Delivered by Publishing Technology to: Duke University IP: 152.3.102.242 on: Tue, 08 Jul 2014 01:26:34 Copyright (c) American Society for Plant Taxonomists. All rights reserved. aeo ulcto 05/27/2014 publication of Date 10.1600/036364414X681518 DOI © Botany Systematic otenHmshr.Peiul eerdt sthe 2009) all analysis. phylogenetic al. for of as group et critical 10% Windham a constitutes thus 1; roughly to and (Fig. contains diversity referred species clade cheilanthoid this Central Previously ferns, and myriopterid North Hemisphere. to limited Southern are species whereas group America islands, this species disjunct Caribbean certain widespread of and single few members America a South a to and extend Africa that from southern to Aside endemic 2013). Windham genus generitype, the the from to tant related to working closely micropteris groups are not monophyletic by taxonomists are out segregating reason, identified that by this genus Eiserhardt clades the For and redefine (2009), cheilanthoid (2011). al. al. et major Windham et in (2008), six reside al. et genus the Rothfels the of to assigned five currently species that phyletic; sam- shown has broad cheilanthoids with across analysis pling genus phylogenetic the molecular of cheilanthoid Every circumscription Sw. the current the within is clade genera monophyletic recognizing of classification among phylogenetically-based relationships new, clarify group. the a foun- to the provides for begun and ferns dation cheilanthoid has of 2010; species 2011; 2012) + al. al. 400 et et the al. Sigel Beck 2011; et al. 2009; 2007; et al. al. Li Link-Perez 2011; et et al. Zhang Windham et 2007; 2008; Eiserhardt al. al. et 2007; et Schuettpelz Kirkpatrick Rothfels sys- 2007; 1998; molecular al. of Rollo et series al. and Prado recent (Gastony et A studies Kramer 2008). tematic 1982; al. et 1973, Rothfels Tryon 1990; and arid (Tryon by imposed environments morpho- selection extensive from to resulting attributed convergence been logical often plagu- confusion has too taxonomic group habitats the the and in ing ferns, thrive other to most ability for their dry this for of known generic Members best natural 248). are and clade 1982: practical Tryon and to (Tryon respect classification” with ferns of group oyih 04b h mrcnSceyo ln Taxonomists Plant of Society American the by 2014 Copyright hs tde niaeta h otsgiiatbrirto barrier significant most the that indicate studies These contentious most “the called been have ferns Cheilanthoid oeadkonpod eesfrmmeso hserydvriglnaeo hiatodferns. cheilanthoid of lineage well-supported diverging early three this the of of members for in discussion levels included brief ploidy previously a known taxa and include American mode also Central We and phylogeny. North this genus primarily recircumscribed 47 the encompasses in lineage placed This ferns. cheilanthoid of ru n aebgnt lrf t ope vltoayhsoy spr fti fot egnrtdadaaye N eunedt for data sequence DNA analyzed and generated we effort, this of part As challenging ( history. this evolutionary of loci complex classification prove revised its plastid often a clarify macromorphology for three on to foundation exclusively begun the based providing have circumscriptions are and generic analyses group result, phylogenetic a molecular As Ongoing (Pteridaceae). non-monophyletic. be ferns to cheilanthoid of species + 400 the atrso iesfcto nteXrcaatdFr Genus Fern Xeric-adapted the in Diversification of Patterns Keywords— Abstract— Cheilanthes w n uhcaeta spyoeeial dis- phylogenetically is that clade such One Sw. Myriopteris 21) 93:p.698–714 pp. 39(3): (2014), togslciepesrsipsdb ruh-rn aiashv otiue oetniemrhlgclcnegneamong convergence morphological extensive to contributed have habitats drought-prone by imposed pressures selective Strong Apomixis, mnaL Grusz, L. Amanda Cheilanthes rbcL 1 .s a eetybe rnfre to transferred been recently has s. s. 3 eateto ilg,Dk nvriy uhm ot aoia278U .A. S. U. 27708 Carolina North Durham, University, Duke Biology, of Department eateto ilg,IdaaUiest,Bomntn nin 70 .S A. S. U. 47405 Indiana Bloomington, University, Indiana Biology, of Department Fg ;seGuz21;Guzand Grusz 2013; Grusz see 1; (Fig. , 2 atpA Cheilanthes isuiBtnclGre,P .Bx29 t oi,Msor 36 .S A. S. U. 63166 Missouri Louis, St. 299, Box O. P. Garden, Botanical Missouri n h negncspacer intergenic the and , .s slreycnie othe to confined largely is s. s. ovrec,mlclrpyoey myriopterid. phylogeny, molecular convergence, , Myriopteris 1,4 eadJ Gastony, J. Gerald 4 ihe .Windham, D. Michael uhrfrcrepnec ([email protected]) correspondence for Author Cheilanthes omnctn dtr akP Simmons P. Mark Editor: Communicating ee eifrapyoeyfrtegopadeaiekymrhlgclcaatr across characters morphological key examine and group the for phylogeny a infer we Here, . Cheilanthes Cheilanthes spoly- is trnG–trnR 3 n ahenM Pryer M. Kathleen and 698 o h yipei ld,oeo h ags oohltcgroups monophyletic largest the of one clade, myriopterid the for ) 25 aincce (94 cycles gation Tbe1.Fu ugoptx ( taxa outgroup analyses Four phylogenetic windhamii molecular 1). our in (Table included were taxa myriopterid tp(94 step 1 and 2), (Table pair primer locus-specific each of 200 ldadeie sn eunhr48(eeCdsCorporation, Codes (Gene 4.8 were Sequencher sequences consensus resulting using the of alignments edited Manual Michigan). and were sequences bled obtained newly 178 1). the All (Appendix followed GenBank (2009). sequencing in al. deposited and subsequently et purification Grusz PCR The of gel. protocol agarose 1% a on ia lnainse (72 step elongation final a uinars h yipei tree. distri- myriopterid their the examine and across analyses, bution for our level in ploidy included and species mode all summarize reproductive also on data we available ferns, evolution- the myriopterid important among phylogeny. are processes this ary apomixis across and polyploidy characters Because morphological key map recircumscribed newly under- the 2009; better of genus To history al. known. evolutionary poorly the et are stand group this among Windham of relationships species phylogenetic (e.g. the yet 2011), clade al. et well-supported Eiserhardt a tute ufrI otiigMgCl containing IV buffer ta.20;Esrad ta.21) eicue utpeaccessions multiple included We 2011). to al. sister et within taxa as ranging Eiserhardt wide Windham of resolved 2008; 2009; al. et al. was Rothfels 2007; et Kirkpatrick which 1998; Rollo clade, and (Gastony pellaeid the Myriopteris from selected egahcdistribution. geographic idfralacsin.TePRratoswr odce sn 1 using conducted were reactions PCR The accessions. spacer, all for intergenic fied the and bp), (1,872 nShetezadPyr(07.Trepatdloci, plastid described Three protocol (2007). Pryer the and following Schuettpelz California) plant in Valencia, DNeasy (Qiagen, the using kit specimens mini herbarium silica-dried air-dried from or extracted fragments was DNA leaf genomic 1), Appendix (see sampled 1 ao Sampling— Taxon euneAinetadDt Sets— Data and Alignment Sequence N xrcin mlfcto,adSequencing— and Amplification, Extraction, DNA rvossuishv hw httemrotrd consti- myriopterids the that shown have studies Previous ereYatskievych, George m m ecin h C mlfctosetie niiildenaturation initial an entailed amplifications PCR The reaction. l ahdT,100 dNTP, each M Myriopteris Myriopteris  o i)floe y3 eauain neln,adelon- and annealing, denaturation, 35 by followed min) 5 for C , nalpeiu oeua tde ihsfiin sampling sufficient with studies molecular previous all in aaynpei marantae Paragymnopteris  o i,45 min, 1 for C ucae,aogwt eiwo reproductive of review a with along subclades, aeil n Methods and Materials eetmt hlgn o h ld and clade the for phylogeny a estimate we , oa f6 cesosrpeetn 0(f4 total) 47 (of 40 representing accessions 68 of total A m 1 Myriopteris /lBA 0Um a oyeae 0.5 polymerase, Taq U/ml 50 BSA, g/ml  Myriopteris 2 o 0mn.Apioswr visualized were Amplicons min). 10 for C Agn,Esm .K) obndwith combined K.), U. Epsom, (ABgene, 2 an Huiet, Layne  o i,ad72 and min, 2 for C ryohsamicrophylla Argyrochosma ,and trnG–trnR tepigt apears their across sample to attempting , eunefamnswr assem- were fragments Sequence ele atropurpurea Pellaea (Pteridaceae) Cheilanthes 123b) eeampli- were bp), (1,293 m 1 epaeDAfra for DNA template l rbcL o ahindividual each For  o i)and min) 2 for C 133bp), (1,343 u now but , Astrolepis

+ were ) atpA PCR m M Delivered by Publishing Technology to: Duke University IP: 152.3.102.242 on: Tue, 08 Jul 2014 01:26:34 Copyright (c) American Society for Plant Taxonomists. All rights reserved. he lsi igelcsdt es( sets data single-locus plastid ambiguously three excluded; were 3’ data and missing excluded. also 5’ of were the indels amounts aligned of large portions alignment, with 2005). each ends For Maddison unnecessary. alignment was extensive specific and criterion lacked a they of implementation (Maddison (i.e. regions), ambiguous eye and/or 4.08 by indels completed be MacClade could alignments in Because performed then 699 MYRIOPTERIS OF PHYLOGENY AL.: ET GRUSZ 2014] emsinfo ida ta.(2009). al. et Windham from permission rprinlt ld ie h otrcn omnacso (mrca) ancestor common recent most The roughly size. lengths of tip clade with shown to are The ferns clade. proportional cheilanthoid myriopterid of the clades to major related six distantly only clade, hemionitid the of placement nlsswr odce sn ,0 otta elcts ahwt a with MLBS each 2006); replicates, Zwickl bootstrap Manual, 1,000 pseudoreplicate. (Garli using single conducted topology were most-likely replicates analyses a eight for ensure repeated ML was both search to in optimal-tree used The was analyses. none), BI = and invariantsites sites; invariant the of therefore, + proportion analyses; GTR BI model, the complex in most stationarity second reach best to to failed interpreted reality) thus reflect and available, currently a model using tractable tationally separately + a assessed using I searches was + Initial GTR support (MLBS). approach branch bootstrap of and likelihood each maximum sets for identified data was CIPRES four GARLI topology most-likely on in the a implemented run where were 2006), Duke analyses were (Zwickl the ML 2.0 on analyses The run were inference cluster. ML analyses DSCR BI Bayesian The University and 2010) 1997). al. and et Rannala Miller 1973) (www.phylo.org; and Felsenstein Yang (ML; (BI; likelihood maximum n ugoptx eeicue.Frti esn ugoptx were taxa outgroup reason, trnG–trnR this For the included. from ingroup removed were both taxa when regions outgroup ambiguous and of number substantial a included ( set data three-locus combined hlgntcAnalyses— Phylogenetic oa ffu aast eesbetdt hlgntcaayi:the analysis: phylogenetic to subjected were sets data four of total A Fig. h lgmn fnncdn ein ihnthe within regions non-coding of alignment The .micropteris C. .Smaypyoeyfrcelnhi en,idctn the indicating ferns, cheilanthoid for phylogeny Summary 1. G oto ftetrelcscmie alignment. combined three-locus the of portion oe fsqec vlto tems ope e compu- yet complex most (the evolution sequence of model hiate micropteris Cheilanthes n h yipei ld sidctd oiidwith Modified indicated. is clade myriopterid the and trnG–trnR aho h ordt eswseautdusing evaluated was sets data four the of Each igelcsainet swl sfo the from as well as alignment, single-locus rbcL + tp pce for species (type G bL atpA, rbcL, atpA ntalwn o siaino the of estimation for allowing (not + trnG–trnR and Cheilanthes trnG–trnR trnG–trnR ). ,ada and ), within ) spacer obnddt arxadrsligtesaedpstdi Tree in deposited are trees resulting (e.g. and sets methods matrix sets data data between data among combined or plastid incongruence phylogenies BI) individual well-supported vs. the three (ML mutually the of of no comparison each revealed of criterion A analysis MLBS 1996). 70% from a resulting Kellogg and BI and for measure (Mason-Gamer (PP) probability posterior posterior 0.95 clade and allcompat). each = phylogeny (contype from command consensus “sumt” excluded the a were with probabilities generations obtaining million before 2.5 using analysis first plotted convergence these were the on Based estimates diagnostics, 2005). Drummond parameter and (Rambaut output the 1.2.1 the Tracer of MrBayes) and by deviation calculated examined (as identify standard runs was To independent the trees the generations. stationarity, among and 1,000 frequencies reached split every generations had the chain million analyses in cold swapping 10 when the 0.08) for of from = run frequency sampled and (temp were were the analyses, Chains 0.08 improve combined chains. to to the between decreased analysis in was combined variable) parameter three-locus = heating allowed were (ratepr the evolution loci of (2) rates among (1) vary default exceptions: otherwise + two to with with GTR applied priors, A was flat) heated). gamma) (i.e. runs, three = and independent (rates cold evolution four (one sequence comprised chains four analyses with BI each All 2003). Huelsenbeck eevn togspotfo ohBysa PadMLBS and are analyses phylogenetic PP all Bayesian for statistics both Summary measures. from support branches strong most receiving with topologies, well-resolved produced yses oaLiaM 2 iscigmcocp tete 80 count either Spore at attached microscope glycerol. camera dissecting of digital 125 XSi drop MZ Rebel Leica the EOS a Canon over to a placed using taken was were slip images a frag- using cover sporangial-wall Each of drop a slide. removal the the microscope ments, in Following a needles. dispersed on dissecting spores of glycerol the pair of and drop ruptured sporan- a was intact in sporangium The placed glycerol. then with was moistened the gium needle from counted a removed was using sporangia were pinnae sporangium sporangia four fertile per individual to spores, phylogeny spores one count of the To specimen, number in manually. fertile the included and each not examined For were individuals 1). analyses, additional Appendix phylogenetic 22 our 1; in in for (Table concentrated included as accessions is sporan- well fertile per as apomixis 29 number or all whether 2011; spore for counted al. determine 16 gium we et To lineages, either Beck evolutionary 2011). 1989; produce particular Windham al. and apomicts produce et Gastony whereas Sigel usually 1950; (Manton sporangium, taxa spores reproducing per 32 sexual sexually spores spores ferns, to fewer 64 relative leptosporangiate in sporangia results Among that mature species. undergo meiosis in ferns to in produced apomictic prior role cycle, being just important life mitosis their an incomplete of play an part may As “ and diversification. the (2003)] their Yatskievych [e.g. and ferns Windham myriopterid the in from mon obtained was Mickel 2003; 4x) Yatskievych Tryon and or 2004). and Windham Smith 3x, Tryon 1993; and 1979; Rabe (2x, and Reeves level Windham 1967; 1982; ploidy 1965, (Knobloch and literature 30) relevant or 29, 27, omdsoe eesoe ssxa;idvdasdslyn ny3 or well- 32 apomictic. 64 only as with scored displaying were individuals sporangium sporangium sexual; per one spores as 16 least scored were at spores having formed specimens All fication. aighisadsae) nomto ncrmsm aenme ( number base or chromosome only, on hairs Information only, non- scales). scales vs. and with (circinate hairs (glabrous, having vernation type adaxially), indument grooved and cross-section circinate), or in rachis flattened bead-like of shape vs. not that not)], (terete vs. or such recurved beads) recurved margins spherical the margins elongate, small (= with UT, resemble ultimate oval US, segments of or ultimate UNM, shape the UC, round included: P, (= NY, examined [bead-like MO, features segments K, Morphological JEPS, YU. GH, and DUKE, B, ASU, herbaria: to assigned TB2:S15192). number study 15192; ID: mission rvosatoswr apdot rme snl emnlper terminal (single trimmed a onto by informative mapped taxonomically taxon) were be to authors considered features previous of variety a ters, hrce Mapping— Character ofitaogtersligtplge a sesdacrigt a to according assessed was topologies resulting the among Conflict and (Ronquist 3.1.1 MrBayes in implemented were analyses BI The hlgntcAnalyses— Phylogenetic lento fgnrtoswtotfriiain(..aoii)i com- is apomixis) (i.e. fertilization without generations of Alternation Myriopteris Myriopteris hlgn.Seiesrpeetn vr species every representing Specimens phylogeny. oepoetedsrbto fidvda charac- individual of distribution the explore To eeotie nla rmtefollowing the from loan on obtained were Results aho h orpyoeei anal- phylogenetic four the of Each rbcL hiate myriophylla Cheilanthes vs. trnG–trnR

+ .Tethree-locus The ). r100 or G ru”in group” BASE

+ of model magni- (sub- x = Delivered by Publishing Technology to: Duke University IP: 152.3.102.242 on: Tue, 08 Jul 2014 01:26:34 Copyright (c) American Society for Plant Taxonomists. All rights reserved. nApni 1. Appendix in (= 0 YTMTCBTN Vlm 39 [Volume BOTANY SYSTEMATIC aemula M. 700 imtrmaueet rmGuze l 20)aedsgae yaht() N eunedt vial o oce pcmn sidctdwith spor indicated on is based specimens estimates voucher Ploidy for respectively. available data asterisks, sequence (****) DNA four (^). or hat is (***), a taxon three by each (**), designated for Fraser- level are or unique two (2004), ( ploidy (or (2009) (*), Smith T known, taxa al. and abbreviations: one Where (sexual); Mickel following et S sexual). (1993), with the are Grusz Rabe as or designated and sporangium from specimen apomictic Windham per are (either measurements (2003), voucher spores S Yatskievych (2009) diameter one 64 and A, Dulawat (apomictic); Windham as than in A and spores reported sporangium more as 64 counts per Jenkins inferred by chromosome or number is on spore 32 represented sporangium based on either those per based taxa text containing listed; inferred spores bold study; sporangia is 32 in mode with this 1): not Reproductive specimens) Appendix Rows in 1). voucher in taxon. Appendix included available and given are 2 a specimen Fig. data about voucher in (raw known numbering information unique to the (corresponding a summarize sequentially text for numbered bold available in Rows information availability. document sequence DNA and number, chromosome .alabamensis M. .gracilis M. fimbriata M. .fendleri M. .cucullans M. .intertexta M. gracillima M. .allosuroides M. .chipinquensis M. aurea M. .clevelandii M. .covillei M. cooperae M. Table Myriopteris .aml 2 aemula M. 1 aemula M. rs Windham & Grusz .fmraa1 fimbriata M. Windham & Grusz 1 fendleri M. .cclas1 cucullans M. .aaaess3 alabamensis M. 2 alabamensis M. 1 alabamensis M. .itret 2 intertexta M. 1 intertexta M. 3 gracillima M. 2 gracillima M. 1 gracillima M. 3 gracilis M. 2 gracilis M. 1 gracilis M. .alsrie 1 allosuroides M. Windham & Grusz rs Windham & Grusz .ara5 aurea M. 4 aurea M. 3 aurea M. 2 aurea M. 1 aurea M. .ceeadi2 clevelandii M. 1 clevelandii M. Windham & Grusz 1 chipinquensis M. .coea 1 cooperae M. Windham & Grusz .cvle 5 covillei M. 4 covillei M. 3 covillei M. 2 covillei M. 1 covillei M. Pi. rs Windham & Grusz (Poir.) .Tx of Taxa 1. Mxn rs Windham & Grusz (Maxon) Fe Mxn A (Maxon) Ho. .Fourn. E. (Hook.) D .Eaton) C. (D. ´ (Fe AR Smith) (A.R. Mxn Maxon (Maxon) ) e DC ao)J Sm. J. Eaton) (D.C. DC Eaton) (D.C. notholaenoides ´ (Mett.) (Buckley) )Guz&Windham & Grusz e) a Kolc Lellinger) & (Knobloch oeta ikladSih(04 obe h rgnldtriainof determination original the doubled (2004) Smith and Mickel that Note ao oce Information Voucher Taxon ´ Myriopteris .Lo ¨ e&D Lo D. & ve hsseisi naoitctili,thus triploid, apomictic an is species this ; trnG–trnR n eae ugop tde,aogwt oce nomto,dt nifre erdciemd,pod level, ploidy mode, reproductive inferred on data information, voucher with along studied, outgroups related and ¨ ve ,A( A ), atpA .S . ea,Bc 07(UE R A T S Gastony & Yatskievych (DUKE) Tamaulipas, 1037 MEXICO, Beck Texas, A., S. U. EIO aaa aleg15 DK)STAR A T R A T S — (DUKE) 1656 Hallberg Oaxaca, MEXICO, (DUKE) 470 Schuettpelz Arizona, A., S. U. EIO unjao ek13 DK)—TAR A T — (DUKE) 1137 Beck Guanajuato, MEXICO, .S . isui ida 40(UE R A T R A T A — Blomquist Carolina, North A., (DUKE) S. 3450 U. Windham Missouri, A., (DUKE) S. 468 U. Schuettpelz Arizona, A., S. U. .S . rgn re 60 DK)STAR A T R A T R A T — R A T — R A T S — n. s. Dudley Arizona, A., (JEPS) S. 5086 U. Greenhouse S California, A., A — S. U. (DUKE) 06–03 A Pryer Oregon, A., (DUKE) S. 1356A U. Schuettpelz California, — A., (DUKE) S. 3630 U. Windham Washington, A., S. U. (DUKE) 0221A Windham Arizona, A., (DUKE) S. 2470 U. Rothfels Texas, A., (DUKE) S. 416 U. Schuettpelz Arizona, A., S. U. EIO aic,Ytkeyh&Gastony & Yatskievych Jalisco, MEXICO, .S . ea,Bc 08(UE R A T R R A A T T R A T R A T — — A A (DUKE) 1038 — Beck Texas, A., S. U. (DUKE) 991 Schuettpelz (DUKE) Pichincha, 466 ECUADOR, Schuettpelz Arizona, A., S. U. (DUKE) 1192 Beck Guerrero, MEXICO, (DUKE) 3591 Rothfels Carchi, ECUADOR, .S . aiona eza 8 DK)STAR A T R A T S n. s. Cleveland California, A., (DUKE) S. 180 U. Metzgar — California, A., S. U. (IND) 1996B Knobloch Leon, Nuevo MEXICO, .S . aiona alr195(C R A T — (UC) 15925 Taylor California, A., S. U. .S . rzn,Rtfl 51(UE — — R A T R A T S S S — 593 Funston & Coville California, A., (DUKE) S. 2571 U. Rothfels Arizona, A., (DUKE) S. 1090 U. Beck California, A., (DUKE) S. 3436 U. Windham California, A., (DUKE) S. 443 U. Schuettpelz Arizona, A., S. U. ,adR( R and ), 922(IND) 89–222 U,tp specimen) type (US, 62(DUKE) 9602 U,tp specimen) type (US, 927(IND) 89–237 Y,tp specimen) type (YU, rbcL ;ads elcsteasneo aa eBn ceso ubr o ahaereported are each for numbers accession GenBank data; of absence the reflects dash a ); n = 2n 87. = n 7t roeul report erroneously to 87 = Reproductive * * x 3x 2x, A** S*, S—— S— S—— S—— — — A—— S— S— *2x S* *3x A* *2x S* *3x A* *2x S* * — — S** * x2 2x S** —TAR ——— — — ——— **2x S*** —TAR Inferred Mode Ploidy Level 2n n n n n n n n n Chromosome n =2 =29* =30* =2 =30* =30* 29*, = =2 =60** 7 for 174 = Count n n n 90* = 87** = 90* = ( Continued Cheilanthes Sequence TAR DNA Data e ) Delivered by Publishing Technology to: Duke University IP: 152.3.102.242 on: Tue, 08 Jul 2014 01:26:34 Copyright (c) American Society for Plant Taxonomists. All rights reserved. 04 RS TA. HLGN FMROTRS701 MYRIOPTERIS OF PHYLOGENY AL.: ET GRUSZ jamaicensis M. 2014] .lanosa M. .myriophylla M. .parryi M. .lindheimeri M. lendigera M. .peninsularis M. .notholaenoides M. newberryi M. .pringlei M. .longipila M. .rawsonii M. pringlei M. .marsupianthes M. .microphylla M. mickelii M. mexicana M. .moritziana M. T .ntoanie 1 notholaenoides M. .jmiess1 jamaicensis M. .mrtin 2 moritziana M. .ntoanie 2 notholaenoides M. .lniea4 lendigera M. 3 lendigera M. 2 lendigera M. 1 lendigera M. 3 lanosa M. 2 lanosa M. 1 lanosa M. .pry 2 parryi M. 1 parryi M. .nweri1 newberryi M. Windham & Grusz 5 myriophylla M. 4 myriophylla M. 3 myriophylla M. 2 myriophylla M. 1 myriophylla M. .pnnuai 1 peninsularis M. .lnhiei5 lindheimeri M. 4 lindheimeri M. 3 lindheimeri M. 2 lindheimeri M. 1 lindheimeri M. rs Windham & Grusz .pringlei M. Windham & Grusz 2 pringlei M. 1 pringlei M. .lniia1 longipila M. .rwoi 2 rawsonii M. 1 rawsonii M. Windham & Grusz .mcei 1 mickelii M. 1 mexicana M. 1 marsupianthes M. .mcohla3 microphylla M. 2 microphylla M. 1 microphylla M. .mrtin 1 moritziana M. ABLE .(C 1. DC ao)Guz&Windham & Grusz Eaton) (D.C. Mcx)Guz&Windham & Grusz (Michx.) Dvn. rs Windham & Grusz (Davenp.) var. T evs rs Windham & Grusz Reeves) (T. Mt.e Kuhn) ex (Mett. Bkr rs Windham & Grusz (Baker) Cv)Fe (Cav.) Dvn. rs Windham & Grusz (Davenp.) ONTINUED DC Eaton) (D.C. var. Kne rs Windham & Grusz (Kunze) Ho. .Sm. J. (Hook.) Mxn rs Windham & Grusz (Maxon) moncloviensis Mxn rs Windham & Grusz (Maxon) S. rs Windham & Grusz (Sw.) Ds. .Sm. J. (Desv.) Fe ocoini 1 moncloviensis (Desv.) ao oce Information Voucher Taxon ´ e ´ e ). (Baker) EIO uv en ida tal. et Windham Leon, Nuevo MEXICO, O.RP,SnJa eL Maguana, La de Juan San REP., DOM. CAO,Crh,Rtfl 59(UE R A T S (DUKE) 3589 Rothfels Carchi, ECUADOR, EEUL,DsrcoFdrl oiz263 Moritz Federal, Districto VENEZUELA, OT IA a oe rs tal. et Grusz Jose, San RICA, COSTA .S . rzn,Shetez40(UE R A R T A T R A T R R A A T T R A T R A T — S S — — (DUKE) 460 Schuettpelz Arizona, (IND) A., S. 89–432 U. Yatskievych Arizona, A., (DUKE) S. 1226 U. Beck Arizona, A., (DUKE) S. 110 U. S Grusz Jose, San RICA, — COSTA (IND) n. s. Hegeman Indiana, (DUKE) A., 2717 S. Rothfels U. Carolina, North A., (DUKE) S. 1224A U. Schuettpelz Alabama, A., S. U. .S . rzn,Mtgr19(UE R A T S Yatskievych & Windham Arizona, A., (DUKE) S. 149 U. Metzgar Arizona, A., S. U. .S . aiona eza 7 DK)STAR A T R — A T R A T R A T S (DUKE) 174 Metzgar — California, A., S. A U. A (DUKE) 990 Schuettpelz Pichincha, ECUADOR, Potosı Luis San A MEXICO, (DUKE) 3281 Rothfels Oaxaca, MEXICO, (DUKE) 3082 Rothfels Guanajuato, MEXICO, (DUKE) 989 Schuettpelz Pichincha, ECUADOR, EIO aaClfri u,Lo el Luz la de Leon Sur, California Baja MEXICO, .S . ea,Rtfl 40(UE R A T R A T R A T S A — — A (K) 744 Lindheimer Texas, A., (K) S. 744 U. Lindheimer Texas, A., (DUKE) S. 471 U. Schuettpelz Arizona, A., (DUKE) S. 2490 U. Rothfels Texas, A., (DUKE) S. 450 U. Schuettpelz Arizona, A., S. U. .S . rzn,Shetez52(UE R A T — Coahila, MEXICO, Yatskievych & Windham Arizona, A., (DUKE) S. 502 U. Schuettpelz Arizona, A., S. U. EIO aaa ikl61 DK)—T—R — T — (DUKE) 6317 Mickel Oaxaca, MEXICO, AII,Glbat71 M)S— R A T S S (MO) 7014 Goldblatt NAMIBIA, (MO) 11325 Smook NAMIBIA, EIO aaa aa ta.14 N)STAR A T R A T R A T S — — (NY) 1848 al. et Salas Oaxaca, MEXICO, (DUKE) 1151 Beck Guanajuato, MEXICO, (UC) 13 Jankiewicz Mexico, MEXICO, OII,Ccaab,Kslr96 U)—TAR A T R A T — — Gua RICO, PUERTO (UC) 9568 Kessler Cochabamba, BOLIVIA, (DUKE) 994 Schuettpelz Pichincha, ECUADOR, 8 (DUKE) 481 ls 86(US) 3856 Clase G,isolectotype) (GH, 800(DUKE) 08–020 30 (DUKE) 0340A 74(MO) 9764 28 (DUKE) 0248A amr1378 Palmer ´ ia rco U)—TAR A T — (US) Proctor nica, ´ rw 33– ID R A T — (IND) 83–31–4 Brown , N)S— S (NY) Reproductive *,A* 4x, A*** S**, S— ^ *2^ 3x 2x^, A* S^, S— S—— S—— S— S—— ATAR *4x S* ATAR *2x S* 3x*** A *2 2 2x S* *2x S* * x2 2x S** *3x* A* * x2 2x S** **2x S*** **2 2 2x S*** **—— — A*** —TAR ——— —TAR ——— Inferred Mode Ploidy Level 3x*** ,a n n n n n n n n Chromosome n n n n =2 =2 60* = 30*** = =2 30* = 30* = =2 2 60* = 60** = 60** = 60*** = Count n n n n 116*** = n 90* = 90* = 87, = =87 a ( Continued Sequence TAR DNA Data ) Delivered by Publishing Technology to: Duke University IP: 152.3.102.242 on: Tue, 08 Jul 2014 01:26:34 Copyright (c) American Society for Plant Taxonomists. All rights reserved. ld ihlwsupport. low with clade nlds1 fte40 the of 13 includes ryohsamicrophylla Argyrochosma ld CaeA i.2 ssse oacombined a to the sister as resolve 2) Fig. set) A, (Clade data clade as three-locus well combined as Relationships analyses, the single-locus best of all the (100/1.0). (for though each topologies uncertain, 2), likelihood remain supported groups Fig. three C, maximally these L, among A, is (Clades clades which major divided three is among diversity Myriopterid (100/1.0). support maximal 2 Fig. in displayed names in nyms Taxon 2. within -16,790.1213) Fig. placement = reflect in data three-locus presented (lnL combined is tree our set of most-likely analysis The the from 3. resulting Table in listed yavapensis M. 39 [Volume BOTANY SYSTEMATIC rufa M. 702 ele atropurpurea Pellaea marantae Paragymnopteris windhamii Astrolepis .scabra M. .tomentosa M. .windhamii M. viscida M. .wootonii M. .yatskievychiana M. wrightii M. T T u eut ofr h oohl of monophyly the confirm results Our .microphylla A. Windham .yvpni 2 yavapensis M. 1 yavapensis M. Windham & Grusz .atropurpurea P. .marantae P. windhamii A. 7 rufa M. 6 rufa M. 5 rufa M. 4 rufa M. 3 rufa M. 2 rufa M. 1 rufa M. .sar 1 scabra M. .sar 2 scabra M. .tmnoa1 tomentosa M. .vsia1 viscida M. .wnhmi1 windhamii M. .wnhmi3 windhamii M. 2 windhamii M. .ytkeyhaa1 yatskievychiana M. Windham & Grusz .wihi 2 wrightii M. 1 wrightii M. 1 wootonii M. ABLE HE Fe A .(C 1. ´ Cheilanthes e H as)Guz&Windham & Grusz Karst) (H. LABAMENSIS Dvn. rs Windham & Grusz (Davenp.) Ho. rs Windham & Grusz (Hook.) Mxn rs Windham & Grusz (Maxon) ONTINUED Fe Grusz T evse Windham) ex Reeves (T. ´ e ao oce Information Voucher Taxon (Mickel) L)Link (L.) ). .M Benham M. D. spoie nApni 2. Appendix in provided is C LADE Mt.e Kuhn) ex (Mett. L)K .Shing H. K. (L.) Myriopteris Myriopteris — hslnae(ld ,Fg 2) Fig. A, (Clade lineage This pce ape o our for sampled species Tbe1;als fsyno- of list a 1); (Table .S . e eio Worthington Mexico, New A., S. U. .S . rzn,Lce 7 DK)A— R A T A A (DUKE) 778 Licher Arizona, A., (DUKE) S. 415 U. Schuettpelz Arizona, A., S. U. .S . igna cutpl 1 DK)——AR A — — (DUKE) 312 Schuettpelz Virginia, A., S. U. HN,Yna,Ytkeyh0–5(O R A — R A — — — (MO) 02–35 Yatskievych Yunnan, CHINA, (DUKE) 431 Schuettpelz Arizona, A., S. U. — R A T R A T R A T R A T R A T A A — A Windham A & Windham Mexico, New A., (DUKE) S. 3902 U. Rothfels Virginia, A., (DUKE) S. 161 U. A Metzgar Arizona, A., (DUKE) S. 2493 U. Rothfels Texas, A., (DUKE) S. 3545 U. Windham Texas, A., (DUKE) S. 323 U. Schuettpelz Texas, (DUKE) A., 2515 S. Rothfels U. Mexico, New A., S. U. EIO uv en atn 90–10–1 Gastony Leon, Nuevo MEXICO, .S . ea,Bc 06(UE R A T S (DUKE) 1036 Beck Texas, A., S. U. .S . ot aoia Christenhusz Carolina, North A., S. U. .S . aiona eza 6 DK)ATAR A T A (DUKE) 169 Metzgar California, A., S. U. .S . rzn,Wnhm48(DUKE, 458 Windham Arizona, A., S. U. .S . e eio ek15 DK)ATAR A T A n. s. Lemmon Arizona, (DUKE) A., 1050 S. Beck U. Mexico, New A., S. U. EIO ooa uqe 632(MO, 96–302 Burquez Sonora, MEXICO, .S . rzn,Wnhm04A(UE — R A T R A T 3x S — — (DUKE) 0341A Windham Arizona, A., (DUKE) S. 441 U. Schuettpelz Arizona, A., S. U. (DUKE) 488 Schuettpelz Arizona, A., S. U. 42 (DUKE) 34623 01 (DUKE) 0021B (DUKE) 83(DUKE) 3823 aayeof paratype U,tp pcmnof specimen type (US, yespecimen) type Myriopteris covillei alabamensis + .windhamii M. lanosa with .villosa C. ) itrrltosi between several relationship including cucullans are support, there sister maximal resolved, receive a well that not groupings is species 2 phylogenetic Clade the of Although maxi- widely backbone Americas. species The the eight across species. encompasses distributed 2 sister Clade as supported mally supported unequivocally are allosuroides M. .S . lhuhterltv oiin of positions four relative southwestern the includes adjacent although the (98/1.0), A.; and S. support Mexico U. to strong endemic with species resolved which 1, Clade is 2). (Fig. set, groups monophyletic data support well-supported statistical combined low with our but clade, ( the on of remainder based the to tree ML wrightii M. the In study. < 0.Termiigmmeso hscaefl notwo into fall clade this of members remaining The 70). ) n iia eainhpbetween relationship similar a and aSnrnCiuha eetedmc ssister is endemic) Desert Sonoran/Chihuahuan (a r uncertain, are Reproductive A— ATAR A— *2x S* *4x A* 3x A* *3x A* *2x S* *3x A* *3x A* *2x S* *3x A* * 3x A** ——AR —TAR —TAR ——— —TAR ** 2x S**** ,S*—— — S** A, Inferred Mode .peninsularis M. Ploidy Level .notholaenoides M. n n n n n n n n n n n Chromosome =2 = =2 =2 = 27* = 29**** = =2 =29* =30* =2 Count 2n 2n n n n n n .mickelii M. and 87* = 90* = 90* = 90* = 87** = 120* = 90* = .scabra M. .pringlei M. and Sequence TAR DNA Data and and M. Delivered by Publishing Technology to: Duke University IP: 152.3.102.242 on: Tue, 08 Jul 2014 01:26:34 Copyright (c) American Society for Plant Taxonomists. All rights reserved. sntwl eovdbtteeaesvrlmxmlysupported maximally several are there but resolved well not is American North western the yavapensis M. from sampled well-supported includes species (92/1.0) eight 3 relation- three the Clade the unresolved. 2), are constitutes Fig. which 5, among and latter ships 4, 3, The (Clades groups 2). monophyletic Fig. (‘cc’, itrt h ihyspotd(010 core (90/1.0) supported highly the endemic to Province sister Floristic Californian species, the remaining the nota- Among shows substructure. and phylogenetic genus ble the in species distributed widely most otda itrt h oaeSnrnDsr endemic, Desert Mohave/Sonoran the to parryi M. sister as ported rmohrmmeso h ru ihmxmlsupport. maximal with group the aurea of Myriopteris members other from ohteiiilPRapiiainadfrDAsqecn;alohrpieswr sdfrDAsqecn only. sequencing DNA for used were primers other all sequencing; DNA for and amplification PCR initial the both fti ld r rmrl ot mrcn h oeAfrican the sole within the American, of North primarily representative are members clade Although this the taxa. of remaining to the endemic to sister species sequentially two ( Province that Floristic indicate Californian analyses Our sis. between relationship and sister apparent the taxa though the among Relationships to species. belonging the sampled to seven includes sister as resolved ape o hssuy h is ao pi eaae the separates split major first 40 The aurea the study. M. this of for 20 sampled including species-rich, most obnd(2 ,0 1 . 0(5)4 7% 2(63%) 42 (70%) 47 (75%) 50 9.5 916 4,508 (72) Combined trnG–trnR atpA rbcL 703 fimbriata M. atpA atpA atpA atpA atpA MYRIOPTERIS atpA OF PHYLOGENY AL.: ET trnG–trnR GRUSZ trnG–trnR trnG–trnR trnG–trnR rbcL rbcL rbcL rbcL 2014] rmtoo h he cesosof accessions three the indistinguishable of genetically two is America, from South to endemic lsi oianalyzed. loci plastid N einPie ’3 rmrsqec rmrsource Primer sequence Primer 5’-3’ Primer region DNA #individuals) (# T Table Table T aaSet Data HE HE 7)13512023 5% 5(3)3 (50%) 33 (53%) 35 (53%) 35 0.2 172 1,345 (71) 7)18322103 5% 6(5)3 (53%) 35 (55%) 36 (57%) 38 1.0 282 1,873 (71) .lanosa M. L C ANOSA .Piesue o N mlfcto n eunigo lsi oifraltx nlddi hssuy Atrssidct rmr sdfor used primers indicate *Asterisks study. this in included taxa all for loci plastid of sequencing and amplification DNA for used Primers 2. .Smaysaitc o hlgntcaaye nti study. this in analyses phylogenetic for statistics Summary 3. OVILLEI . 6)12028233 5% 8(7)3 (51%) 34 (57%) 38 (57%) 38 2.3 228 1,290 (68) ld ( clade lanosa Interestingly, . ope.Tepyoeei akoeo ld 3 Clade of backbone phylogenetic The complex. a o ttsia upr norMB analy- MLBS our in support statistical low has C C .aurea M. LADE LADE ld CaeL i.2 n aial sup- maximally and 2) Fig. L, (Clade clade Myriopteris (previously lanosa Ti ieg CaeL i.2,weakly 2), Fig. L, (Clade lineage —This Ti ieg CaeC i.2 sthe is 2) Fig. C, (Clade lineage —This oa aibeMLBS Variable Total STF1F ACRTCAACATSheteze l 2006 al. et Schuettpelz 2006 al. 2006 et al. Schuettpelz et Schuettpelz 2006 al. et Schuettpelz 2007 2006 al. al. et et Metzgar Schuettpelz 2006 al. et Schuettpelz 2007 al. et Nagalingum 2007 al. et 2007 Nagalingum al. et Nagalingum GTATAGGTTCRARTCCTATTGGACG 2007 Pryer and Schuettpelz GARCARGTTCGACAGCAAGT CATCTCCCGGATATGCTTCTCG CGAGAAGCATATCCGGGAGATG 2007 Pryer and ATTGTATCTGTAGCTACTGC Schuettpelz 2007 Pryer 2007 and ACAGCAGTAGCTACAGATAC Pryer Schuettpelz TTGCTTMTAYGACTCGGTG and Schuettpelz GCGGGAATCGAACCCGCATCA CTATCCATTAGACGATGGACG ESTRNR46F* GCGGGTATAGTTTAGTGGTAA ESATPF412F* ESATPA877R CCATTYATGCGTTGGAGAGATCG ESATPA856F ESATPA557R TCAGGACTCCACTTACTAGCTTCACG AGAYCGTTTCYTATTYGTAGCAGAAGC ATGTCACCACAAACGGAGACTAAAGC ESATPA535F TRNG353R TRNG63R TRNR22R* TRNG1F* ESRBCL628F ESRBCL1361R* ESRBCL654R ESRBCL1F* ld r eeal elresolved, well generally are clade + hrces(aepairs) (base Characters .moritziana M. covillei .yatskievychiana M. ( .rawsonii M. .viscida M. hiate bonariensis Cheilanthes ld CaeC i.2), Fig. C, (Clade clade .microphylla M. h only the , and sdel nested deeply is ) Myriopteris .newberryi M. .cooperae M. a’i i.2) Fig. in ‘au’ ; covillei .longipila M. Myriopteris sthe is ) tthe at isn aa(%) data Missing clade are ) taxa is t fmrotrdtx aercie htaetrt (i.e. terete the of 2 are tatives Clade of that members all the rachises includes within This have section. cross taxa in bead-like round) myriopterid major- of The lack shape. ity leaf-rachis to relating outgroups, states character three including taxa, segments. ultimate other does All as core segments, the ultimate the All is of examined. 3A) (Fig. character members segments morphological ultimate of homoplasious shape least reproductive The 3–5. and Figs. the in cytological, across states morphological, character various of origin the in triploid). apomictic involved (an was latter the 1) of Table diploid; sexual known (a rt osrn upr.Temxmlyspotdpiigof pairing supported maximally chipinquensis M. The support. mod- strong with branches to multiple discrete erate the but occupy resolved, taxa poorly to single are of referred complex accessions this informally in species now the species as other rufa supported M. all maximally to is these, sister among widespread most origin. uncertain of 1) poly- apomictic (Table ploids are which of five species, sampled six includes mexicana M. progenitors maternal diploid sexual indistinguishable known nearly ( (and their with grouping from) 1) Table 2; polyploid known Fig. involve ( pairs these hybrids of Three pairs. species rs ta.20) ld 1010 ossso h widespread the of species consists tetraploid (100/1.0) 4 Clade 2009). al. et Grusz .lnhiei .fendleri M. lindheimeri, M. iue3 lutae h hlgntcdsrbto fthe of distribution phylogenetic the illustrates 3B Figure Myriopteris— Across Characters Mapping (previously .yvpni,M wootonii M. yavapensis, M. alabamensis and covillei ³ and 0PP 70 .marsupianthes M. lendigera M. .eatonii C. nru iattoswt odbac support branch good with bipartitions Ingroup .tomentosa M. ld CaeC i.3) n l u two but all and 3B), Fig. C, (Clade clade ld CaeA i.3) l represen- all 3B), Fig. A, (Clade clade covillei ,and Myriopteris ope.Rltosisamong Relationships complex. ) .gracilis M. n t uaiedpodparents, diploid putative its and ³ .5MLBS 0.95 ld ‘c)hv bead-like have (‘cc’) clade a niaeta h former the that indicate may .gracillima M. aty ld (100/1.0) 5 Clade Lastly, . yipei myriophylla Myriopteris ,and hlgn sshown is phylogeny nthe in h distribution The .intertexta M. lanosa respectively; ³ 0adPP and 70 clade. ,the ³ 0.95 ; Delivered by Publishing Technology to: Duke University IP: 152.3.102.242 on: Tue, 08 Jul 2014 01:26:34 Copyright (c) American Society for Plant Taxonomists. All rights reserved. 0 YTMTCBTN Vlm 39 [Volume BOTANY SYSTEMATIC 704 ovuhrseieslse nTbe1 upr ausaepoie o rnhswith branches for provided ( are for values support Support taxonomy moderate 1. indicate updated Table branches the in thickened listed follow specimens Names voucher -16,790.1213). to = L (ln . P eintda /) h he primary three The +/+). the as designated PP; 1.0 Fig. .aurea M. .Patdpyoeyof phylogeny Plastid 2. ld a)i itnuse rmthe from distinguished is (au) clade Myriopteris ae ncmie nlssof analysis combined on based Myriopteris ³ oecovillei core 0MB n/r09 P;haiytikndbace niaemxmlspot(0 LSand MLBS (100 support maximal indicate branches thickened heavily PP); 0.95 and/or MLBS 70 ldsaedsgae (= A designated are clades c)clade. (cc) Myriopteris rbcL Tbe1 pedcs1ad2;nmesfloignmscorrespond names following numbers 2); and 1 Appendices 1; (Table , atpA ,and alabamensis ³ 0MB n/r09 P(LSP,rsetvl) Lightly respectively). (MLBS/PP, PP 0.95 and/or MLBS 70 trnG–trnR ld) (= C clade), h aiu ieiodtplg sshown is topology likelihood maximum the ; covillei ld) n (= L and clade), lanosa clade); Delivered by Publishing Technology to: Duke University IP: 152.3.102.242 on: Tue, 08 Jul 2014 01:26:34 Copyright (c) American Society for Plant Taxonomists. All rights reserved. h ugopspecies the outgroup of the the representative one of “hooked”) but members all (i.e. sampled in clade, all non-circinate included includes taxa exhibits This 44 majority vernation. the a Of 3C). study, (Fig. the clade pellaeid the from across able cooperae ahss ltee ahssaecaatrsi ftoearly- two the of of characteristic members are diverging rachises Flattened rachises. wrightii M. yeo nuetfudo h dxa Fg B n abaxial and 4B) the (Fig. map adaxial the separately on we found of Here, indument identification of 4A). type for (Fig. character others) species taxonomic in scales individual useful and most hairs both the having is to taxa some in brous Within ferns. cheilanthoid of Myriopteris leaves the on found commonly microphylla alabamensis vernation, do “fiddlehead”) (i.e. as circinate have 3C) Fig. L, (Clade marantae ahss ihnthe ( Within rachises. taxa outgroup four windhamii the of the of species sampled 705 MYRIOPTERIS OF PHYLOGENY AL.: ET GRUSZ 2014] ahssae ht oe lgtyfatnd rybxs=aailygovd lc oe eee .Vrain okd=non-circinate, = hooked Vernation: C. terete. = boxes black grooved, adaxially = boxes grey flattened, slightly = boxes circinate. = spiraled white shape: rachis h hp fyug nuln rns(ento)i vari- is (vernation) fronds unfurling young, of shape The ar n cls olcieyrfre oa nuet are indument, as to referred collectively scales, and Hairs Fig. .Mpigla hrcesin characters leaf Mapping 3. .wrightii M. n n ugopseis( species outgroup one and ) ycnrs,altx eogn othe to belonging taxa all contrast, By . ,and aito nla nuet(agn rmgla- from (ranging indument leaf in variation , and Myriopteris ld)adteotru taxa outgroup the and clade) lsalmmeso ld aegrooved have 1 Clade of members all plus srlpswindhamii Astrolepis aaynpei marantae Paragymnopteris teeris rnhn ebro the of member branching earliest (the ele atropurpurea Pellaea alabamensis swl stefu ugopspecies outgroup four the as well as , lanosa lanosa ld CaeL i.3) Three 3B). Fig. L, (Clade clade ele atropurpurea Pellaea Myriopteris ld CaeA i.3B), Fig. A, (Clade clade ld ( clade ryohsamicrophylla Argyrochosma . alabamensis and .Saeo liaesget:bakbxs=ba-ie ht oe o edlk.B Cross-sectional B. bead-like. not = boxes white bead-like, = boxes black segments: ultimate of Shape A. . )alsohaveterete .viscida M. Paragymnopteris Argyrochosma lanosa , ld,and clade, Astrolepis and covillei clade M. ). otwe h evsrahmtrt.Otru aaare taxa Outgroup distinctive maturity. this reach exhibit leaves be the 3 may they when though Clade surfaces lost adaxial of their on skeletonized type members of indument 3 loss all the Clade through for scales, glabrous synapomorphy become has a of esize exception be the With to 4B). (Fig. appear skeletonized having of which in distribution scales, the taxa Another involves surfaces. other leaf pattern all adaxial interesting on from hairs branched differs but group, nothing the of species r ofndt al-iegn rnhso the 4B). of Fig. A, branches (Clade early-diverging clade to confined are of 4B). (Fig. segments covillei tissue ultimate of exception their green the of With surfaces adaxial the the on species, on few lacking a in segments. entirely ultimate only); the surfaces is com- in abaxial or on indument the alone different occur and (on can often scales, and bination are surfaces ciliate abaxial types length), and indument adaxial their These of scales. biseriate part entire being for in hairs multiseriate subtending branched to any from seg- skeleton- (differing and hairs, scales ultimate branched ized costae hairs, the simple include the of These of stalks). (excluding surfaces types proper the five taxon ments recognize on each We for occurring segments phylogeny. indument ultimate the the in of represented surfaces 4C) (Fig. h aoiyo aain taxa of majority The ld) nru pce ihgaru dxa surfaces adaxial glabrous with species ingroup clade), .fendleri M. yipei rawsonii Myriopteris Myriopteris .fendleri M. amme fCae3i the in 3 Clade of member (a aeol ipehairs simple only have hc ehypoth- we which , h nyAfrican only the , alabamensis Delivered by Publishing Technology to: Duke University IP: 152.3.102.242 on: Tue, 08 Jul 2014 01:26:34 Copyright (c) American Society for Plant Taxonomists. All rights reserved. dxa B n bxa C ufc fteutmt emnsfrmmesof members for segments ultimate the of surface (C) abaxial and (B) adaxial Myriopteris 0 YTMTCBTN Vlm 39 [Volume BOTANY SYSTEMATIC 706 =ylo oe) rnhdhis( rnebxs,seeoie cls( lebxs,claesae =prl oe) retr cls( re boxe green (= scales entire or cm. boxes), 0.5 purple = bars (= scale scales label; ciliate corresponding boxes), its below blue shown (= are scales type indument skeletonized each boxes), of orange images right, (= far hairs On branched boxes), yellow (= Fig. AC apn fidmn in indument of Mapping 4A–C. mdfe rmMce n mt 04;lf orgt lbos nysae;ol ar;bt clsadhis –.Idmn yeo the on type Indument B–C. hairs. and scales both hairs; only scales; only glabrous; right: to left 2004); Smith and Mickel from (modified Myriopteris .Ln lutain fidmn ntelwr(bxa)srae fteutmt emnsacross segments ultimate the of surfaces (abaxial) lower the on indument of illustrations Line A. . Myriopteris nuettp scdda lbos( ht oe) ipehairs simple boxes), white (= glabrous as coded is type Indument . s). Delivered by Publishing Technology to: Duke University IP: 152.3.102.242 on: Tue, 08 Jul 2014 01:26:34 Copyright (c) American Society for Plant Taxonomists. All rights reserved. btntamjrt)of plurality majority) A a surfaces. not adaxial the the (but for similar- observed notable Among patterns some scales’), 4C). to are ities (Fig. there adaxial sampled, skeletonized the species is of ingroup segments the that + ultimate than the diverse of more scales simple surfaces even abaxial + the ‘ciliate scales of ‘ciliate indument and hairs’, combina- simple unique + hairs’, three scales of (‘entire appearance tions the and scales) ciliate four the of state. each character indument; different a adaxial has species to regard with variable 707 MYRIOPTERIS OF PHYLOGENY AL.: ET GRUSZ 2014] lbosaailsrae r ofndt early-diverging to confined are with species surfaces and leaves, abaxial the of glabrous surfaces lower the on hairs ple liylvlfrec ao sntdt h meit eto h icesoigrpoutv oe(X=dpod X=tili,4 erpod X= ?X tetraploid, = 4X triploid, = 3X diploid, = ‘—’. (2X dash a mode by reproductive indicated showing are circle data Missing the apomictic). of = left font apomictic red immediate = sexual, outline sporangium the circles = per to red font spores by noted black 32 indicated level; is circles), are ploidy (black individuals/populations taxon unknown different sexual each in = for modes sporangium reproductive level per apomictic spores Ploidy and 64 sexual exhibiting sporangium): taxa per circles); number (red spore follows: on as (based indicated mode are reproductive 1), Table (see counts ihteadto ftoidmn ye etr clsand scales (entire types indument two of addition the With Fig. .Mpigo yooia n erdciecaatr in characters reproductive and cytological of Mapping 5. Myriopteris pce rdc nysim- only produce species x 7i niae ihge circles, grey with indicated is 27 = Myriopteris aeo dxa nuet h orotru aashow taxa outgroup four the the indument, across adaxial scattered of is case the which within 5 Clade scales, common entire alabamensis most simple and of second combination a The hairs is surfaces surfaces. abaxial on abaxial type indument the on segments. scales ultimate the of fendleri surfaces Myriopteris abaxial the skeleton- on by scales) accompanied ized (occasionally usual scales the ciliate (with having 3 Clade and of hairs, exception branched only having by the rawsonii Myriopteris of branches .Crmsm aenmes ahrdfo xsigchromosome existing from gathered numbers, base Chromosome A. . x 9wt ht ice,and circles, white with 29 = ld n loapast easnpmrh of synapomorphy a be to appears also and clade .fendleri M. suiu npouigntigbtentire but nothing producing in unique is alabamensis covillei saandsigihdfo l te taxa other all from distinguished again is xiisasnua yaoopyof synapomorphy singular a exhibits ) ld CaeC i.4) si the in As 4C). Fig. C, (Clade clade x 0wt lc ice.B Inferred B. circles. black with 30 = ld CaeA i.4C). Fig. A, (Clade clade nblack. in d Delivered by Publishing Technology to: Duke University IP: 152.3.102.242 on: Tue, 08 Jul 2014 01:26:34 Copyright (c) American Society for Plant Taxonomists. All rights reserved. 0 YTMTCBTN Vlm 39 [Volume BOTANY SYSTEMATIC 708 eso hsgopfr aial upre ld Fg 2) (Fig. to clade supported related maximally distantly Windham a only mem- form that 2008; group demonstrating this in al. of 2011) bers al. et et Eiserhardt 2009; Rothfels al. et 2007; (Kirkpatrick studies triploids. apomictic are whereas diploids, sexual both ( scales ciliate ( abaxially glabrous scales are They states. ( character different four ftefu pce nlddi h nlss n ld 4. whereas Clade tetraploid data, sively and in current analysis) the uncommon on the relatively based in are included tetraploids three species for Sexual (where four unknown are 1 the level the Clade of ploidy across from and scattered only mode absent reproductive are apparently triploids clades, Apomictic major exist well. they that as indicates (unpubl.) there al. et Beck by the work ongoing for in except clade lettered/numbered phylogeny levels. every the ploidy in of appear variety diploids a that reports, Sexual existing reaffirm on based results and, taxa Our and apomictic. 23 spores/sporangium be Another larger Myriopteris sexual. to 32 be presumed than to were inferred more were no and exhibited 32) than one more significantly least of at sampling showed (or individuals spores/sporangium our 25 64 on approximately specimen, fertile Based per 5. informa- sporangia Fig. four published to in with level, along ploidy mapped, on tion are data these and of date to than counted other been have that 2 show all Clade of of members number five base chromosome The of a members have 40 available all the are data 2, of the Clade 26 With of 5). for (Fig. exception phylogeny available our are in included inferred, taxa myriopterid be can levels ploidy segments. mate ( hairs otcmrhniesuyt ae(iehrte l 2011), taxa. al. recognized the et currently 47 the (Eiserhardt of the of over date 40 sampling to increase encompassing study Our two-fold comprehensive a 2013). most represents Windham clade and myriopterid Grusz genus, 2013; segregated newly the to belonging mn h ugoptaxa, outgroup clades the ingroup Among all isolated in the analyses, predominate our except taxa in Sexual apomicts other polyploid. all is chromosome like it, documented that suggest have spores unconfirmed. remain not levels do jamaicensis ploidy but and sexual counts, be to clevelandii M. being analysis docu- covillei our only in the example common; mented less cytotypes. even other are to tetraploids addition Apomictic in populations tetraploid sexual ryohsamicrophylla Argyrochosma erdciemd a nerdfrattlo 1specimens 51 of total a for inferred was mode Reproductive and numbers base which from counts, Chromosome hlgntcAnalyses— Phylogenetic taxa among relationships evolutionary explore we Here, x 27. = ele atropurpurea Pellaea ld CaeC i.5). Fig. C, (Clade clade aaynpei marantae Paragymnopteris x 9 aenme hrdwt h ugoptaxa outgroup the with shared number base a 29, = sa pmc fukonpod,tog t large its though ploidy, unknown of apomict an is .microphylla, A. nopse naryo euladapomictic and sexual of array an encompasses , .gracillima M. srlpswindhamii Astrolepis aurea Discussion ,hv ohsml ar n entire and hairs simple both have ), Cheilanthes ntelwrsrae fteulti- the of surfaces lower the on ) ,and .microphylla M. ru ‘u,Fg )adCae5. Clade and 5) Fig. (‘au’, group hc a nqebs number base unique a has which .microphylla A. .lendigera M. u eut ge ihearlier with agree results Our .windhamii A. yipei viscida Myriopteris aurea .intertexta M. ,hv ipehisand hairs simple have ), ,o aeol simple only have or ), ru ‘u,Fg ) and 5), Fig. (‘au’, group .s Fg ) u maxi- Our 1). (Fig. s. s. Myriopteris per ob exclu- be to appears .yavapensis M. and and and Myriopteris r l confirmed all are .scabra M. .marantae P. .atropurpurea P. , .rawsonii M. Myriopteris Myriopteris o which for (Grusz x nthe in 30. = have are ; , at qiaett ldswithin in “ or clades whole The in to herein. are, (1979) equivalent Reeves part, by identified groups four ru opie usto h aablnigt ld 1, Clade to belonging taxa the of sedis insertae subset his a exactly and comprises analysis, (1979)] our group Reeves in 2 by Clade name to corresponds formal a without subgenus the of One sedis. genus, distinct insertae a as considered recognized he ( taxa subgenera of group “ species World New to the divided assigned who (1979), pro- Reeves relationships by of posed of some hypotheses with agreement morphologically-based significant well- the is also no there is studies, ular there 2), Fig. studies. two clade, the ‘cc’ between conflict core supported reconstruction “ our our of of with equivalent placement odds at their by are (specifically (2011) portrayed al. relationships et other Eiserhardt some Although analyses. yipei lds(ldsA ,C i.2,o hc the which of 2), Fig. C, L, A, covillei (Clades clades myriopterid maximally-supported three depicts topology likelihood mum cl(evs17)adioyi Wnhmupb. analyses unpubl.) that (Windham reveal isozymic and 1979) (Reeves ical the (comprising 2 of Clade bulk to belonging the taxa All it. within included eebac oteotru aa eea pce therein species several morphological taxa; in greatest named outgroup originally the were the show A to Clade resemblance the of to Members sister A). as supported weakly Dvn. rs ida.Teeitneo uhcross- such of the that existence suggests The hybrids clade Windham. form & to Grusz repeatedly (Davenp.) hybridized have L) (Clade the hybridization between whereas occur clades, does two other the of members with the to ing of number base a show chromosomally emr lsl eae ooeaohrta ihri omem- to is either than the another of one bers to related closely more be other- but outgroup, pellaeid the from of absent wise most with shared state ett our to (equiva- well-supported subgroups lent their major three 2); comprises (Fig. clade myriopterid tree in those likelihood match maximum generally study, (2011) our al. our et in Eiserhardt relationships by phylogenetic included The presented were taxa. additional (2011) 22 al. with along et Eiserhardt of yses outspotfrorCae2 huhteconflicting the identical “ though nearly the 2, of and Clade species sequences of our arrangement for branching the Within support another. robust one to sister alabamensis as supported weakly also including lineages itrrltosi ewe h otenArcnendemic “ African endemic unexpected southern the the support “ also between and relationship 2) (Fig. sister tree our branching same in the pattern precisely show analyses their in included lswsmsdniid h orseiso the of species four The misidentified. was ples notholaenoides ta.(01 dniy“ identify (2011) al. et aurea hiate rawsonii Cheilanthes eodtentbecnrec ewe hs w molec- two these between congruence notable the Beyond l 8mrotrdseisicue ntemlclranal- molecular the in included species myriopterid 18 All steeris-iegn ao,i ulacr ihour with accord full in taxon, earliest-diverging the as ) and alabamensis .parryi C. .covillei M. alabamensis ld,teEsrad ta.(01 aae provides dataset (2011) al. et Eiserhardt the clade, Othonoloma alabamensis lanosa ntersuysget htoeo hi sam- their of one that suggests study their in ” Cheilanthes hiate alabamensis Cheilanthes alabamensis hiate alabamensis Cheilanthes Myriopteris .covillei M. .Wti the Within ”. lds(ldsCadL oehrare together L) and C (Clades clades tenmsk fCaeC and C) Clade of namesake (the n h ooa/oaeDesert Sonoran/Mojave the and ” clade. ld r o nw ofr hybrids form to known not are clade hiate bonariensis Cheilanthes , covillei ike .Cr)rcnl a been has recently Chr.) C. ex Link covillei nofu ugnr n fifth a and subgenera four into ” Pellaea ld)ta aebe analyzed been have that clade) and Fg ) ial,seisbelong- species Finally, 5). (Fig. and Gaga and , covillei rhv,a oepit been point, some at have, or .lanosa M. .newberryi C. lanosa covillei alabamensis L ta.21) h other The 2012). al. et (Li Myriopteris lanosa ru”[rae sa as [treated group” and n “ and ” lds Morpholog- clades. x (as lanosa ld,Eiserhardt clade, 9 character a 29, = lds,adthe and clades), ”(= Cheilanthes ihnthe within ” ld (Clade clade M. lanosa ldsmay clades sdefined as Myriopteris Cheilanthes x .parryi M. parishii clade )are Delivered by Publishing Technology to: Duke University IP: 152.3.102.242 on: Tue, 08 Jul 2014 01:26:34 Copyright (c) American Society for Plant Taxonomists. All rights reserved. pce norsuy nldn l ebr ftecore the of the members of members all derived more including the of study, subset covillei our limited a a in form to often species applies segments clearly ultimate “bead” develop- the the contracted that over such folding sporangia margins ing laminar having as genus of description inal 04 RS TA. HLGN FMROTRS709 MYRIOPTERIS OF PHYLOGENY AL.: ET GRUSZ 2014] intfdfod n ag,fa liaesget (pinna pinnate- segments linear, ultimate flat its large, lobes), With and fronds margins. pinnatifid segment the Tryon in and unrecurved included Tryon been of had work generally genus the species two to these Prior (1982), study. this of results the of branches of positioning owne htteueo hscaatra h rmr diag- primary the as of character feature this of nostic use the that as wonder no such genera cheilanthoid Notholaena related distantly other, than several to fewer assigned in here species present the are half segments ultimate bead-like scale, evolu- the group. during the twice of just segments tion arisen par- has this ultimate state that character appears bead-like ticular it of phylogeny, well-sampled distribution our across the on Based 17)ldt h eonto fptnl non-monophyletic patently of recognition the to led (1875) plus eog otegenus the to belongs h core the the of hsgopn nldsfv pce htapa noranal- our in appear unpubl.). that al. species yses: five et cheilanthoid includes Windham grouping the 2011; This across al. dispersed et taxa widely (Eiserhardt representative phylogeny be 12 to containing known “ diverse, now (1982) most Tryon’s and and largest Tryon 2). Fig. of exception the with And, are and of genus, species that of to American species related feei, type South closely C. the not the leucopoda, include C. which 1) kaulfussii, C. are: viscida, lanosa, C. C. cooperae, C. species American South the of of most subgeneric includes polyphyletic subgenus “this patently subgenus only his the is construct and core 2), our Fig. to (‘cc’, corresponds exactly Baker Presl) (C. (= the With clade. myriopterid the of to exception belonging species tain Cheilanthes our 2). with (Fig. congruent clade largely is species) American South subg. (incor- subgenus called fourth (1979) rectly Reeves’ taxa, these of removal to sister is which ru, nldsol ebr ftecore the of the members only includes of group,” representatives the of member another as list they species “ the Moore], .microphylla C. ept hi paetsaiiyo oa phylogenetic local a on stability apparent their Despite L ro n ro 18)dvddteAeia aaof taxa American the divided (1982) Tryon and Tryon Cheilanthes .aurea M. EAF yipei wrightii Myriopteris .feei C. lanosa .aurea M. ld ‘c,Fg A swl as well as 3A) Fig. (‘cc’, clade U Notholaena covillei LTIMATE and and .l no1 nomlgop,treo hc con- which of three groups, informal 11 into l. s. ,and ), (= .regularis C. ld;teohrtoaesqetal itrto sister sequentially are two other the clade; oehrwt h ot American North the with together Cheilanthes .gracilis M. .longipila C. ld ‘c,Fg 2). Fig. (‘cc’, clade .aurea M. ru”albln othe to belong all group” tnsi tr otatt Fe to contrast stark in stands covillei S Myriopteris EGMENTS Notholaena .newberryi C. eas fterpol differentiated, poorly their of because Cheilanthes Myriopteris Gaga alabamensis ld) soeo h otsurprising most the of one is clade), Myriopteris et [= Mett. Cheilanthes ), Telte idn ie h robust the (i.e. finding latter —The Fg ) i subgenus His 2). (Fig. and L ta.21) n 3) and 2012); al. et (Li .s Wnhme l nul) tis It unpubl.). al. et (Windham s. s. ”Tedsodn lmnshere elements discordant The .” .lns,C parryi C. lanosa, C. .horridula C. Rtfl ta.20) ihthe With 2008). al. et (Rothfels ybt Fe both by lanosa h is he r members are three first The . i hrceiaino the of characterization His . .newberryi M. olwn lmnto fthe of elimination following Myriopteris, datpi regularis Adiantopsis ld) hi “ their clade), ;2) evs(99 7 stated 47) (1979: Reeves . ld CaeL i.3A). Fig. L, (Clade clade .fraseri C. .gracilis M. (= ´ .kaulfussii C. 15)adSmith and (1852) e yipei scabra Myriopteris alabamensis covillei n loocrin occur also and ´ steearliest the as ’ 15)orig- (1852) e’s , ru”i the is group” .myriophylla C. .bonariensis C. covillei .leucopoda C. n fthe of one , Cheilanthes Physapteris ld (‘cc’, clade .parryi, C. which , (Mett.) clade. lanosa clade , , , ahssa neednl eie rmgovdrcie in terete rachises view grooved to from tempting derived is the it independently maximum 3B, as the Fig. rachises in on shown Based the tree distally. likelihood of grooved branches shallowly two become first ( the clade and adaxially, grooved the of ( members clade early-diverging including 3B), 2011), (Fig. al. rachises et Link-Perez 1984; Myriopteris Anthony (e.g. cheilanthoid several genera in character taxonomic valuable a furnishes is eotdb hry(96 n eteb 12)based (1926) Weatherby of and observations (1926) on non-circinate Wherry or by reported circinate vari- first was vernation condition imperfectly non-circinate cheilanthoids, a as Among shape, vernation. to “hook” referred a in ously expand fronds young verna- circinate 1962); [e.g. as (Mickel ferns shape known “fiddlehead” Some also or fronds, tion. coiled unfurling the young, is of ferns of features logical o-icnto ento n1 diinlseishere species additional to belonging cies 14 in in included vernation non-circination eatonii C. opisfrwl-upre lds vlto findument of Evolution clades. well-supported certain synapo- for phylo- with providing morphies thereof) a combinations molecular 4B–C), also (or types (Fig. is indument our character type identification informative onto for indument genetically crucial that data being illustrates indument to phylogeny addition mapping Grusz 1979; In (Reeves purposes, 2009). hybrids in al. additive be et to charac- the tend and states the species, ter on among scales widely 1982; and/or vary hairs surfaces pres- Tryon laminar of The distribution 2004). and and Smith absence, and Tryon ence, Mickel 1993; 1979; Rabe and (Reeves Windham among species ferns identifying myriopterid for feature morphological useful lcmn of placement ce ttsaogteotrusmksi mosbet draw time. to this impossible at derived it conclusions are makes firm outgroups any rachises the among terete states that spora acter the indication but homoplastic), an (and be might the of eny branches diverging flattened early and on grooved rachises of concentration the Similarly, scenarios. CaeA n l ebr fthe of members all and of A) (Clade exception the taxa, with ingroup of majority the characterizes 3C), to Fig. outgroups, unique not while of docu- vernation, species Non-circinate remaining we all observations, in type these vernation mented augment To vernation. coiled core the to sebae fseis(e rs n ida 03.The 2013). Windham of and Grusz taxa (see species of assemblages ao yipei lds(ldsA ,adC,confirming ferns. systematic C), cheilanthoid useful among character and a is vernation L, that three hypothesis A, (1979) the Reeves’ (Clades of each clades within myriopterid conserved major be to appears type nation agn ihwl-ifrnitd as nui n others and indusia. false indusia lacking essentially margins false plane showing well-differentiated, with recurved exhibiting segments taxa flatter margins some elongate, with more diverse, otherwise have are all but total) the of 60% (ca. L L L EAF EAF EAF alabamensis .viscida M. .wrightii M. R V I Myriopteris NDUMENT ACHISES ERNATION (= hl otseiso h eu xii terete exhibit genus the of species most While . covillei Myriopteris .rufa M. .wrightii M. Pteris ld,bttelwsaitclspotfrthe for support statistical low the but clade, Tesaeo efrcie ncross-section in rachises leaf of shape —The and Cheilanthes La nueti rubytemost the arguably is indument —Leaf Oeo h otcaatrsi morpho- characteristic most the of —One ld c’ i.3)hdhoe ahrthan rather hooked had 3C) Fig. ‘cc’, clade ld )hv ahssta r deeply are that rachises have 1) Clade + hiate tomentosa Cheilanthes ,rsetvl.Kolc 16)observed (1965) Knobloch respectively. ), htlc edlk liaesegments ultimate bead-like lack that Kolc 95]dfe nhvn their having in differ 1965)] (Knobloch .cooperae M. n evs(99 ttdta l spe- all that stated (1979) Reeves and , Ophioglossum .wrightii M. Fg )alw o te evolutionary other for allows 2) (Fig. subgenus i itiuino hs char- these of distribution dic aefatndrcie that rachises flattened have ) lanosa nthe in Ems1936); (Eames Physapteris (= ld CaeL.Ver- L). (Clade clade Myriopteris .tomentosa M. alabamensis Myriopteris Myriopteris. (equivalent alabamensis phylog- Anemia lanosa )and clade (see Delivered by Publishing Technology to: Duke University IP: 152.3.102.242 on: Tue, 08 Jul 2014 01:26:34 Copyright (c) American Society for Plant Taxonomists. All rights reserved. ae normxmmlklho hlgn Fg Band but, 4B (Fig. polarity phylogeny character likelihood establish maximum not of our tri- on does uniseriate existence based species continuum The of group. a evolution this the in of exclusive scales the multiseriate from among for chomes argue trichomes to ‘cc’) “skeletonized simple called “ to (herein trichomes scales”) branched in to distinctive scales quite are completely. scales types intergrade except skeletonized they 3 indument theory, Clade or the of these 5) of species Clade Although (all species of scales six ciliate entirety and (in simple the scales plus either the clade entire involve on and occurs admixtures two also hairs These of of which surfaces. combinations of surfaces one exhibit adaxial abaxial types, species The indument ingroup scales. different mixture 17 entire a other and show the hairs abaxial the simple whereas of glabrous are surfaces aiybtenupradlwrsrae sosre in observed is surfaces dis- lower greatest cucullans and The M. upper scales. between entire rare, parity producing surfaces ial 1 YTMTCBTN Vlm 39 [Volume BOTANY SYSTEMATIC 710 ihrsett h w ufcs(..a with as (e.g. surfaces two the involve Hu to may respect regulation/expression, phenotypes differential that with as observed well than 1979). as the Reeves genes, complex) multiple 4C; that and more suggests 4B Figs. cases, This (compare with surfaces those adaxial accord in of in (and, is different (1936). hairs) Eames by simple general in ferns from for proposed struc- derived hypotheses scale-like multiseriate, are even tures and here hairs advance branched on we 3 that lost (that scenario are Clade evolutionary glabrous often The all leaves. these truly older though of scales, the leaves skeletonized young from scattered the (aside based that is species 4B observations Fig. segments. in our shown ultimate on indument the adaxial of of surfaces recoding upper Our the on glabrous as bxa ufcso h liaesget.Ti includes This segments. the to ultimate and belonging adaxial the taxa the seven of 40) on of type surfaces (20 indument taxa abaxial same ingroup the sampled basically the differences have half profound) exactly sometimes density, (and in pervasive aside ting In aurea the of ute hnefo kltnzdsae on indument except 3, no Clade to of members scales one skeletonized and (in from 3), Clade change for further synapomorphy (a scales skeletonized n hnefo ipet rnhdhis(ntebranch the (on hairs branched to to simple leading from change the within one from (all indument transitions no to this independent hairs form, simple three simplest involve its would In 4B). scenario the (Fig. on tree based likelihood changes) than maximum character-state parsimonious seven more vs. (six slightly glabrous is simple Hairs indument. seti h lsoopi dxa hrce tt for state to character difficult early- it adaxial the makes plesiomorphic as Myriopteris ingroup, the well the as ascertain of outgroups, branches among diverging Neverthe- more states variability types. is different character less, of segments fewer amalgamation no ultimate are and there the involved because of understood surfaces easily adaxial the on Cheilanthes ¨ evs(99 sdteaprn rniinfo ciliate from transition apparent the used (1979) Reeves h nueto bxa ufcsin surfaces abaxial of indument The .fendleri M. sapadShite 98 zmnk ta.20) Set- 2000). al. et Szymanski 1998; Schnittger and lskamp .fendleri M. ld ‘u)and (‘au’) clade lanosa hc ol eete ipehiso akof lack a or hairs simple either be could which , .rawsonii M. subgenus lbosaailsrae otatwt abax- with contrast surfaces adaxial glabrous , ld n ld ,pu h w pce fthe of species two the plus 4, Clade and clade and .W oehr htRee 17)soe all scored (1979) Reeves that here note We ). .notholaenoides M. ,oetasto rmsml ar to hairs simple from transition one ), Physapteris .newberryi M. .gracillima M. alabamensis orcore (our ” nwihteadaxial the which in , Fg.4 n 4C). and 4B (Figs. Myriopteris ld,almembers all clade, alabamensis .fendleri M. and covillei .intertexta M. .fendleri M. Arabidopsis alabamensis soften is have ) clade), clade; ). ; , a o nueti h ees fta rpsdby proposed that the and of (‘au’) of clade branches reverse aurea the diverging the (i.e. early clade The is path- (1979). evolutionary indument Reeves dominant for the that way hypothesize we 4C), ino rcoe ncelnhi en eevs(further) Myriopteris— deserves ferns cheilanthoid in we deriva- analysis.” and critical trichomes particulars, nature “the of some that in tion on 27) (1979: Reeves disagree some with likely concur in we seems hairs simple Although also are from it lineages. directly they evolved tree, scales phylogenetic entire from where our that the derived species, on entire Based ultimately, on as same and, scales. scales occur 3 these ciliate to transitional scales Clade of completely in skeletonized surfaces species Identical abaxial sur- all hairs. adaxial the nearly simple on we of Therefore, many found 5). do scales faces and as skeletonized 4 4B), (Clades the species (Fig. interpret derived surfaces more adaxial the the of on hairs simple sigsbsoisivligtegorpy aetg,and parentage, geography, inter- the multiple involving illuminate sub-stories of also well-supported esting patterns findings broad-scale this our these diversification, within Beyond group. characters monophyletic cytological, reproductive morphological, several and of us evolution allows the and assess taxa genus, to recircumscribed disparate newly morphologically this in the included among relationships diversifi- of species of genus the patterns in elucidate cation to data sequence ular pce fCae2hvn h hoooebs number base chromosome the x having 2 x Clade of species rvln mn pce of species among are prevelant polyploidy) (i.e. genome-duplication whole and apomixis pattern This (2012)]. Zhang and often in He true numbers 1990); holds base in (1971, [e.g. different informative in Smith phylogenetically occur where be to to genera known prove is large variation fern such some related 1974), closely (Britton among species uncommon relatively is number ( numbers (2003), eaieysml eei n/revrnetlcontrols. environmental involve and/or may genetic fre- transition simple this so, relatively that indicate Even across tree reproduction gametes). myriopterid apomictic the to of sexual a fusion from from switches the than quent via (rather tissue produced diplospores somatic zygote from of sporophytes production of the tion ( in haplospores than results rather preced- that endomitosis meiosis) an to ing (owing 1989): meiosis Windham non-reductive and (Gastony a cycle 1) life the of in parsi- origins changes major simple independent nine on least within Based predominate apomixis at generally taxa. hypothesize polyploids sexual diploids we apomictic the mony, that sexual among and nested 5, reveals are Clade phylog- that but apomictic; our all with 5B) to in congruent is (Fig. sexual This 2012)]. eny (2011, [from al. et unidirectional Beck should effectively mode circum- reproductive these be in Given the changes triploid). in evolutionary (mostly apomicts stances, known polyploid these all are and 1981), genus linked, Grant closely 1950; are (Stebbins processes lineages plant apomictic 9adalohrigopseissuidt aehaving date to studied species ingroup other all and 29 = 0(i.5A). (Fig. 30 = yoeei n erdcieVraiiywithin Variability Reproductive and Cytogenetic nadto ovraini hoooebs ubr both number, base chromosome in variation to addition In idnso Note— of Findings Myriopteris x 9and 29 = sdcmne yWnhmadYatskievych and Windham by documented As Myriopteris Myriopteris Myriopteris pce xii w hoooebase chromosome two exhibit species u td tlzstepwro molec- of power the utilizes study Our x 0.Atog aiblt nbase in variability Although 30). = n ihalctgntclystudied cytogenetically all with , =2 pmxsi en eurstwo requires ferns in Apomixis . Myriopteris tpoie nipoe view improved an provides It . n ;ad2 h ioi produc- mitotic the 2) and ); .newberryi M. swt otother most with As . )haveonly Thelypteris covillei ; Delivered by Publishing Technology to: Duke University IP: 152.3.102.242 on: Tue, 08 Jul 2014 01:26:34 Copyright (c) American Society for Plant Taxonomists. All rights reserved. 99,hsaie hog eurn yrdzto between hybridization Soltis lineages. recurrent parental and distinct through Soltis genetically (see arisen date has to studied 1999), hybrids of that majority suggest the results These 2). (Fig. analyzed lendigera M. by represented lineage lendigera tetraploid M. the of two progenitor that maternal to other sampled similar the genotype the a to that of infer sister we this is From collections. that clade (97/1.0) of sample available only al upre oohltcgop(ld ) ihthe with tetraploid mexicana 4), M. of (Clade accessions group maxi- a four monophyletic constitute taxa supported three these mally 2), (Fig. tree phylogenetic td n hr sn la egahco opooi dis- morphologic following or dataset. geographic current the clear divergence in no evident tinction is there substantial and uted, of or clades Both either polyploidization. origins suggesting of 2), Fig. samples (‘au’, multiple clades sister five divergent highly the the of aurea Interestingly, progenitor M. sexual apomict. these relictual sporangium; widespread a per represent spores 64 highly-localized presumably few, produce a that identified has populations (unpubl.) work al. recent et triploid, Beck apomictic by an as only known Previously n oa 95 htteSuhAeia endemic American South the that taxon 1995) moritziana M. Moran and Yatskievych (e.g. hypotheses morphologically-based previous erpodseisaoetruhhbiiainbtenthe between diploids hybridization through sexual arose species tetraploid 93 ro 96,wt ag xedn rmtesouth- the from extending Hispan and range A. S. a U. with western 1986), Tryon Tryon and 1973; (Tryon ferns cheilanthoid distributed widely most as 04 RS TA. HLGN FMROTRS711 MYRIOPTERIS OF PHYLOGENY AL.: ET GRUSZ hope we that findings notable these research. further of inspire will few briefly we a Here, taxa. highlight particular of distinctions species-level 2014] hssuyi h orbrto feiec u ot by forth African put southern the evidence of inclusion of for endemic corroboration (2011) al. the et Eiserhardt is study this ags ae norcut fsoenme e sporan- 5B). Fig. per 1; number (Table unknown spore remains of counts respective our their gium, in on habitats Based desert ranges. inhospitable most driest, lmn nArcnfoa n nhn 18)ntdta its that other noted any Mexico. of (1984) those Anthony adjacent unlike are and and spores flora, African A. in S. element U. rawsonii southwestern Myriopteris the to to fined sister as deeply supported is mally World, the New the within outside nested occur to known group the yipei clade. myriopterid oe efsrae r nqe ti neetn ont that note to interesting species between sister is similarities in ecological It anomalous are unique. there are less surfaces no leaf lower seems species Myriopteris the However, nent. M M M M hiate bonariensis Cheilanthes ROTRSMORITZIANA YRIOPTERIS LENDIGERA YRIOPTERIS AUREA YRIOPTERIS RAWSONII YRIOPTERIS .microphylla M. .rawsonii M. nlddi u nlss(l pmci)fr two form apomictic) (all analysis our in included hiate rawsonii Cheilanthes hr h rnhdhiso h pe and upper the on hairs branched the where , w cesosof accessions Two . n .Hwvr h w otenacsin of accessions northern two the However, 2. and 1 3ad4 r ihydvreta h lsi loci plastid the at divergent highly are 4) and (3 .parryi M. scoeyrltdt h iernigCaribbean wide-ranging the to related closely is .marsupianthes M. .mexicana M. per ob eul u t liylevel ploidy its but sexual, be to appears lanosa yipei rawsonii Myriopteris Ti pce,koni h literature the in known species, —This a ogbe osdrdadisparate a considered been long has Cae2 i.2.Teeaesbl but subtle are There 2). Fig. 2, (Clade Oeo h otsrrsn eut of results surprising most the of —One hs w pce cuysm fthe of some occupy species two these ; Ree 17)pooe htthis that proposed (1979) —Reeves .mexicana M. Ormlclrrslsconfirm results molecular —Our ld L i.2 hr ti maxi- is it where 2) Fig. (L, clade or ˜ l ot oAgniaadChile. and Argentina to south ola .parryi M. ohleaaurea Notholaena niiulfntoe sthe as functioned individual .lendigera M. .lendigera M. (= .aurea M. and .rawsonii M. Cheilanthes omawell-supported a form euldpodcon- diploid sexual a , h nymme of member only the , .mexicana. M. .rawsonii M. r ieydistrib- widely are 1ad2 n the and 2) and (1 .lendigera M. aahltcto paraphyletic soeo the of one is , ihnthe within ) nta conti- that on .lendigera M. n its and nour In like , ek .B,M .Wnhm n .M re.21.D sxa polyploids asexual Do 2011. Pryer. M. K. and Windham, D. M. B., J. Beck, of Identifying 2012. Windham. species D. M. African and Pryer, M. southern K. Allison, J. of B., J. revision Beck, A 1984. C. N. Anthony, as well 1110767). as (NSF-DDIG Taxonomists Grant, Grant Improvement Research Plant Dissertation Student Doctoral of Graduate NSF Society an Graduate Graham Biologists Alan American Systematic and the for Shirley Society Award, a by Research support provided to Research Student was author. awarded G. first disser- L. 0717430 the 0717398 doctoral by A. a NSF-DEB University to NSF-DEB of and Duke fulfillment at by W., partial Biology in in D. part completed tation M. was in study and This P. provided Y. G. M. was K. project to manuscript. the awarded on this comments M. helpful for E. for Burge, Rothfels Funding O. J. D. C. phy- and to to Li, appreciation pertaining F.-W. our Sigel, advice to extend useful also contributions for We their Johnson analyses. for G. logenetic Schuettpelz M. and E. work, and laboratory Rothfels reproduce publication, J. to loans. us C. their Smith, expediting allowing acknowledge R. from for A. generously Press and drawings Garden Mickel for Botanical line J. York P authors New Fukuda, of The H. and illustrator Rouhan and to Mynssen G. YU. also Fe C. and Thanks of to images specifically UT, high-resolution also US, staff, obtaining UNM, help curatorial specimens; their UC, including: RB for P, Forrza, the herbaria, C. NY, to R. several MO, grateful K, by are JEPS, supplied We GH, Voucher was DUKE, material. B, project voucher ASU, this and DNA for obtaining material assistance for Rothfels ek .B,M .Wnhm .Ytkeih n .M re.21.A 2010. Pryer. M. K. and Yatskievich, G. Windham, D. M. B., J. Beck, hi dnia eune ttetremtral inherited maternally three the analyzed. at loci despite sequences species separate identical as entities their two tenta- these we maintain involved, tively disparities cytogenetic polyploid and reproductive of progenitor that diploid hypothesize we and evidence, Based this (1966)]. (1967) al. on et Knobloch Mickel in in triploid apomictic (1966); tetraploid Walker [sexual exclu- polyploid are counts sively chromosome available unpubl.). the and (Windham spores larger taxa diploid microphylla sexual Myriopteris documented related those approximate closely sizes in spore that sporangium) reveals per spores and 64 about produces (i.e. sexual is taxon of isolectotype of Examination an however. two, the between differences critical esnti,J 93 aiu ieiodadmnmmsesmethods minimum-steps and likelihood Maximum 1973. J. Felsenstein, iehrt .L,J .Rhe,S .Rsel .C eiyr,adH. and Yesilyurt, C. J. Russell, J. S. Rohwer, G. J. L., W. Eiserhardt, ferns. 271–304. in Pp. 1936. numbers J. chromosome A. Eames, of significance The 1974. M. D. Britton, Fe ´ ,A .A 82 p i,[]37 38 ot] .I–30, t. cont.], [388, [I]–387, [i], Pp. 1852. A. L. A. e, Acknowledgments. edsoteouinr ie?Acs td rmtefern the from study case A lives? evolutionary genus short lead hybrid the of Botany study ( multilocus fern a taxa: cloak polyploid of origins multiple barium Cheilanthes li vlto ntefr genus fern the in poly- evolution interpreting ploid and delimitation species to approach diploids-first o siaigeouinr re rmdt ndsrt characters. discrete on data from Biology Systematic trees evolutionary estimating for fils. et Berger-Levrault 5] Foug. cnie.21.Eiec o aitoso hiatodfrsi the in ferns Region. cheilanthoid Floristic of Cape radiations Greater for Evidence 2011. Schneider. McGraw-Hill. London: and York New Garden Botanical Missouri the of Annals Botany iiu.Epsto e ersd a ail e Polypodiace des famille las de fouge genres des Exposition filicum. ` e) .(Cinquie . res). Astrolepis 9 1857–1865. 99: 5 223–234. 35: 1 1–293. 11: ai:J .Bailie B. J. Paris: . wrzand Swartz srlpsintegerrima Astrolepis . Evolution .moritziana M. 2 240–249. 22: ` eme me etakR oa,A .Sih n .J. C. and Smith, R. A. Moran, R. thank We nteohrhn,hssignificantly has hand, other the on , ieaueCited Literature Pellaea ´ or u afmledsfouge des famille la sur moire opooyo aclrpat.Lwrgroups Lower plants. vascular of Morphology 5 3217–3229. 65: ` e itrMso.Srsor:Veuve Strasbourg: Masson. Victor re, Taxon Link. Pteridaceae). ; Astrolepis rmG niae htthis that indicates GH from h trdpye fMexico of Pteridophytes The .microphylla M. 6 1–15. 26: otiuin oteBlsHer- Bolus the to Contributions 1 310–317. 61: .mortiziana M. (Pteridaceae). mrcnJunlof Journal American 7i,2tr Genera 27ter. 27bis, ` e)[Me res) ie the Given . ´ s(lsedes (Classe es a ea be may Systematic ´ ´ ’ type e’s .Fam. m. .We . Delivered by Publishing Technology to: Duke University IP: 152.3.102.242 on: Tue, 08 Jul 2014 01:26:34 Copyright (c) American Society for Plant Taxonomists. All rights reserved. ikl .T n .R mt.2004. Smith. R. genus A. and fern T. the J. of Mickel, study monographic A 1962. phylogenetic T. for J. Testing Mickel, 1996. Kellogg. A. E. and J. R. Mason-Gamer, adsn .R n .P adsn 05 aCae4 Analysis 4: 1950. MacClade I. 2005. Manton, Maddison. P. W. and R. D. Maddison, 39 [Volume BOTANY SYSTEMATIC 2013. L. A. Grusz, pterido- 1981. in V. concepts Grant, Species 1989. Windham. D. M. and J. G. Gastony, (Pteridaceae: ferns Cheilanthoid 1998. Rollo. R. D. and J. Indian G. of Gastony, summary A 2009. Dulawat. S. C. and R. C. Fraser-Jenkins, 712 abu,A n .Dumn.20.Tae,vrin150 Available 1979. 1.5.0, T. version Tracer, Reeves, 2005. Drummond. A. and A. Rambaut, Avent, T. Rothfels, J. C. Grusz, L. 2007. A. Huiet, Salatino. L. Schuettpelz, F. E. L. M., K. M. Pryer, and Salatino, A. Rodriguez, N. D. C. J., Prado, CIPRES the “Creating 2010. Schwartz. T. and Pfeiffer, W. observa- A., Chromosome M. 1966. Miller, Chen. L. K. and Wagner, H. W. T., J. Mickel, rs,A .adM .Wnhm 03 oadamonophyletic a Toward 2013. Windham. D. M. and L. A. Grusz, rs,A . .D ida,adK .Pyr 09 eihrn the Deciphering 2009. Pryer. M. K. and Windham, D. M. L., A. Grusz, ikarc,R .B 07 netgtn h oohl of monophyly the Investigating 2007. B. E. R. 2012. Kirkpatrick, Pryer. M. K. and Windham, D. M. Rothfels, J. C. K., A. Johnson, within Hu delimitation generic Exploring 2012. Zhang. X.-C. and L.-J. He, nboh .W 95 ento nsm pce ftegenus the of species some in Vernation 1965. W. I. Knobloch, rmr .U,R .Tyn n .F ro.1990. Tryon. F. A. and Tryon, M. R. U., K. Kramer, in numbers Chromosome 1967. W. I. Knobloch, ikPrz .A,L .Wto,adR .Hce.21.Redefinition 2011. Hickey. J. R. and Watson, E. L. A., 2012. M. Windham. Link-Perez, D. M. and Pryer, M. K. F.-W., Li, ¨ sap .adA cntgr 98 pta euaino trichome of regulation Spatial 1998. Schnittger. A. and M. lskamp, University. genus (Gramineae). Triticeae tribe Biology the Systematic in sets data molecular among conflict Press. University Cambridge Cambridge: fpyoeyadcaatreouin eso .8 Sunderland: 4.08. version evolution, character Associates. Sinauer and phylogeny of species. agamosporous of definition and Journal Fern treatment American the phytes: adjacent and lines. 131–144. generic States 17: of reassassment United phylogenetic molecular southwestern a Mexico: the in Cheilanthoideae) India. to new genus of 216–229. fern discovery Afro-Arabian the an and ferns cheilanthoid Physapteris http://beast.bio.ed.ac.uk/Tracer. from trade. a horticultural exposes fern barcoding the DNA in Resources 2010. identity Ecology Windham. mistaken D. of M. case and Swartz, D. Brazilian including from inferred Pteridaceae, species, among relationships Phylogenetic Envi- Computing Work- Gateway Environments Louisiana: Workshop. Orleans, Computing ronments New Gateway 1–8 Pp. (GCE). the trees” shop of phylogenetic large Proceedings of in inference for Gateway Science Mexico. of ferns the on tions Press. Garden Botanical York New The Cheilanthes villosa Cheilanthes rgn faoitcplpod nthe in polyploids apomictic of origins (Pteridaceae). Peiaee ntecneto hlgntcaayi fcheilanthoid of analysis phylogenetic ferns. a of context the in (Pteridaceae) gametophytes (Pteridaceae). 1118–1124. the ferns on character notholaenid sporophytic of a of expression Unique 213–220. in formation 757–764. 65: Thelypteridaceae. family fern the (Pteridaceae). Llavea Journal Fern American n biogeography. and of 845–860. 37: from segregated genus Springer-Verlag. Berlin: Green. S. P. and in 241 Adiantopsis ytmtcBotany Systematic h aiisadgnr fvsua plants vascular of genera and families The and Coptophyllum ln speciation Plant h eurcinadrcrusrpinof recircumscription and resurrection The : Polypodium (Adiantaceae) rbeso yooyadeouini h Pteridophyta the in evolution and cytology of Problems oorp ftefr genus fern the of monograph A rbdpi thaliana Arabidopsis Phytokeys mrcnJunlo Botany of Journal American yipei windhamii Myriopteris Fe 0 979–985. 10: (Pteridaceae). 5 524–545. 45: ´ Taxon . Peiaee:Sseais diversification, Systematics, (Pteridaceae): e oaSaeJunlo Science of Journal State Iowa 9 65–77. 79: 5 113–116. 55: . rbcL mrcnJunlo Botany of Journal American 2 504–518. 32: 2 49–64. 32: Cheilanthes h .dsetto,Tme rzn State Arizona Tempe: dissertation, D. Ph. . e ok oubaUiest Press. University Columbia York: New . 0 1255–1268. 60: sequences. Caryologia h trdpye fMexico of Pteridophytes The mrcnFr Journal Fern American oeua hlgntc n Evolution and Phylogenetics Molecular . eladDvlpetlBiology Developmental and Cell (Pteridaceae). mrcnJunlo Botany of Journal American hiate yavapensis Cheilanthes Taxon 9 85–94. 19: p o. e aefor name new a nov., sp. 6 1636–1645. 96: Negripteris 6 355–368. 56: o.,es .U Kramer U. K. eds. vol.1, hiate,Notholaena, Cheilanthes, Cheilanthes h enGazette Fern The Cheilanthes 6 4–482. 349– 36: 4 6–464. 461– 54: Gaga ytmtcBotany Systematic 0:112–117. 103: (Pteridaceae), e fern new a , Anemia e York: New . Cheilanthes Myriopteris p 240– Pp. . Molecular subgenus complex Pellaea sub- , Aliso 18: 99: 9: . . ohes .J,M .Wnhm .L rs,G .Gsoy n .M. K. and Gastony, J. Bayesian G. Grusz, 3: L. A. MrBayes Windham, D. 2003. M. J., Huelsenbeck. C. Rothfels, P. J. and F. Ronquist, ro,R .18.Teboegah fseis ihseilreference special with species, of biogeography The 1986. M. R. Tryon, tbis .L 1950. L. G. Stebbins, cutpl,E,H cnie,L ue,M .Wnhm n .M Pryer. M. K. and Windham, D. M. Huiet, from L. inferred Schneider, H. phylogeny E., Schuettpelz, Fern 2007. Pryer. M. K. and E. Schuettpelz, ro,R .adA .Tyn 1982. Tryon. F. A. and M. R. Tryon, evolutionary and spores, Geography, 1973. Tryon. F. A. and M. R. Tryon, the in Progress 2000. Marks. D. M. and Lloyd, M. A. B., D. Szymanski, mt,A .19.Teytrdca.P.2322in 263–272 Pp. Thelypteridaceae. 1990. R. A. Smith, ots .E n .S ots 99 oyliy eurn omto and formation Recurrent Polyploidy: 1999. Soltis. S. P. and E. D. Soltis, 1875. J. Smith, of species World New some M. of numbers K. Chromosome 1971. and R. A. Yatskievych, Smith, G. Huiet, L. Windham, D. M. M., E. Sigel, akr .G 96 yoaooi uvyo h trdpye of pteridophytes the of survey cytotaxonomic A 1966. G. T. Walker, hry .T 96 bevtoso h olylipfern. woolly the on Observations 1926. T. E. Wherry, ferns. in vernation circinate Imperfectly 1926. A. C. Weatherby, asivc,G n .C oa.1995. Moran. C. R. and G. Yatskievych, ag .adB anl.19.Bysa hlgntcifrneusing inference phylogenetic Bayesian 1997. Rannala. B. and Z. Yang, B. J. Rothfels, J. C. Grusz, L. A. Schuettpelz, E. Huiet, L. D., M. Windham, ida,M .adG asivc.20.Crmsm tde of studies Chromosome 2003. Yatskievych. G. and D. M. Windham, 1993. Rabe. E. and D. M. Windham, hn,Z . .Lu n .Yn.20.Frtisgt ntephylogeny the in insights First 2007. Yang. W. and Liu, H. C., Z. Zhang, wcl .J 2006. J. D. Zwickl, #soagasuid pr ubrprsoagu bevdfreach for observed sporangium per number spore pub- studied) previously for sporangia for existing) (# Acro- citations if (with (Herbarium sequences, numbers number lished accession collector GenBank and nym); collector Voucher duke.edu), Appendix re.20.Twr monophyletic a Toward 2008. Pryer. models. mixed under 1572–1574. inference phylogenetic oferns. to vrl eainhp n h fiiiso rvosyunsampled previously of affinities the genera. and assessing relationships Pteridaceae: family fern overall the of phylogeny molecular A 2007. genes. plastid three and 1037–1050. species leptosporangiate 400 xeric-adapted in convergence evolutionary ferns. of patterns resolving oaia ora fteLnaa Society Linnaean the Press. Academic of Journal Botanical in 145–153 ferns Pp. of ferns. classification cheilanthoid the in relations morphogenesis and initiation in trichome of analysis genetic molecular Press. University Columbia eeec otoia America tropical to reference eoeevolution. genome Springer-Verlag. Berlin: Kubitzki. plants K. vascular of the in Thelypteris evolution farina and 554–564. 36: relationships genus fern Species cheilanthoid 2011. Pryer. Jamaica. Journal Journal Fern N eune:aMro hi ot al method. Carlo Monte Evolution Chain and Markov Biology a sequences: DNA and plastid ferns. Using cheilanthoid demys- 128–132. and in 99: 2009. boundaries complexes Pryer. generic species redraw M. tify to K. sequences DNA and nuclear Yatskievych, G. Beck, hiatodfrs(trdca:Celnhiee rmtewestern Mexico. the and from States United Cheilanthoideae) (Pteridaceae: ferns cheilanthoid Press. University Oxford York: New Mexico Committee. of Editorial north America North fAincelnhi en ae nsqecso two of sequences on based ferns cheilanthoid markers. chloroplast Asian of nvria ainlAuto Nacional Universidad Mesoamericana flrebooia eunedtst ne h aiu ieiodcrite- likelihood maximum the under datasets rion sequence biological large of Arabidopsis h .dsetto.Asi:TeUiest fTxsa Austin. at Texas of University The Austin: dissertation. D. Ph. . Taxon 6 107–109. 16: oeua hlgntc n Evolution and Phylogenetics Molecular oaia Review Botanical .TxnFr N aaaenme (fernlab.biology. number Database DNA Taxon—Fern 1. rnatoso h oa oit fEdinburgh of Society Royal the of Transactions itraFilicum Historia . Brittonia 6 109–111. 16: 7 712–724. 57: . eei loih prahsfrtepyoeei analysis phylogenetic the for approaches algorithm Genetic o.1 d.R oa n .Rb.Mxc City: Mexico Riba. R. and Moran R. eds. 1, vol. , rnsi ln Science Plant in Trends o.1 trdpye n ynsem.Ed. Gymnosperms. and Pteridophytes 1. vol. , d.JryA . .A rbe n .A Thomas. A. B. and Crabbe, A. J. C., A. Jermy eds. . rnsi clg Evolution & Ecology in Trends aito n vlto nplants in evolution and Variation 3 354–360. 23: Taxon 4 717–724. 14: Argyrochosma odn amla n Co. and Macmillan London: . 2 117–156. 52: e ok Springer-Verlag. York: New . mrcnJunlo Botany of Journal American ´ 6 369–378. 56: oad Me de noma rGtn;ap;rbcL atpA; trnG–trnR; o.2 d.Foao ot America North of Flora eds. 2. vol. , Cheilanthes en n lidpat,wt special with plants, allied and Ferns Cheilanthes :214–219. 5: (Pteridaceae). ´ xico. 7(up.1.NwYork: New 1). (Suppl. 67 Notholaena p 5–6 in 152–169 Pp. . 4 1172–1185. 44: p 2–2 in 121–128 Pp. . mrcnFr Journal Fern American h aiisadgenera and families The 4 348–352. 14: Bioinformatics h hlgn and phylogeny The ytmtcBotany Systematic 6 169–237. 66: i htorder); that (in 0 1788–1800. 90: mrcnFern American e York: New . (Pteridaceae): Taxon Molecular American lr of Flora Flora 19: 56: Delivered by Publishing Technology to: Duke University IP: 152.3.102.242 on: Tue, 08 Jul 2014 01:26:34 Copyright (c) American Society for Plant Taxonomists. All rights reserved. F679 F672 1 3 :3173, KF961769; 3: KF961706; 23. (1) KF961772; KF961709; U673(ohese l 08;E283 Rtfl ta.2008); al. et (Rothfels EU268733 2008); al. et (Rothfels EU268733 KF961773; KF961710; —— 4497, cutpl 416 Schuettpelz Guze l 09;K913;K919;()3,3.2 5364, KF961860; 2: KF961738; KF961860; 31. KF961800; (DUKE); 30, KF961739; (2) KF961861; KF961798; KF961737; (DUKE); 2009); al. et (Grusz 7153, 5074, KF961795; 3: 2: 61. (1) 64. KF961797; (1) KF961796; lendigera Myriopteris 4 :4495, 3: 64. 713 2: 3833, —1: HQ846423 2011); MYRIOPTERIS al. OF et PHYLOGENY 2011); AL.: (Sigel ET al. HQ846374 GRUSZ 2011); et al. (Sigel et (Sigel HQ846476 #’). DB ‘no GenBank a as have here the not (designated do number either analyses Database molecular of DNA in Fern place included respec- not in observations, accessions sporangium Those ‘——’ repro- per tively. number dash inferring spore for long or the number included a in accession not included have were not mode were that ductive that those Taxa or one speci- acronym. is analyses than herbarium number molecular the accession more to herbarium by a next collection, fied represented same taxa the of selected duplicate For studied. sporangium 2014] covillei 15925 Taylor 5654, 5: 26. (1) KF961770; KF961707; 468 Schuettpelz #, 3450 Windham F686 F673 F674 2 2 64. 62, (2) KF961784; KF961723; KF961846; oDB no 2470 Rothfels 08;E283 Rtfl ta.20) U674(ohese l 2008); al. et (Rothfels EU268784 2008); al. et —— (Rothfels EU268735 2008); 1996B KF961771; KF961708; KF961768; 4496, 2: KF961705; KF961763; 59. 2011); KF961700; 58, KF961827; al. (2) et KF961764; aemula (Beck Myriopteris JF929936 (DUKE); F679 2 7 9 3: #, 59. 57, (2) KF961779; 3845, KJ000203; 3177, :6114, 2: 5038, 1: 3856 Clase 7594, —1: 6005, 2: 62. 06-03 61, (2) KF961787; 1356A KF961726; KF961849; (DUKE); (DUKE); (US); DK) F682 F679 KF961780; KF961719; KF961842; (DUKE); oDB no lmus 9602 Blomquist ohes2571 Rothfels . . ryohsamicrophylla— Argyrochosma asivc atn 89-237 Gastony & Yatskievych DK) F687 F674 KF961785; KF961724; KF961847; (DUKE); yipei lindheimeri Myriopteris —— ida 3436 Windham cutpl 470 Schuettpelz 1 3150, —1: #, ID;K913;K911;KF961776; KF961714; KF961839; (IND); yipei aurea Myriopteris DK) F688 F675 F676 2 2 7 :3871, 3: 57. 52, (2) KF961786; KF961725; KF961848; (DUKE); cutpl 1244A Schuettpelz ohes2717 Rothfels ulys n. s. Dudley #, —— eza 180 Metzgar rehue5086 Greenhouse U) F683 F670 KF961791; KF961730; KF961853; (US); 4 1 3 4 64. 64, 63, 61, (4) ; —— lvln .n. s. Cleveland —— eea .n. s. Hegeman (DUKE); U) F681 F677 KF961778; KF961717; KF961841; (UC); 1 28. (1) ; DK) F680 F673 F676 1 2 3: 32. (1) KF961766; KF961703; KF961830; (DUKE); DK) F685 F672 KF961783; KF961722; KF961845; (DUKE); :3167, 4: . DK) F689 F672 KF961765; KF961702; KF961829; (DUKE); . (DUKE); cutpl 443 Schuettpelz (DUKE); , yipei fimbriata Myriopteris 1 5653, —1: 1 5575, —1: (US); DK) F686 F673 F674 3 9 61, 59, (3) KF961794; KF961733; KF961856; (DUKE); —— DK) J774(rs ta.20) KF961718; 2009); al. et (Grusz FJ870774 (DUKE); DK) F680 F675 F677 2 2 63. 62, (2) KF961777; KF961715; KF961840; (DUKE); DK) J776(rs ta.20) KJ000204; 2009); al. et (Grusz FJ870776 (DUKE); —— —— —— oDB no —— cutpl 460 Schuettpelz 1 7355, —1: yipei gracillima Myriopteris —— (YU); asivc 89-432 Yatskievych —— DK) F685 F672 KF961793; KF961732; KF961855; (DUKE); . JP) F682 F679 KF961790; KF961729; KF961852; (JEPS); :4477, 4: . 4 0 0 2 2 3: 32. 32, 30, 30, (4) ; ID;K915;K913;KF961792; KF961731; KF961854; (IND); . —— 1 3157, —1: srlpswindhamii Astrolepis :6914, 2: . yipei chipinquensis Myriopteris ek1226 Beck 1 4 5: 64. (1) ; ek1037 Beck #, 2 0 64. 60, (2) ; rs 110 Grusz yipei cucullans Myriopteris —— 3 9 9 31. 29, 29, (3) ; DK) U669(ohese l 2008); al. et (Rothfels EU268679 (DUKE); ek1090 Beck —— asivc atn 89-222 Gastony & Yatskievych 4583, ID;K913;K910;KF961767; KF961704; KF961831; (IND); 1 56. (1) ; ohes3591 Rothfels cutpl 991 Schuettpelz cutpl 466 Schuettpelz . cutpl 450 Schuettpelz 1 6321, —1: DK) U661(ohese al. et (Rothfels EU268681 (DUKE); yipei alabamensis Myriopteris ek1192 Beck oDB no DK) F689 KF961736; KF961859; (DUKE); ek1038 Beck DK) F688 KF961701; KF961828; (DUKE); yipei jamaicensis Myriopteris —— otigo 34623 Worthington DK) F688 KF961735; KF961858; (DUKE); (DUKE); —— —— yipei cooperae Myriopteris yipei gracilis Myriopteris ID;K915;KF961734; KF961857; (IND); —— .4: 1 6334, —1: yipei allosuroides Myriopteris —— :3178, 3: . oDB no —— #, . —3138, oDB no yipei fendleri Myriopteris . oili&Fntn593 Funston & Covillei . aleg1656 Hallberg yipei clevelandii Myriopteris —— 1 7138, —1: DK) KF961836; (DUKE); . DK) KF961835; (DUKE); yipei intertexta Myriopteris DK) KF961834; (DUKE); DK) KF961833; (DUKE); 1 4498, —1: DK) KF961832; (DUKE); yipei lanosa Myriopteris DK) FJ870779 (DUKE); #, —— #, 1 1 4: 61. (1) ; —— ida 0221A Windham cutpl 431 Schuettpelz ida 3630 Windham cutpl 471 Schuettpelz idemr744 Lindheimer —— . ohes2490 Rothfels .2: Myriopteris Schuettpelz 1 3175, —1: 1 3123, —1: ek1137 Beck 1 6445, —1: 1 6444, —1: :4510, 2: . (DUKE); Knobloch oDB no —— —— (IND); oDB no oDB no (NY); Pryer —— —— —— —1: —1: .2: .2: — #, . . . 263 DK) F689 F676 F688 3 1 2 7 2: 47. 42, 41, (3) KF961808; KF961746; KF961869; (DUKE); F670 KF961802; KF961740; F675 KF961807; KF961745; F674 KF961806; KF961744; —— mickelii U) F684 F671 KF961803; KF961741; 7148, KF961864; (UC); ta.21) M001(re ta.2010); moncloviensis al. 0248A et (Pryer Yatskievych HM003031 2010); al. et 502 Schuettpelz F688 1 1 2: 41. (1) KF961818; rawsonii Myriopteris —— —— Sheteze l 07;E286 Sheteze l 07;EF452161 2007); al. et (Schuettpelz 2007); al. EU268763 et 2007); (Schuettpelz al. et (Schuettpelz marantae Paragymnopteris F686 1 9 2: 29. (1) KF961826; 415 Schuettpelz KF961825; KF961712; KF961884; —— yipei rufa Myriopteris KF961816; KF961754; KF961876; K K000501493); (K: DK) F680 F679 F681 3 2 2 32. 32, 32, (3) KF961821; KF961759; windhamii KF961880; (DUKE); 2 8 63. 58, (2) F685 2 0 3 2: 63. 2008); 50, (2) al. KF961815; 08-020 et parryi al. Myriopteris (Rothfels et EU268738 Grusz 2008); 62. 481 (1) Windham al. 2008); al. et et (Rothfels EU268787 (Rothfels EU268685 F674 1 1 :5367, 2: 31. (1) KF961774; —— 4500, yipei tomentosa Myriopteris 5652, KF961822; KF961819; KF961757; DK) M004(re ta.21) M006(re ta.2010); al. et (Pryer HM003026 2010); 2010); al. al. et (Pryer et HM003030 (Pryer HM003034 (DUKE); F675 1 1 :2968, 4: 31. (1) KF961775; KF961782; 2008); al. et (Rothfels EU268737 2008); al. 2008); et al. (Rothfels EU268786 et (Rothfels EU268684 KF961811; (IND); KF961749; KF961872; (DUKE); 6520, 2: 32. 31, 30, 3082 28, (4) KF961809; KF961747; KF961870; (DUKE); ta.21) F504(cutpl ta.20) F514(Schuettpelz 3814, EF452144 #, 5: 6: 2007); 32. 31. al. (1) (1) KF961781; et 2007); (Schuettpelz al. EF452084 et 2012); al. et F680 1 7 3: 27. (1) KF961820; F671 KF961823; KF961761; DK) Q593(ono ta.21) Q595(ono ta.2012); al. et (Johnson 2007); JQ855925 al. 2012); et (Schuettpelz al. EF452162 et (Johnson JQ855913 (DUKE); wootonii ida ida 0021B Windham & Windham (GH); . 2 2 44. 32, (2) ; KF961801; ; 1 63. (1) ; 1 30. (1) ; DK) F681 F678 F680 1 1 :6674, 3: 31. (1) KF961810; KF961748; KF961871; (DUKE); ek1151 Beck yipei microphylla Myriopteris atn 90-10-1 Gastony ek1036 Beck 1 6327, —1: 1 3195, —1: 1 4491, —1: —— —— ——. yipei yatskievychiana Myriopteris —1: yipei peninsularis Myriopteris DK) F683 F670 F682 2 1 2 :5134, 2: 32. 31, (2) KF961812; KF961750; KF961873; (DUKE); 1 a 64. ca. (1) ; DK) F685 F672 KF961804; KF961742; KF961865; (DUKE); DK) M005(re ta.21) M007(Pryer HM003027 2010); al. et (Pryer HM003035 (DUKE); yipei longipila Myriopteris yipei newberryi Myriopteris :6199, 3: . 1 5391, —1: —— —— 1 3802, —1: DK) J779(rs ta.20) KF961716; 2009); al. et (Grusz FJ870789 (DUKE); aa ta.1848 al. et Salas oDB no :5666, 2: cutpl 488 Schuettpelz DK) F681 F678 F679 1 60. (1) KF961789; KF961728; KF961851; (DUKE); 1 9185, —1: oDB no oDB no (DUKE); oDB no DK) F684 F671 F683 1 31. (1) KF961813; KF961751; KF961874; (DUKE); 1 2721, —1: oDB no 1 2 5: 32. (1) ; . —— —— ida 458 Windham —— ID;K915;K912;KF961788; KF961727; KF961850; (IND); yipei marsupianthes Myriopteris —— —— oDB no —— yipei myriophylla Myriopteris —3736, ida 3545 Windham . #, . #, ohes2515 Rothfels #, ohes2493 Rothfels . cutpl 323 Schuettpelz yipei moritziana Myriopteris 1 4480, —1: yipei wrightii Myriopteris :9246, 3: . :5703, 2: . #, eza 149 Metzgar ek1050 Beck eza 161 Metzgar #, ohes3902 Rothfels . yipei viscida Myriopteris amr1378 Palmer emns n. s. Lemmon (DUKE); —— mo 11325 Smook #, ele atropurpurea Pellaea odlt 7014 Goldblatt —— ihr778 Licher —— oDB no hitnuz3823 Christenhusz ida asivc 0340A Yatskievych & Windham N) F686 F673 KF961805; KF961743; KF961866; (NY); —— DK) J774(rs ta.2009); al. et (Grusz FJ870784 (DUKE); —— 1 6325, —1: .2: asivc 02-35 Yatskievych —— 1 42. (1) ; 1 5030, —1: .5: 1 3827, —1: cutpl 994 Schuettpelz yipei notholaenoides Myriopteris oDB no 1 6333, —1: . #, . —— DK) F681 KF961760; KF961881; (DUKE); oDB no . rco 39365 Proctor DK) F689 KF961758; KF961879; (DUKE); yipei yavapensis Myriopteris ese 9568 Kessler idemr744 Lindheimer DK) F687 KF961711; KF961837; (DUKE); —— DK) F684 KF961721; KF961844; (DUKE); DK) F688 KF961713; KF961838; (DUKE); DK) F685 KF961753; KF961875; (DUKE); DK) F683 KF961720; KF961843; (DUKE); yipei pringlei Myriopteris (DUKE); (DUKE); (US); —— —— (NY); 1 16. (1) ; DK) Q591(Johnson JQ855901 (DUKE); M) F687 KF961756; KF961877; (MO); ikl6317 Mickel #, (MO); . end aLz9764 Luz la de Leon #, 1 3148, —1: yipei rnlivar. pringlei Myriopteris ida 0341A Windham .2: :4484, 4: . yipei mexicana Myriopteris 1 4475, —1: 1 3822, —1: 1 6158, —1: cutpl 990 Schuettpelz —— 1 7353, —1: eza 174 Metzgar —2957, uqe 96-302 Burquez —— oDB no yipei scabra Myriopteris —— —— DK) KF961878; (DUKE); —— DK) KF961867; (DUKE); 1 32. (1) ; M) EU268711 (MO); 3 0 9 64. 49, 40, (3) ; U) KF961868; (UC); U) KF961863; (US); K K000501491); (K: 1 0 7: 30. (1) ; —— N) KF961862; (NY); 3 1 1 31. 31, 21, (3) ; 3 3 8 61. 58, 53, (3) ; oDB no cutpl 488 Schuettpelz cutpl 312 Schuettpelz cutpl 989 Schuettpelz rw 83-31-4 Brown #, akeiz13 Jankiewicz ohes3589 Rothfels eza 169 Metzgar ohes3281 Rothfels . ida & Windham Myriopteris Myriopteris Myriopteris 1 3209, —1: 1 3122, —1: 1 4494, —1: #, (DUKE); (DUKE); (DUKE); (DUKE); —— Rothfels Moritz oDB no (MO); (MO); —1: —1: .2: Delivered by Publishing Technology to: Duke University IP: 152.3.102.242 on: Tue, 08 Jul 2014 01:26:34 Copyright (c) American Society for Plant Taxonomists. All rights reserved. hiate wootonii Cheilanthes viscida Cheilanthes villosa Cheilanthes 1 YTMTCBTN Vlm 39 [Volume BOTANY SYSTEMATIC 714 hiate allosuroides Cheilanthes alabamensis Cheilanthes hiate yavapensis Cheilanthes yatskievychiana Cheilanthes wrightii Cheilanthes tomentosa Cheilanthes hiate covillei Cheilanthes cooperae Cheilanthes chipinquensis Cheilanthes bonariensis Cheilanthes aemula Cheilanthes hiate rawsonii Cheilanthes pringlei Cheilanthes hiate microphylla Cheilanthes mexicana Cheilanthes maxoniana Cheilanthes hiate longipila Cheilanthes lindheimeri Cheilanthes hiate horridula Cheilanthes gracillima Cheilanthes feei Cheilanthes hiate fimbriata Cheilanthes eatonii Cheilanthes hiate cucullans Cheilanthes clevelandii Cheilanthes hiate newberryi Cheilanthes myriophylla Cheilanthes moritziana Cheilanthes marsupianthes Cheilanthes hiate lendigera Cheilanthes lanosa Cheilanthes jamaicensis Cheilanthes intertexta Cheilanthes hiate parishii Cheilanthes notholaenoides Cheilanthes Appendix .Ls of List 2. .Moe= Moore T. Mcx)D .Etn= Eaton C. D. (Michx.) aep xMxn= Maxon ex Davenp. ae = Baker aep = Davenp. ao = Maxon ao = Maxon aep = Davenp. aep = Davenp. ok = Hook. .C ao = Eaton C. D. et xKh = Kuhn ex Mett. ao = Maxon ae = Baker A .S. ikl&Bie = Beitel & Mickel Sm.) R. (A. Cv)S.= Sw. (Cav.) ao = Maxon aep = Davenp. Fe ao = Maxon D .Etn oi.= Domin. Eaton) C. (D. .C ao = Eaton C. D. ik = Link. .C ao = Eaton C. D. evse ida = Windham ex Reeves uz = Kunze ikl= Mickel ´ Wld)Potr= Proctor (Willd.) ok = Hook. ao = Maxon et = Mett. S. w = Sw. (Sw.) Bcly uz = Kunze (Buckley) e= ev = Desv. nboh&Lligr= Lellinger & Knobloch Myriopteris (Fe Ds. ao xWah = Weath. ex Maxon (Desv.) ikl= Mickel ´ )T evs&Mce = Mickel & Reeves T. e) aa(rmGuzadWnhm21)wt ae omnyapidt hmin them to applied commonly names with 2013) Windham and Grusz (from taxa yipei viscida Myriopteris windhamii Myriopteris tomentosa Myriopteris yipei wootonii Myriopteris yipei allosuroides Myriopteris alabamensis Myriopteris aemula Myriopteris yipei yatskievychiana Myriopteris wrightii Myriopteris rawsonii Myriopteris yipei yavapensis Myriopteris yipei clevelandii Myriopteris yipei covillei Myriopteris cooperae Myriopteris chipinquensis Myriopteris aurea Myriopteris yipei pringlei Myriopteris yipei myriophylla Myriopteris microphylla Myrioperis mexicana Myriopteris marsupianthes Myriopteris yipei maxoniana Myriopteris yipei longipila Myriopteris lindheimeri Myriopteris yipei scabra Myriopteris gracilis Myriopteris yipei gracillima Myriopteris yipei fimbriata Myriopteris rufa Myriopteris yipei cucullans Myriopteris yipei newberryi Myriopteris moritziana Myriopteris yipei lendigera Myriopteris lanosa Myriopteris jamaicensis Myriopteris intertexta Myriopteris Myriopteris notholaenoides Myriopteris

+ parishii Fe Pi. rs Windham & Grusz (Poir.) ´ C h. rs Windham & Grusz Chr.) (C. Mcx)Guz&Windham & Grusz (Michx.) e Dvn. rs Windham & Grusz (Davenp.) Mxn A (Maxon) Mxn rs Windham & Grusz (Maxon) Fe Dvn. rs Windham & Grusz (Davenp.) Ho. rs Windham & Grusz (Hook.) D .Etn rs Windham & Grusz Eaton) C. (D. Mt.e.Kh)Guz&Windham & Grusz Kuhn) ex. (Mett. Mxn rs Windham & Grusz (Maxon) Bkr rs Windham & Grusz (Baker) ´ A .S. rs Windham & Grusz Sm.) R. (A. Cv)Fe (Cav.) Dvn. rs Windham & Grusz (Davenp.) (Fe Mxn rs Windham & Grusz (Maxon) e D .Etn rs Windham & Grusz Eaton) C. (D. D .Etn rs Windham & Grusz Eaton) C. (D. Ln. Fe (Link.) Dvn. rs Windham & Grusz (Davenp.) D .Etn rs Windham & Grusz Eaton) C. (D. Grusz Ree xWnhm rs Windham & Grusz Windham) ex (Reeves Kne rs Windham & Grusz (Kunze) Mce)Guz&Windham & Grusz (Mickel) S. rs Windham & Grusz (Sw.) Ho. .Sm. J. (Hook.) Mxn rs Windham & Grusz (Maxon) Mt. rs Windham & Grusz (Mett.) ´ Bcly rs Windham & Grusz (Buckley) Ds. rs Windham & Grusz (Desv.) )Guz&Windham & Grusz e) Kolc elne)Guz&Windham & Grusz Lellinger) & (Knobloch Fe Ds. rs Windham & Grusz (Desv.) Mce)Guz&Windham & Grusz (Mickel) ´ e ´ ´ .Lo e ´ e ¨ e&D Lo D. & ve Cheilanthes ¨ ve .