Janus Kinase 2 Regulates Transcription Factor EB Expression and Autophagy Completion in Glomerular Podocytes

BASIC RESEARCH www.jasn.org

Tamadher A. Alghamdi,* Syamantak Majumder,* Karina Thieme,* Sri N. Batchu,* † Kathryn E. White, Youan Liu,* Angela S. Brijmohan,* Bridgit B. Bowskill,* ‡ Suzanne L. Advani,* Minna Woo, and Andrew Advani*

*Keenan Research Centre for Biomedical Science and Li Ka Shing Knowledge Institute of St. Michael’s Hospital, Toronto, Ontario, Canada; †Electron Microscopy Research Services, Newcastle University, Newcastle upon Tyne, United Kingdom; and ‡Toronto General Hospital Research Institute, University Health Network, Toronto, Ontario, Canada

ABSTRACT The nonreceptor kinase Janus kinase 2 (JAK2) has garnered attention as a promising therapeutic target for the treatment of CKD. However, being ubiquitously expressed in the adult, JAK2 is also likely to be necessary for normal organ function. Here, we investigated the phenotypic effects of JAK2 deﬁciency. Mice in which JAK2 had been deleted from podocytes exhibited an elevation in urine albumin excretion that was accompanied by increased podocyte autophagosome fractional volume and p62 aggregation, which are indicative of impaired autophagy completion. In cultured podocytes, knockdown of JAK2 similarly impaired autophagy and led to downregulation in the expression of lysosomal genes and decreased activity of the lysosomal enzyme, cathepsin D. Because transcription factor EB (TFEB) has recently emerged as a master regulator of autophagosome-lysosome function, controlling the expression of several of the genes downregulated by JAK2 knockdown, we questioned whether TFEB is regulated by JAK2. In immortalized mouse podocytes, JAK2 knockdown decreased TFEB promoter activity, expression, and nuclear localization. In silico analysis and chromatin immunoprecipitation assays revealed that the downstream mediator of JAK2 signaling STAT1 binds to the TFEB promoter. Finally, overexpression of TFEB in JAK2-deﬁcient podocytes reversed lysosomal dysfunction and restored albumin permselectivity. Collec- tively, these observations highlight the homeostatic actions of JAK2 in podocytes and the importance of TFEB to autophagosome-lysosome function in these cells. These results also raise the possibility that therapeutically modulating TFEB activity may improve podocyte health in glomerular disease.

J Am Soc Nephrol 28: 2641–2653, 2017. doi: https://doi.org/10.1681/ASN.2016111208

Podocytes are in a unique situation. As terminally dif- organelles. They also depend on intrinsic survival sig- ferentiated epithelial cells with interdigitating feet that nals, among them signals that are mediated by the encompass the capillary walls within the glomerular nonreceptor kinase, Janus kinase 2 (JAK2).2 tuft, they are uniquely exposed to metabolic shifts and hemodynamic pressures that render them vulnerable to injury in glomerular disease. Where the potential Received November 14, 2016. Accepted March 20, 2017. for regeneration and replacement is limited, podocytes Published online ahead of print. Publication date available at depend heavily on their use of homeostatic pathways www.jasn.org. to mitigate the pressures that they face. For instance, Correspondence: Dr. Andrew Advani, St. Michael’sHospital, they possess a high basal rate of macroautophagy 6-151, 61 Queen Street East, Toronto, ON, Canada M5C 2T2. (henceforth referred to as autophagy),1 aself-degradative Email: [email protected] process that removes protein aggregates and damaged Copyright © 2017 by the American Society of Nephrology

J Am Soc Nephrol 28: 2641–2653, 2017 ISSN : 1046-6673/2809-2641 2641 BASIC RESEARCH www.jasn.org

The JAK/Signal Transduction and Activation of Transcrip- (Supplemental Figure 1). Second, to generate podocyte-specific fl fl tion (STAT) pathway is an intracellular signaling cascade that JAK2 knockout animals, we bred Podocin-cre+ mice with Jak2 / regulates cell growth, proliferation, and differentiation.3 Of the mice in which loxP sites had been placed around the promoter four JAK family members (JAK1, JAK2, JAK3, and tyrosine and first coding exon of Jak2.19 We studied two groups of mice: fl fl kinase 2), the JAK2 isoform has become a focus of accelerated Podocin-cre+Jak2+/+ mice and Podocin-cre+Jak2 / mice, hence- drug discovery attentions since 2005, when activating muta- forth referred to as JAK2Ctrl and JAK2podKO, respectively. Both tions of its encoding gene were first shown to underlie the groups of mice were born in the expected Mendelian frequency. development of certain myeloproliferative neoplasias.4 In kid- To determine the efficiency of JAK2 deletion, we isolated pri- ney disease, evidence of JAK/STAT pathway activation in hu- mary cultured podocytes from JAK2Ctrl and JAK2podKO mice. man diabetic nephropathy5,6 encouraged the repurposing of Primary cultured podocytes were recognizable by their arbor- the JAK1/2 inhibitor baricitinib, and this was recently shown ized morphology and the expression of the podocyte protein to reduce albuminuria and markers of renal inflammation in a nephrin on immunoblotting (Figure 1B). JAK2 deletion from phase 2 study.7 podocytes in JAK2podKO mice was confirmed by (1)immuno- Although current advances have shone the spotlight on JAK/ blotting (Figure 1C) and (2)immunofluorescence microscopy STAT signaling as a promising treatment target for kidney dis- (Figure 1D). ease,8 this is not itself a new concept. It has been a decade and a In adult mice (age 10 weeks old), the magnitude of urine half since JAK2-mediated signaling was first implicated in the albumin excretion in JAK2podKO mice was almost double that development of kidney inflammation and fibrosis, an inference of their littermate controls (Figure 1E, Supplemental Table 1). fl that came about with the publication of a collection of reports Albuminuria in Podocin-cre+Jak2 /+ heterozygous mice fell describing its actions in glomerular mesangial cells.9–11 Since midway between the levels seen in JAK2Ctrl and JAK2podKO then, podocyte preservation has gained increasing traction for mice (urine albumin excretion, 2264 mg/d; n=13). By 6 its importance in preventing both the initiation and propagation months of age, urine albumin excretion was increased three- of glomerular disease,12,13 and in contrast to the studies in rep- fold in JAK2podKO mice(Figure1E).Insubsequentexperi- licating mesangial cells, the few reports that have examined the ments, we focused our analyses on the structural changes actions of JAK2 in podocytes have cited the kinase as being a that occurred in mice at the earlier (10 weeks) time point, mediator of cell survival.2,14 which we speculated were more likely to be causatively impli- Cognizant of the growing interest in therapeutic applica- cated in the development of albuminuria. At this stage, glo- tions that alter JAK/STAT signaling in kidney disease and the merular morphology in JAK2podKO mice was unremarkable dearth of literature espousing the homeostatic actions of the when assessed by light microscopy (Supplemental Figure 2). pathway in podocytes, we set out to examine the phenotypic In contrast, when we examined the ultrastructure of podocytes effects of JAK2 absence. To our surprise, we found that JAK2 by transmission electron microscopy, we observed an approx- deficiency in mice led to an impairment in autophagy in po- imately 80% increase in autophagosome fractional volume in docytes, and in exploring the means by which this occurred, we JAK2podKO mice (Figure 1F). Similarly, in primary podocytes identified a hitherto unrecognized action of JAK2 in control- from JAK2podKO mice, there was an increase in abundance of LC3- ling the expression of the master regulator of autophagy15 and II, the autophagosome-associated phosphatidylethanolamine- lysosome function,16 transcription factor EB (TFEB). conjugated form of the protein microtubule-associated protein 1A/1B–light chain 3 (LC3)20 (Figure 1G). We considered that increased autophagosome fractional volume and LC3-II levels RESULTS could be due to either enhanced induction of autophagy or impaired completion of autophagy. To help us distinguish Knockout of JAK2 from Podocytes Impairs Autophagy between these two scenarios, we probed for the autophagy sub- Completion in Mice strate, p62 (also called sequestosome 1), that accumulates in Toexamine the normal actions of JAK2-dependent signaling in the cytosol when autophagy is impaired.21 In comparison with podocytes, we generated podocyte-specificJAK2knockout JAK2Ctrl mice and suggestive of impaired autophagy comple- mice. First, to confirm that Cre recombinase expression was tion, there was an increase in podocyte p62 in JAK2podKO mice limited to the glomerulus, we bred Podocin-cre+ mice17 with (Figure 1, H and I). This impairment in autophagy completion fl fl ROSA26 reporter mice (R26R / ).18 Histologic staining of kid- was accompanied by an increase in lysosome accumulation as 2 ney sections from Podocin-cre mice showed no expression of assessed by immunostaining and immunoblotting for the b-galactosidase, whereas b-galactosidase was strongly ex- lysosome marker lysosome-associated membrane protein 2 fl fl pressed in the kidneys of Podocin-cre+R26R / mice, where (LAMP2) (Figure 1, J and K). it was constrained to the glomeruli (Figure 1A). To examine whether the presence of the cre transgene affects podocyte JAK2 Knockdown Impairs Autophagy Completion in 2 permselectivity, we followed Podocin-cre and Podocin-cre+ Differentiated Immortalized Podocytes mice for 6 months, observing no difference in the rate of To better understand the causes of autophagosome-lysosome urinary albumin excretion between the two groups accumulation in JAK2-deficient podocytes, we turned to an

2642 Journal of the American Society of Nephrology J Am Soc Nephrol 28: 2641–2653, 2017 www.jasn.org BASIC RESEARCH

2 Figure 1. JAK2 deletion impairs podocyte autophagy completion in vivo. (A) Enzymatic X-gal staining of kidney sections from a Podocin-cre fl fl fl fl mouse and a Podocin-cre+R26R / mouse showing glomerular b-galactosidase expression in the Podocin-cre+R26R / mouse.

J Am Soc Nephrol 28: 2641–2653, 2017 Janus Kinase 2 and Podocyte Autophagy 2643 BASIC RESEARCH www.jasn.org immortalized cell culture system and transfected conditionally 2). A difference in mRNA levels encoding four proteins achieved immortalized differentiated mouse podocytes22 with either statistical significance (histone deacetylase 6, Huntingtin- sequence-specific short interference RNA (siRNA) directed associated protein 1, sorting nexin 14, and vesicle-associated against JAK2 or scramble control (Figure 2A). Immunoblot- membrane protein 8). However, whereas each was in- ting cell lysates revealed that JAK2 knockdown in these cells creased in its expression, none were upregulated .1.25-fold similarly led to an increase in the abundance of LC3-II and p62 (Supplemental Table 2). (Figure 2B), suggestive of impaired autophagy completion. The increase in LC3-II after JAK2 knockdown was comparable JAK2 Knockdown Downregulates the Transcription with that observed when autophagic flux was blocked with Factor TFEB Earle’s Balanced Salt Solution (EBSS; autophagy induction) In the context of minimal change in expression of genes in- and bafilomycin A1 (an inhibitor of autophagy completion), volvedinautophagosome-lysosomefusion,wehypothesizedthat with no additive effect of the combination of JAK2 siRNA, the impairment in autophagy completion in JAK2-deficient EBSS, and bafilomycin A1 (Figure 2C). In contrast, LC3-I lev- podocytes was a consequence of lysosome dysfunction. els appeared lower in podocytes exposed to EBSS and bafilo- Consistent with the presence of lysosome dysfunction, JAK2 mycin A1 in the presence or absence of JAK2 siRNA, likely knockdown caused a decrease in the activity of cathepsin D indicative of autophagy induction with the former conditions (Figure 3A), a lysosomal aspartic proteinase, the deficiency of that was unaffected by JAK2 knockdown (Figure 2C). Stereo- which was recently implicated in impaired podocyte auto- metric evaluation of transmission electron micrographs re- phagy.24 Because the transcription factor TFEB has been linked vealed an increase in autophagosome and lysosome volume to lysosome function,16 autophagy,15 and cathepsin D activ- fraction in JAK2 siRNA-transfected podocytes compared with ity,25 we performed a second RT-qPCR–based screen for scramble-transfected cells (Figure 2D). Likewise, LAMP2 ex- mRNA changes of 13 genes drawn from a list of the most likely pression was increased in the setting of JAK2 knockdown lysosomal direct targets of TFEB.26 Six of the 13 likely TFEB when assessed by either immunoblotting (Figure 2E) or im- targets were significantly downregulated with JAK2 siRNA (in- munostaining (Figure 2F). cluding cathepsin D) (Table 1). Of these six transcripts, five Although the regulation of autophagic processes can differ were also downregulated in podocytes from JAK2podKO mice, between primary cells and cell lines23 and although the pri- with statistically significant reductions seen in mRNA levels of mary culture was an enriched but not pure podocyte cell pop- beclin-1, cathepsin D, and cystinosin (Figure 3B). ulation (.85% nephrin positive) (Supplemental Figure 3), Having discovered a downregulation in the expression of JAK2 knockout/knockdown consistently impaired late-phase several putatively TFEB-regulated genes with JAK2 knockout autophagy. We speculated that this impairment could be due or knockdown, we queried whether TFEB itself is affected by to either improper fusion of autophagosomes with lysosomes JAK2 knockdown. Supportive of this assertion, TFEB pro- or impairment of lysosome function itself. Because the JAK/ moter activity (Figure 3C), mRNA levels (Figure 3D), protein STAT pathway is a major regulator of gene transcription, we levels (Figure 3E), and nuclear localization (Figure 3F) were focused our next discovery experiments on mRNA changes of each reduced in mouse podocytes transfected with JAK2 genes linked to autophagy pathways in podocytes transfected siRNA compared with scramble-transfected cells. In deter- with JAK2 siRNA. To explore the regulation of autophagosome- mining how JAK2 may regulate the expression of TFEB, we lysosome fusion, we reviewed the biomedical literature and performed in silico analysis of the mouse TFEB promoter and compiled a list of 16 genes previously linked to this process. identified six putative binding sites for the JAK2-dependent Using RT-qPCR, we found little change in the expression of transcription factor, STAT1 (Supplemental Figure 4). By chro- any of these genes with JAK2 knockdown (Supplemental Table matin immunoprecipitation, we found that STAT1 was

Original magnification, 3400. (B) Phase-contrast microscopy (original magnification, 3100) and immunoblotting for nephrin in primary cultured mouse podocytes. Lysates from 3T3 cells are provided as a comparator. (C) Immunoblotting for JAK2 in lysates of primary podocytes isolated from JAK2Ctrl and JAK2podKO mice. (D) Immunofluorescence dual staining for nephrin and JAK2 in glomerular sections from JAK2Ctrl and JAK2podKO mice. The merged image shows colocalization of JAK2 and nephrin (yellow-orange color) in JAK2Ctrl but not in JAK2podKO.Blueis4’,6-diamidino-2-phenylindole (DAPI). (E) Urine albumin excretion in JAK2Ctrl and JAK2podKO mice ages 10 weeks old and 6 months old. (F) Transmission electron micrographs of podocytes from JAK2Ctrl and JAK2podKO mice and autophagosome volume fraction. The transmission electron micrographs illustrate autophagosomes (thick black arrows) and lysosomes (thin black arrows) in the podocyte from the JAK2podKO mouse. Insets are a higher magnification. Original magnification, 325,000. (G) Immunoblotting primary cultured podocytes from JAK2Ctrl and JAK2podKO mice for LC3. (H) Immunofluorescence dual staining for nephrin and p62 in glomerular sections of JAK2Ctrl and JAK2podKO mice. Insets represent zoomed-in images of the dashed areas. The white arrows point to p62 puncta in podocytes (nephrin positive) from the JAK2podKO mouse. (I) Immunoblotting primary cultured podocytes from JAK2Ctrl and JAK2podKO mice for p62. (J) Immunofluorescence staining for nephrin and LAMP2 in glomerular sections of JAK2Ctrl and JAK2podKO mice. (K) Im- † munoblotting primary cultured podocytes from JAK2Ctrl and JAK2podKO mice for LAMP2. AU, arbitrary units. *P,0.05; P,0.01.

2644 Journal of the American Society of Nephrology J Am Soc Nephrol 28: 2641–2653, 2017 www.jasn.org BASIC RESEARCH

Figure 2. JAK2 knockdown with siRNA causes autophagosome and lysosome accumulation in cultured immortalized mouse podocytes. (A) JAK2 knockdown with siRNA. (B) Immunoblotting for LC3 and p62. (C) Immunoblotting forLC3inJAK2siRNA- transfected podocytes (or scramble-transfected cells) incubated in EBSS for 19 hours (5 hours post-transfection), with bafilomycin A1 (100 nM) added for the final 4 hours. (D) Transmission electronmicrographsofmousepodocytes transfected with scramble or JAK2 siRNA and autophagosome and lysosome volume fraction. Insets are higher magnification (original magnification, 325,000). The thick arrow labels an autophagosome, and the thin arrow labels a lysosome. (E) Immunoblotting for LAMP2. (F) Immuno- fluorescence staining for LAMP2 (red) and 4’,6-diamidino-2-phenylindole (DAPI) (blue). GAPDH, glyceraldehyde 3-phosphate † dehydrogenase; AU, arbitrary units. *P,0.05 versus scramble; P,0.01 versus scramble.

J Am Soc Nephrol 28: 2641–2653, 2017 Janus Kinase 2 and Podocyte Autophagy 2645 BASIC RESEARCH www.jasn.org

Figure 3. JAK2 knockdown or knockout impairs lysosome function and decreases TFEB expression in mouse podocytes. (A) Cathepsin D activity in immortalized podocytes transfected with scramble or JAK2 siRNA for 24 hours. (B) Relative mRNA levels of TFEB targets in primary podocytes from JAK2Ctrl and JAK2podKO mice. BECN1, beclin 1; CTSD, cathepsin D; CTNS, cystinosin; MCOLN1, mucopilin-1; RRGAC, Ras- related GTP binding C; STK4, serine/threonine kinase 4. (C–G) Regulation of TFEB expression by JAK2 in immortalized podocytes transfected with scramble or JAK2 siRNA for 24 hours. (C) TFEB promoter activity. (D) TFEB mRNA levels. (E) TFEB protein levels. (F) TFEB nuclear levels. (G) Chromatin immunoprecipitation of the TFEB promoter after STAT1 enrichment. (H) TFEB protein levels in primary podocytes from JAK2Ctrl † ‡ and JAK2podKO mice. AU, arbitrary units. *P,0.05 versus scramble; P,0.05 versus JAK2Ctrl; P,0.01 versus scramble; §P,0.01 versus IgG. enriched at the TFEB promoter and that its enrichment was reversed by TFEB overexpression. We transfected cells with a negated with JAK2 siRNA (Figure 3G). We immunoblotted plasmid encoding EGFP-tagged TFEB27 (Figure 4A) that ne- podocytes isolated from JAK2podKO mice, and in doing this, gated both the downregulation in cathepsin D gene expression we also observed a reduction in TFEB expression with JAK2 (Figure 4B) and the reduction in cathepsin D activity (Figure knockout (Figure 3H). 4C) with JAK2 siRNA. By immunoblotting, we observed an increase in LC3-II with TFEB overexpression and an augmen- TFEB Overexpression Restores Podocyte Function tation in this increase with the inhibitor of late-phase auto- after JAK2 Knockdown phagy bafilomycin A1 (Figure 4D), indicative of increased In our final series of experiments, we investigated whether the autophagic flux with TFEB overexpression that was blocked podocyte dysfunction, induced by JAK2 knockdown, could be by bafilomycin A1. Unlike bafilomycin A1, however, JAK2

2646 Journal of the American Society of Nephrology J Am Soc Nephrol 28: 2641–2653, 2017 www.jasn.org BASIC RESEARCH

Table 1. Relative mRNA levels of likely direct targets of TFEB with a known role direct sequestration of cytoplasmic mate- in lysosome function26 in mouse podocytes transfected with JAK2 siRNA or rial into lysosomes), chaperone-mediated scramble autophagy (the transport of cargo proteins Target Gene Scramble (AU) JAK2 siRNA (AU) to lysosomes for degradation), and macro- a-Galactosidase 1.0360.15 0.8660.05 autophagy (the best studied form; herein ATPase H+ transporting accessory protein 1 1.0360.15 0.8360.01 termed autophagy).33 (Macro)autophagy ATPase H+ transporting lysosomal V0 subunit C 1.0660.23 1.0660.08 can be conceptualized as taking place Beclin 1 1.0460.18 0.7260.03a through two consecutive phases: (1) Cathepsin B 1.0460.19 1.4260.13 the induction of autophagy, formation of a Cathepsin D 1.0360.15 0.6860.04 double-membraned autophagosomes, and 6 6 a Cystinosin 1.06 0.22 0.72 0.02 sequestration of cytoplasmic debris; and a 6 6 Lysosomal -glucosidase 1.05 0.21 1.01 0.10 (2) the fusion of autophagosomes with ly- Mucopilin-1 1.0460.17 0.7060.03a sosomes and the degradation of the seques- Nuclear receptor binding factor-2 1.0660.20 1.0160.08 33,34 Ras-related GTP binding C 1.0460.18 0.6160.03a tered debris. Historically, efforts to Serine/threonine kinase 4 1.0460.19 0.7260.04a understand the mechanisms by which au- Vacuolar protein sorting-associated protein 18 1.0660.22 0.8460.02 tophagic processes are regulated have ten- Values normalized to RPL13a. AU, arbitrary units; RPL13a, ribosomal protein L13a. ded to focus on its induction. Indeed, the aP,0.05. factors that promote autophagy induction (e.g., nutrient deprivation, 59 AMP-activated protein kinase, and inhibition of the mam- siRNA did not augment the increase in LC3-II with TFEB malian target of rapamycin complex 1) are generally well un- overexpression (Figure 4D), suggesting that JAK2 is upstream derstood. It is only in the past few years that attentions have of TFEB in autophagy regulation. Lastly, to assess whether the shifted to the strategies used by the cell to ensure autophagy enhancement of autophagic flux with TFEB overexpression completion. These attentions have been focused (at least in improved podocyte function, we assessed the passage of fluo- part) by the discovery of TFEB, initially as a master regulator rescently labeled albumin across podocyte monolayers. of lysosomal biogenesis and function16 and subsequently as a Whereas JAK2 knockdown increased albumin transport regulator of broader autophagic-lysosomal processes.15 across monolayers, this increase was negated by TFEB over- In this study, we examined the effects of knockout of JAK2 in expression (Figure 4E). podocytes of otherwise healthy mice and knockdown of JAK2 with siRNA in cultured podocytes under conditions of serum starvation. In each case, JAK2 deficiency resulted in an increase DISCUSSION in autophagosome volume fraction and the accumulation of the autophagy cargo receptor of ubiquitinated proteins p62, The autophagy-lysosome pathway is a highly regulated and which are together indicative of autophagy initiation but failed evolutionarily conserved catabolic process that enables cells completion. Impairment in podocyte function was accompa- to remove and recycle intracytoplasmic material during times nied by an increase in urine albumin excretion in mice and an of stress or starvation. It seems to be particularly important to increase in albumin passage across podocyte monolayers. the maintenance of the health of nonmitotic cells, such as the These findings are generally congruent with the previous neurons of the central nervous system28 and the podocytes of descriptions of the phenotype of mice in which autophagy- the renal glomerulus.1 Here, we found that genetic removal of related genes were selectively removed from podocytes1,35 and the kinase JAK2 impairs autophagy completion and podocyte the phenotype of mice when the lysosomal protein cathepsin function. JAK/STAT signaling facilitates podocyte autophagy D was deleted.24 Whereas both basal autophagy and auto- by promoting expression of the transcription factor TFEB phagy induction in response to nutrient deprivation are of that coordinates a network of genes that regulate autophagic- use for cellular survival, under certain circumstances, autolysosomal function. Collectively, these findings (1) highlight phagy can be detrimental, both initiating and executing cell the importance of JAK2-dependent autophagic processes to death.36 To help us distinguish between cause and conse- podocyte homeostasis, (2) uncover the significance of TFEB quence, we elected to study JAK2podKO mice at a young, albeit to the maintenance of podocyte function, and (3) show that adult, age (10 weeks). The largely unremarkable glomerular TFEB is itself transcriptionally regulated by JAK2/STAT1 in appearance under light microscopy at this age suggests that the podocytes. impairment in autophagy completion with JAK2 knockdown Since an original report described the importance of auto- was a de novo event and was not a response to generalized phagy to podocyte homeostasis in aging mice just 7 years ago,1 cellular injury. there has been a rapid recognition that autophagic disturbance We considered two possibilities for the impairment of auto- causes podocyte dysfunction in a range of disease settings.29–32 phagy completion with JAK2 knockdown: (1) a block in the There are three forms of autophagy: microautophagy (the fusion of autophagosomes and lysosomes and (2) impairment

J Am Soc Nephrol 28: 2641–2653, 2017 Janus Kinase 2 and Podocyte Autophagy 2647 BASIC RESEARCH www.jasn.org

Figure 4. TFEB overexpression restores lysosome function and albumin permselectivity in JAK2-deficient mouse podocytes. (A) Im- munoblotting for GFP in control mouse podocytes or podocytes transfected with EGFP-tagged TFEB. (B) Cathepsin D mRNA levels under control conditions (scramble) or transfected with JAK2 siRNA, EGFP-tagged TFEB, or JAK2 siRNA and EGFP-tagged TFEB. (C) Cathepsin D activity in podocytes under control conditions (scramble) or transfected with JAK2 siRNA, EGFP-tagged TFEB, or JAK2 siRNA and EGFP-tagged TFEB. (D) Immunoblotting for LC3 in podocytes transfected with EGFP-tagged TFEB in the presence or absence of 100 nM bafilomycin A1 for 4 hours or JAK2 siRNA for 24 hours. (E) Albumin permeability in podocytes under control conditions (scramble) or transfected with JAK2 siRNA, EGFP-tagged TFEB, or JAK2 siRNA and EGFP-tagged TFEB. EGFP, enhanced green fluorescent protein; GFP, green fluorescent protein; RPLPO, large ribosomal protein; AU, arbitrary units. *P,0.05 versus control; † ‡ P,0.05 versus all other groups; P,0.001 versus all other groups. in lysosome function itself. We found that few genes encoding dysfunction was due to the downregulation of the transcrip- proteins involved in autophagosome-lysosome fusion were tional regulator of lysosomal biogenesis and function, TFEB. altered in their expression with JAK2 knockdown and that TFEB is a member of the basic helix-loop-helix leucine- those that were altered were all marginally increased in their zipper family of transcription factors that was first identified expression. We speculate that this increase reflects a compen- as a regulatorof coordinatedlysosomal biogenesisandfunction satory response to a downstream impediment. Reflective of in 2009.16 In its phosphorylated, inactive form, TFEB resides lysosome enzymatic dysfunction, we found that JAK2 defi- in the cytoplasm.34 On activation, it shuttles to the nucleus, ciency was accompanied by an increase in lysosome where it binds to specific E-box sites at the promoters of sev- number, a decrease in the expression of lysosomal genes, eral lysosomal genes that have been collectively termed the and a reduction in the activity of the lysosomal aspartic pro- Coordinated Lysosomal Expression and Regulation gene net- teinase, cathepsin D. We went on to discover that this work.16 Subsequent to the initial discovery of the role of TFEB

2648 Journal of the American Society of Nephrology J Am Soc Nephrol 28: 2641–2653, 2017 www.jasn.org BASIC RESEARCH

37 in the coordinated regulation of lysosomal genes, it has now JAK1 and JAK2 (IC50=5.9 and 5.7 nM, respectively). Third, become apparent that the transcription factor also drives the although JAK2 functions in a homeostatic capacity in normal expression of a network of autophagy-related genes.15,26 Al- podocytes, the JAK/STAT signaling pathway also plays an im- though TFEB is known to be regulated post-translationally,34 portant role in the development of inflammation,38 one of the this study also highlights the importance of its transcriptional principal drivers of the progression of diabetic kidney dis- regulation. Specifically, the JAK2-activated transcription fac- ease.39 Thus, the extent to which JAK inhibition may affect tor STAT1 binds to the TFEB promoter, and knockdown of JAK2-regulated podocyte autophagy completion in patients JAK2 decreases TFEB promoter activity, mRNA and protein and the extent to which these effects may temper the poten- levels, and nuclear localization. A functional role for TFEB tially renoprotective anti-inflammatory properties of JAK in- downregulation in impaired autophagy completion with hibitors remain to be determined. JAK2 knockdown is implied by the coincident downregulation In summary, JAK2 functions in a homeostatic capacity in in TFEB-regulated genes and a restoration of autophagic flux podocytes by facilitating autophagy. It does this by regulating and podocyte permselectivity by TFEB overexpression. the expression of the transcription factor TFEB that is neces- The autophagosomal-lysosomal clearance of accumulated sary for normal autophagic-lysosomal function (Figure 5). proteins and damaged organelles is a complex process. One of These actions should be borne in mind in considering the the nuances of this complexity is its temporal regulation. As an long-term implications of therapies that interfere with the illustration, the LC3-phosphatidylethanolamine conjugate, JAK/STAT signaling pathway. They also raise the intriguing LC3-II, is recruited to autophagosomal membranes and de- possibility that therapeutically modulating TFEB activity40 graded in the autolysosomal lumen during autophagy. In HeLa may improve podocyte health in glomerular disease. cells, TFEB overexpression caused an increase in LC3-II abundance, and siRNA-mediated knockdown of TFEB downregulated LC3-II.15 In podocytes, we similarly observed an increase CONCISE METHODS in LC3-II with TFEB overexpression, and we observed an aug- mentation of this increase with the inhibitor of late-phase In Vivo Studies fl fl autophagy, bafilomycin A1, indicative of heightened autophagic Podocin-cre+ mice [B6.Cg-Tg(NPHS2-cre)295Lbh/J]17 and R26R / mice flux. In contrast, downregulation of TFEB with JAK2 [B6;129S4-Gt(ROSA)26Sortm1Sor/J]18 were obtained from the Jackson Lab- fl fl knockdown also caused LC3-II accumulation. This is likely oratory (Bar Harbor, ME). Jak2 / mice were provided by Kay-Uwe Wag- to be a consequence of lysosomal dysfunction. Indeed, specific ner (Nebraska Medical Center).19 Male JAK2Ctrl (n=10) and JAK2podKO knockdown of the lysosomal enzyme and TFEB target cathep- mice (n=12) were studied at 10 weeks of age, and albuminuria was de- sin D was recently shown to lead to LC3-II accumulation in termined in an additional four mice per group at age 6 months old. Systolic podocytes.24 In this respect, it is noteworthy that, whereas BP was measured using a CODA Noninvasive BP System (Kent Scientific, TFEB expression was decreased with JAK2 knockout/knock- Torr ington, CA). 41 Urine albumin excretion was determined by ELISA down in podocytes, it was not abolished; also, TFEB-dependent (Assaypro, St. Charles, MO) after housing mice individually in metabolic autophagosomal-lysosomal genes were not uniformly cages for 24 hours. After harvesting, mouse kidneys were immersed in reduced in their expression. Thus, with persistent, albeit re- 10% neutral buffered formalin, routinely processed, and embedded in duced, TFEB expression, autophagy completion was impaired paraffin; cryoembedded in Tissue-Tek optimum cutting temperature for- but was not negated, causing a phenotype characterized by the mulation compound (VWR International, Mississauga, ON, Canada) and accumulation of autophagosomes and lysosomes and an in- stored at 280°C; or fixed in 2.5% gluteraldehyde for later analysis by crease in albuminuria without florid glomerular damage. transmission electron microscopy. All experimental procedures adhered The discovery that, under normal circumstances, JAK2 pre- to the guidelines of the Canadian Council on Animal Care and were serves podocyte functionality by promoting autophagy com- approved by the St. Michael’s Hospital Animal Care Committee. pletion warrants consideration in the context of JAK/STAT pathway activation in human diabetic kidney disease5,6 and b-Galactosidase Expression the preliminary benefits of the JAK1/2 inhibitor baricitinib X-gal staining of kidney cryosections was performed using an X-Gal in a 24-week, phase 2 study of participants with type 2 diabetes Staining Kit (Oz Biosciences, San Diego, CA) according to the man- and kidney disease.7 Although the findings herein described ufacturer’sinstructions. would seem to sound a cautionary note as to the possibility of adverse renal effects of JAK2 inhibition, several distinctions Primary Culture of Podocytes should be considered. First, in an effort to unravel the normal Glomeruli were isolated from JAK2Ctrl and JAK2podKO mice using actions of JAK2, we examined the effects of the kinase in one Dynabeads. After isoflurane anesthesia, the abdominal aorta was can- particular cell type (the podocyte), whereas systemic JAK in- nulated with a 24-gauge angiocath, and the mouse was perfused with hibition affects multiple cell types, not even those limited to 13105 Dynabeads (ThermoFisher Scientific, Rockford, IL) in 5 ml the kidney. Second, whereas we examined the consequences of HBSS (ThermoFisher Scientific). Podocytes were isolated using pre- JAK2 knockout/knockdown, baricitinib is an enzyme inhibi- viously reported methods.42,43 Briefly, glomeruli were seeded on col- tor and equally efficacious in blocking the activity of both lagen 1–coated plates in a 1:1 mixture of F-12 Kaighn’sModification

J Am Soc Nephrol 28: 2641–2653, 2017 Janus Kinase 2 and Podocyte Autophagy 2649 BASIC RESEARCH www.jasn.org

Figure 5. JAK2 regulates autophagy completion in podocytes. (A) Under normal conditions (wild type), signaling through JAK2 induces translocation of STAT1 to the nucleus, where STAT1 binds to the promoter region of the gene encoding the transcription factor TFEB. TFEB, in turn, facilitates the transcription of genes involved in lysosome and autophagosome function, including cathepsin D. Auto- phagosomes are recognized by the presence of LC3-II and contain proteins bound to p62 and targeted for degradation. Autophagy completion involves the fusion of double-membrane–bound autophagosomes with lysosomes (recognized by the presence of LAMP2) and subsequent degradation of the contents of the resultant autolysosome. (B) When JAK2 is absent (JAK2podKO), TFEB expression is diminished, leading to decreased expression of lysosomal genes (including cathepsin D) and lysosomal dysfunction, impairing autophagy completion, and leading to podocyte dysfunction, diminished podocyte permselectivity, and consequent albuminuria. media (HyClone Laboratories, Logan, UT) with media harvested a-tubulin (1:1000; Sigma-Aldrich, Oakville, ON, Canada), LC3 from NIH/3T3 cells (American Type Culture Collection, Manassas, (1:1000; Cell Signaling Technology), p62 (1:1000; BD Biosciences), VA). Cell cultures were maintained for approximately 4–6 days and LAMP2 (1:1000; Abcam, Cambridge, MA), b-actin (1:10,000; Sigma- were not passaged.44 For flow cytometry, cells were stained with anti- Aldrich), TFEB (1:500; Abcam), and GFP (1:1000; Santa Cruz Bio- nephrin antibody (1:100; R&D Systems, Minneapolis, MN) and technology, Dallas, TX). Densitometry was performed using ImageJ Alexa Fluor 488 donkey anti-goat antibody (1:100; ThermoFisher 1.46r software (National Institutes of Health, Bethesda, MD). Scientific) before analysis using a Fortessa X-20 (BD Biosciences, San Jose, CA). Data analysis was with FlowJo software version 10.2 Immunofluorescence Staining (FlowJo LLC, Ashland, OR). Immunofluorescence microscopy was performed on formalin-fixed, paraffin-embedded kidney sections and cultured cells with antibodies Immunoblotting in the following concentrations: JAK2 (1:50; Cell Signaling Technol- Immunoblotting was performed on cultured cell extracts with anti- ogy), secondary antibody Alexa Fluor 488 donkey anti-rabbit (1:100; bodies in the following concentrations: nephrin (1:1000; R&D Sys- ThermoFisher Scientific), p62 (1:100; Cell Signaling Technol- tems), JAK2 (1:1000; Cell Signaling Technology, Danvers, MA), ogy), secondary antibody Alexa Fluor 555 donkey anti-rabbit

2650 Journal of the American Society of Nephrology J Am Soc Nephrol 28: 2641–2653, 2017 www.jasn.org BASIC RESEARCH

(1:100; ThermoFisher Scientific), LAMP2 (1:100; Abcam), secondary mice and four JAK2podKO mice. Experiments were performed in trip- antibody Alexa Fluor 488 donkey anti-rat (1:100; ThermoFisher Sci- licate, and data analyses were conducted using the Applied Biosys- entific), TFEB (1:100; Abcam), nephrin (1:100; R&D Systems), tems Comparative CT method. and secondary antibody Alexa Fluor 647 donkey anti-goat (1:100; fi ThermoFisher Scienti c). DAPI was from Cell Signaling Technology Promoter Reporter Assay and used at a concentration of 1:10,000. Slides were visualized on a Podocytes were transfected with a luciferase reporter under the con- Zeiss LSM 700 confocal microscope (Carl Zeiss Canada, Toronto, trol of the TFEB promoter46 (gift from Albert La Spada; Addgene ON, Canada). For p62, p62-positive puncta were counted in six glo- plasmid 66801; Addgene). Cells were transfected with JAK2 siRNA meruli from six mice per group. For LAMP2, mean fluorescence or scramble for 24 hours before determination of luciferase activity intensity was determined in six glomeruli from six mice per group with a reporter assay system (Promega, Madison, MA). using ImageJ and represented as the fold change relative to control. fl In cultured cells, LAMP2 was calculated as the mean uorescence Chromatin Immunoprecipitation intensity from four samples per condition, and nuclear TFEB was Chromatin immunoprecipitationwas performed using the Magna calculated as the proportion of positively immunostaining nuclear ChIP Kit (EMD Millipore, Etobicoke, ON, Canada). Briefly, mouse pixels (red) in five fields (36300 magnification) from nine samples podocytes weretransfected with scramble or JAK2siRNAfor24hours. per condition using Adobe Photoshop 7.0 (San Jose, CA), with both After crosslinking and sonication, sheared chromatin was immuno- represented as the fold change relative to control (scramble). precipitated with an antibody directed against STAT1 (1:100; Cell Signaling Technology) or an equal concentration of normal rabbit Transmission Electron Microscopy IgG (Santa Cruz Biotechnology). Samples were then washed, re- Transmission electron microscopy was performed with a Philips verse crosslinked, and proteinase K treated to obtain purified DNA CM100 transmission electron microscope (Electron Microscope Re- fragments. Quantitative real-time PCR was performed using primers search Services, Newcastle University, Newcastle upon Tyne, United specific for a sequence of the mouse TFEB promoter (Supplemental Kingdom). Kidney cortical tissue was examined in each mouse as well Table 3). as JAK2 siRNA and scramble-transfected podocytes (n=6 per condition). The volume fraction of autophagosomes (or lysosomes) was Albumin Permeability Assay – 3 calculated on 10 20 representative electron micrographs ( 7900 An albumin permeability assay was adapted from a previously defi magni cation) from each mouse or each experimental replicate scribed method.47 Mouse podocytes were grown to confluent mono- with a masked quantitative point counting method using ImageJ.45 layers on transwell plates and transfected with p-EGFP-N1-TFEB, JAK2 siRNA, or scramble for 24 hours. A tracer solution of 250 mg/ml Conditionally Immortalized Mouse Podocytes FITC-albumin (Sigma-Aldrich) in RPMI medium was applied to the Differentiated conditionally immortalized mouse podocytes were upper compartment, and the ratio of fluorescence of samples drawn cultured as previously described.22 For knockdown of JAK2, cells from the lower compartment at 2 and 24 hours (excitation/emission fi were transfected with sequence-speci c siRNA or scrambled siRNA wavelengths =495/520 nm) was determined using a SpectraMax M5 fi (ThermoFisher Scienti c) at a concentration of 75 nM for 24 hours. Microplate Reader (Molecular Devices, Sunnyvale, CA). For experiments with EBSS, RPMI medium (Sigma-Aldrich) was replaced by EBSS (Sigma-Aldrich) 5 hours after the addition of Statistical Analyses siRNA (or scrambled siRNA), and cells were maintained for another Data are expressed as means6SEMs. Statistical significance was defi 19 hours. Ba lomycin A1 (Sigma-Aldrich) was used at a concentra- termined by one-way ANOVA with a Fisher least significant differ- 31 tion of 100 nM for 4 hours. TFEB overexpression was achieved by ence test for comparison of multiple groups and unpaired t test for 27 transfecting cells with a p-EGFP-N1-TFEB construct (gift from comparison between two groups (or Mann–Whitney test for non- Shawn Ferguson; Addgene plasmid 38119; Addgene, Cambridge, parametric data). Skew distributed data were log transformed before MA) for 24 hours. Cathepsin D activity was determined with a com- statistical comparison. Statistical analyses were performed using mercial kit (Abcam). GraphPadPrism6forMacOSX(GraphPadSoftwareInc.,San Diego, CA). Real-Time PCR RNA was isolated from cell extracts using TRIzol Reagent (Thermo- Fisher Scientific), and cDNA was reverse transcribed from 1 mgRNA using SuperScript III Reverse Transcriptase (ThermoFisher Scien- ACKNOWLEDGMENTS tific). Primers were designed and validated using Primer-BLAST (http://www.ncbi.nlm.nih.gov/tools/primer-blast/), and they were The authors thank Dr. M. Golam Kabir for his technical assistance and synthesized by Integrated DNATechnologies (Coralville, IA). Primer Kryski Biomedia for the artwork. sequences are shown in Supplemental Table 3. Measurement of gene These studies were supported by Canadian Institutes of Health expression was performed using SYBR green on a ViiA 7 Real-Time Research Operating grant MOP-133631 (to A.A.). T.A.A. is supported PCR System (ThermoFisher Scientific). For experiments in primary by a King Abdullah Foreign Scholarship. S.M. is supported by a cells, mRNA levels were determined in podocytes from four JAK2Ctrl Canadian Diabetes Association Postdoctoral Fellowship. K.T. is

J Am Soc Nephrol 28: 2641–2653, 2017 Janus Kinase 2 and Podocyte Autophagy 2651 BASIC RESEARCH www.jasn.org supported by a Research Internship Abroad from the Sao Paulo Re- 11. Wang X, Shaw S, Amiri F, Eaton DC, Marrero MB: Inhibition of the Jak/ search Foundation (Fapesp 2016/04591-1). S.N.B. is supported by a STAT signaling pathway prevents the high glucose-induced increase in fi Keenan Family Foundation Kidney Research Scientist Core Education tgf-beta and bronectin synthesis in mesangial cells. Diabetes 51: 3505–3509, 2002 and National Training Program (KRESCENT) Postdoctoral Fellow- 12. Shankland SJ: The podocyte’s response to injury: Role in proteinuria ship and was supported by a Heart and Stroke/Richard Lewar Center and glomerulosclerosis. Kidney Int 69: 2131–2147, 2006 of Excellence Fellowship Award and a Banting and Best Diabetes 13. Wolf G, Chen S, Ziyadeh FN: From the periphery of the glomerular Centre Hugh Sellers Postdoctoral Fellowship. A.S.B. is supported by a capillary wall toward the center of disease: Podocyte injury comes of – Banting and Best Diabetes Centre-Novo Nordisk Studentship and age in diabetic nephropathy. Diabetes 54: 1626 1634, 2005 14. Schiffer M, Park JK, Tossidou I, Bartels J, Shushakova N, Menne J, Fliser was supported by a Queen Elizabeth II/Dr. Arnie Aberman Graduate D: Erythropoietin prevents diabetes-induced podocyte damage. Kid- Scholarship in Science and Technology and a Yow Kam-Yuen Grad- ney Blood Press Res 31: 411–415, 2008 uate Scholarship in Diabetes Research from the Banting and Best 15. Settembre C, Di Malta C, Polito VA, Garcia Arencibia M, Vetrini F, Erdin Diabetes Centre. S, Erdin SU, Huynh T, Medina D, Colella P, Sardiello M, Rubinsztein DC, Portions of this work were presented in abstract form at the Annual Ballabio A: TFEB links autophagy to lysosomal biogenesis. Science 332: – Scientific Meeting of the American Society of Nephrology (Chicago, 1429 1433, 2011 – 16. Sardiello M, Palmieri M, di Ronza A, Medina DL, Valenza M, Gennarino IL; November 15 20, 2016). VA, Di Malta C, Donaudy F, Embrione V, Polishchuk RS, Banfi S, Parenti G, Cattaneo E, Ballabio A: A gene network regulating lysosomal biogenesis and function. Science 325: 473–477, 2009 fi DISCLOSURES 17. Moeller MJ, Sanden SK, Soo A, Wiggins RC, Holzman LB: Podocyte- specific expression of cre recombinase in transgenic mice. Genesis 35: None. 39–42, 2003 18. Soriano P: Generalized lacZ expression with the ROSA26 Cre reporter strain. Nat Genet 21: 70–71, 1999 REFERENCES 19. Krempler A, Qi Y, Triplett AA, Zhu J, Rui H, Wagner KU: Generation of a conditional knockout allele for the Janus kinase 2 (Jak2) gene in mice. Genesis 40: 52–57, 2004 1. Hartleben B, Gödel M, Meyer-Schwesinger C, Liu S, Ulrich T, Köbler S, 20. Kabeya Y, Mizushima N, Ueno T, Yamamoto A, Kirisako T, Noda T, Wiech T, Grahammer F, Arnold SJ, Lindenmeyer MT, Cohen CD, Kominami E, Ohsumi Y, Yoshimori T: LC3, a mammalian homologue of Pavenstädt H, Kerjaschki D, Mizushima N, Shaw AS, Walz G, Huber TB: yeast Apg8p, is localized in autophagosome membranes after pro- Autophagy influences glomerular disease susceptibility and maintains cessing. EMBO J 19: 5720–5728, 2000 podocyte homeostasis in aging mice. JClinInvest120: 1084–1096, 21. Bjørkøy G, Lamark T, Brech A, Outzen H, Perander M, Overvatn A, 2010 Stenmark H, Johansen T: p62/SQSTM1 forms protein aggregates 2. Logar CM, Brinkkoetter PT, Krofft RD, Pippin JW, Shankland SJ: degraded by autophagy and has a protective effect on huntingtin- Darbepoetin alfa protects podocytes from apoptosis in vitro and in induced cell death. JCellBiol171: 603–614, 2005 vivo. Kidney Int 72: 489–498, 2007 22. Endlich N, Kress KR, Reiser J, Uttenweiler D, Kriz W, Mundel P, Endlich 3. Chuang PY, He JC: JAK/STAT signaling in renal diseases. Kidney Int 78: K: Podocytes respond to mechanical stress in vitro. J Am Soc Nephrol 231–234, 2010 12: 413–422, 2001 4. Kralovics R, Passamonti F, Buser AS, Teo SS, Tiedt R, Passweg JR, Tichelli A, Cazzola M, Skoda RC: A gain-of-function mutation of JAK2 in 23. Puleston D, Phadwal K, Watson AS, Soilleux EJ, Chittaranjan S, Bortnik myeloproliferative disorders. NEnglJMed352: 1779–1790, 2005 S, Gorski SM, Ktistakis N, Simon AK: Techniques for the detection of 5. Berthier CC, Zhang H, Schin M, Henger A, Nelson RG, Yee B, Boucherot autophagy in primary mammalian cells. Cold Spring Harb Protoc 2015: A, Neusser MA, Cohen CD, Carter-Su C, Argetsinger LS, Rastaldi MP, pdb top070391, 2015 Brosius FC, Kretzler M: Enhanced expression of Janus kinase-signal 24. Yamamoto-Nonaka K, Koike M, Asanuma K, Takagi M, Oliva Trejo JA, transducer and activator of transcription pathway members in human Seki T, Hidaka T, Ichimura K, Sakai T, Tada N, Ueno T, Uchiyama Y, diabetic nephropathy. Diabetes 58: 469–477, 2009 Tomino Y: Cathepsin D in podocytes is important in the pathogenesis – 6. Hodgin JB, Nair V, Zhang H, Randolph A, Harris RC, Nelson RG, Weil EJ, of proteinuria and CKD. J Am Soc Nephrol 27: 2685 2700, 2016 Cavalcoli JD, Patel JM, Brosius FC 3rd, Kretzler M: Identification of 25. Ivankovic D, Chau KY, Schapira AH, Gegg ME: Mitochondrial and ly- cross-species shared transcriptional networks of diabetic nephropathy sosomal biogenesis are activated following PINK1/parkin-mediated – in human and mouse glomeruli. Diabetes 62: 299–308, 2013 mitophagy. J Neurochem 136: 388 402, 2016 7. Tuttle K, Brosius FC, Adler SG, Kretzler M, Mehta RL, Tumlin JA, Liu J, Silk ME, 26. Palmieri M, Impey S, Kang H, di Ronza A, Pelz C, Sardiello M, Ballabio Cardillo TE, Duffin KL, Haas JV, Macias WL, Janes JM: Baricitinib in diabetic A: Characterization of the CLEAR network reveals an integrated con- kidney disease: Results from a phase 2, multicenter randomized, double-blind, trol of cellular clearance pathways. Hum Mol Genet 20: 3852–3866, placebo-controlled study [abstract], 2015. Available at http://app.core-apps. 2011 com/tristar_ada15/abstract/1678f29f2a56ce35baedcc25f3994ccb. Accessed 27. Roczniak-Ferguson A, Petit CS, Froehlich F, Qian S, Ky J, Angarola B, April 3, 2017 Walther TC, Ferguson SM: The transcription factor TFEB links mTORC1 8. Brosius FC 3rd, He JC: JAK inhibition and progressive kidney disease. signaling to transcriptional control of lysosome homeostasis. Sci Signal Curr Opin Nephrol Hypertens 24: 88–95, 2015 5: ra42, 2012 9. Amiri F, Shaw S, Wang X, Tang J, Waller JL, Eaton DC, Marrero MB: 28. Rubinsztein DC, DiFiglia M, Heintz N, Nixon RA, Qin ZH, Ravikumar B, Angiotensin II activation of the JAK/STAT pathway in mesangial cells is Stefanis L, Tolkovsky A: Autophagy and its possible roles in nervous altered by high glucose. Kidney Int 61: 1605–1616, 2002 system diseases, damage and repair. Autophagy 1: 11–22, 2005 10. Banes AK, Shaw S, Jenkins J, Redd H, Amiri F, Pollock DM, Marrero MB: 29. Kawakami T, Gomez IG, Ren S, Hudkins K, Roach A, Alpers CE, Angiotensin II blockade prevents hyperglycemia-induced activation of Shankland SJ, D’Agati VD, Duffield JS: Deficient autophagy results in JAK and STAT proteins in diabetic rat kidney glomeruli. Am J Physiol mitochondrial dysfunction and FSGS. JAmSocNephrol26: 1040– Renal Physiol 286: F653–F659, 2004 1052, 2015

2652 Journal of the American Society of Nephrology J Am Soc Nephrol 28: 2641–2653, 2017 www.jasn.org BASIC RESEARCH

30. Yamahara K, Kume S, Koya D, Tanaka Y, Morita Y, Chin-Kanasaki M, 39. Heerspink HJ, De Zeeuw D: Novel anti-inflammatory drugs for the Araki H, Isshiki K, Araki S, Haneda M, Matsusaka T, Kashiwagi A, treatment of diabetic kidney disease. Diabetologia 59: 1621–1623, Maegawa H, Uzu T: Obesity-mediated autophagy insufficiency exac- 2016 erbates proteinuria-induced tubulointerstitial lesions. JAmSoc 40. Rubinsztein DC, Codogno P, Levine B: Autophagy modulation as a Nephrol 24: 1769–1781, 2013 potential therapeutic target for diverse diseases. Nat Rev Drug Discov 31. Lenoir O, Jasiek M, Hénique C, Guyonnet L, Hartleben B, Bork T, 11: 709–730, 2012 Chipont A, Flosseau K, Bensaada I, Schmitt A, Massé JM, Souyri M, 41. Yuen DA, Stead BE, Zhang Y, White KE, Kabir MG, Thai K, Advani SL, Huber TB, Tharaux PL: Endothelial cell and podocyte autophagy syn- Connelly KA, Takano T, Zhu L, Cox AJ, Kelly DJ, Gibson IW, Takahashi ergistically protect from diabetes-induced glomerulosclerosis. Auto- T, Harris RC, Advani A: eNOS deficiency predisposes podocytes to phagy 11: 1130–1145, 2015 injury in diabetes. J Am Soc Nephrol 23: 1810–1823, 2012 32. Tagawa A, Yasuda M, Kume S, Yamahara K, Nakazawa J, Chin-Kanasaki 42. Stitt-Cavanagh EM, Faour WH, Takami K, Carter A, Vanderhyden B, M, Araki H, Araki S, Koya D, Asanuma K, Kim EH, Haneda M, Kajiwara N, Guan Y, Schneider A, Breyer MD, Kennedy CR: A maladaptive role for Hayashi K, Ohashi H, Ugi S, Maegawa H, Uzu T: Impaired podocyte EP4 receptors in podocytes. JAmSocNephrol21: 1678–1690, 2010 autophagy exacerbates proteinuria in diabetic nephropathy. Diabetes 43. Shankland SJ, Pippin JW, Couser WG: Complement (C5b-9) induces 65: 755–767, 2016 glomerular epithelial cell DNA synthesis but not proliferation in vitro. 33. Lapierre LR, Kumsta C, Sandri M, Ballabio A, Hansen M: Transcriptional Kidney Int 56: 538–548, 1999 and epigenetic regulation of autophagy in aging. Autophagy 11: 867– 44. Katsuya K, Yaoita E, Yoshida Y, Yamamoto Y, Yamamoto T: An im- 880, 2015 proved method for primary culture of rat podocytes. Kidney Int 69: 34. Shen HM, Mizushima N: At the end of the autophagic road: An 2101–2106, 2006 emerging understanding of lysosomal functions in autophagy. Trends 45. Advani A, Huang Q, Thai K, Advani SL, White KE, Kelly DJ, Yuen DA, Biochem Sci 39: 61–71, 2014 Connelly KA, Marsden PA, Gilbert RE: Long-term administration of the 35. Riediger F, Quack I, Qadri F, Hartleben B, Park JK, Potthoff SA, Sohn D, histone deacetylase inhibitor vorinostat attenuates renal injury in Sihn G, Rousselle A, Fokuhl V, Maschke U, Purfürst B, Schneider W, experimental diabetes through an endothelial nitric oxide synthase- Rump LC, Luft FC, Dechend R, Bader M, Huber TB, Nguyen G, Muller dependent mechanism. Am J Pathol 178: 2205–2214, 2011 DN: Prorenin receptor is essential for podocyte autophagy and survival. 46. Tsunemi T, Ashe TD, Morrison BE, Soriano KR, Au J, Roque RA, JAmSocNephrol22: 2193–2202, 2011 Lazarowski ER, Damian VA, Masliah E, La Spada AR: PGC-1a rescues 36. Eskelinen EL: Doctor Jekyll and Mister Hyde: Autophagy can promote Huntington’s disease proteotoxicity by preventing oxidative stress and both cell survival and cell death. Cell Death Differ 12[Suppl 2]: 1468– promoting TFEB function. Sci Transl Med 4: 142ra97, 2012 1472, 2005 47. Nooteboom A, Hendriks T, Ottehöller I, van der Linden CJ: Perme- 37. Fridman JS, Scherle PA, Collins R, Burn TC, Li Y, Li J, Covington MB, ability characteristics of human endothelial monolayers seeded on Thomas B, Collier P, Favata MF, Wen X, Shi J, McGee R, Haley PJ, different extracellular matrix proteins. Mediators Inflamm 9: 235–241, Shepard S, Rodgers JD, Yeleswaram S, Hollis G, Newton RC, Metcalf B, 2000 Friedman SM, Vaddi K: Selective inhibition of JAK1 and JAK2 is efficacious in rodent models of arthritis: Preclinical characterization of INCB028050. JImmunol184: 5298–5307, 2010 38. Kaplan MH: STAT signaling in inflammation. JAK-STAT 2: e24198, This article contains supplemental material online at http://jasn.asnjournals. 2013 org/lookup/suppl/doi:10.1681/ASN.2016111208/-/DCSupplemental.

J Am Soc Nephrol 28: 2641–2653, 2017 Janus Kinase 2 and Podocyte Autophagy 2653 SUPPORTING INFORMATION

Supporting Information Table 1. Body weight, kidney weight and systolic blood pressure

(SBP) in JAK2Ctrl and JAK2podKO mice.

Body weight (g) Kidney weight Kidney weight: SBP (mmHg)

(g) body weight (%)

Ctrl JAK2 23.5±0.4 0.19±0.01 0.82±0.03 89±2

podKO JAK2 23.7±0.4 0.18±0.01 0.79±0.02 88±3

Supporting Information Table 2. Relative mRNA levels of genes involved in the fusion of autophagosomes with lysosomes.

Scramble (AU) JAK2 siRNA (AU)

ATP6AP2 1.00±0.04 1.05±0.02

Autophagy related 14 1.00±0.05 1.08±0.05

Caveolin-1 1.00±0.02 0.96±0.01

CD38 1.00±0.05 1.06±0.10

DNA damage regulated autophagy modulator 1 1.02±0.10 0.91±0.10

FAM176A 1.09±0.07 0.95±0.04

Histone deacetylase 6 1.01±0.07 1.22±0.04*

Huntingtin-associated protein 1 1.00±0.03 1.19±0.07*

Niemann-Pick C1 1.00±0.02 1.08±0.03

Pleckstrin homology domain-containing family M 1.01±0.06 1.02±0.05

member 1

SNAP-associated protein 1.00±0.05 1.12±0.01

Sorting nexin 14 1.00±0.04 1.13±0.02*

Syntaxin 17 1.00±0.05 1.06±0.01

Tectonin ß-propeller repeat containing 1 1.01 ±0.08 1.01±0.04

Vesicle-associated membrane protein 7 1.00±0.05 1.11±0.06

Vesicle-associated membrane protein 8 1.00±0.02 1.15±0.03†

Values normalized to RPL13a. AU = arbitrary units. *p<0.05, †p<0.01.

Supporting Information Table 3. Primer sequences used in the study.

Sequences (5’→ 3’)

Forward α-galactosidase TGGGATCAAACACCTCGCAA

Reverse α-galactosidase CCAGTCAGCAAATGTCTGCG

Forward ATP6AP2 TCTCTCCGAACTGCAAGTGCAACA

Reverse ATP6AP2 CCAAACCTGCCAGCTCCAATGAAT

Forward ATPase H+ transporting accessory protein 1 TACACCGCAGCTCTTACTGC

Reverse ATPase H+ transporting accessory protein 1 AGGAGATGCCACCTGAGTCT

Forward ATPase H+ transporting lysosomal V0 subunit C TGCTGGTATTTAGAGCGCAG

Reverse ATPase H+ transporting lysosomal V0 subunit C GCCTCATGACTGACATGGCT

Forward Autophagy related 14 GTGGCGAAAACCTCAGCAAG

Reverse Autophagy related 14 GAACCAAGAGGTCACCGAGG

Forward Beclin 1 AGGCATGGAGGGGTCTAAGG

Reverse Beclin 1 GCCTGGGCTGTGGTAAGTAAT

Forward Cathepsin B ATGTGGTGGTCCTTGATCCTT

Reverse Cathepsin B CTTCCTGGCAGTTTGGGTCC

Forward Cathepsin D CTATAAGCCGGCGACCTCTG

Reverse Cathepsin D TGAACTTGCGCAGAGGGATT

Forward Caveolin-1 AAAAGTTGTAGCGCCAGGCT

Reverse Caveolin-1 GACCACGTCGTCGTTGAGAT

Forward CD38 GATGCTCAATGGGTCCCTCC

Reverse CD38 GGAAGCTCCTTCGATGTCGT

Forward Cystinosin CAAGTCCTGGGGGCTTAGAG

Reverse Cystinosin GGCTGGGTAGGCATCTTGAA

Forward DNA damage regulated autophagy modulator 1 GCTTCTTGGTCCGACGAG

Reverse DNA damage regulated autophagy modulator 1 AGTGTCGTTGGTGCTATCCA

Forward FAM176A GAAGTACGCGCCAGTCGT

Reverse FAM176A TCAGCACCTTTCCAAGGC

Forward Histone deacetylase 6 AGCCTGGTTAAACGGTAGGC

Reverse Histone deacetylase 6 AAGGCTCTCTAATCTGCGCC

Forward Huntingtin-associated protein 1 TCCCTCTGAGGAGCTGTCTG

Reverse Huntingtin-associated protein 1 GGGGCATCAGAACGACTGAA

Forward Lysosomal α-glucosidase AGCGAGTTCCTGCTTTGGAG

Reverse Lysosomal α-glucosidase CCGAAGCATGAGATGACCCA

Forward Mucopilin-1 GGCGCCTATGACACCATCAA

Reverse Mucopilin-1 CAGTTCACCAGCAGCGAATG

Forward Niemann-Pick C1 CCTACCCCACATGCTGTCTC

Reverse Niemann-Pick C1 CTGTCTTCCCGGGCCATAAC

Forward Nuclear receptor binding factor-2 TGTCGCTCTTGGGCTCTCA

Reverse Nuclear receptor binding factor-2 CCAGCAGCTAACAAACGGTC

Forward Pleckstrin homology domain-containing family M member 1 TCGAAGTCCAACACTCAGGC

Reverse Pleckstrin homology domain-containing family M member 1 CTCAAAGTGCAGGTGTGTGC

Forward Ras-related GTP binding C AAGTTTTTGTGCGGCATCGG

Reverse Ras-related GTP binding C GGTCATGATCAGGCGAGGAG

Forward Ribosomal protein large p0 GCGTCCTGGCATTGTCTGT

Reverse Ribosomal protein large p0 GAAGGCCTTGACCTTTTCAGTAAG

Forward Ribosomal protein L13a GCTCTCAAGGTTGTTCGGCTGA

Reverse Ribosomal protein L13a AGATCTGCTTCTTCTTCCGATA

Forward Serine/threonine kinase 4 TGTGTGGCAGACATCTGGTC

Reverse Serine/threonine kinase 4 ACAAACGGGTGCTGTAGGAG

Forward SNAP-associated protein GCTACAGAACTGTGCCGGAT

Reverse SNAP-associated protein AACCGCCTTAGTCGTTCCTG

Forward Sorting nexin 14 CCAAATTCAACAGAAGCACACA

Reverse Sorting nexin 14 TGTCCAACTGCTCGTCTGTC

Forward Syntaxin 17 CTAGGCGGGAGGTGTTTCTG

Reverse Syntaxin 17 AGCCTGCGTAACTTCACCTT

Forward Tectonin ß-propeller repeat containing 1 GAATTTTGGAGGGGAGCCCA

Reverse Tectonin ß-propeller repeat containing 1 TGGCTGACATCCTCTCGGTA

Forward Transcription factor EB CTCTTGCAGAAGACCCCTCT

Reverse Transcription factor EB AGGGTGGTGGGATAGTGCAA

Forward Transcription factor EB promoter GCTACACCCCAGGAAACGTC

Reverse Transcription factor EB promoter TTGTTTTGGTGAGTCCCGCA

Forward Vacuolar protein sorting-associated protein 18 TGGGCGAGGTTGTGATTACC

Reverse Vacuolar protein sorting-associated protein 18 AAGGACGAGACGATCGAGGA

Forward Vesicle-associated membrane protein 7 CAGACGGTACTCGGTCAGATT

Reverse Vesicle-associated membrane protein 7 CTTAGCCAGAATCTGCTCTGTC

Forward Vesicle-associated membrane protein 8 AACCTGCAGTTACGTGTGTG

Reverse Vesicle-associated membrane protein 8 TGTTCAGACGTGGCTTCCAA

SUPPORTING INFORMATION FIGURE LEGENDS

SUPPORTING INFORMATION FIGURE 1. Urine albumin excretion in Podocin-cre- and

Podocin-cre+ mice aged six months.

SUPPORTING INFORMATION FIGURE 2. Representative periodic acid-Schiff (a and b, original magnification x 400) and hematoxylin and eosin (c and d, original magnification x 100) stained kidney sections from JAK2Ctrl (a and c) and JAK2podKO mice (b and d) aged 10 weeks.

SUPPORTING INFORMATION FIGURE 3. Representative flow cytometry histograms from primary cultured cells stained for nephrin.

SUPPORTING INFORMATION FIGURE 4. Putative binding sites for STAT1 within the mouse

TFEB promoter.

Supporting Information Figure 1.

Supporting Information Figure 2.

Supporting Information Figure 3.

Supporting Information Figure 4.