. After removal of the solvent the residue was derivatized with N-methyl-N-trimethylsilyl- heptafluorbutyramide (MSHFBA, Macherey-Nagel, Düren, Germany). The resulting trimethylsilyl derivatives were analyzed on the single quadrupole mass spectrometer DSQ II (Thermo Fisher Scientific GmbH) coupled to the gaschromatograph TRACE GC (Thermo Fisher Scientific GmbH). The mass spectrometer was run in the full scan mode (m/z 50 to m/z 650) with electron impact ionization. Gas chromatographic separation was achieved on a capillary column (DB-5MS, 30 m x 0.25 mm; film thickness: 0.25; J&W Scientific, Folsom, CA, USA) using helium as a carrier gas. A volume of 1 µL of the derivatized sample was injected in splitless mode. GC temperature parameters were 80°C for 2 minutes, ramp 50°C/minute to 150 °C, ramp 10°C/minute to 300°C. Injector temperature was set to 260°C and interface temperature to 260°C. Supplement 5: Filipin Staining Fibroblasts were obtained from skin biopsies from 4 different subjects: (1) subject III.3 from the SERAC1 index family; (2) patient SERAC1 MEGDEL #1; (3) a healthy control; and (4) a patient with a typical infantile-onset Niemann Pick Type C (NP-C) disease. For filipin staining cells from confluent culture were seeded on Chamber Slides (Lab- Tek). After 24 h culturing in RPMI supplemented with 20% Fetal Calf Serum cells were fixed, stained with Filipin reagent and analyzed with a fluorescent microscope. Intracellular lipid accumulation was classified as normal (negative fluorescence), variant (moderate fluorescence) or classical (high fluorescence). Filipin staining showed a classical lipid accumulation pattern in the typical NP-C subject (Figure 4A), but a negative fluorescence pattern in both the mildly affected, late-onset SERAC1 subject III.3 (Figure 4B) and the severely affected, infantile-onset SERAC1 subject with the MEGDEL phenotype (Figure 4C), both similar to the healthy control (Figure 4D), except a slightly higher, unspecific level of background fluorescence These findings indicate that the sensitivity of filipin staining as a cell-based diagnostic biomarker might be limited for detecting underlying SERAC1 disease, both in SERAC1 patients with an atypical late-onset, oligosymptomatic phenotype as well as in SERAC1 patients with the typical infantile-onset multisystemic MEGDEL phenotype. Supplement 6 Figure Supplement 6: FLAIR MRI images showing the different extent of the T2- hyperintense lesions of the caudate nucleus and putamen in the affected family members (dd = disease duration). On closer inspection, MRI revealed an at least biphasic development of the signal changes of the putamen and caudate nucleus across subjects, with initial swelling (in subject III.5, images A & F; corresponding to Wortmann stage 2 [1]) and subsequent atrophy of these structures (in subjects II.6 and III.2, III.3., III.4, images 1 B- E & G-J); corresponding to Wortmann stage 3-4 [1]). The most severely affected subject with the longest disease duration (22 years) showed the most advanced signal and atrophic changes, respectively (II.6), with characteristic sparing of T2-hyperintense lesions in the dorsal putamen (“putaminal eye” [1]; arrows). Supplement references 1. Zeng WQ, Al-Yamani E, Acierno JS, Jr., Slaugenhaupt S, Gillis T, MacDonald ME, Ozand PT, Gusella JF. Biotin-responsive basal ganglia disease maps to 2q36.3 and is due to mutations in SLC19A3. American journal of human genetics 2005;77(1):16-26 doi: 10.1086/431216[published Online First: Epub Date]|. 2. Herzog K, Pras-Raves ML, Vervaart MA, Luyf AC, van Kampen AH, Wanders RJ, Waterham HR, Vaz FM. Lipidomic analysis of fibroblasts from Zellweger spectrum disorder patients identifies disease-specific phospholipid ratios. J Lipid Res 2016;57(8):1447-54 doi: 10.1194/jlr.M067470[published Online First: Epub Date]|. 3. Hoffmann G, Aramaki S, Blum-Hoffmann E, Nyhan WL, Sweetman L. Quantitative analysis for organic acids in biological samples: batch isolation followed by gas chromatographic-mass spectrometric analysis. Clinical chemistry 1989;35(4):587-95 4. Sweetman L. Organic Acids Analysis. New York: Wiley-Liss, 1991. .